Organism | Arabidopsis thaliana | |
ID | AtREG402 | |
Sequence | AGCCCAAT | |
Annotation | ||
PPDB Motif | GCCCA | Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression |
PLACE Motif | TGGGCY | "Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);) |
Total Entry Count | 681 |
Locus | Gene model | Sequence | Description |
AT1G01630 | AT1G01630.1 | GAGCCCAATAG | SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G14820.3); Has 2114 Blast hits to 2114 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 944; Fungi - 440; Plants - 452; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink).  |
AT1G01840 | AT1G01840.1 | TTAAAGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G02090 | AT1G02090.1 | TGAGCCCAATTA | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.  |
AT1G02090.2 | TGAGCCCAATTA | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.  | |
AT1G02090.3 | TGAGCCCAATTA | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.  | |
AT1G02100 | AT1G02100.1 | TAATTGGGCTCA | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
AT1G02100.2 | TAATTGGGCTCA | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT1G02100.3 | TAATTGGGCTCA | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT1G02170 | AT1G02170.1 | AATTGGGCTTA | Metacaspase AtMCP1b. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam profile PF00656: ICE-like protease (caspase) p20 domain  |
AT1G02180 | AT1G02180.1 | CAAAGCCCAATAA | ferredoxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G02680 | AT1G02680.1 | TAAGCCCAATT | TBP-ASSOCIATED FACTOR 13 (TAF13); FUNCTIONS IN: RNA polymerase II transcription factor activity, DNA binding; INVOLVED IN: transcription initiation, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IID, 18 kDa subunit (InterPro:IPR003195), Histone-fold (InterPro:IPR009072); Has 401 Blast hits to 401 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 182; Fungi - 191; Plants - 19; Viruses - 2; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G02690 | AT1G02690.1 | CTAAGCCCAATAT | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.  |
AT1G02690.1 | GTTGGGCCGATATTGGGCTAA | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.  | |
AT1G02690.2 | CTAAGCCCAATAT | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.  | |
AT1G02690.2 | GTTGGGCCGATATTGGGCTAA | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.  | |
AT1G02780 | AT1G02780.1 | TTAAAGCCCAATAT | embryo defective 2386 (emb2386); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 865 Blast hits to 865 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 278; Fungi - 107; Plants - 94; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink).  |
AT1G02960 | AT1G02960.1 | AATTGGGCCTGTTAAAGCCCAATTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT1G02960.2 | AATTGGGCCTGTTAAAGCCCAATTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  | |
AT1G02960.3 | AATTGGGCCTGTTAAAGCCCAATTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  | |
AT1G03430 | AT1G03430.1 | GGGCCTAAGCCCAATTGGG | Encodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6).  |
AT1G03687 | AT1G03687.1 | TTAAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT1G03687.2 | TTAAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  | |
AT1G04190 | AT1G04190.1 | TTATTGGGCTTTT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G62740.1); Has 15524 Blast hits to 9686 proteins in 698 species: Archae - 779; Bacteria - 4552; Metazoa - 3572; Fungi - 847; Plants - 951; Viruses - 0; Other Eukaryotes - 4823 (source: NCBI BLink).  |
AT1G04790 | AT1G04790.1 | TTAGCCCAATAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6374 Blast hits to 6356 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2257; Fungi - 483; Plants - 2544; Viruses - 68; Other Eukaryotes - 1022 (source: NCBI BLink).  |
AT1G04985 | AT1G04985.1 | TTATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G05850 | AT1G05850.1 | TAAAAGCCCAATGGGCCATA | Encodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants.  |
AT1G05860 | AT1G05860.1 | TATGGCCCATTGGGCTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31600.1); Has 51 Blast hits to 50 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT1G06190 | AT1G06190.1 | CAAAGCCCATAAAGCCCAATA | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).  |
AT1G06190.2 | CAAAGCCCATAAAGCCCAATA | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).  | |
AT1G07810 | AT1G07810.1 | CATTGGGCTTA | Encodes an ER-type Ca2+-pumping ATPase.  |
AT1G07910 | AT1G07910.1 | AATTGGGCT | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo.  |
AT1G07910.2 | AATTGGGCT | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo.  | |
AT1G08040 | AT1G08040.1 | AGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G28310.3); Has 193 Blast hits to 192 proteins in 15 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT1G08040.2 | AGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G28310.3); Has 193 Blast hits to 192 proteins in 15 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT1G08610 | AT1G08610.1 | AAAAAGCCCAAT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 19965 Blast hits to 5457 proteins in 167 species: Archae - 5; Bacteria - 16; Metazoa - 328; Fungi - 289; Plants - 18418; Viruses - 0; Other Eukaryotes - 909 (source: NCBI BLink).  |
AT1G08970 | AT1G08970.1 | ATAAGCCCAATG | heme activated protein (HAP5c)  |
AT1G08970.2 | ATAAGCCCAATG | heme activated protein (HAP5c)  | |
AT1G08970.3 | ATAAGCCCAATG | heme activated protein (HAP5c)  | |
AT1G08970.4 | ATAAGCCCAATG | heme activated protein (HAP5c)  | |
AT1G09660 | AT1G09660.1 | GAAGCCCAATAA | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT1G09660.2 | GAAGCCCAATAA | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  | |
AT1G09950 | AT1G09950.1 | CAAGCCCAATG | transcription factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf apex, flower, root, leaf; EXPRESSED DURING: petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: ZW2 (TAIR:AT1G58330.1); Has 330 Blast hits to 329 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 330; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G10030 | AT1G10030.1 | GAAGCCCAATTGAAAAGCCCATTT | Arabidopsis homolog of yeast ergosterol28 (ERG28); INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Erg28-like (InterPro:IPR005352); Has 155 Blast hits to 155 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 64; Plants - 23; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT1G10210 | AT1G10210.1 | TAATTGGGCTCA | Encodes ATMPK1.  |
AT1G10210.2 | TAATTGGGCTCA | Encodes ATMPK1.  | |
AT1G10950 | AT1G10950.1 | CAAGCCCAATTA | endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT2G01970.1); Has 1032 Blast hits to 991 proteins in 166 species: Archae - 0; Bacteria - 8; Metazoa - 443; Fungi - 164; Plants - 234; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink).  |
AT1G11240 | AT1G11240.1 | TTAAAGCCTAAAGCCCAATTAAAAGGCC | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 2452 Blast hits to 1845 proteins in 201 species: Archae - 0; Bacteria - 81; Metazoa - 1026; Fungi - 315; Plants - 107; Viruses - 18; Other Eukaryotes - 905 (source: NCBI BLink).  |
AT1G11890 | AT1G11890.1 | ATAAGCCCAAT | member of SEC22 Gene Family  |
AT1G12390 | AT1G12390.1 | TAATTGGGCTAA | cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G62880.1); Has 466 Blast hits to 466 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 278; Fungi - 110; Plants - 42; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).  |
AT1G12800 | AT1G12800.1 | AGCCCAAT | S1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink).  |
AT1G13060 | AT1G13060.1 | AGCCCAATAT | Encodes 20S proteasome beta subunit PBE1 (PBE1).  |
AT1G13220 | AT1G13220.1 | CATTGGGCTTTT | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.  |
AT1G13220.2 | CATTGGGCTTTT | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.  | |
AT1G13270 | AT1G13270.1 | CAAGCCCAATGGGCTTTAA | Encodes a methionine aminopeptidase formerly called MAP1B, renamed to MAP1C.  |
AT1G13270.2 | CAAGCCCAATGGGCTTTAA | Encodes a methionine aminopeptidase formerly called MAP1B, renamed to MAP1C.  | |
AT1G13900 | AT1G13900.1 | GTAAGGCCCATAATATTGGGCTTAGATAGGCCCATATA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity, metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP9 (PURPLE ACID PHOSPHATASE 9); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G03450.1); Has 1052 Blast hits to 1042 proteins in 232 species: Archae - 0; Bacteria - 259; Metazoa - 179; Fungi - 58; Plants - 399; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink).  |
AT1G13910 | AT1G13910.1 | TATATGGGCCTATCTAAGCCCAATATTATGGGCCTTAC | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT5G61240.1); Has 54187 Blast hits to 17810 proteins in 751 species: Archae - 26; Bacteria - 3393; Metazoa - 14506; Fungi - 646; Plants - 32565; Viruses - 0; Other Eukaryotes - 3051 (source: NCBI BLink).  |
AT1G14010 | AT1G14010.1 | TTAAAGCCCAATT | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
AT1G14140 | AT1G14140.1 | TTAAAGCCCAATAT | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink).  |
AT1G15930 | AT1G15930.1 | AGCCCAATTAATAGGCCCATTTAAGCCCAAAT | 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).  |
AT1G15930.2 | AGCCCAATTAATAGGCCCATTTAAGCCCAAAT | 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).  | |
AT1G16445 | AT1G16445.1 | ATAAAGCCCAATAT | methylase-related; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Putative rRNA methylase (InterPro:IPR010719); Has 531 Blast hits to 531 proteins in 250 species: Archae - 2; Bacteria - 482; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT1G16810 | AT1G16810.1 | ATATTGGGCCCTATTGGGCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
AT1G16810.2 | ATATTGGGCCCTATTGGGCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  | |
AT1G17210 | AT1G17210.1 | CTATTGGGCTC | zinc ion binding; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytosol, nucleus, phragmoplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC-like (InterPro:IPR012935), Proteinase inhibitor I32, inhibitor of apoptosis (InterPro:IPR001370); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G48950.1); Has 388 Blast hits to 192 proteins in 68 species: Archae - 2; Bacteria - 7; Metazoa - 100; Fungi - 38; Plants - 41; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink).  |
AT1G17220 | AT1G17220.1 | GAGCCCAATAG | Encodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal.  |
AT1G18540 | AT1G18540.1 | TTAAAGCCCAATAT | 60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
AT1G19800 | AT1G19800.1 | ATATTGGGCTTTACGGCCCA | Encodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate.  |
AT1G19800.2 | ATATTGGGCTTTACGGCCCA | Encodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate.  | |
AT1G19800.3 | ATATTGGGCTTTACGGCCCA | Encodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate.  | |
AT1G20430 | AT1G20430.1 | CTTATTGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G20960 | AT1G20960.1 | ACAGGCCCAGCCCAAT | embryo defective 1507 (emb1507); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: U5 small nuclear ribonucleoprotein helicase, putative (TAIR:AT2G42270.1); Has 13822 Blast hits to 8453 proteins in 1026 species: Archae - 1055; Bacteria - 3787; Metazoa - 2595; Fungi - 1690; Plants - 529; Viruses - 118; Other Eukaryotes - 4048 (source: NCBI BLink).  |
AT1G21350 | AT1G21350.1 | ATATTGGGCT | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).  |
AT1G21350.2 | ATATTGGGCT | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).  | |
AT1G21350.3 | ATATTGGGCT | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).  | |
AT1G21560 | AT1G21560.1 | TGAGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01170.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G21720 | AT1G21720.1 | GAAGCCCAATAA | 20S proteasome beta subunit PBC1 truncated protein (PBC1)  |
AT1G22200 | AT1G22200.1 | GAGCCCAAGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).  |
AT1G22200.2 | GAGCCCAAGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).  | |
AT1G23280 | AT1G23280.1 | AATTGGGCT | MAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink).  |
AT1G23290 | AT1G23290.1 | AGCCCAATT | Encodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20.  |
AT1G23750 | AT1G23750.1 | AATTGGGCTTTAT | DNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT1G26110 | AT1G26110.1 | AATTGGGCTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45330.1); Has 43564 Blast hits to 18145 proteins in 930 species: Archae - 33; Bacteria - 8614; Metazoa - 16661; Fungi - 5004; Plants - 6818; Viruses - 592; Other Eukaryotes - 5842 (source: NCBI BLink).  |
AT1G26110.2 | AATTGGGCTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45330.1); Has 43564 Blast hits to 18145 proteins in 930 species: Archae - 33; Bacteria - 8614; Metazoa - 16661; Fungi - 5004; Plants - 6818; Viruses - 592; Other Eukaryotes - 5842 (source: NCBI BLink).  | |
AT1G27390 | AT1G27390.1 | AAAAAGCCCAATTA | Form of TOM20, which is a component of the TOM complex, involved in transport of nuclear-encoded mitochondrial proteins  |
AT1G27400 | AT1G27400.1 | TAATTGGGCTTTTT | 60S ribosomal protein L17 (RPL17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane, chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17B) (TAIR:AT1G67430.1); Has 1647 Blast hits to 1647 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 401 (source: NCBI BLink).  |
AT1G28490 | AT1G28490.1 | CTTATTGGGCTC | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.  |
AT1G28490.1 | CTTATTGGGCTTTAT | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.  | |
AT1G28490.2 | CTTATTGGGCTC | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.  | |
AT1G28490.2 | CTTATTGGGCTTTAT | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.  | |
AT1G29070 | AT1G29070.1 | TATTGGGCTTTTA | ribosomal protein L34 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34 (InterPro:IPR000271); Has 389 Blast hits to 389 proteins in 164 species: Archae - 0; Bacteria - 342; Metazoa - 0; Fungi - 9; Plants - 23; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT1G29250 | AT1G29250.1 | CCCAATTGGGCCTATTGGGCT | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT2G34160.1); Has 89 Blast hits to 89 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT1G29260 | AT1G29260.1 | AGCCCAATAGGCCCAATTGGG | Encodes the peroxisomal targeting signal type 2 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS2 consensus sequence (RLX5HL or a variant) within the first 30 or so amino acids. RNAi experiments suggest that PEX7 is necessary for the maintenance of glyoxysomal but not leaf peroxisomal function.  |
AT1G31817 | AT1G31817.1 | AGCCCAATA | NUCLEAR FUSION DEFECTIVE 3 (NFD3); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00750.1); Has 5242 Blast hits to 5242 proteins in 1532 species: Archae - 8; Bacteria - 2826; Metazoa - 58; Fungi - 4; Plants - 484; Viruses - 0; Other Eukaryotes - 1862 (source: NCBI BLink).  |
AT1G31817.1 | GAGCCCAATAAG | NUCLEAR FUSION DEFECTIVE 3 (NFD3); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00750.1); Has 5242 Blast hits to 5242 proteins in 1532 species: Archae - 8; Bacteria - 2826; Metazoa - 58; Fungi - 4; Plants - 484; Viruses - 0; Other Eukaryotes - 1862 (source: NCBI BLink).  | |
AT1G32730 | AT1G32730.1 | ATATTGGGCTTTAA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT1G33120 | AT1G33120.1 | AGCCCAATAT | 60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).  |
AT1G33490 | AT1G33490.1 | ATAAAGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G33500 | AT1G33500.1 | TAATTGGGCTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink).  |
AT1G33980 | AT1G33980.1 | TAAGCCCAATAACAAGCCCATTT | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD)  |
AT1G33980.2 | TAAGCCCAATAACAAGCCCATTT | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD)  | |
AT1G34430 | AT1G34430.1 | AAAAAGCCCAATA | embryo defective 3003 (EMB3003); FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosolic ribosome, plasma membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: LTA2; dihydrolipoyllysine-residue acetyltransferase (TAIR:AT3G25860.1); Has 15590 Blast hits to 14171 proteins in 1332 species: Archae - 64; Bacteria - 7001; Metazoa - 632; Fungi - 308; Plants - 200; Viruses - 0; Other Eukaryotes - 7385 (source: NCBI BLink).  |
AT1G35340 | AT1G35340.1 | CTATTGGGCTTT | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT1G35340.2 | CTATTGGGCTTT | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  | |
AT1G35340.3 | CTATTGGGCTTT | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  | |
AT1G41880 | AT1G41880.1 | ATAAGCCCAATAG | 60S ribosomal protein L35a (RPL35aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aD) (TAIR:AT3G55750.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  |
AT1G44835 | AT1G44835.1 | AAAAGCCCAATG | YbaK/prolyl-tRNA synthetase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YbaK/aminoacyl-tRNA synthetase associated region (InterPro:IPR007214); Has 745 Blast hits to 744 proteins in 221 species: Archae - 0; Bacteria - 335; Metazoa - 45; Fungi - 5; Plants - 21; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).  |
AT1G44835.2 | AAAAGCCCAATG | YbaK/prolyl-tRNA synthetase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YbaK/aminoacyl-tRNA synthetase associated region (InterPro:IPR007214); Has 745 Blast hits to 744 proteins in 221 species: Archae - 0; Bacteria - 335; Metazoa - 45; Fungi - 5; Plants - 21; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).  | |
AT1G48650 | AT1G48650.1 | GAAGCCCAATG | helicase domain-containing protein; FUNCTIONS IN: in 6 functions; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Double-stranded RNA binding (InterPro:IPR001159), Region of unknown function DUF1605 (InterPro:IPR011709), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ RNA binding / double-stranded RNA binding / helicase/ nucleic acid binding (TAIR:AT2G01130.1).  |
AT1G48650.1 | TTAGCCCAATAA | helicase domain-containing protein; FUNCTIONS IN: in 6 functions; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Double-stranded RNA binding (InterPro:IPR001159), Region of unknown function DUF1605 (InterPro:IPR011709), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ RNA binding / double-stranded RNA binding / helicase/ nucleic acid binding (TAIR:AT2G01130.1).  | |
AT1G48650.2 | GAAGCCCAATG | helicase domain-containing protein; FUNCTIONS IN: in 6 functions; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Double-stranded RNA binding (InterPro:IPR001159), Region of unknown function DUF1605 (InterPro:IPR011709), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ RNA binding / double-stranded RNA binding / helicase/ nucleic acid binding (TAIR:AT2G01130.1).  | |
AT1G48650.2 | TTAGCCCAATAA | helicase domain-containing protein; FUNCTIONS IN: in 6 functions; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Double-stranded RNA binding (InterPro:IPR001159), Region of unknown function DUF1605 (InterPro:IPR011709), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ RNA binding / double-stranded RNA binding / helicase/ nucleic acid binding (TAIR:AT2G01130.1).  | |
AT1G49850 | AT1G49850.1 | ATAGGCCCAATAATTGGGCTTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6256 Blast hits to 6238 proteins in 202 species: Archae - 0; Bacteria - 4; Metazoa - 2216; Fungi - 437; Plants - 2560; Viruses - 6; Other Eukaryotes - 1033 (source: NCBI BLink).  |
AT1G50170 | AT1G50170.1 | AAAAGCCCAATTG | encodes sirohydrochlorin ferrochelatase catalyzing the last step of the siroheme biosynthesis  |
AT1G51060 | AT1G51060.1 | AATTGGGCTC | Encodes HTA10, a histone H2A protein.  |
AT1G51400 | AT1G51400.1 | AATTGGGCTTTT | photosystem II 5 kD protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to UV-B, response to wounding, response to ozone; LOCATED IN: chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSBTN (photosystem II subunit T) (TAIR:AT3G21055.1); Has 59 Blast hits to 59 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G52340 | AT1G52340.1 | TTATTGGGCTTA | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose.  |
AT1G53670 | AT1G53670.1 | AAAAAGCCCAATAA | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink).  |
AT1G53670.2 | AAAAAGCCCAATAA | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink).  | |
AT1G54360 | AT1G54360.1 | ATAAGCCCAATAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6.  |
AT1G54360.2 | ATAAGCCCAATAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6.  | |
AT1G54360.3 | ATAAGCCCAATAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6.  | |
AT1G54360.4 | ATAAGCCCAATAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6.  | |
AT1G55250 | AT1G55250.1 | TTATTGGGCTTTTT | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B.  |
AT1G57540 | AT1G57540.1 | CTTATTGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G57540.2 | CTTATTGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G57540.3 | CTTATTGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G62690 | AT1G62690.1 | CAATTGGGCTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G62880 | AT1G62880.1 | TAATTGGGCTTA | cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G12390.1); Has 465 Blast hits to 465 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 110; Plants - 43; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  |
AT1G62880.2 | TAATTGGGCTTA | cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G12390.1); Has 465 Blast hits to 465 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 110; Plants - 43; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  | |
AT1G66820 | AT1G66820.1 | ATAAGCCCAATAA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 4695 Blast hits to 1095 proteins in 171 species: Archae - 18; Bacteria - 305; Metazoa - 2068; Fungi - 95; Plants - 1647; Viruses - 112; Other Eukaryotes - 450 (source: NCBI BLink).  |
AT1G66820.1 | TAAATGGGTTAAAGCCCAATAT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 4695 Blast hits to 1095 proteins in 171 species: Archae - 18; Bacteria - 305; Metazoa - 2068; Fungi - 95; Plants - 1647; Viruses - 112; Other Eukaryotes - 450 (source: NCBI BLink).  | |
AT1G67660 | AT1G67660.1 | ATTGGGCTTCATGGGCCTTAA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative phage-type endonuclease (InterPro:IPR017482), Exonuclease, phage-type/RecB, C-terminal (InterPro:IPR011604), Restriction endonuclease, type II-like, core (InterPro:IPR011335); BEST Arabidopsis thaliana protein match is: DNA binding / nuclease (TAIR:AT1G13810.1); Has 366 Blast hits to 366 proteins in 59 species: Archae - 0; Bacteria - 65; Metazoa - 25; Fungi - 0; Plants - 35; Viruses - 27; Other Eukaryotes - 214 (source: NCBI BLink).  |
AT1G67660.2 | ATTGGGCTTCATGGGCCTTAA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative phage-type endonuclease (InterPro:IPR017482), Exonuclease, phage-type/RecB, C-terminal (InterPro:IPR011604), Restriction endonuclease, type II-like, core (InterPro:IPR011335); BEST Arabidopsis thaliana protein match is: DNA binding / nuclease (TAIR:AT1G13810.1); Has 366 Blast hits to 366 proteins in 59 species: Archae - 0; Bacteria - 65; Metazoa - 25; Fungi - 0; Plants - 35; Viruses - 27; Other Eukaryotes - 214 (source: NCBI BLink).  | |
AT1G68790 | AT1G68790.1 | GAAGCCCAATAGGCCCAATAA | LITTLE NUCLEI3 (LINC3); INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LINC2 (LITTLE NUCLEI2) (TAIR:AT1G13220.2); Has 250284 Blast hits to 107694 proteins in 2507 species: Archae - 2115; Bacteria - 37052; Metazoa - 113182; Fungi - 17848; Plants - 9025; Viruses - 1093; Other Eukaryotes - 69969 (source: NCBI BLink).  |
AT1G70190 | AT1G70190.1 | TTATTGGGCTTTTA | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G37660.1); Has 5742 Blast hits to 5742 proteins in 1557 species: Archae - 0; Bacteria - 3189; Metazoa - 133; Fungi - 84; Plants - 174; Viruses - 0; Other Eukaryotes - 2162 (source: NCBI BLink).  |
AT1G70900 | AT1G70900.1 | CATTGGGCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23110.3); Has 29 Blast hits to 29 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G71090 | AT1G71090.1 | AGCCCAATG | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G01990.1); Has 433 Blast hits to 370 proteins in 101 species: Archae - 9; Bacteria - 33; Metazoa - 0; Fungi - 220; Plants - 97; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
AT1G71090.1 | TTAATGGGCTTATAATTGGGCTTC | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G01990.1); Has 433 Blast hits to 370 proteins in 101 species: Archae - 9; Bacteria - 33; Metazoa - 0; Fungi - 220; Plants - 97; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  | |
AT1G73350 | AT1G73350.1 | TATTGGGCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G73350.2 | TATTGGGCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT1G73350.3 | TATTGGGCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT1G73710 | AT1G73710.1 | TAAAGCCCAATAG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23020.1); Has 27768 Blast hits to 6414 proteins in 199 species: Archae - 2; Bacteria - 35; Metazoa - 962; Fungi - 509; Plants - 25092; Viruses - 0; Other Eukaryotes - 1168 (source: NCBI BLink).  |
AT1G73930 | AT1G73930.1 | TAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1630 (InterPro:IPR012860); Has 216 Blast hits to 196 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 22; Plants - 20; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT1G73930.2 | TAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1630 (InterPro:IPR012860); Has 216 Blast hits to 196 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 22; Plants - 20; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  | |
AT1G74260 | AT1G74260.1 | TTATTGGGCTTA | Encodes formylglycinamidine ribonucleotide synthase an enzyme involved in de novo purine biosynthesis. PUR4 is localizes to the chloroplast and mitochondria. Loss of PUR4 function affects male but not female gametophyte development.  |
AT1G74530 | AT1G74530.1 | CTAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G74530.2 | CTAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G74530.3 | CTAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G74780 | AT1G74780.1 | TAATTGGGCTCA | nodulin family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT1G18940.1); Has 1801 Blast hits to 1756 proteins in 510 species: Archae - 9; Bacteria - 869; Metazoa - 40; Fungi - 217; Plants - 319; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink).  |
AT1G74970 | AT1G74970.1 | TAAGCCCAATG | ribosomal protein S9, nuclear encoded component of the chloroplast ribosome  |
AT1G75180 | AT1G75180.1 | TAAAAGCCCAATAAAGGCCCAATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G75180.2 | TAAAAGCCCAATAAAGGCCCAATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G75180.3 | TAAAAGCCCAATAAAGGCCCAATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G75330 | AT1G75330.1 | AAAAAGCCCAATAAG | ORNITHINE CARBAMOYLTRANSFERASE (OTC); FUNCTIONS IN: amino acid binding, ornithine carbamoyltransferase activity, carboxyl- or carbamoyltransferase activity; INVOLVED IN: amino acid metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (InterPro:IPR006132), Aspartate/ornithine carbamoyltransferase (InterPro:IPR006130), Aspartate/ornithine carbamoyltransferase, Asp/Orn-binding region (InterPro:IPR006131), Ornithine carbamoyltransferase (InterPro:IPR002292); BEST Arabidopsis thaliana protein match is: aspartate carabmoyltransferase, chloroplast / aspartate transcarbamylase / ATCase (PYRB) (TAIR:AT3G20330.1); Has 11337 Blast hits to 11337 proteins in 1659 species: Archae - 346; Bacteria - 6031; Metazoa - 180; Fungi - 195; Plants - 66; Viruses - 6; Other Eukaryotes - 4513 (source: NCBI BLink).  |
AT1G75560 | AT1G75560.1 | TAAATGGGCTATTGGGCTTTA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink).  |
AT1G75560.2 | TAAATGGGCTATTGGGCTTTA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink).  | |
AT1G75630 | AT1G75630.1 | CTAAGCCCAATAA | vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA,  |
AT1G77420 | AT1G77420.1 | TAAAAGCCCAATAA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G16120.2); Has 2683 Blast hits to 2679 proteins in 755 species: Archae - 29; Bacteria - 1623; Metazoa - 110; Fungi - 139; Plants - 254; Viruses - 40; Other Eukaryotes - 488 (source: NCBI BLink).  |
AT1G77420.1 | TAAAAGCCCAATAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G16120.2); Has 2683 Blast hits to 2679 proteins in 755 species: Archae - 29; Bacteria - 1623; Metazoa - 110; Fungi - 139; Plants - 254; Viruses - 40; Other Eukaryotes - 488 (source: NCBI BLink).  | |
AT1G77440 | AT1G77440.1 | AAAGCCCAATAA | Encodes beta subunit of 20s proteosome complex which is involved in protein degradation.  |
AT1G77750 | AT1G77750.1 | AAAAAGCCCAATAA | 30S ribosomal protein S13, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: mitochondrion, small ribosomal subunit, chloroplast, mitochondrial small ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: 30S ribosomal protein S13, chloroplast (CS13) (TAIR:AT5G14320.1); Has 5725 Blast hits to 5725 proteins in 1762 species: Archae - 116; Bacteria - 2963; Metazoa - 147; Fungi - 105; Plants - 348; Viruses - 0; Other Eukaryotes - 2046 (source: NCBI BLink).  |
AT1G78670 | AT1G78670.1 | CAAAGCCCAATAT | gamma-glutamyl hydrolase 3 (ATGGH3); FUNCTIONS IN: hydrolase activity, omega peptidase activity, catalytic activity; INVOLVED IN: glutamine metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C26, gamma-glutamyl hydrolase (InterPro:IPR015527), Peptidase C26 (InterPro:IPR011697); BEST Arabidopsis thaliana protein match is: gamma-glutamyl hydrolase, putative / gamma-Glu-X carboxypeptidase, putative / conjugase, putative (TAIR:AT1G78660.2); Has 274 Blast hits to 271 proteins in 59 species: Archae - 0; Bacteria - 0; Metazoa - 163; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT1G78900 | AT1G78900.1 | ATAAAGCCCAATAA | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology.  |
AT1G78900.2 | ATAAAGCCCAATAA | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology.  | |
AT1G79550 | AT1G79550.1 | TAATTGGGCTAGCCCATTAAG | Encodes cytosolic phosphoglycerate kinase (PGK).  |
AT1G79550.2 | TAATTGGGCTAGCCCATTAAG | Encodes cytosolic phosphoglycerate kinase (PGK).  | |
AT1G79610 | AT1G79610.1 | TAATTGGGCTCA | sodium proton exchanger, putative (NHX6); FUNCTIONS IN: solute:hydrogen antiporter activity, sodium:hydrogen antiporter activity; INVOLVED IN: cation transport, sodium ion transport, regulation of pH; LOCATED IN: integral to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Na+/H+ exchanger, subfamily (InterPro:IPR004709), Cation/H+ exchanger, conserved region (InterPro:IPR018422), Na+/H+ exchanger, isoform 5/6/8, conserved region (InterPro:IPR018409), Cation/H+ exchanger (InterPro:IPR006153), Na+/H+ exchanger, conserved region (InterPro:IPR018406); BEST Arabidopsis thaliana protein match is: NHX5; sodium ion transmembrane transporter/ sodium:hydrogen antiporter (TAIR:AT1G54370.1); Has 4010 Blast hits to 4005 proteins in 1041 species: Archae - 71; Bacteria - 2418; Metazoa - 735; Fungi - 95; Plants - 280; Viruses - 0; Other Eukaryotes - 411 (source: NCBI BLink).  |
AT1G80500 | AT1G80500.1 | CCCAATAGCCCAATAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sedlin (InterPro:IPR006722), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20930.1); Has 437 Blast hits to 435 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 248; Fungi - 75; Plants - 53; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  |
AT1G80750 | AT1G80750.1 | GTAAGGCCTTACATAAGCCCATAAATATTGGGCTTTTTTAGCCCAATAG | 60S ribosomal protein L7 (RPL7A); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7D) (TAIR:AT3G13580.3); Has 856 Blast hits to 856 proteins in 248 species: Archae - 76; Bacteria - 0; Metazoa - 354; Fungi - 146; Plants - 114; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink).  |
AT2G01270 | AT2G01270.1 | AGCCCAATTGGGCCCAAAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.  |
AT2G01350 | AT2G01350.1 | GAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli.  |
AT2G01350.1 | TAAAAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli.  | |
AT2G01350.2 | GAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli.  | |
AT2G01350.2 | TAAAAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli.  | |
AT2G01350.3 | GAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli.  | |
AT2G01350.3 | TAAAAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli.  | |
AT2G01350.4 | GAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli.  | |
AT2G01350.4 | TAAAAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli.  | |
AT2G01720 | AT2G01720.1 | GAAGCCCAATAA | ribophorin I family protein; FUNCTIONS IN: oligosaccharyl transferase activity, dolichyl-diphosphooligosaccharide-protein glycotransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribophorin I (InterPro:IPR007676); BEST Arabidopsis thaliana protein match is: ribophorin I family protein (TAIR:AT1G76400.1); Has 285 Blast hits to 285 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 87; Plants - 31; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  |
AT2G02790 | AT2G02790.1 | TAATTGGGCTCA | IQ-domain 29 (IQD29); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD28 (IQ67 DOMAIN PROTEIN 28); calmodulin binding (TAIR:AT1G14380.2); Has 7393 Blast hits to 5438 proteins in 475 species: Archae - 15; Bacteria - 609; Metazoa - 3092; Fungi - 719; Plants - 642; Viruses - 17; Other Eukaryotes - 2299 (source: NCBI BLink).  |
AT2G03270 | AT2G03270.1 | TTAAAGCCCAATTA | DNA-binding protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA helicase, putative (InterPro:IPR004483), DEAD-like helicase, N-terminal (InterPro:IPR014001); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT5G35970.1); Has 4398 Blast hits to 3880 proteins in 634 species: Archae - 141; Bacteria - 1267; Metazoa - 1124; Fungi - 651; Plants - 305; Viruses - 8; Other Eukaryotes - 902 (source: NCBI BLink).  |
AT2G06990 | AT2G06990.1 | CAATTGGGCTCA | encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl.  |
AT2G06990.1 | TAATTGGGCTTTT | encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl.  | |
AT2G06990.1 | TGAGCCCAATAG | encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl.  | |
AT2G14660 | AT2G14660.1 | TAATTGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0310 (InterPro:IPR002740); Has 2334 Blast hits to 2333 proteins in 479 species: Archae - 5; Bacteria - 781; Metazoa - 60; Fungi - 50; Plants - 22; Viruses - 0; Other Eukaryotes - 1416 (source: NCBI BLink).  |
AT2G16600 | AT2G16600.1 | CATTGGGCTTA | Encodes cytosolic cyclophilin ROC3.  |
AT2G16600.2 | CATTGGGCTTA | Encodes cytosolic cyclophilin ROC3.  | |
AT2G17670 | AT2G17670.1 | AAAAGCCCAATAGGCCCAATG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink).  |
AT2G17670.1 | CAAGCCCAATAGGCCCAATG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink).  | |
AT2G17670.2 | AAAAGCCCAATAGGCCCAATG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink).  | |
AT2G17670.2 | CAAGCCCAATAGGCCCAATG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink).  | |
AT2G19310 | AT2G19310.1 | AAAAGGCCTTTTCTATTGGGCTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress, response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: HSP18.2 (heat shock protein 18.2) (TAIR:AT5G59720.1); Has 527 Blast hits to 527 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 34; Plants - 479; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT2G20330 | AT2G20330.1 | GAAGCCCAATT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 23940 Blast hits to 14550 proteins in 496 species: Archae - 38; Bacteria - 4162; Metazoa - 9990; Fungi - 4392; Plants - 2081; Viruses - 20; Other Eukaryotes - 3257 (source: NCBI BLink).  |
AT2G20580 | AT2G20580.1 | TGAGCCCAATA | encoding the RPN subunits of the 26S proteasome  |
AT2G20585 | AT2G20585.1 | AATTGGGCTTT | NUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G20585.2 | AATTGGGCTTT | NUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G20585.3 | AATTGGGCTTT | NUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G21150 | AT2G21150.1 | AAAAGCCCAATTATTGGGCCGAT | XAP5 family protein involved in light regulation of the circadian clock and photomorphogenesis. Nuclear localized.  |
AT2G21195 | AT2G21195.1 | ATTGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G21195.2 | ATTGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G21195.3 | ATTGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G21280 | AT2G21280.1 | CAAAGCCCAATAAGGGCCTTTAA | A nuclear-encoded, plastid-targeted protein (AtSulA) whose overexpression causes severe yet stochastic plastid (shown in chloroplasts and leucoplasts) division defects. The protein does not appear to interact with either AtFtsZ proteins when studied in a yeast two-hybrid system.  |
AT2G21290 | AT2G21290.1 | TTAAAGGCCCTTATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G21580 | AT2G21580.1 | TAATTGGGCTTA | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
AT2G21580.2 | TAATTGGGCTTA | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT2G22400 | AT2G22400.1 | TAAAGCCCAATTAAAAAGCC | NOL1/NOP2/sun family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314); BEST Arabidopsis thaliana protein match is: NOL1/NOP2/sun family protein (TAIR:AT4G40000.1); Has 5426 Blast hits to 5396 proteins in 1280 species: Archae - 185; Bacteria - 3179; Metazoa - 525; Fungi - 201; Plants - 119; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink).  |
AT2G23440 | AT2G23440.1 | ATATTGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; Has 8 Blast hits to 8 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G23930 | AT2G23930.1 | TTATTGGGCTTA | PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G (SNRNP-G); FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative (TAIR:AT3G11500.1); Has 892 Blast hits to 892 proteins in 193 species: Archae - 86; Bacteria - 0; Metazoa - 373; Fungi - 185; Plants - 110; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).  |
AT2G23930.2 | TTATTGGGCTTA | PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G (SNRNP-G); FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative (TAIR:AT3G11500.1); Has 892 Blast hits to 892 proteins in 193 species: Archae - 86; Bacteria - 0; Metazoa - 373; Fungi - 185; Plants - 110; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).  | |
AT2G25350 | AT2G25350.1 | TATTGGGCTATT | phox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT4G32160.1); Has 19818 Blast hits to 12588 proteins in 761 species: Archae - 181; Bacteria - 1370; Metazoa - 11138; Fungi - 1442; Plants - 628; Viruses - 164; Other Eukaryotes - 4895 (source: NCBI BLink).  |
AT2G25890 | AT2G25890.1 | AATAGCCCAATAAG | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: leaf whorl, petal, flower, carpel; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO1 (OLEOSIN 1) (TAIR:AT4G25140.1); Has 402 Blast hits to 402 proteins in 48 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 398; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G25910 | AT2G25910.1 | AAAAAGCCCAAT | 3'-5' exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein; FUNCTIONS IN: 3'-5' exonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25920.1); Has 798 Blast hits to 798 proteins in 239 species: Archae - 0; Bacteria - 274; Metazoa - 164; Fungi - 38; Plants - 61; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink).  |
AT2G25910.2 | AAAAAGCCCAAT | 3'-5' exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein; FUNCTIONS IN: 3'-5' exonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25920.1); Has 798 Blast hits to 798 proteins in 239 species: Archae - 0; Bacteria - 274; Metazoa - 164; Fungi - 38; Plants - 61; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink).  | |
AT2G26430 | AT2G26430.1 | CTAAGCCCAATAAGGGCCTAG | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast.  |
AT2G26430.2 | CTAAGCCCAATAAGGGCCTAG | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast.  | |
AT2G26430.3 | CTAAGCCCAATAAGGGCCTAG | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast.  | |
AT2G26840 | AT2G26840.1 | CAAAGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43910.1); Has 799 Blast hits to 799 proteins in 14 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 2; Other Eukaryotes - 768 (source: NCBI BLink).  |
AT2G29180 | AT2G29180.1 | ATATTGGGCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 21 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT2G31610 | AT2G31610.1 | CATTGGGCTGA | 40S ribosomal protein S3 (RPS3A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to salt stress, translation, response to abiotic stimulus; LOCATED IN: in 6 components; EXPRESSED IN: root, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: K Homology, prokaryotic type (InterPro:IPR009019), K Homology, type 2 (InterPro:IPR004044), K Homology (InterPro:IPR004087), Ribosomal protein S3, C-terminal (InterPro:IPR001351), Ribosomal protein S3, conserved site (InterPro:IPR018280), Ribosomal protein S3, eukaryotic/archaeal (InterPro:IPR005703); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3 (RPS3B) (TAIR:AT3G53870.1); Has 3946 Blast hits to 3943 proteins in 1195 species: Archae - 174; Bacteria - 1992; Metazoa - 298; Fungi - 94; Plants - 101; Viruses - 0; Other Eukaryotes - 1287 (source: NCBI BLink).  |
AT2G34480 | AT2G34480.1 | AGCCCATTGGGCTTTTA | 60S ribosomal protein L18A (RPL18aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aC) (TAIR:AT3G14600.1); Has 545 Blast hits to 543 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 93; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT2G34630 | AT2G34630.2 | TTATTGGGCTTA | Encodes a geranyl diphosphate synthase. RNAi lines are dwarf. T-DNA knock-out lines are embryo lethal.  |
AT2G35750 | AT2G35750.1 | CTAATGGGCTTAATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G36990 | AT2G36990.1 | ATTTGGGCTTTTAAGCCCAATATAAGGCCCAACA | Encodes a general sigma factor in chloroplasts and is probably responsible for the recognition of sigma 70 type standard bacteria-type multi-subunit RNA polymerase (PEP) promoters in young cotyledons.  |
AT2G37120 | AT2G37120.1 | CTTATTGGGCTTC | DNA-binding S1FA family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA binding protein S1FA (InterPro:IPR006779); Has 54 Blast hits to 54 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G37270 | AT2G37270.1 | AAAAGCCCAACATAAGCCCAATAA | One of two genes encoding the ribosomal protein S5. Expressed at a lower level compared to ATRPS5A.  |
AT2G37270.2 | AAAAGCCCAACATAAGCCCAATAA | One of two genes encoding the ribosomal protein S5. Expressed at a lower level compared to ATRPS5A.  | |
AT2G38090 | AT2G38090.1 | GAAGCCCAATTG | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), SANT, eukarya (InterPro:IPR017884), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-related (InterPro:IPR012287), Myb-type HTH DNA-binding domain (InterPro:IPR017930); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT5G58900.1); Has 1110 Blast hits to 1107 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 2; Plants - 818; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).  |
AT2G38130 | AT2G38130.1 | CAATTGGGCTTAT | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes.  |
AT2G38130.2 | CAATTGGGCTTAT | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes.  | |
AT2G38140 | AT2G38140.1 | ATAAGCCCAATTG | plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete  |
AT2G40020 | AT2G40020.1 | CTATTGGGCTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink).  |
AT2G40020.2 | CTATTGGGCTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink).  | |
AT2G40020.3 | CTATTGGGCTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink).  | |
AT2G40090 | AT2G40090.1 | CAAGCCCAATAAGTAAGGCCCACA | member of ATH subfamily  |
AT2G42210 | AT2G42210.1 | TAATTGGGCTTT | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family.  |
AT2G42210.2 | TAATTGGGCTTT | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family.  | |
AT2G42210.3 | TAATTGGGCTTT | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family.  | |
AT2G42210.4 | TAATTGGGCTTT | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family.  | |
AT2G42300 | AT2G42300.1 | ATAAAGCCCAATAGGCCCAATT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT3G57800.2); Has 1141 Blast hits to 1141 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 3; Plants - 1128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G42300.2 | ATAAAGCCCAATAGGCCCAATT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT3G57800.2); Has 1141 Blast hits to 1141 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 3; Plants - 1128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G42390 | AT2G42390.1 | CAAAGCCCAATAT | protein kinase C substrate, heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT5G56360.1); Has 464 Blast hits to 443 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 290; Fungi - 79; Plants - 29; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).  |
AT2G43360 | AT2G43360.1 | AATTGGGCTTAT | Catalyzes the conversion of dethiobiotin to biotin.  |
AT2G43370 | AT2G43370.1 | ATAAGCCCAATT | U1 small nuclear ribonucleoprotein 70 kDa, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: U1-70K (U1 SMALL NUCLEAR RIBONUCLEOPROTEIN-70K); RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G50670.1); Has 15940 Blast hits to 13539 proteins in 557 species: Archae - 10; Bacteria - 827; Metazoa - 9526; Fungi - 1771; Plants - 2091; Viruses - 3; Other Eukaryotes - 1712 (source: NCBI BLink).  |
AT2G44065 | AT2G44065.1 | TATTGGGCTTG | ribosomal protein L2 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding, transferase activity; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Translation protein SH3-like, subgroup (InterPro:IPR014722), Ribosomal protein L2, bacterial-type (InterPro:IPR005880), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG01310.1); Has 7469 Blast hits to 7469 proteins in 2227 species: Archae - 235; Bacteria - 3117; Metazoa - 361; Fungi - 186; Plants - 960; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink).  |
AT2G44065.2 | TATTGGGCTTG | ribosomal protein L2 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding, transferase activity; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Translation protein SH3-like, subgroup (InterPro:IPR014722), Ribosomal protein L2, bacterial-type (InterPro:IPR005880), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG01310.1); Has 7469 Blast hits to 7469 proteins in 2227 species: Archae - 235; Bacteria - 3117; Metazoa - 361; Fungi - 186; Plants - 960; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink).  | |
AT2G44120 | AT2G44120.1 | CAAGCCCAATT | 60S ribosomal protein L7 (RPL7C); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7B) (TAIR:AT2G01250.1); Has 982 Blast hits to 980 proteins in 291 species: Archae - 151; Bacteria - 0; Metazoa - 383; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).  |
AT2G44120.2 | CAAGCCCAATT | 60S ribosomal protein L7 (RPL7C); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7B) (TAIR:AT2G01250.1); Has 982 Blast hits to 980 proteins in 291 species: Archae - 151; Bacteria - 0; Metazoa - 383; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).  | |
AT2G45000 | AT2G45000.1 | TTATTGGGCTGGGCCGA | EMBRYO DEFECTIVE 2766 (EMB2766); FUNCTIONS IN: structural constituent of nuclear pore; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, nuclear pore; CONTAINS InterPro DOMAIN/s: Nucleoporin, Nsp1-like, C-terminal (InterPro:IPR007758); Has 196388 Blast hits to 74057 proteins in 2349 species: Archae - 657; Bacteria - 41194; Metazoa - 62656; Fungi - 37422; Plants - 6443; Viruses - 2462; Other Eukaryotes - 45554 (source: NCBI BLink).  |
AT2G45200 | AT2G45200.1 | ATAAGCCCAATAT | Encodes a member of the GOS1 (Golgi SNARE) gene family.  |
AT2G45200.1 | GAGCCCAATT | Encodes a member of the GOS1 (Golgi SNARE) gene family.  | |
AT2G45200.1 | TGAGCCCAATAA | Encodes a member of the GOS1 (Golgi SNARE) gene family.  | |
AT2G45200.1 | TGAGCCCAATAA | Encodes a member of the GOS1 (Golgi SNARE) gene family.  | |
AT2G45200.1 | TGAGCCCAATAT | Encodes a member of the GOS1 (Golgi SNARE) gene family.  | |
AT2G45710 | AT2G45710.1 | TTAGCCCAATAG | 40S ribosomal protein S27 (RPS27A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, nucleolus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein S27e (InterPro:IPR000592); BEST Arabidopsis thaliana protein match is: ARS27A (ARABIDOPSIS RIBOSOMAL PROTEIN S27); structural constituent of ribosome (TAIR:AT3G61110.1); Has 690 Blast hits to 690 proteins in 269 species: Archae - 76; Bacteria - 0; Metazoa - 297; Fungi - 98; Plants - 99; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  |
AT2G45730 | AT2G45730.1 | TTAAAGCCCAATAA | eukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
AT2G46230 | AT2G46230.1 | TTATTGGGCTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
AT2G46230.2 | TTATTGGGCTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  | |
AT2G46490 | AT2G46490.1 | CTTATTGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35110.1); Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G46735 | AT2G46735.1 | AAAAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 5 Blast hits to 5 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G47110 | AT2G47110.1 | AAAAGGCCTTTGAAGCCCAATG | polyubiquitin gene  |
AT2G47170 | AT2G47170.1 | TAAATGGGCCGAATTGGGCTGA | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct.  |
AT2G47380 | AT2G47380.1 | TTAGCCCAATAG | cytochrome c oxidase subunit Vc family protein / COX5C family protein; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase subunit Vc (InterPro:IPR008432); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit Vc, putative / COX5C, putative (TAIR:AT5G61310.4); Has 60 Blast hits to 60 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G47580 | AT2G47580.1 | ATATTGGGCTAA | encodes spliceosomal protein U1A  |
AT3G01130 | AT3G01130.1 | TAAAGGCCCATATAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G01130.2 | TAAAGGCCCATATAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G01320 | AT3G01320.1 | AAAAAGCCCAATAG | Encodes SIN3-like 1, a homolog of the transcriptional repressor SIN3 (AT1G24190).  |
AT3G01370 | AT3G01370.1 | AGCCCAATAA | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing.  |
AT3G01410 | AT3G01410.1 | CTATTGGGCTTTTT | RNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink).  |
AT3G01410.2 | CTATTGGGCTTTTT | RNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink).  | |
AT3G01740 | AT3G01740.1 | ATATTGGGCTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37, mitochondrial (InterPro:IPR013870); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14290.1); Has 117 Blast hits to 117 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 22; Plants - 27; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT3G01770 | AT3G01770.1 | CATTGGGCTTTA | Arabidopsis thaliana BROMODOMAIN AND EXTRATERMINAL DOMAIN PROTEIN 10 (ATBET10); FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: ATBET9 (Arabidopsis thaliana Bromodomain and Extraterminal Domain protein 9); DNA binding (TAIR:AT5G14270.1); Has 10636 Blast hits to 8190 proteins in 445 species: Archae - 19; Bacteria - 529; Metazoa - 5538; Fungi - 1309; Plants - 426; Viruses - 19; Other Eukaryotes - 2796 (source: NCBI BLink).  |
AT3G01780 | AT3G01780.1 | TAAAGCCCAATG | Encodes TPLATE, a cytokinesis protein targeted to the cell plate. Functions in vesicle-trafficking events required for site-specific cell wall modifications during pollen germination and for anchoring of the cell plate to the mother wall at the correct cortical position.  |
AT3G02450 | AT3G02450.1 | AGCCCAATAG | cell division protein ftsH, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase M41, FtsH extracellular (InterPro:IPR011546); BEST Arabidopsis thaliana protein match is: FTSH6 (FTSH PROTEASE 6); ATP-dependent peptidase/ ATPase/ metallopeptidase/ peptidase/ zinc ion binding (TAIR:AT5G15250.1); Has 29914 Blast hits to 28201 proteins in 1898 species: Archae - 923; Bacteria - 10733; Metazoa - 4167; Fungi - 2480; Plants - 1767; Viruses - 20; Other Eukaryotes - 9824 (source: NCBI BLink).  |
AT3G02640 | AT3G02640.1 | TTGGCCCATTGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16250.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G03720 | AT3G03720.2 | TTAGCCCAATTG | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters.  |
AT3G03840 | AT3G03840.1 | AGCCCAATAT | auxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT3G03820.1); Has 578 Blast hits to 575 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 577; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G03920 | AT3G03920.1 | ATATTGGGCTAA | Gar1 RNA-binding region family protein; FUNCTIONS IN: RNA binding, rRNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast thylakoid membrane, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gar1 protein RNA-binding region (InterPro:IPR007504); BEST Arabidopsis thaliana protein match is: Gar1 RNA-binding region family protein (TAIR:AT5G18180.1); Has 26246 Blast hits to 8264 proteins in 726 species: Archae - 15; Bacteria - 4613; Metazoa - 10704; Fungi - 2027; Plants - 5901; Viruses - 362; Other Eukaryotes - 2624 (source: NCBI BLink).  |
AT3G04400 | AT3G04400.1 | TTATTGGGCTTAT | embryo defective 2171 (emb2171); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14b/L23e (InterPro:IPR000218); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L23 (RPL23B) (TAIR:AT2G33370.1); Has 6297 Blast hits to 6297 proteins in 1833 species: Archae - 236; Bacteria - 2977; Metazoa - 280; Fungi - 176; Plants - 586; Viruses - 0; Other Eukaryotes - 2042 (source: NCBI BLink).  |
AT3G04500 | AT3G04500.1 | CTATTGGGCCTCAGCCCAATAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), RNA recognition motif-related (InterPro:IPR015464); BEST Arabidopsis thaliana protein match is: UBP1B (oligouridylate binding protein 1B); mRNA 3'-UTR binding (TAIR:AT1G17370.2); Has 10169 Blast hits to 8298 proteins in 506 species: Archae - 0; Bacteria - 623; Metazoa - 5880; Fungi - 1176; Plants - 1670; Viruses - 0; Other Eukaryotes - 820 (source: NCBI BLink).  |
AT3G05280 | AT3G05280.1 | ATATTGGGCTCA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 381 Blast hits to 380 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 69; Plants - 47; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT3G06030 | AT3G06030.1 | AAAAAGCCCAATAAGAAGGCCCATTAAG | NPK1-related protein kinase 3  |
AT3G06040 | AT3G06040.1 | CTTATTGGGCTTGGCCCATA | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink).  |
AT3G06040.2 | CTTATTGGGCTTGGCCCATA | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink).  | |
AT3G06040.3 | CTTATTGGGCTTGGCCCATA | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink).  | |
AT3G06310 | AT3G06310.1 | TGAGCCCAATATCAGCCCA | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G06310.2 | TGAGCCCAATATCAGCCCA | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT3G06320 | AT3G06320.1 | TGGGCTGATATTGGGCTCA | ribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT5G18790.1); Has 1784 Blast hits to 1784 proteins in 750 species: Archae - 0; Bacteria - 1568; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink).  |
AT3G07150 | AT3G07150.1 | ATAAAGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G07400 | AT3G07400.1 | ATTTGGGCCTAAAGCCCAATAG | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); Has 274 Blast hits to 273 proteins in 48 species: Archae - 0; Bacteria - 6; Metazoa - 26; Fungi - 34; Plants - 176; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT3G08510 | AT3G08510.1 | AAAAGCCCAATAA | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol.  |
AT3G08510.2 | AAAAGCCCAATAA | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol.  | |
AT3G08510.3 | AAAAGCCCAATAA | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol.  | |
AT3G08520 | AT3G08520.1 | TTATTGGGCTTTT | 60S ribosomal protein L41 (RPL41D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT3G08610 | AT3G08610.1 | TATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G08780 | AT3G08780.1 | ATTGGGCTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G08780.2 | ATTGGGCTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT3G09350 | AT3G09350.1 | TAAGCCCAATAA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT3G09350.2 | TAAGCCCAATAA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  | |
AT3G09350.3 | TAAGCCCAATAA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  | |
AT3G09630 | AT3G09630.1 | TTATTGGGCTTTAT | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).  |
AT3G09630.2 | TTATTGGGCTTTAT | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).  | |
AT3G10730 | AT3G10730.1 | TTATTGGGCTTTTAAAAGCCCATCA | sad1/unc-84-like 2 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope, endoplasmic reticulum, spindle, phragmoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sad1/UNC-like, C-terminal (InterPro:IPR012919); BEST Arabidopsis thaliana protein match is: sad1/unc-84 protein-related (TAIR:AT5G04990.1); Has 419 Blast hits to 416 proteins in 105 species: Archae - 4; Bacteria - 31; Metazoa - 294; Fungi - 27; Plants - 31; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT3G10940 | AT3G10940.1 | AAAAAGCCCAATAA | protein phosphatase-related; FUNCTIONS IN: phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase (InterPro:IPR000387), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340); BEST Arabidopsis thaliana protein match is: SEX4 (STARCH-EXCESS 4); polysaccharide binding / protein tyrosine/serine/threonine phosphatase (TAIR:AT3G52180.2); Has 743 Blast hits to 742 proteins in 92 species: Archae - 5; Bacteria - 8; Metazoa - 545; Fungi - 12; Plants - 77; Viruses - 11; Other Eukaryotes - 85 (source: NCBI BLink).  |
AT3G11240 | AT3G11240.1 | AATTGGGCTTTAA | Encodes an arginyl-tRNA:protein arginyltransferase (ATE2), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination.  |
AT3G11250 | AT3G11250.1 | TTAAAGCCCAATT | 60S acidic ribosomal protein P0 (RPP0C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, translation; LOCATED IN: cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0B) (TAIR:AT3G09200.1); Has 1503 Blast hits to 1500 proteins in 380 species: Archae - 223; Bacteria - 1; Metazoa - 578; Fungi - 277; Plants - 141; Viruses - 0; Other Eukaryotes - 283 (source: NCBI BLink).  |
AT3G11270 | AT3G11270.1 | TTTAGGCCCATATAATTGGGCTTTAT | maternal effect embryo arrest 34 (MEE34); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus, proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: RPN8A (RP NON-ATPASE SUBUNIT 8A) (TAIR:AT5G05780.1); Has 981 Blast hits to 977 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 446; Fungi - 210; Plants - 166; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT3G11745 | AT3G11745.1 | ATTGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G12740 | AT3G12740.1 | TAAGCCCAATT | Physically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3.  |
AT3G13230 | AT3G13230.1 | AGCCCAAT | RNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087); Has 526 Blast hits to 526 proteins in 226 species: Archae - 118; Bacteria - 0; Metazoa - 138; Fungi - 131; Plants - 49; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT3G13740 | AT3G13740.1 | AAAAGCCCAATT | URF 4-related; FUNCTIONS IN: RNA binding, ribonuclease III activity; INVOLVED IN: RNA processing; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonuclease III (InterPro:IPR000999); BEST Arabidopsis thaliana protein match is: RNA binding / ribonuclease III (TAIR:AT1G55140.1); Has 698 Blast hits to 697 proteins in 302 species: Archae - 0; Bacteria - 571; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink).  |
AT3G14430 | AT3G14430.1 | CTTATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G14890 | AT3G14890.1 | GTTAGGCCTTTAAAGCCCAAATAAGCCCAATG | phosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink).  |
AT3G14890.2 | GTTAGGCCTTTAAAGCCCAAATAAGCCCAATG | phosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink).  | |
AT3G15040 | AT3G15040.1 | CTATTGGGCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 2804 Blast hits to 412 proteins in 66 species: Archae - 0; Bacteria - 22; Metazoa - 419; Fungi - 51; Plants - 212; Viruses - 0; Other Eukaryotes - 2100 (source: NCBI BLink).  |
AT3G15060 | AT3G15060.1 | ATTGGGCTTAT | Arabidopsis Rab GTPase homolog A1g (AtRABA1g); FUNCTIONS IN: GTP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: AtRABA1f (Arabidopsis Rab GTPase homolog A1f); GTP binding (TAIR:AT5G60860.1); Has 22374 Blast hits to 22336 proteins in 611 species: Archae - 21; Bacteria - 95; Metazoa - 12471; Fungi - 2920; Plants - 1850; Viruses - 19; Other Eukaryotes - 4998 (source: NCBI BLink).  |
AT3G15120 | AT3G15120.1 | CTAAGCCCAATT | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: cell division cycle protein 48-related / CDC48-related (TAIR:AT1G05910.1); Has 65380 Blast hits to 45049 proteins in 2200 species: Archae - 999; Bacteria - 13338; Metazoa - 21190; Fungi - 6719; Plants - 3370; Viruses - 463; Other Eukaryotes - 19301 (source: NCBI BLink).  |
AT3G15220 | AT3G15220.1 | CTTATTGGGCTTTTA | protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: spindle, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATMAP4K ALPHA1; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT1G53165.2); Has 97460 Blast hits to 95819 proteins in 3033 species: Archae - 88; Bacteria - 8614; Metazoa - 42541; Fungi - 8570; Plants - 18723; Viruses - 614; Other Eukaryotes - 18310 (source: NCBI BLink).  |
AT3G15840 | AT3G15840.1 | CAATTGGGCTCA | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport.  |
AT3G15840.2 | CAATTGGGCTCA | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport.  | |
AT3G15840.3 | CAATTGGGCTCA | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport.  | |
AT3G15840.4 | CAATTGGGCTCA | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport.  | |
AT3G16990 | AT3G16990.1 | TTAAAGCCCAATG | TENA/THI-4 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem oxygenase-like, multi-helical (InterPro:IPR016084), TENA/THI-4 protein/Coenzyme PQQ biosynthesis protein C (InterPro:IPR004305); Has 201 Blast hits to 201 proteins in 61 species: Archae - 21; Bacteria - 69; Metazoa - 0; Fungi - 17; Plants - 26; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
AT3G17430 | AT3G17430.1 | TATAGGCCCATAAAGCCCAAT | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT1G48230.1); Has 1446 Blast hits to 1445 proteins in 173 species: Archae - 0; Bacteria - 5; Metazoa - 374; Fungi - 259; Plants - 650; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).  |
AT3G17626 | AT3G17626.1 | TTATGGGCTTTATTATTGGGCTTTTAGCCCAACT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: ribosomal protein L18 family protein (TAIR:AT1G48350.1); Has 336 Blast hits to 336 proteins in 121 species: Archae - 0; Bacteria - 241; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  |
AT3G18880 | AT3G18880.1 | AATTGGGCTGA | ribosomal protein S17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: emb1129 (embryo defective 1129); structural constituent of ribosome (TAIR:AT1G49400.1); Has 4907 Blast hits to 4907 proteins in 1461 species: Archae - 81; Bacteria - 2923; Metazoa - 31; Fungi - 32; Plants - 65; Viruses - 0; Other Eukaryotes - 1775 (source: NCBI BLink).  |
AT3G18940 | AT3G18940.1 | TTATTGGGCTTTAATATGGCCCATAT | clast3-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP010044 (InterPro:IPR016562); Has 170 Blast hits to 170 proteins in 73 species: Archae - 1; Bacteria - 0; Metazoa - 98; Fungi - 37; Plants - 26; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT3G19190 | AT3G19190.1 | GAGCCCAATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATG2, C-terminal (InterPro:IPR015412); Has 603 Blast hits to 514 proteins in 156 species: Archae - 0; Bacteria - 19; Metazoa - 326; Fungi - 168; Plants - 38; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT3G19340 | AT3G19340.1 | CATTGGGCTGA | LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: aminopeptidase (TAIR:AT5G13940.1); Has 143 Blast hits to 138 proteins in 46 species: Archae - 0; Bacteria - 59; Metazoa - 12; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT3G19590 | AT3G19590.1 | ATATGGGCTTTATTAGCCCAAT | WD-40 repeat family protein / mitotic checkpoint protein, putative; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / mitotic checkpoint protein, putative (TAIR:AT1G49910.1); Has 5445 Blast hits to 4008 proteins in 309 species: Archae - 14; Bacteria - 1198; Metazoa - 1895; Fungi - 1134; Plants - 290; Viruses - 0; Other Eukaryotes - 914 (source: NCBI BLink).  |
AT3G20890 | AT3G20890.1 | AAAAGCCCAATT | RNA binding / nucleic acid binding / nucleotide binding; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT5G66010.1); Has 18009 Blast hits to 6834 proteins in 573 species: Archae - 17; Bacteria - 2353; Metazoa - 8618; Fungi - 803; Plants - 4240; Viruses - 179; Other Eukaryotes - 1799 (source: NCBI BLink).  |
AT3G21110 | AT3G21110.1 | CAATTGGGCTTCAGCCCA | 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone.  |
AT3G21110.2 | CAATTGGGCTTCAGCCCA | 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone.  | |
AT3G22110 | AT3G22110.1 | CATTGGGCTTG | Encodes the alpha-3 subunit of 20s proteasome.  |
AT3G23325 | AT3G23325.1 | CAAAGCCCAAT | splicing factor, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Splicing factor 3B subunit 5/RDS3 complex subunit 10 (InterPro:IPR009846), Splicing factor 3B, subunit 5 (InterPro:IPR017089); BEST Arabidopsis thaliana protein match is: pre-mRNA splicing factor 10 kDa subunit, putative (TAIR:AT4G14342.1); Has 220 Blast hits to 220 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 61; Plants - 31; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT3G24570 | AT3G24570.1 | TAAAAGCCCAATG | peroxisomal membrane 22 kDa family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, integral to membrane, peroxisomal membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane 22 kDa family protein (TAIR:AT5G43140.1); Has 898 Blast hits to 898 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 471; Fungi - 216; Plants - 153; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  |
AT3G26020 | AT3G26020.1 | AGCCCAAT | serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative (TAIR:AT1G13460.2).  |
AT3G26020.2 | AGCCCAAT | serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative (TAIR:AT1G13460.2).  | |
AT3G26020.3 | AGCCCAAT | serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative (TAIR:AT1G13460.2).  | |
AT3G26020.4 | AGCCCAAT | serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative (TAIR:AT1G13460.2).  | |
AT3G27020 | AT3G27020.1 | AGCCCAATA | Arabidopsis thaliana metal-nicotianamine transporter YSL6  |
AT3G27230 | AT3G27230.1 | CTAAGCCCAATTA | LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: methyltransferase (TAIR:AT5G40830.2); Has 184 Blast hits to 183 proteins in 14 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 182; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G32180 | AT3G32180.1 | TTATTGGGCTTGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G32160.1); Has 34 Blast hits to 22 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G45030 | AT3G45030.1 | TTATTGGGCTTTAT | 40S ribosomal protein S20 (RPS20A); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20C) (TAIR:AT5G62300.2); Has 5001 Blast hits to 5001 proteins in 1494 species: Archae - 173; Bacteria - 2599; Metazoa - 280; Fungi - 90; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).  |
AT3G46790 | AT3G46790.1 | TCAGCCCAATT | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-H subfamily) with 9 pentatricopeptide (PPR) repeats. The protein is involved the intergenic processing of chloroplast RNA between rps7 and ndhB, which is essential for ndhB translation.  |
AT3G47610 | AT3G47610.1 | TAATTGGGCT | transcription regulator/ zinc ion binding; FUNCTIONS IN: transcription regulator activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2HC5-type (InterPro:IPR009349); Has 247 Blast hits to 233 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 80; Plants - 16; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
AT3G48380 | AT3G48380.1 | ATATTGGGCTAGGCCCATATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidase C78, ubiquitin fold modifier-specific peptidase 1 and 2 (InterPro:IPR012462); Has 257 Blast hits to 257 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  |
AT3G48380.2 | ATATTGGGCTAGGCCCATATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidase C78, ubiquitin fold modifier-specific peptidase 1 and 2 (InterPro:IPR012462); Has 257 Blast hits to 257 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  | |
AT3G48425 | AT3G48425.1 | ATATTGGGCTTG | endonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: hydrolase activity, nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135), Exodeoxyribonuclease III xth (InterPro:IPR004808); BEST Arabidopsis thaliana protein match is: ARP; DNA-(apurinic or apyrimidinic site) lyase (TAIR:AT2G41460.1); Has 3937 Blast hits to 3936 proteins in 1101 species: Archae - 54; Bacteria - 2118; Metazoa - 201; Fungi - 59; Plants - 62; Viruses - 0; Other Eukaryotes - 1443 (source: NCBI BLink).  |
AT3G49470 | AT3G49470.1 | GAAGCCCAATAAAAGGCCCAAT | NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 2 (NACA2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT4G10480.1); Has 1168 Blast hits to 1151 proteins in 231 species: Archae - 23; Bacteria - 6; Metazoa - 522; Fungi - 246; Plants - 124; Viruses - 7; Other Eukaryotes - 240 (source: NCBI BLink).  |
AT3G50808 | AT3G50808.1 | ATAAGCCCAATAA | unknown protein.  |
AT3G52590 | AT3G52590.1 | AGCCCAATAT | Ubiquitin extension protein  |
AT3G54190 | AT3G54190.1 | TTATTGGGCTGGGCCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38630.1); Has 77 Blast hits to 77 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT3G54440 | AT3G54440.1 | AAAGCCCAATAA | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).  |
AT3G54440.2 | AAAGCCCAATAA | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).  | |
AT3G55280 | AT3G55280.1 | AAAGCCCAATTA | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA  |
AT3G55280.2 | AAAGCCCAATTA | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA  | |
AT3G55280.3 | AAAGCCCAATTA | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA  | |
AT3G55750 | AT3G55750.1 | ATAAGCCCAATAG | 60S ribosomal protein L35a (RPL35aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aB) (TAIR:AT1G41880.1); Has 539 Blast hits to 539 proteins in 185 species: Archae - 19; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  |
AT3G56020 | AT3G56020.1 | TTATTGGGCT | 60S ribosomal protein L41 (RPL41G); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT3G56030 | AT3G56030.1 | AGCCCAATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G40240.1); Has 6707 Blast hits to 2251 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 13; Plants - 6562; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).  |
AT3G56190 | AT3G56190.1 | ATTGGGCTAA | Encodes one of two alpha-SNAPs (soluble NSF attachment protein) in Arabidopsis  |
AT3G56190.2 | ATTGGGCTAA | Encodes one of two alpha-SNAPs (soluble NSF attachment protein) in Arabidopsis  | |
AT3G56270 | AT3G56270.1 | AAAAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40480.1); Has 136 Blast hits to 136 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT3G56860 | AT3G56860.1 | TTAAAGCCCAATAA | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  |
AT3G56860.2 | TTAAAGCCCAATAA | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  | |
AT3G56860.3 | TTAAAGCCCAATAA | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  | |
AT3G57280 | AT3G57280.1 | TGAGCCCAATAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G20510.1); Has 95 Blast hits to 95 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 21; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G58130 | AT3G58130.1 | TATTGGGCTCA | N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: N-acetylglucosaminyl phosphatidylinositol deacetylase (InterPro:IPR003737); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27340.4); Has 346 Blast hits to 344 proteins in 163 species: Archae - 0; Bacteria - 54; Metazoa - 92; Fungi - 109; Plants - 28; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  |
AT3G58130.2 | TATTGGGCTCA | N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: N-acetylglucosaminyl phosphatidylinositol deacetylase (InterPro:IPR003737); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27340.4); Has 346 Blast hits to 344 proteins in 163 species: Archae - 0; Bacteria - 54; Metazoa - 92; Fungi - 109; Plants - 28; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  | |
AT3G59340 | AT3G59340.1 | GAGCCCAATAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF914, eukaryotic (InterPro:IPR009262); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59310.1); Has 715 Blast hits to 712 proteins in 169 species: Archae - 7; Bacteria - 146; Metazoa - 153; Fungi - 87; Plants - 74; Viruses - 0; Other Eukaryotes - 248 (source: NCBI BLink).  |
AT3G60810 | AT3G60810.1 | TTATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1499 (InterPro:IPR010865); Has 355 Blast hits to 355 proteins in 103 species: Archae - 0; Bacteria - 211; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).  |
AT3G60810.2 | TTATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1499 (InterPro:IPR010865); Has 355 Blast hits to 355 proteins in 103 species: Archae - 0; Bacteria - 211; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).  | |
AT3G60880 | AT3G60880.1 | TTAAAGCCCAATT | Encodes a dihydropicolinate synthase involved in lysine biosynthesis. The enzyme is allosterically inhibited by lysine. It is predicted to localize to the cholorplast.  |
AT3G60880.2 | TTAAAGCCCAATT | Encodes a dihydropicolinate synthase involved in lysine biosynthesis. The enzyme is allosterically inhibited by lysine. It is predicted to localize to the cholorplast.  | |
AT3G62120 | AT3G62120.1 | CTTATTGGGCTTGGCCCATG | tRNA synthetase class II (G, H, P and S) family protein; FUNCTIONS IN: proline-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: prolyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Prolyl-tRNA synthetase, class IIa, prokaryotic-type (InterPro:IPR004499), Prolyl-tRNA synthetase, class II, C-terminal (InterPro:IPR016061), Anticodon-binding (InterPro:IPR004154), Prolyl-tRNA synthetase, class II (InterPro:IPR017449), Prolyl-tRNA synthetase, class IIa, conserved region (InterPro:IPR002316), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA6 (OVULE ABORTION 6); ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / proline-tRNA ligase (TAIR:AT5G52520.1); Has 5872 Blast hits to 5731 proteins in 1483 species: Archae - 181; Bacteria - 3502; Metazoa - 187; Fungi - 122; Plants - 56; Viruses - 0; Other Eukaryotes - 1824 (source: NCBI BLink).  |
AT3G62120.2 | CTTATTGGGCTTGGCCCATG | tRNA synthetase class II (G, H, P and S) family protein; FUNCTIONS IN: proline-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: prolyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Prolyl-tRNA synthetase, class IIa, prokaryotic-type (InterPro:IPR004499), Prolyl-tRNA synthetase, class II, C-terminal (InterPro:IPR016061), Anticodon-binding (InterPro:IPR004154), Prolyl-tRNA synthetase, class II (InterPro:IPR017449), Prolyl-tRNA synthetase, class IIa, conserved region (InterPro:IPR002316), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA6 (OVULE ABORTION 6); ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / proline-tRNA ligase (TAIR:AT5G52520.1); Has 5872 Blast hits to 5731 proteins in 1483 species: Archae - 181; Bacteria - 3502; Metazoa - 187; Fungi - 122; Plants - 56; Viruses - 0; Other Eukaryotes - 1824 (source: NCBI BLink).  | |
AT3G62800 | AT3G62800.1 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression.  |
AT3G62800.2 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression.  | |
AT3G62800.3 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression.  | |
AT3G62810 | AT3G62810.1 | TTAATGGGCCAAAATTGGGCTTAT | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 68 Blast hits to 68 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 22; Plants - 17; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT4G00335 | AT4G00335.1 | AAAAGCCCAATG | RHB1A; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G41350.1); Has 3768 Blast hits to 3762 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1338; Fungi - 286; Plants - 1392; Viruses - 4; Other Eukaryotes - 748 (source: NCBI BLink).  |
AT4G00335.2 | AAAAGCCCAATG | RHB1A; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G41350.1); Has 3768 Blast hits to 3762 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1338; Fungi - 286; Plants - 1392; Viruses - 4; Other Eukaryotes - 748 (source: NCBI BLink).  | |
AT4G00335.3 | AAAAGCCCAATG | RHB1A; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G41350.1); Has 3768 Blast hits to 3762 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1338; Fungi - 286; Plants - 1392; Viruses - 4; Other Eukaryotes - 748 (source: NCBI BLink).  | |
AT4G00660 | AT4G00660.1 | CAAGCCCAAGCCCAATA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH12) (TAIR:AT3G61240.2); Has 29911 Blast hits to 28926 proteins in 1767 species: Archae - 415; Bacteria - 11594; Metazoa - 5504; Fungi - 3568; Plants - 1459; Viruses - 51; Other Eukaryotes - 7320 (source: NCBI BLink).  |
AT4G00660.2 | CAAGCCCAAGCCCAATA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH12) (TAIR:AT3G61240.2); Has 29911 Blast hits to 28926 proteins in 1767 species: Archae - 415; Bacteria - 11594; Metazoa - 5504; Fungi - 3568; Plants - 1459; Viruses - 51; Other Eukaryotes - 7320 (source: NCBI BLink).  | |
AT4G00810 | AT4G00810.1 | AGCCCAATAT | 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae - 60; Bacteria - 0; Metazoa - 672; Fungi - 360; Plants - 316; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink).  |
AT4G00810.2 | AGCCCAATAT | 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae - 60; Bacteria - 0; Metazoa - 672; Fungi - 360; Plants - 316; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink).  | |
AT4G01010 | AT4G01010.1 | AATTGGGCTTTTA | member of Cyclic nucleotide gated channel family  |
AT4G01220 | AT4G01220.1 | CAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: RGXT1 (rhamnogalacturonan xylosyltransferase 1); UDP-xylosyltransferase (TAIR:AT4G01770.1); Has 188 Blast hits to 185 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT4G01220.2 | CAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: RGXT1 (rhamnogalacturonan xylosyltransferase 1); UDP-xylosyltransferase (TAIR:AT4G01770.1); Has 188 Blast hits to 185 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  | |
AT4G01660 | AT4G01660.1 | AGCCCAATGGGCCTTAT | Encodes an ABC1-like protein, member of the ATH subfamily; putative ABC transporter; isolated by functional complementation of a yeast abc1 mutant  |
AT4G02195 | AT4G02195.1 | ATAAGCCCAATAT | member of SYP4 Gene Family  |
AT4G02210 | AT4G02210.1 | CTAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 475 Blast hits to 288 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 463; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G02220 | AT4G02220.1 | TTATTGGGCTTAG | zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320), Zinc finger, MYND-type (InterPro:IPR002893); BEST Arabidopsis thaliana protein match is: programmed cell death 2 C-terminal domain-containing protein (TAIR:AT5G64830.1); Has 702 Blast hits to 666 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 368; Fungi - 111; Plants - 110; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink).  |
AT4G02230 | AT4G02230.1 | AAAGCCCAATTA | 60S ribosomal protein L19 (RPL19C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: emb2386 (embryo defective 2386); structural constituent of ribosome (TAIR:AT1G02780.1); Has 848 Blast hits to 848 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 265; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink).  |
AT4G02460 | AT4G02460.1 | CTAAGCCCAATG | Encodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination.  |
AT4G03030 | AT4G03030.1 | AAAGCCCAATA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G63220.2); Has 1405 Blast hits to 1314 proteins in 98 species: Archae - 0; Bacteria - 31; Metazoa - 962; Fungi - 4; Plants - 358; Viruses - 9; Other Eukaryotes - 41 (source: NCBI BLink).  |
AT4G03030.1 | TAAGCCCAATA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G63220.2); Has 1405 Blast hits to 1314 proteins in 98 species: Archae - 0; Bacteria - 31; Metazoa - 962; Fungi - 4; Plants - 358; Viruses - 9; Other Eukaryotes - 41 (source: NCBI BLink).  | |
AT4G03180 | AT4G03180.1 | GTGGGCTTATTGGGCAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 869 Blast hits to 650 proteins in 112 species: Archae - 2; Bacteria - 20; Metazoa - 199; Fungi - 90; Plants - 42; Viruses - 0; Other Eukaryotes - 516 (source: NCBI BLink).  |
AT4G03220 | AT4G03220.1 | ATTGGGCT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL13) (TAIR:AT5G53840.1); Has 965 Blast hits to 954 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 962; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT4G03280 | AT4G03280.1 | TCAGCCCAATAAGGCCCAC | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen.  |
AT4G03280.2 | TCAGCCCAATAAGGCCCAC | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen.  | |
AT4G04740 | AT4G04740.1 | AGCCCAAT | member of Calcium Dependent Protein Kinase  |
AT4G07390 | AT4G07390.1 | AACGACGTAATTGGGCTGA | PQ-loop repeat family protein / transmembrane family protein; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Mannose-P-dolichol utilization defect 1 protein (InterPro:IPR016817); BEST Arabidopsis thaliana protein match is: PQ-loop repeat family protein / transmembrane family protein (TAIR:AT5G59470.1); Has 451 Blast hits to 449 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 81; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT4G08500 | AT4G08500.1 | TAAGCCCAATTAAAAAGCCCAGTA | Member of MAP Kinase Kinase gene family. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates AtMEK1.  |
AT4G08940 | AT4G08940.1 | TAAAGCCCAATAA | ubiquitin thiolesterase; FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: response to oxidative stress; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase (TAIR:AT4G01037.1); Has 214 Blast hits to 214 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G10330 | AT4G10330.1 | CTATTGGGCTGAAGTTGGGCCTTG | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 4017 Blast hits to 987 proteins in 153 species: Archae - 18; Bacteria - 164; Metazoa - 2052; Fungi - 67; Plants - 1382; Viruses - 57; Other Eukaryotes - 277 (source: NCBI BLink).  |
AT4G10710 | AT4G10710.1 | TAAGCCCAATA | encodes a component of the FAcilitates Chromatin Transcription (FACT) complex, SPT16.  |
AT4G12340 | AT4G12340.1 | AGCCCAATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); Has 33 Blast hits to 31 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G12382 | AT4G12382.1 | AATTGGGCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00893.1); Has 86 Blast hits to 86 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G12382.2 | AATTGGGCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00893.1); Has 86 Blast hits to 86 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G12620 | AT4G12620.1 | ATAAGCCCAATATTCGGCCCAAA | Origin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime.  |
AT4G12640 | AT4G12640.1 | TTTGGGCCGAATATTGGGCTTAT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: FPA; RNA binding (TAIR:AT2G43410.4); Has 6679 Blast hits to 5578 proteins in 311 species: Archae - 8; Bacteria - 143; Metazoa - 3956; Fungi - 1074; Plants - 834; Viruses - 0; Other Eukaryotes - 664 (source: NCBI BLink).  |
AT4G13170 | AT4G13170.1 | GGGCCAATATTGGGCTTTAA | 60S ribosomal protein L13A (RPL13aC); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1401 Blast hits to 1401 proteins in 423 species: Archae - 212; Bacteria - 236; Metazoa - 292; Fungi - 130; Plants - 165; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink).  |
AT4G14220 | AT4G14220.1 | CAAAGCCCAAT | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. RHF1a can interact with the cell cycle inhibitor ICK4/KRP6 in vitro. It apppears to target ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF1a is expressed in the carpels throughout floral development. It is expressed in various tissues of the anthers during the early stages of anther development but not in stage 12 flowers and beyond.  |
AT4G14300 | AT4G14300.1 | CTATTGGGCT | heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative (TAIR:AT2G33410.1); Has 82956 Blast hits to 37358 proteins in 1472 species: Archae - 56; Bacteria - 18252; Metazoa - 33610; Fungi - 7047; Plants - 9752; Viruses - 546; Other Eukaryotes - 13693 (source: NCBI BLink).  |
AT4G14455 | AT4G14455.1 | TAAAGCCCAGTAAGCCCAATT | Encodes a Bet1/Sft1-like SNARE protein, which can only partially suppresses the temperature-sensitive growth defect in <i>sft1-1</i> yeast cells; however, it cannot support the deletion of the yeast BET1 gene (<i>bet1Δ</i>). In yeast, Bet1p is the v-SNARE (soluble N-ethylmaleimide-sensitive factor adaptor protein receptor, V-type) involved in trafficking between the ER and Golgi.  |
AT4G15950 | AT4G15950.1 | GAAGCCCAAT | Non-catalytic subunit common to Nuclear DNA-dependent RNA polymerases IV and V; homologous to budding yeast RPB4  |
AT4G16720 | AT4G16720.1 | AGCCCAATT | 60S ribosomal protein L15 (RPL15A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15B) (TAIR:AT4G17390.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).  |
AT4G16720.1 | CAAAGCCCAATAG | 60S ribosomal protein L15 (RPL15A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15B) (TAIR:AT4G17390.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).  | |
AT4G19210 | AT4G19210.1 | CAAGCCCAATAA | member of RLI subfamily  |
AT4G21860 | AT4G21860.1 | ATATTGGGCTAAAGGGCCCAAACGTAAGGCCCAAAT | methionine sulfoxide reductase B 2 (MSRB2); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04800.1); Has 5933 Blast hits to 5932 proteins in 1231 species: Archae - 53; Bacteria - 2689; Metazoa - 222; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2775 (source: NCBI BLink).  |
AT4G21860.2 | ATATTGGGCTAAAGGGCCCAAACGTAAGGCCCAAAT | methionine sulfoxide reductase B 2 (MSRB2); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04800.1); Has 5933 Blast hits to 5932 proteins in 1231 species: Archae - 53; Bacteria - 2689; Metazoa - 222; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2775 (source: NCBI BLink).  | |
AT4G22260 | AT4G22260.1 | CTAAGCCCAATAAG | Similar to mitochondrial alternative oxidase. im mutants have a variegated phenotype and fail to differentiate chloroplasts in the majority of their cells under high light intensity continuous illumination. The white tissues of immutans accumulate phytoene, a non-colored C40 carotenoid intermediate. This suggests that immutans controls, either directly or indirectly, the activity of phytoene desaturase (PDS), the enzyme that converts phytoene to zeta-carotene in higher plants. However, im is not the structural gene for PDS. It is located in the lumenar face of the thylakoid membrane. IM is expressed ubiquitously in plant tissues.  |
AT4G22350 | AT4G22350.1 | TTATTGGGCT | ubiquitin carboxyl-terminal hydrolase family protein; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase/ zinc ion binding (TAIR:AT4G22285.1); Has 2784 Blast hits to 2384 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1738; Fungi - 374; Plants - 244; Viruses - 0; Other Eukaryotes - 428 (source: NCBI BLink).  |
AT4G22720 | AT4G22720.1 | TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink).  |
AT4G22720.2 | TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink).  | |
AT4G23140 | AT4G23140.1 | TTATTGGGCTCA | Arabidopsis thaliana receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307)  |
AT4G23140.2 | TTATTGGGCTCA | Arabidopsis thaliana receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307)  | |
AT4G23390 | AT4G23390.1 | ATATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF239, plant (InterPro:IPR004314); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20170.2); Has 423 Blast hits to 388 proteins in 17 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 10; Plants - 409; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G24570 | AT4G24570.1 | AAAAAGCCCAATTA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: UCP5 (UNCOUPLING PROTEIN 5); binding (TAIR:AT2G22500.1); Has 15369 Blast hits to 9513 proteins in 356 species: Archae - 0; Bacteria - 0; Metazoa - 7655; Fungi - 4171; Plants - 2183; Viruses - 0; Other Eukaryotes - 1360 (source: NCBI BLink).  |
AT4G24780 | AT4G24780.1 | ATATTGGGCTAA | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT5G63180.1); Has 863 Blast hits to 860 proteins in 162 species: Archae - 0; Bacteria - 350; Metazoa - 0; Fungi - 105; Plants - 397; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT4G25740 | AT4G25740.1 | TCAGCCCAATAAAAGCCCAAAT | 40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink).  |
AT4G25740.2 | TCAGCCCAATAAAAGCCCAAAT | 40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink).  | |
AT4G26210 | AT4G26210.1 | ATATTGGGCTATT | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT4G26210.2 | ATATTGGGCTATT | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT4G26670 | AT4G26670.1 | TAAGCCCAATT | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter/ protein transporter (TAIR:AT5G55510.1); Has 467 Blast hits to 467 proteins in 116 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 144; Plants - 82; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink).  |
AT4G26900 | AT4G26900.1 | GAAGCCCAATCCCATTAT | encodes a glutamine amidotransferase and cyclase, catalyzes the fifth and sixth steps of the histidine biosynthetic pathway  |
AT4G26900.1 | TAAAAGCCCAATTA | encodes a glutamine amidotransferase and cyclase, catalyzes the fifth and sixth steps of the histidine biosynthetic pathway  | |
AT4G27230 | AT4G27230.1 | CAAGCCCAATATAGCCCATATA | Encodes HTA2, a histone H2A protein.  |
AT4G27585 | AT4G27585.1 | TAAAGCCCAATAA | band 7 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid, membrane; EXPRESSED IN: callus, leaf; CONTAINS InterPro DOMAIN/s: Stomatin (InterPro:IPR001972), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: band 7 family protein (TAIR:AT5G54100.1); Has 7621 Blast hits to 7607 proteins in 1311 species: Archae - 148; Bacteria - 4066; Metazoa - 810; Fungi - 128; Plants - 171; Viruses - 3; Other Eukaryotes - 2295 (source: NCBI BLink).  |
AT4G28470 | AT4G28470.1 | TATGGCCCAATGAATAGCCCAATT | encoding the RPN subunits of the 26S proteasome  |
AT4G28510 | AT4G28510.1 | CTAAGCCCAATAA | prohibitin 1 (Atphb1)  |
AT4G28610 | AT4G28610.1 | CAAGCCCAATA | Similar to phosphate starvation response gene from Chlamydomonas. Weakly responsive to phosphate starvation. Acts upstream of PHO2 in phosphate signaling.  |
AT4G28830 | AT4G28830.1 | AAAGCCCAATGGGCCTGA | methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase small (InterPro:IPR007848), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 2052 Blast hits to 2052 proteins in 760 species: Archae - 135; Bacteria - 1556; Metazoa - 106; Fungi - 2; Plants - 24; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink).  |
AT4G28830.2 | AAAGCCCAATGGGCCTGA | methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase small (InterPro:IPR007848), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 2052 Blast hits to 2052 proteins in 760 species: Archae - 135; Bacteria - 1556; Metazoa - 106; Fungi - 2; Plants - 24; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink).  | |
AT4G29070 | AT4G29070.1 | TCGGCCCATTTTGAGCCCAATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase A2 (InterPro:IPR016090); Has 22 Blast hits to 22 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G29070.2 | TCGGCCCATTTTGAGCCCAATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase A2 (InterPro:IPR016090); Has 22 Blast hits to 22 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G30820 | AT4G30820.1 | CATTGGGCTTG | cyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT4G30820.2 | CATTGGGCTTG | cyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  | |
AT4G30820.3 | CATTGGGCTTG | cyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  | |
AT4G31080 | AT4G31080.1 | TTAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24330.1); Has 251 Blast hits to 245 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 75; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT4G31300 | AT4G31300.1 | ATATTGGGCTTT | Encodes 20S proteasome subunit PBA1 (PBA1).  |
AT4G31300.1 | TATTGGGCTTG | Encodes 20S proteasome subunit PBA1 (PBA1).  | |
AT4G31300.1 | TATTGGGCTTTTA | Encodes 20S proteasome subunit PBA1 (PBA1).  | |
AT4G31300.2 | ATATTGGGCTTT | Encodes 20S proteasome subunit PBA1 (PBA1).  | |
AT4G31300.2 | TATTGGGCTTG | Encodes 20S proteasome subunit PBA1 (PBA1).  | |
AT4G31300.2 | TATTGGGCTTTTA | Encodes 20S proteasome subunit PBA1 (PBA1).  | |
AT4G31570 | AT4G31570.1 | ATTGGGCTTTTAAGGCCCAGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; EXPRESSED DURING: E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24460.1); Has 149725 Blast hits to 50120 proteins in 2064 species: Archae - 2358; Bacteria - 20690; Metazoa - 73457; Fungi - 11975; Plants - 5885; Viruses - 756; Other Eukaryotes - 34604 (source: NCBI BLink).  |
AT4G31580 | AT4G31580.1 | TAAGCCCAATAAATAGGCCCAAAT | Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K.  |
AT4G31580.2 | TAAGCCCAATAAATAGGCCCAAAT | Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K.  | |
AT4G31930 | AT4G31930.1 | AATTGGGCTTTAA | mitochondrial glycoprotein family protein / MAM33 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 212 Blast hits to 212 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 66; Plants - 109; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
AT4G31985 | AT4G31985.1 | AAAAAGCCCAATAA | 60S ribosomal protein L39 (RPL39C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39B) (TAIR:AT3G02190.1); Has 591 Blast hits to 591 proteins in 225 species: Archae - 151; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink).  |
AT4G32930 | AT4G32930.1 | AATTGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF866, eukaryotic (InterPro:IPR008584); Has 275 Blast hits to 274 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 73; Plants - 42; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  |
AT4G33500 | AT4G33500.1 | AGCCCAATTA | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic (TAIR:AT4G16580.1); Has 6922 Blast hits to 4689 proteins in 525 species: Archae - 32; Bacteria - 1170; Metazoa - 2745; Fungi - 1059; Plants - 300; Viruses - 25; Other Eukaryotes - 1591 (source: NCBI BLink).  |
AT4G33510 | AT4G33510.1 | TAATTGGGCT | Enzyme catalyzing the first committed step in aromatic amino acid biosynthesis  |
AT4G33510.2 | TAATTGGGCT | Enzyme catalyzing the first committed step in aromatic amino acid biosynthesis  | |
AT4G34660 | AT4G34660.1 | CAAGCCCAATGGGCTATT | SH3 domain-containing protein 2 (SH3P2); FUNCTIONS IN: clathrin binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Src homology-3 domain (InterPro:IPR001452); BEST Arabidopsis thaliana protein match is: clathrin binding (TAIR:AT4G18060.1); Has 1201 Blast hits to 1169 proteins in 144 species: Archae - 0; Bacteria - 12; Metazoa - 956; Fungi - 47; Plants - 87; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink).  |
AT4G34660.1 | GAGCCCAATAT | SH3 domain-containing protein 2 (SH3P2); FUNCTIONS IN: clathrin binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Src homology-3 domain (InterPro:IPR001452); BEST Arabidopsis thaliana protein match is: clathrin binding (TAIR:AT4G18060.1); Has 1201 Blast hits to 1169 proteins in 144 species: Archae - 0; Bacteria - 12; Metazoa - 956; Fungi - 47; Plants - 87; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink).  | |
AT4G34670 | AT4G34670.1 | AATAGCCCATTGGGCTTG | 40S ribosomal protein S3A (RPS3aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S3Ae, conserved site (InterPro:IPR018281), Ribosomal protein S3Ae (InterPro:IPR001593); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3A (RPS3aA) (TAIR:AT3G04840.1); Has 941 Blast hits to 936 proteins in 297 species: Archae - 150; Bacteria - 1; Metazoa - 370; Fungi - 111; Plants - 126; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink).  |
AT4G34670.1 | ATATTGGGCTC | 40S ribosomal protein S3A (RPS3aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S3Ae, conserved site (InterPro:IPR018281), Ribosomal protein S3Ae (InterPro:IPR001593); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3A (RPS3aA) (TAIR:AT3G04840.1); Has 941 Blast hits to 936 proteins in 297 species: Archae - 150; Bacteria - 1; Metazoa - 370; Fungi - 111; Plants - 126; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink).  | |
AT4G34720 | AT4G34720.1 | AATTGGGCTTTTA | vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p1)  |
AT4G34870 | AT4G34870.1 | ATATTGGGCTTTA | belongs to cyclophilin family  |
AT4G34900 | AT4G34900.1 | ATATTGGGCTTATTTTGGGCT | XXANTHINE DEHYDROGENASE 2 (XDH2); FUNCTIONS IN: in 8 functions; INVOLVED IN: allantoin biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Aldehyde oxidase/xanthine dehydrogenase (InterPro:IPR016208), Ferredoxin (InterPro:IPR001041), Molybdopterin dehydrogenase, FAD-binding (InterPro:IPR002346), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), [2Fe-2S]-binding (InterPro:IPR002888), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167), FAD-binding, type 2 (InterPro:IPR016166), CO dehydrogenase flavoprotein, C-terminal (InterPro:IPR005107), 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (InterPro:IPR016169), Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead (InterPro:IPR000674), Aldehyde oxidase and xanthine dehydrogenase, molybdopterin binding (InterPro:IPR008274); BEST Arabidopsis thaliana protein match is: XDH1 (XANTHINE DEHYDROGENASE 1); xanthine dehydrogenase (TAIR:AT4G34890.1); Has 15600 Blast hits to 15136 proteins in 810 species: Archae - 184; Bacteria - 7544; Metazoa - 1009; Fungi - 62; Plants - 139; Viruses - 0; Other Eukaryotes - 6662 (source: NCBI BLink).  |
AT4G34900.1 | TAATTGGGCTTTT | XXANTHINE DEHYDROGENASE 2 (XDH2); FUNCTIONS IN: in 8 functions; INVOLVED IN: allantoin biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Aldehyde oxidase/xanthine dehydrogenase (InterPro:IPR016208), Ferredoxin (InterPro:IPR001041), Molybdopterin dehydrogenase, FAD-binding (InterPro:IPR002346), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), [2Fe-2S]-binding (InterPro:IPR002888), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167), FAD-binding, type 2 (InterPro:IPR016166), CO dehydrogenase flavoprotein, C-terminal (InterPro:IPR005107), 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (InterPro:IPR016169), Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead (InterPro:IPR000674), Aldehyde oxidase and xanthine dehydrogenase, molybdopterin binding (InterPro:IPR008274); BEST Arabidopsis thaliana protein match is: XDH1 (XANTHINE DEHYDROGENASE 1); xanthine dehydrogenase (TAIR:AT4G34890.1); Has 15600 Blast hits to 15136 proteins in 810 species: Archae - 184; Bacteria - 7544; Metazoa - 1009; Fungi - 62; Plants - 139; Viruses - 0; Other Eukaryotes - 6662 (source: NCBI BLink).  | |
AT4G34910 | AT4G34910.1 | AAAAGCCCAATTA | DEAD/DEAH box helicase, putative (RH16); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 23736 Blast hits to 23298 proteins in 1666 species: Archae - 321; Bacteria - 8811; Metazoa - 4714; Fungi - 2993; Plants - 1279; Viruses - 4; Other Eukaryotes - 5614 (source: NCBI BLink).  |
AT4G34910.1 | AGCCCAAAATAAGCCCAATAT | DEAD/DEAH box helicase, putative (RH16); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 23736 Blast hits to 23298 proteins in 1666 species: Archae - 321; Bacteria - 8811; Metazoa - 4714; Fungi - 2993; Plants - 1279; Viruses - 4; Other Eukaryotes - 5614 (source: NCBI BLink).  | |
AT4G35140 | AT4G35140.1 | GAAGCCCAAAAAGCCCAATG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G38480.1); Has 7738 Blast hits to 5690 proteins in 350 species: Archae - 10; Bacteria - 1449; Metazoa - 3242; Fungi - 1387; Plants - 483; Viruses - 0; Other Eukaryotes - 1167 (source: NCBI BLink).  |
AT4G35800 | AT4G35800.1 | AGCCCAATTA | Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit.  |
AT4G35850 | AT4G35850.1 | TAAGCCCAATAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G02150.1); Has 6373 Blast hits to 2522 proteins in 127 species: Archae - 1; Bacteria - 4; Metazoa - 104; Fungi - 77; Plants - 5853; Viruses - 0; Other Eukaryotes - 334 (source: NCBI BLink).  |
AT4G36280 | AT4G36280.1 | GAGCCCAATTA | ATP-binding region, ATPase-like domain-containing protein; FUNCTIONS IN: ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATP-binding region, ATPase-like (InterPro:IPR003594); BEST Arabidopsis thaliana protein match is: ATP-binding region, ATPase-like domain-containing protein (TAIR:AT4G36290.1); Has 306 Blast hits to 292 proteins in 51 species: Archae - 0; Bacteria - 16; Metazoa - 167; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT4G37040 | AT4G37040.1 | TTGGCCCATTAATAGCCCAATAT | encodes a methionine aminopeptidase  |
AT4G38930 | AT4G38930.1 | AGCCCATTGGGCT | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 484 Blast hits to 484 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 135; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  |
AT4G38930.2 | AGCCCATTGGGCT | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 484 Blast hits to 484 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 135; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  | |
AT4G39080 | AT4G39080.1 | GAAGCCCATTAAAAGCCCAATA | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast.  |
AT4G39150 | AT4G39150.1 | GAGCCCAATT | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G21510.1); Has 15752 Blast hits to 15663 proteins in 1939 species: Archae - 106; Bacteria - 5221; Metazoa - 3289; Fungi - 1398; Plants - 1148; Viruses - 18; Other Eukaryotes - 4572 (source: NCBI BLink).  |
AT4G39240 | AT4G39240.1 | TAATTGGGCTTTA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G14905.2); Has 1294 Blast hits to 1212 proteins in 90 species: Archae - 10; Bacteria - 44; Metazoa - 634; Fungi - 4; Plants - 571; Viruses - 7; Other Eukaryotes - 24 (source: NCBI BLink).  |
AT4G39420 | AT4G39420.1 | AAAGCCCAATTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible.  |
AT4G39420.2 | AAAGCCCAATTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible.  | |
AT4G39740 | AT4G39740.1 | GAAGCCCAATAA | electron transport SCO1/SenC family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT3G08950.1); Has 2451 Blast hits to 2451 proteins in 612 species: Archae - 9; Bacteria - 1265; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 905 (source: NCBI BLink).  |
AT4G39740.1 | TTAAAGCCCAATAA | electron transport SCO1/SenC family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT3G08950.1); Has 2451 Blast hits to 2451 proteins in 612 species: Archae - 9; Bacteria - 1265; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 905 (source: NCBI BLink).  | |
AT5G01110 | AT5G01110.1 | TCAGCCCAATTAAAACCGGAT | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05670.2); Has 28807 Blast hits to 6228 proteins in 193 species: Archae - 4; Bacteria - 24; Metazoa - 956; Fungi - 844; Plants - 25427; Viruses - 0; Other Eukaryotes - 1552 (source: NCBI BLink).  |
AT5G01230 | AT5G01230.1 | CAAGCCCAATAA | FtsJ-like methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: rRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal RNA methyltransferase J (InterPro:IPR015507), Ribosomal RNA methyltransferase RrmJ/FtsJ (InterPro:IPR002877); BEST Arabidopsis thaliana protein match is: FtsJ-like methyltransferase family protein (TAIR:AT4G25730.1); Has 4341 Blast hits to 4312 proteins in 938 species: Archae - 101; Bacteria - 1436; Metazoa - 438; Fungi - 272; Plants - 53; Viruses - 63; Other Eukaryotes - 1978 (source: NCBI BLink).  |
AT5G01230.2 | CAAGCCCAATAA | FtsJ-like methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: rRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal RNA methyltransferase J (InterPro:IPR015507), Ribosomal RNA methyltransferase RrmJ/FtsJ (InterPro:IPR002877); BEST Arabidopsis thaliana protein match is: FtsJ-like methyltransferase family protein (TAIR:AT4G25730.1); Has 4341 Blast hits to 4312 proteins in 938 species: Archae - 101; Bacteria - 1436; Metazoa - 438; Fungi - 272; Plants - 53; Viruses - 63; Other Eukaryotes - 1978 (source: NCBI BLink).  | |
AT5G01300 | AT5G01300.1 | TTTAGGCCCAATAAAGCCCAATAT | phosphatidylethanolamine-binding family protein; FUNCTIONS IN: phosphatidylethanolamine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: YbhB and YbcL (InterPro:IPR005247), Phosphatidylethanolamine-binding protein PEBP (InterPro:IPR008914); Has 1569 Blast hits to 1569 proteins in 571 species: Archae - 85; Bacteria - 1347; Metazoa - 0; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT5G01300.2 | TTTAGGCCCAATAAAGCCCAATAT | phosphatidylethanolamine-binding family protein; FUNCTIONS IN: phosphatidylethanolamine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: YbhB and YbcL (InterPro:IPR005247), Phosphatidylethanolamine-binding protein PEBP (InterPro:IPR008914); Has 1569 Blast hits to 1569 proteins in 571 species: Archae - 85; Bacteria - 1347; Metazoa - 0; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  | |
AT5G01910 | AT5G01910.1 | GTGGCCCAATATAGCCCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages; Has 47 Blast hits to 47 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT5G01910.1 | GTGGCCCAATATAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages; Has 47 Blast hits to 47 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT5G01910.2 | GTGGCCCAATATAGCCCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages; Has 47 Blast hits to 47 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT5G01910.2 | GTGGCCCAATATAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages; Has 47 Blast hits to 47 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT5G01920 | AT5G01920.1 | ATTGGGCTATATTGGGCCAC | Chloroplast thylakoid protein kinase STN8 is specific in phosphorylation of N-terminal threonine residues in D1, D2 and CP43 proteins, and Thr-4 in PsbH protein of photosystem II. Phosphorylation of Thr-4 in the wild type required both light and prior phosphorylation at Thr-2.  |
AT5G01920.1 | TTATTGGGCTATATTGGGCCAC | Chloroplast thylakoid protein kinase STN8 is specific in phosphorylation of N-terminal threonine residues in D1, D2 and CP43 proteins, and Thr-4 in PsbH protein of photosystem II. Phosphorylation of Thr-4 in the wild type required both light and prior phosphorylation at Thr-2.  | |
AT5G02610 | AT5G02610.1 | CTATTGGGCTATT | 60S ribosomal protein L35 (RPL35D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 840 Blast hits to 840 proteins in 308 species: Archae - 109; Bacteria - 145; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink).  |
AT5G03770 | AT5G03770.1 | TTATTGGGCTCA | 3-deoxy-D-manno-octulosonic acid transferase-related; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process, carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Three-deoxy-D-manno-octulosonic-acid transferase, N-terminal (InterPro:IPR007507); Has 3832 Blast hits to 3832 proteins in 736 species: Archae - 0; Bacteria - 1449; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 2371 (source: NCBI BLink).  |
AT5G04130 | AT5G04130.1 | CTATTGGGCT | DNA topoisomerase, ATP-hydrolyzing, putative / DNA topoisomerase II, putative / DNA gyrase, putative; FUNCTIONS IN: DNA topoisomerase (ATP-hydrolyzing) activity, DNA binding, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IIA, conserved site (InterPro:IPR018522), DNA topoisomerase, type IIA, subunit B, region 2 (InterPro:IPR013506), DNA topoisomerase, type IIA, subunit B (InterPro:IPR000565), ATP-binding region, ATPase-like (InterPro:IPR003594), DNA topoisomerase, type IIA, subunit B, C-terminal (InterPro:IPR002288), DNA topoisomerase, type IIA, subunit B or N-terminal (InterPro:IPR001241), DNA topoisomerase, type IIA, subunit B or N-terminal, alpha-beta (InterPro:IPR013759), TOPRIM (InterPro:IPR006171), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), DNA topoisomerase, type IIA, central (InterPro:IPR013760); BEST Arabidopsis thaliana protein match is: ATP binding / DNA binding / DNA topoisomerase (ATP-hydrolyzing) (TAIR:AT3G10270.1); Has 23506 Blast hits to 21729 proteins in 4482 species: Archae - 75; Bacteria - 14076; Metazoa - 167; Fungi - 179; Plants - 62; Viruses - 72; Other Eukaryotes - 8875 (source: NCBI BLink).  |
AT5G04130.2 | CTATTGGGCT | DNA topoisomerase, ATP-hydrolyzing, putative / DNA topoisomerase II, putative / DNA gyrase, putative; FUNCTIONS IN: DNA topoisomerase (ATP-hydrolyzing) activity, DNA binding, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IIA, conserved site (InterPro:IPR018522), DNA topoisomerase, type IIA, subunit B, region 2 (InterPro:IPR013506), DNA topoisomerase, type IIA, subunit B (InterPro:IPR000565), ATP-binding region, ATPase-like (InterPro:IPR003594), DNA topoisomerase, type IIA, subunit B, C-terminal (InterPro:IPR002288), DNA topoisomerase, type IIA, subunit B or N-terminal (InterPro:IPR001241), DNA topoisomerase, type IIA, subunit B or N-terminal, alpha-beta (InterPro:IPR013759), TOPRIM (InterPro:IPR006171), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), DNA topoisomerase, type IIA, central (InterPro:IPR013760); BEST Arabidopsis thaliana protein match is: ATP binding / DNA binding / DNA topoisomerase (ATP-hydrolyzing) (TAIR:AT3G10270.1); Has 23506 Blast hits to 21729 proteins in 4482 species: Archae - 75; Bacteria - 14076; Metazoa - 167; Fungi - 179; Plants - 62; Viruses - 72; Other Eukaryotes - 8875 (source: NCBI BLink).  | |
AT5G04270 | AT5G04270.1 | ATAAGCCCAATAA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G09320.1); Has 3947 Blast hits to 3944 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1934; Fungi - 520; Plants - 397; Viruses - 0; Other Eukaryotes - 1096 (source: NCBI BLink).  |
AT5G04270.1 | CAAGCCCAATT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G09320.1); Has 3947 Blast hits to 3944 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1934; Fungi - 520; Plants - 397; Viruses - 0; Other Eukaryotes - 1096 (source: NCBI BLink).  | |
AT5G04750 | AT5G04750.1 | CTATTGGGCTATT | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G04750.2 | CTATTGGGCTATT | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G05000 | AT5G05000.1 | CTTATTGGGCTTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast.  |
AT5G05000.2 | CTTATTGGGCTTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast.  | |
AT5G05000.3 | CTTATTGGGCTTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast.  | |
AT5G05010 | AT5G05010.1 | AAAGCCCAATAAG | clathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  |
AT5G05010.2 | AAAGCCCAATAAG | clathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  | |
AT5G05310 | AT5G05310.1 | GATGGGCCATTATTGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).  |
AT5G05310.2 | GATGGGCCATTATTGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).  | |
AT5G05310.3 | GATGGGCCATTATTGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).  | |
AT5G05370 | AT5G05370.1 | CATTGGGCTTA | ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT3G10860.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G05380 | AT5G05380.1 | TAAGCCCAATG | PRENYLATED RAB ACCEPTOR 1.B3 (PRA1.B3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 371 Blast hits to 371 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 59; Plants - 178; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).  |
AT5G05780 | AT5G05780.1 | TCAGGCCCATCATATTGGGCTTA | Encodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity.  |
AT5G05800 | AT5G05800.1 | TTATTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11290.1); Has 434 Blast hits to 262 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 26; Plants - 408; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G05800.2 | TTATTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11290.1); Has 434 Blast hits to 262 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 26; Plants - 408; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G06340 | AT5G06340.1 | TAATTGGGCTTTTA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27 (ATNUDX27); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 3191 Blast hits to 3191 proteins in 724 species: Archae - 2; Bacteria - 1483; Metazoa - 9; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1660 (source: NCBI BLink).  |
AT5G07090 | AT5G07090.1 | ATAAGCCCAATAA | 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).  |
AT5G07090.2 | ATAAGCCCAATAA | 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).  | |
AT5G07120 | AT5G07120.1 | ATATTGGGCTGGGCTGGGC | SORTING NEXIN 2b (SNX2b); FUNCTIONS IN: protein binding, phosphoinositide binding; INVOLVED IN: intracellular signaling cascade, cell communication; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2a (SORTING NEXIN 2a); phosphoinositide binding (TAIR:AT5G58440.1); Has 1877 Blast hits to 1867 proteins in 192 species: Archae - 11; Bacteria - 46; Metazoa - 1184; Fungi - 380; Plants - 83; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink).  |
AT5G07770 | AT5G07770.1 | CGGCCCATTGGGCTTC | formin homology 2 domain-containing protein / FH2 domain-containing protein; FUNCTIONS IN: actin binding; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Actin-binding FH2 (InterPro:IPR015425); BEST Arabidopsis thaliana protein match is: formin homology 2 domain-containing protein / FH2 domain-containing protein (TAIR:AT5G07780.1); Has 30202 Blast hits to 12248 proteins in 656 species: Archae - 50; Bacteria - 2578; Metazoa - 12793; Fungi - 3250; Plants - 6039; Viruses - 1524; Other Eukaryotes - 3968 (source: NCBI BLink).  |
AT5G08415 | AT5G08415.1 | TATTGGGCT | lipoic acid synthase family protein; FUNCTIONS IN: lipoic acid synthase activity, iron-sulfur cluster binding, lipoate synthase activity, catalytic activity; INVOLVED IN: lipoic acid biosynthetic process, lipoate biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Lipoate synthase (InterPro:IPR003698), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Radical SAM (InterPro:IPR007197); BEST Arabidopsis thaliana protein match is: LIP1 (LIPOIC ACID SYNTHASE 1); lipoic acid synthase (TAIR:AT2G20860.1); Has 5746 Blast hits to 5746 proteins in 1192 species: Archae - 36; Bacteria - 2422; Metazoa - 113; Fungi - 91; Plants - 53; Viruses - 0; Other Eukaryotes - 3031 (source: NCBI BLink).  |
AT5G08420 | AT5G08420.1 | AGCCCAATA | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); Has 2056 Blast hits to 1575 proteins in 229 species: Archae - 85; Bacteria - 30; Metazoa - 600; Fungi - 242; Plants - 75; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink).  |
AT5G10110 | AT5G10110.1 | CTATTGGGCTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65120.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G10690 | AT5G10690.1 | ATATTGGGCTTTAA | pentatricopeptide (PPR) repeat-containing protein / CBS domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G12775.1); Has 9217 Blast hits to 4059 proteins in 145 species: Archae - 2; Bacteria - 6; Metazoa - 124; Fungi - 115; Plants - 8658; Viruses - 0; Other Eukaryotes - 312 (source: NCBI BLink).  |
AT5G10695 | AT5G10695.1 | TTAAAGCCCAATAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G10730 | AT5G10730.1 | ATAAGCCCAATTA | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: dehydrogenase-related (TAIR:AT5G15910.1); Has 2817 Blast hits to 2817 proteins in 746 species: Archae - 59; Bacteria - 1671; Metazoa - 115; Fungi - 146; Plants - 119; Viruses - 0; Other Eukaryotes - 707 (source: NCBI BLink).  |
AT5G10740 | AT5G10740.1 | AATAGGCCCATTAGCCCAATTG | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT5G24940.1); Has 5631 Blast hits to 5529 proteins in 624 species: Archae - 9; Bacteria - 1045; Metazoa - 1489; Fungi - 552; Plants - 1360; Viruses - 11; Other Eukaryotes - 1165 (source: NCBI BLink).  |
AT5G10745 | AT5G10745.1 | CAATTGGGCTAATGGGCCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G11330 | AT5G11330.1 | ATTGGGCTTG | monooxygenase family protein; FUNCTIONS IN: oxidoreductase activity, monooxygenase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938); BEST Arabidopsis thaliana protein match is: CTF2B; monooxygenase/ oxidoreductase (TAIR:AT2G29720.1); Has 2280 Blast hits to 2280 proteins in 460 species: Archae - 2; Bacteria - 1124; Metazoa - 4; Fungi - 594; Plants - 114; Viruses - 0; Other Eukaryotes - 442 (source: NCBI BLink).  |
AT5G11340 | AT5G11340.1 | CAAGCCCAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT5G16800.2); Has 2784 Blast hits to 2784 proteins in 681 species: Archae - 121; Bacteria - 1284; Metazoa - 435; Fungi - 175; Plants - 77; Viruses - 0; Other Eukaryotes - 692 (source: NCBI BLink).  |
AT5G12290 | AT5G12290.1 | TACTGGGCCCATTAAAAGCCCAATAAG | Encodes a mitochondrial outer membrane protein, involved in galactoglycerolipid biosynthesis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background.  |
AT5G12410 | AT5G12410.1 | CAAGCCCAATAGGCCCATTC | THUMP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: THUMP (InterPro:IPR004114); Has 2926 Blast hits to 1988 proteins in 205 species: Archae - 10; Bacteria - 67; Metazoa - 1296; Fungi - 226; Plants - 118; Viruses - 74; Other Eukaryotes - 1135 (source: NCBI BLink).  |
AT5G13070 | AT5G13070.1 | TTAAAGCCCAATAA | MSF1-like family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PRELI/MSF1 (InterPro:IPR006797); Has 651 Blast hits to 651 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 458; Fungi - 150; Plants - 18; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
AT5G13190 | AT5G13190.1 | ATTAGGCCTTTTGAGCCCAATAT | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: LPS-induced tumor necrosis factor alpha factor (InterPro:IPR006629); Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G13370 | AT5G13370.1 | AAAAGCCCAATAA | auxin-responsive GH3 family protein; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); BEST Arabidopsis thaliana protein match is: auxin-responsive GH3 family protein (TAIR:AT5G13360.2); Has 819 Blast hits to 760 proteins in 112 species: Archae - 0; Bacteria - 241; Metazoa - 51; Fungi - 2; Plants - 219; Viruses - 0; Other Eukaryotes - 306 (source: NCBI BLink).  |
AT5G13450 | AT5G13450.1 | ATAAGCCCAATAA | ATP synthase delta chain, mitochondrial, putative / H(+)-transporting two-sector ATPase, delta (OSCP) subunit, putative; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: mitochondrion, chloroplast, plasma membrane, membrane, mitochondrial proton-transporting ATP synthase complex, catalytic core F(1); EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); BEST Arabidopsis thaliana protein match is: ATPD (ATP SYNTHASE DELTA-SUBUNIT GENE); hydrogen ion transporting ATP synthase, rotational mechanism / proton-transporting ATPase, rotational mechanism (TAIR:AT4G09650.1); Has 3881 Blast hits to 3881 proteins in 1167 species: Archae - 0; Bacteria - 1909; Metazoa - 184; Fungi - 93; Plants - 120; Viruses - 0; Other Eukaryotes - 1575 (source: NCBI BLink).  |
AT5G13450.1 | GAAGCCCAATG | ATP synthase delta chain, mitochondrial, putative / H(+)-transporting two-sector ATPase, delta (OSCP) subunit, putative; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: mitochondrion, chloroplast, plasma membrane, membrane, mitochondrial proton-transporting ATP synthase complex, catalytic core F(1); EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); BEST Arabidopsis thaliana protein match is: ATPD (ATP SYNTHASE DELTA-SUBUNIT GENE); hydrogen ion transporting ATP synthase, rotational mechanism / proton-transporting ATPase, rotational mechanism (TAIR:AT4G09650.1); Has 3881 Blast hits to 3881 proteins in 1167 species: Archae - 0; Bacteria - 1909; Metazoa - 184; Fungi - 93; Plants - 120; Viruses - 0; Other Eukaryotes - 1575 (source: NCBI BLink).  | |
AT5G13450.2 | ATAAGCCCAATAA | ATP synthase delta chain, mitochondrial, putative / H(+)-transporting two-sector ATPase, delta (OSCP) subunit, putative; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: mitochondrion, chloroplast, plasma membrane, membrane, mitochondrial proton-transporting ATP synthase complex, catalytic core F(1); EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); BEST Arabidopsis thaliana protein match is: ATPD (ATP SYNTHASE DELTA-SUBUNIT GENE); hydrogen ion transporting ATP synthase, rotational mechanism / proton-transporting ATPase, rotational mechanism (TAIR:AT4G09650.1); Has 3881 Blast hits to 3881 proteins in 1167 species: Archae - 0; Bacteria - 1909; Metazoa - 184; Fungi - 93; Plants - 120; Viruses - 0; Other Eukaryotes - 1575 (source: NCBI BLink).  | |
AT5G13450.2 | GAAGCCCAATG | ATP synthase delta chain, mitochondrial, putative / H(+)-transporting two-sector ATPase, delta (OSCP) subunit, putative; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: mitochondrion, chloroplast, plasma membrane, membrane, mitochondrial proton-transporting ATP synthase complex, catalytic core F(1); EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); BEST Arabidopsis thaliana protein match is: ATPD (ATP SYNTHASE DELTA-SUBUNIT GENE); hydrogen ion transporting ATP synthase, rotational mechanism / proton-transporting ATPase, rotational mechanism (TAIR:AT4G09650.1); Has 3881 Blast hits to 3881 proteins in 1167 species: Archae - 0; Bacteria - 1909; Metazoa - 184; Fungi - 93; Plants - 120; Viruses - 0; Other Eukaryotes - 1575 (source: NCBI BLink).  | |
AT5G13700 | AT5G13700.1 | TTATTGGGCTTTA | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants).  |
AT5G13970 | AT5G13970.1 | ATAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13310.1); Has 608 Blast hits to 543 proteins in 119 species: Archae - 2; Bacteria - 47; Metazoa - 119; Fungi - 63; Plants - 38; Viruses - 17; Other Eukaryotes - 322 (source: NCBI BLink).  |
AT5G14100 | AT5G14100.1 | AAAAGCCCAATTAAGGCCCATTC | member of NAP subfamily  |
AT5G14430 | AT5G14430.1 | ATAAAGCCCAATAAG | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT5G14430.1 | ATAAAGCCCAATAT | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  | |
AT5G14430.2 | ATAAAGCCCAATAAG | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  | |
AT5G14430.2 | ATAAAGCCCAATAT | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  | |
AT5G14440 | AT5G14440.1 | TTATTGGGCTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink).  |
AT5G14440.2 | TTATTGGGCTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink).  | |
AT5G14610 | AT5G14610.1 | TAAGCCCAATAAG | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding / protein binding; FUNCTIONS IN: protein binding, helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), WW/Rsp5/WWP (InterPro:IPR001202), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DRH1 (DEAD BOX RNA HELICASE 1); ATP-dependent RNA helicase/ ATPase (TAIR:AT3G01540.4); Has 52477 Blast hits to 39251 proteins in 1971 species: Archae - 612; Bacteria - 22224; Metazoa - 10881; Fungi - 4675; Plants - 4189; Viruses - 260; Other Eukaryotes - 9636 (source: NCBI BLink).  |
AT5G15260 | AT5G15260.1 | AATTGGGCTTC | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT3G01170.1); Has 39 Blast hits to 39 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G15320 | AT5G15320.1 | AGAGGCCCATTTAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G15320.2 | AGAGGCCCATTTAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G15700 | AT5G15700.1 | TAATTGGGCTC | DNA-directed RNA polymerase (RPOT2); FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: DNA-directed RNA polymerase, bacteriophage type (InterPro:IPR002092); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase, mitochondrial (RPOMT) (TAIR:AT1G68990.1); Has 1079 Blast hits to 1064 proteins in 245 species: Archae - 0; Bacteria - 22; Metazoa - 122; Fungi - 163; Plants - 126; Viruses - 102; Other Eukaryotes - 544 (source: NCBI BLink).  |
AT5G16550 | AT5G16550.1 | CAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT5G17060 | AT5G17060.1 | AATTGGGCT | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster), other ARFs and ARF-like proteins.  |
AT5G17510 | AT5G17510.1 | TAAAAGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03460.1); Has 22577 Blast hits to 10768 proteins in 507 species: Archae - 4; Bacteria - 485; Metazoa - 8864; Fungi - 2539; Plants - 1455; Viruses - 66; Other Eukaryotes - 9164 (source: NCBI BLink).  |
AT5G17900 | AT5G17900.1 | ATAGGCCCATGAAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink).  |
AT5G18140 | AT5G18140.1 | CAAGCCCAATAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G22360.1); Has 15420 Blast hits to 15415 proteins in 1898 species: Archae - 116; Bacteria - 5110; Metazoa - 3216; Fungi - 1289; Plants - 1204; Viruses - 8; Other Eukaryotes - 4477 (source: NCBI BLink).  |
AT5G20850 | AT5G20850.1 | GCCTTTAAAGCCCAATAT | Encodes a homolog of yeast RAD51. Its mRNA is most abundant in early flower buds and is expressed at high levels in exponentially growing cells in suspension cultures and is induced in response to gamma radiation.  |
AT5G20900 | AT5G20900.1 | GAGCCCAATG | JASMONATE-ZIM-DOMAIN PROTEIN 12 (JAZ12); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399), CCT domain-like (InterPro:IPR018467); BEST Arabidopsis thaliana protein match is: JAZ11 (JASMONATE-ZIM-DOMAIN PROTEIN 11) (TAIR:AT3G43440.1); Has 247 Blast hits to 242 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 245; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G21280 | AT5G21280.1 | AATTGGGCT | hydroxyproline-rich glycoprotein family protein; Has 6155 Blast hits to 3771 proteins in 331 species: Archae - 6; Bacteria - 473; Metazoa - 2380; Fungi - 745; Plants - 1401; Viruses - 261; Other Eukaryotes - 889 (source: NCBI BLink).  |
AT5G22875 | AT5G22875.1 | AGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G22875.1 | TTAGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT5G22875.2 | AGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT5G22875.2 | TTAGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT5G23395 | AT5G23395.1 | CAAGCCCAATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); Has 224 Blast hits to 224 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 94; Plants - 20; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G23550 | AT5G23550.1 | CAATTGGGCTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SFT2-like (InterPro:IPR011691); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24170.1); Has 455 Blast hits to 455 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 96; Plants - 62; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  |
AT5G23900 | AT5G23900.1 | ATAAGCCCAATAA | 60S ribosomal protein L13 (RPL13D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13e, conserved site (InterPro:IPR018256), Ribosomal protein L13e (InterPro:IPR001380); BEST Arabidopsis thaliana protein match is: ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1); structural constituent of ribosome (TAIR:AT3G49010.3); Has 546 Blast hits to 546 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 113; Plants - 98; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT5G24640 | AT5G24640.1 | TAAAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41730.1); Has 13 Blast hits to 13 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G24650 | AT5G24650.1 | TAAAAGCCCAATAT | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, plasma membrane, vacuole, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT3G49560.1); Has 132 Blast hits to 130 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT5G24760 | AT5G24760.1 | AAAAAGCCCAATAA | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink).  |
AT5G24760.2 | AAAAAGCCCAATAA | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink).  | |
AT5G24760.3 | AAAAAGCCCAATAA | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink).  | |
AT5G25630 | AT5G25630.1 | TAATTGGGCT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G21222.1); Has 19068 Blast hits to 5732 proteins in 184 species: Archae - 3; Bacteria - 21; Metazoa - 595; Fungi - 399; Plants - 17210; Viruses - 0; Other Eukaryotes - 840 (source: NCBI BLink).  |
AT5G26742 | AT5G26742.1 | AGCCCAATAACGGCCCACTA | embryo defective 1138 (emb1138); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), GUCT (InterPro:IPR012562), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, CCHC-type (InterPro:IPR001878), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: PMH2 (putative mitochondrial RNA helicase 2); ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT3G22330.1); Has 41664 Blast hits to 39827 proteins in 1977 species: Archae - 837; Bacteria - 17695; Metazoa - 6892; Fungi - 3987; Plants - 1854; Viruses - 126; Other Eukaryotes - 10273 (source: NCBI BLink).  |
AT5G26742.2 | AGCCCAATAACGGCCCACTA | embryo defective 1138 (emb1138); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), GUCT (InterPro:IPR012562), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, CCHC-type (InterPro:IPR001878), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: PMH2 (putative mitochondrial RNA helicase 2); ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT3G22330.1); Has 41664 Blast hits to 39827 proteins in 1977 species: Archae - 837; Bacteria - 17695; Metazoa - 6892; Fungi - 3987; Plants - 1854; Viruses - 126; Other Eukaryotes - 10273 (source: NCBI BLink).  | |
AT5G27395 | AT5G27395.1 | TTAGCCCAATTG | P-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim44 (InterPro:IPR007379); Has 247 Blast hits to 247 proteins in 89 species: Archae - 0; Bacteria - 90; Metazoa - 76; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT5G27395.2 | TTAGCCCAATTG | P-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim44 (InterPro:IPR007379); Has 247 Blast hits to 247 proteins in 89 species: Archae - 0; Bacteria - 90; Metazoa - 76; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  | |
AT5G27640 | AT5G27640.1 | AATTGGGCTTACCCGGCCCATATA | encodes a member of eukaryotic translation initiation factor 3B family.  |
AT5G27640.2 | AATTGGGCTTACCCGGCCCATATA | encodes a member of eukaryotic translation initiation factor 3B family.  | |
AT5G27650 | AT5G27650.1 | TATATGGGCCGGGTAAGCCCAATT | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G05430.1); Has 6970 Blast hits to 4442 proteins in 299 species: Archae - 10; Bacteria - 363; Metazoa - 3592; Fungi - 627; Plants - 302; Viruses - 141; Other Eukaryotes - 1935 (source: NCBI BLink).  |
AT5G35400 | AT5G35400.1 | ATATTGGGCTC | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 4676 Blast hits to 4649 proteins in 1359 species: Archae - 66; Bacteria - 2736; Metazoa - 98; Fungi - 50; Plants - 81; Viruses - 0; Other Eukaryotes - 1645 (source: NCBI BLink).  |
AT5G38040 | AT5G38040.1 | GAGCCCAAT | UDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, stem, embryo, sepal, seed; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT5G38010.1); Has 4566 Blast hits to 4539 proteins in 305 species: Archae - 0; Bacteria - 130; Metazoa - 1639; Fungi - 14; Plants - 2694; Viruses - 70; Other Eukaryotes - 19 (source: NCBI BLink).  |
AT5G39250 | AT5G39250.1 | TAATTGGGCTTCTATATGGGCTAAGGCCTTTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G39850 | AT5G39850.1 | AAAAAGCCCAATGGGCCAA | 40S ribosomal protein S9 (RPS9C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9B) (TAIR:AT5G15200.1); Has 5400 Blast hits to 5397 proteins in 2680 species: Archae - 171; Bacteria - 348; Metazoa - 335; Fungi - 191; Plants - 3457; Viruses - 0; Other Eukaryotes - 898 (source: NCBI BLink).  |
AT5G40200 | AT5G40200.1 | GAAGCCCAATAT | Encodes a putative DegP protease.  |
AT5G40770 | AT5G40770.1 | ATATTGGGCTAA | prohibitin 3  |
AT5G40770.1 | TCAGCCCAATG | prohibitin 3  | |
AT5G42790 | AT5G42790.1 | TTAGCCCAATAAG | encodes a protein with extensive homology to the largest subunit of the multicatalytic proteinase complex (proteasome)  |
AT5G43260 | AT5G43260.1 | AGCCCAATAA | chaperone protein dnaJ-related; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 66 Blast hits to 65 proteins in 21 species: Archae - 0; Bacteria - 15; Metazoa - 2; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT5G43750 | AT5G43750.1 | AATTGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G43970 | AT5G43970.1 | TAATTGGGCTTTTATGGCCCAAT | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.  |
AT5G44430 | AT5G44430.1 | AAAGCCCAATTG | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.  |
AT5G44440 | AT5G44440.1 | AGCCCAATT | FAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, petal, sepal, flower, pedicel; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT5G44410.1); Has 3215 Blast hits to 3107 proteins in 522 species: Archae - 13; Bacteria - 1477; Metazoa - 1; Fungi - 1131; Plants - 356; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).  |
AT5G45680 | AT5G45680.1 | GAAGCCCAATT | FK506-binding protein 1 (FKBP13); FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative (TAIR:AT4G39710.1); Has 6942 Blast hits to 6551 proteins in 1120 species: Archae - 86; Bacteria - 3279; Metazoa - 1434; Fungi - 355; Plants - 420; Viruses - 0; Other Eukaryotes - 1368 (source: NCBI BLink).  |
AT5G46840 | AT5G46840.2 | TCAGCCCAATG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink).  |
AT5G46840.2 | TTAAAGCCCAATG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink).  | |
AT5G47320 | AT5G47320.1 | CTTATTGGGCT | Nuclear encoded mitochondrial ribosome subunit.  |
AT5G47630 | AT5G47630.1 | TTAAAGCCCAATAA | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis.  |
AT5G47630.2 | TTAAAGCCCAATAA | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis.  | |
AT5G47700 | AT5G47700.1 | CAAAGCCCAATAA | 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink).  |
AT5G47700.2 | CAAAGCCCAATAA | 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink).  | |
AT5G47860 | AT5G47860.1 | GAAGCCCAATTA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1350 (InterPro:IPR010765); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43540.1); Has 289 Blast hits to 289 proteins in 66 species: Archae - 0; Bacteria - 111; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink).  |
AT5G49200 | AT5G49200.1 | TAAGCCCAATAG | WD-40 repeat family protein / zfwd4 protein (ZFWD4); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / zfwd3 protein (ZFWD3) (TAIR:AT5G40880.1); Has 25041 Blast hits to 14412 proteins in 471 species: Archae - 20; Bacteria - 3252; Metazoa - 10699; Fungi - 5302; Plants - 2300; Viruses - 0; Other Eukaryotes - 3468 (source: NCBI BLink).  |
AT5G49220 | AT5G49220.1 | AAAAAGCCCAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF789 (InterPro:IPR008507); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16100.1); Has 150 Blast hits to 150 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G49930 | AT5G49930.1 | ATATTGGGCTTATAGGCCC | embryo defective 1441 (emb1441); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Fibronectin-binding A, N-terminal (InterPro:IPR008616), Zinc finger, CCHC-type (InterPro:IPR001878), Protein of unknown function DUF814 (InterPro:IPR008532); Has 2906 Blast hits to 2454 proteins in 381 species: Archae - 144; Bacteria - 336; Metazoa - 995; Fungi - 294; Plants - 92; Viruses - 7; Other Eukaryotes - 1038 (source: NCBI BLink).  |
AT5G51940 | AT5G51940.1 | TGTGGGCCTAAATTGGGCTTG | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At2g04630.  |
AT5G52070 | AT5G52070.1 | AGCCCAATAG | agenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT5G42670.1); Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G52990 | AT5G52990.1 | CTATTGGGCT | vesicle-associated membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27840.1); Has 89 Blast hits to 89 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G53400 | AT5G53400.1 | GTTGGGCCTTATTGGGCTC | nuclear movement family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: nuclear movement family protein (TAIR:AT4G27890.1); Has 1930 Blast hits to 1478 proteins in 221 species: Archae - 7; Bacteria - 113; Metazoa - 767; Fungi - 136; Plants - 100; Viruses - 4; Other Eukaryotes - 803 (source: NCBI BLink).  |
AT5G53540 | AT5G53540.1 | AATTGGGCTTT | MSP1 protein, putative / intramitochondrial sorting protein, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: MSP1 protein, putative / intramitochondrial sorting protein, putative (TAIR:AT4G27680.1); Has 21950 Blast hits to 20239 proteins in 1757 species: Archae - 878; Bacteria - 6604; Metazoa - 4050; Fungi - 2359; Plants - 1467; Viruses - 23; Other Eukaryotes - 6569 (source: NCBI BLink).  |
AT5G53560 | AT5G53560.1 | CAAAGCCCAATT | Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase.  |
AT5G53620 | AT5G53620.1 | TCAGCCCAATAGGCCCAACA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).  |
AT5G53620.1 | TCAGCCCAATAGGCCCGT | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).  | |
AT5G53620.2 | TCAGCCCAATAGGCCCAACA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).  | |
AT5G53620.2 | TCAGCCCAATAGGCCCGT | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).  | |
AT5G53620.3 | TCAGCCCAATAGGCCCAACA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).  | |
AT5G53620.3 | TCAGCCCAATAGGCCCGT | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).  | |
AT5G54080 | AT5G54080.1 | CAAGCCCAATAG | homogentisate 1,2-dioxygenase  |
AT5G54080.2 | CAAGCCCAATAG | homogentisate 1,2-dioxygenase  | |
AT5G55000 | AT5G55000.1 | AATTGGGCTTTTA | FH protein interacting protein FIP2  |
AT5G55000.1 | TATTGGGCTTTAA | FH protein interacting protein FIP2  | |
AT5G55000.2 | AATTGGGCTTTTA | FH protein interacting protein FIP2  | |
AT5G55000.2 | TATTGGGCTTTAA | FH protein interacting protein FIP2  | |
AT5G56670 | AT5G56670.1 | ATAAAGCCCAATAG | 40S ribosomal protein S30 (RPS30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30B) (TAIR:AT4G29390.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT5G56670.1 | TATGGGCCCATAAAGCCCAATAT | 40S ribosomal protein S30 (RPS30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30B) (TAIR:AT4G29390.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  | |
AT5G56710 | AT5G56710.1 | AATAGGCCCATTAAAGCCCAAT | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  |
AT5G56710.2 | AATAGGCCCATTAAAGCCCAAT | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  | |
AT5G57120 | AT5G57120.1 | CATTGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif (InterPro:IPR006594), SRP40, C-terminal (InterPro:IPR007718); Has 90949 Blast hits to 45608 proteins in 1620 species: Archae - 300; Bacteria - 8281; Metazoa - 37603; Fungi - 8095; Plants - 3374; Viruses - 548; Other Eukaryotes - 32748 (source: NCBI BLink).  |
AT5G57120.1 | GCCCATTGGGCTCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif (InterPro:IPR006594), SRP40, C-terminal (InterPro:IPR007718); Has 90949 Blast hits to 45608 proteins in 1620 species: Archae - 300; Bacteria - 8281; Metazoa - 37603; Fungi - 8095; Plants - 3374; Viruses - 548; Other Eukaryotes - 32748 (source: NCBI BLink).  | |
AT5G57300 | AT5G57300.1 | TAAAAGCCCAATT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink).  |
AT5G57300.2 | TAAAAGCCCAATT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink).  | |
AT5G57460 | AT5G57460.1 | CTATTGGGCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to 121 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT5G57460.1 | TTATTGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to 121 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G57535 | AT5G57535.1 | ATTGGGCT | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).  |
AT5G57630 | AT5G57630.1 | AGCCCAATCCACGTAG | CBL-interacting protein kinase  |
AT5G57700 | AT5G57700.1 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
AT5G57700.2 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT5G57700.3 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT5G57700.4 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT5G57815 | AT5G57815.1 | TTTTGGGCCCATTAAAGCCCAATAAAATGGGCTA | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT5G57860 | AT5G57860.1 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT5G57860.2 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G57860.3 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G57860.4 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G58440 | AT5G58440.1 | ATATTGGGCTTT | SORTING NEXIN 2a (SNX2a); FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2b (SORTING NEXIN 2b); phosphoinositide binding / protein binding (TAIR:AT5G07120.1); Has 1775 Blast hits to 1763 proteins in 175 species: Archae - 7; Bacteria - 6; Metazoa - 1144; Fungi - 391; Plants - 81; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
AT5G58490 | AT5G58490.1 | AATTGGGCTTGGGCTTC | cinnamoyl-CoA reductase family; FUNCTIONS IN: 3-beta-hydroxy-delta5-steroid dehydrogenase activity, binding, cinnamoyl-CoA reductase activity, catalytic activity; INVOLVED IN: lignin biosynthetic process, steroid biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-beta hydroxysteroid dehydrogenase/isomerase (InterPro:IPR002225), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: cinnamoyl-CoA reductase family (TAIR:AT2G02400.1); Has 8253 Blast hits to 8243 proteins in 1158 species: Archae - 140; Bacteria - 2986; Metazoa - 418; Fungi - 574; Plants - 1442; Viruses - 7; Other Eukaryotes - 2686 (source: NCBI BLink).  |
AT5G58800 | AT5G58800.1 | TTATTGGGCTTG | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink).  |
AT5G58800.2 | TTATTGGGCTTG | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink).  | |
AT5G59560 | AT5G59560.1 | AGCCCAATA | Encodes a novel protein conserved in higher eukaryotes. Normal function of the protein is required for normal oscillator function during circadian rhythm. Mutant analyses also suggest a role in phytochrome B (phyB)-mediated light signaling.  |
AT5G59560.2 | AGCCCAATA | Encodes a novel protein conserved in higher eukaryotes. Normal function of the protein is required for normal oscillator function during circadian rhythm. Mutant analyses also suggest a role in phytochrome B (phyB)-mediated light signaling.  | |
AT5G60160 | AT5G60160.1 | CAATTGGGCTTTGTAATGGGCCAAT | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: response to cadmium ion, proteolysis; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G04710.1); Has 1278 Blast hits to 1277 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 41; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).  |
AT5G61450 | AT5G61450.1 | ATATTGGGCT | 2-phosphoglycerate kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; Has 393 Blast hits to 372 proteins in 106 species: Archae - 58; Bacteria - 24; Metazoa - 63; Fungi - 40; Plants - 52; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink).  |
AT5G62300 | AT5G62300.1 | TTATTGGGCTGA | 40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).  |
AT5G62300.2 | TTATTGGGCTGA | 40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).  | |
AT5G63280 | AT5G63280.1 | ATTGGGCCTAGCCCAGCCCAATAA | zinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT5G40710.1); Has 77 Blast hits to 75 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 44; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT5G63510 | AT5G63510.1 | CCGTTAAAAAGCCCAATAT | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex.  |
AT5G63520 | AT5G63520.1 | ATAAAGCCCAATG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FIST domain, N-terminal (InterPro:IPR013702); Has 96 Blast hits to 96 proteins in 46 species: Archae - 0; Bacteria - 72; Metazoa - 6; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT5G64270 | AT5G64270.1 | TAATTGGGCTTATGGGCTTTG | splicing factor, putative; FUNCTIONS IN: binding; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Splicing factor 3B subunit 1 (InterPro:IPR015016), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A regulator (TAIR:AT1G25490.1); Has 1441 Blast hits to 1324 proteins in 270 species: Archae - 12; Bacteria - 198; Metazoa - 607; Fungi - 267; Plants - 142; Viruses - 10; Other Eukaryotes - 205 (source: NCBI BLink).  |
AT5G64270.1 | TATTGGGCTTC | splicing factor, putative; FUNCTIONS IN: binding; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Splicing factor 3B subunit 1 (InterPro:IPR015016), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A regulator (TAIR:AT1G25490.1); Has 1441 Blast hits to 1324 proteins in 270 species: Archae - 12; Bacteria - 198; Metazoa - 607; Fungi - 267; Plants - 142; Viruses - 10; Other Eukaryotes - 205 (source: NCBI BLink).  | |
AT5G64370 | AT5G64370.1 | TAAAGCCCAATAA | PYD3 encodes a beta-ureidopropionase which, when expressed in E. coli, has been shown to convert beta-ureidopropionate into beta-alanine.  |
AT5G64650 | AT5G64650.1 | ATTGGGCTAA | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 5414 Blast hits to 5398 proteins in 1517 species: Archae - 0; Bacteria - 3033; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink).  |
AT5G64650.1 | TTATTGGGCT | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 5414 Blast hits to 5398 proteins in 1517 species: Archae - 0; Bacteria - 3033; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink).  | |
AT5G65750 | AT5G65750.1 | GTTGGGCCTAAAAGCCCAATAT | 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor, oxoglutarate dehydrogenase (succinyl-transferring) activity, thiamin pyrophosphate binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxoglutarate dehydrogenase, E1 component (InterPro:IPR011603), Dehydrogenase, E1 component (InterPro:IPR001017), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative (TAIR:AT3G55410.1); Has 8716 Blast hits to 8694 proteins in 1114 species: Archae - 2; Bacteria - 2389; Metazoa - 550; Fungi - 187; Plants - 68; Viruses - 0; Other Eukaryotes - 5520 (source: NCBI BLink).  |
AT5G65750.1 | TTTTGGGCCGATAAGCCCAATAT | 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor, oxoglutarate dehydrogenase (succinyl-transferring) activity, thiamin pyrophosphate binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxoglutarate dehydrogenase, E1 component (InterPro:IPR011603), Dehydrogenase, E1 component (InterPro:IPR001017), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative (TAIR:AT3G55410.1); Has 8716 Blast hits to 8694 proteins in 1114 species: Archae - 2; Bacteria - 2389; Metazoa - 550; Fungi - 187; Plants - 68; Viruses - 0; Other Eukaryotes - 5520 (source: NCBI BLink).  | |
AT5G65840 | AT5G65840.1 | AATTGGGCTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37240.1); Has 167 Blast hits to 165 proteins in 51 species: Archae - 0; Bacteria - 28; Metazoa - 51; Fungi - 13; Plants - 59; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT5G66080 | AT5G66080.1 | CAAAGCCCAATAAG | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51370.1); Has 3605 Blast hits to 3604 proteins in 217 species: Archae - 0; Bacteria - 11; Metazoa - 1260; Fungi - 366; Plants - 1225; Viruses - 5; Other Eukaryotes - 738 (source: NCBI BLink).  |
AT5G66090 | AT5G66090.1 | CTTATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G66280 | AT5G66280.1 | ATAAGCCCAATAA | GDP-D-mannose 4,6-dehydratase  |
AT5G66860 | AT5G66860.1 | TATGGGCCAATAAAAGCCCAATG | INVOLVED IN: translation; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035); BEST Arabidopsis thaliana protein match is: 50S ribosomal protein-related (TAIR:AT4G23620.1); Has 2346 Blast hits to 2345 proteins in 433 species: Archae - 0; Bacteria - 930; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 1375 (source: NCBI BLink).  |
AT5G66930 | AT5G66930.1 | GAAGCCCAATAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445).  |
AT5G66930.2 | GAAGCCCAATAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445).  |