| Locus | Gene model | Sequence | Description |
| AT1G04950 | AT1G04950.1 | CCCGGCCC | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G04950.2 | CCCGGCCC | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G04950.3 | CCCGGCCC | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G07440 | AT1G07440.1 | CCCGGCCCATCA | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G29340.2); Has 82964 Blast hits to 82757 proteins in 2203 species: Archae - 469; Bacteria - 45784; Metazoa - 4525; Fungi - 4011; Plants - 1547; Viruses - 5; Other Eukaryotes - 26623 (source: NCBI BLink). |
| AT1G07440.2 | CCCGGCCCATCA | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G29340.2); Has 82964 Blast hits to 82757 proteins in 2203 species: Archae - 469; Bacteria - 45784; Metazoa - 4525; Fungi - 4011; Plants - 1547; Viruses - 5; Other Eukaryotes - 26623 (source: NCBI BLink). |
| AT1G10050 | AT1G10050.1 | ACAGGCCCGGCCCATTTA | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT1G10585 | AT1G10585.1 | CCCGGCCC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: transcription regulator (TAIR:AT1G10586.1); Has 43 Blast hits to 43 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G12850 | AT1G12850.1 | GTTTGGGCCGGGTCG | phosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078), Uncharacterised conserved protein UCP036920, phosphoglycerate mutase, plant X4/Y4 (InterPro:IPR017070); BEST Arabidopsis thaliana protein match is: catalytic (TAIR:AT3G26780.1); Has 1266 Blast hits to 1214 proteins in 304 species: Archae - 4; Bacteria - 504; Metazoa - 376; Fungi - 31; Plants - 127; Viruses - 2; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT1G26370 | AT1G26370.1 | ACTGGGCCGGG | RNA helicase, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP-dependent RNA helicase, putative (TAIR:AT3G26560.1); Has 6916 Blast hits to 6404 proteins in 949 species: Archae - 2; Bacteria - 1916; Metazoa - 1973; Fungi - 797; Plants - 383; Viruses - 390; Other Eukaryotes - 1455 (source: NCBI BLink). |
| AT1G30110 | AT1G30110.1 | CCCGGCCCAATA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 25 (ATNUDX25); FUNCTIONS IN: bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: diadenosine tetraphosphate catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 4194 Blast hits to 4194 proteins in 805 species: Archae - 14; Bacteria - 2251; Metazoa - 23; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 1859 (source: NCBI BLink). |
| AT1G56110 | AT1G56110.1 | TGATGGGCCGGG | NOP56-like protein |
| AT1G70720 | AT1G70720.1 | TTCGGCCCGGCCCACTA | invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G23205.1); Has 428 Blast hits to 423 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 428; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G72710 | AT1G72710.1 | TCTGGGCCGGG | Encodes a member of the casein kinase 1 protein family that is localized to the cytoplasm and nucleus. |
| AT1G76940 | AT1G76940.1 | AACGGGCCGGG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT1G21320.2); Has 450 Blast hits to 448 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 247; Fungi - 119; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT2G16510 | AT2G16510.1 | TCGACCCGGCCCAAAA | vacuolar ATP synthase 16 kDa proteolipid subunit 5 / V-ATPase 16 kDa proteolipid subunit 5 (AVAP5); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: ATVHA-C3 (VACUOLAR-TYPE H(+)-ATPASE C3); ATPase (TAIR:AT4G38920.1); Has 1813 Blast hits to 1633 proteins in 398 species: Archae - 127; Bacteria - 309; Metazoa - 519; Fungi - 314; Plants - 224; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink). |
| AT2G17190 | AT2G17190.1 | GACCCGACCCGGCCCAAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17200.1); Has 8273 Blast hits to 4684 proteins in 635 species: Archae - 6; Bacteria - 189; Metazoa - 3590; Fungi - 1163; Plants - 1579; Viruses - 154; Other Eukaryotes - 1592 (source: NCBI BLink). |
| AT2G20300 | AT2G20300.1 | CCCGGCCCAATAAG | Encodes ABNORMAL LEAF SHAPE 2 (ALE2), a receptor-like protein kinase (RLK) with a cluster of basic amino acid residues followed by a cysteine-containing sequence in the putative extracellular domain. Function together with ACR4 (Arabidopsis homolog of the Crinkly4) and ALE1 in positively regulating protoderm-specific gene expression and for the formation of leafy organs. ale2 mutants have various epidermal defects, including disorganization of epidermis-related tissues, defects in the leaf cuticle and the fusion of organs. |
| AT2G21190 | AT2G21190.1 | CCCGGCCCATTTA | ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT4G38790.1); Has 626 Blast hits to 626 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 264; Fungi - 114; Plants - 120; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT2G32280 | AT2G32280.1 | CCCGGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21310.1); Has 99 Blast hits to 99 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 99; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G37550 | AT2G37550.1 | CCCGGCCC | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT2G37550.2 | CCCGGCCC | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT2G39930 | AT2G39930.1 | TTAAGGCCCGGCCCTAAAGCCCATTTA | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
| AT2G47970 | AT2G47970.1 | CGACCCGGCCC | NPL4 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NPL4 (InterPro:IPR007717); BEST Arabidopsis thaliana protein match is: NPL41 (NPL4-LIKE PROTEIN 1) (TAIR:AT3G63000.1); Has 289 Blast hits to 289 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 111; Fungi - 76; Plants - 36; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). |
| AT2G47970.2 | CGACCCGGCCC | NPL4 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NPL4 (InterPro:IPR007717); BEST Arabidopsis thaliana protein match is: NPL41 (NPL4-LIKE PROTEIN 1) (TAIR:AT3G63000.1); Has 289 Blast hits to 289 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 111; Fungi - 76; Plants - 36; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). |
| AT3G07440 | AT3G07440.1 | TTATTGGGCCGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48530.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G10270 | AT3G10270.1 | CCCGGCCC | Protein targeting to mitochondria is influenced by UTR sequences. |
| AT3G10270.1 | TTTGGGCCGGG | Protein targeting to mitochondria is influenced by UTR sequences. |
| AT3G10330 | AT3G10330.1 | TAGGGCTTCAAAACGTTGGGCCGGG | transcription initiation factor IIB-2 / general transcription factor TFIIB-2 (TFIIB2); FUNCTIONS IN: protein binding, RNA polymerase II transcription factor activity, transcription regulator activity, zinc ion binding, translation initiation factor activity; INVOLVED IN: translational initiation, regulation of transcription, DNA-dependent, transcription initiation, regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor TFIIB related (InterPro:IPR000812), Cyclin-like (InterPro:IPR011028), Transcription factor TFIIB, cyclin-related (InterPro:IPR013150), Cyclin-related (InterPro:IPR013763), Zinc finger, TFIIB-type (InterPro:IPR013137), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: TFIIB (TRANSCRIPTION FACTOR II B); RNA polymerase II transcription factor/ protein binding / transcription regulator/ translation initiation factor/ zinc ion binding (TAIR:AT2G41630.1); Has 1521 Blast hits to 1508 proteins in 255 species: Archae - 348; Bacteria - 0; Metazoa - 268; Fungi - 189; Plants - 107; Viruses - 10; Other Eukaryotes - 599 (source: NCBI BLink). |
| AT3G15351 | AT3G15351.1 | TAGTGGGCCGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15351.2 | TAGTGGGCCGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15351.3 | TAGTGGGCCGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G18100 | AT3G18100.1 | CCCGGCCCGTT | Member of the R2R3 transcription factor gene family. |
| AT3G18850 | AT3G18850.1 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.2 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.3 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.4 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.5 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18860 | AT3G18860.1 | CAATTGGGCCGGGCTTTGAAAGCCCAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink). |
| AT3G18860.2 | CAATTGGGCCGGGCTTTGAAAGCCCAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink). |
| AT3G19520 | AT3G19520.1 | CCCGGCCCTTGGGCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G19520.2 | CCCGGCCCTTGGGCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G56440 | AT3G56440.1 | GGGCCGGGTCGGGTCGGGTCG | AtATG18d; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18c (TAIR:AT2G40810.2); Has 1093 Blast hits to 1046 proteins in 176 species: Archae - 0; Bacteria - 24; Metazoa - 508; Fungi - 305; Plants - 110; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT3G57170 | AT3G57170.1 | AAAAGCCCGGCCCATA | N-acetylglucosaminyl transferase component family protein / Gpi1 family protein; FUNCTIONS IN: transferase activity, phosphatidylinositol N-acetylglucosaminyltransferase activity; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: N-acetylglucosaminyl transferase component (InterPro:IPR007720); Has 246 Blast hits to 246 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 84; Plants - 15; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT3G57330 | AT3G57330.1 | CCCGGCCC | autoinhibited Ca2+-ATPase 11 (ACA11); FUNCTIONS IN: calmodulin binding, calcium-transporting ATPase activity; INVOLVED IN: cation transport, calcium ion transport, metabolic process, ATP biosynthetic process; LOCATED IN: chloroplast, plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, ATPase-associated region (InterPro:IPR008250), ATPase, P-type, calcium-transporting, PMCA-type (InterPro:IPR006408), ATPase, P-type, H+ transporting proton pump (InterPro:IPR000695), ATPase, P-type cation-transporter, N-terminal (InterPro:IPR004014), Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type cation-transporter, C-terminal (InterPro:IPR006068), ATPase, P-type phosphorylation site (InterPro:IPR018303); BEST Arabidopsis thaliana protein match is: ACA4 (AUTO-INHIBITED CA(2+)-ATPASE, ISOFORM 4); calcium-transporting ATPase/ calmodulin binding (TAIR:AT2G41560.1); Has 25242 Blast hits to 19809 proteins in 1858 species: Archae - 502; Bacteria - 15238; Metazoa - 3407; Fungi - 1728; Plants - 1099; Viruses - 3; Other Eukaryotes - 3265 (source: NCBI BLink). |
| AT3G58270 | AT3G58270.1 | ACTGGGCCGGG | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT3G58270.2 | ACTGGGCCGGG | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT3G62080 | AT3G62080.1 | TTAATGGGCCGGGCCTAAT | SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink). |
| AT4G15010 | AT4G15010.1 | TCGACCCGGCCCGTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT4G15010.2 | TCGACCCGGCCCGTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT4G15010.3 | TCGACCCGGCCCGTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT4G15020 | AT4G15020.1 | AACGGGCCGGGTCGA | DNA binding / protein dimerization; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G22220.2); Has 326 Blast hits to 324 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 323; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G15020.2 | AACGGGCCGGGTCGA | DNA binding / protein dimerization; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G22220.2); Has 326 Blast hits to 324 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 323; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G17520 | AT4G17520.1 | TAACGGGCCCGGCCCAATAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT5G47210.1); Has 13357 Blast hits to 8375 proteins in 750 species: Archae - 13; Bacteria - 2605; Metazoa - 5274; Fungi - 1340; Plants - 1789; Viruses - 136; Other Eukaryotes - 2200 (source: NCBI BLink). |
| AT4G17640 | AT4G17640.1 | CATGGGCCGGG | Encodes casein kinase II beta (regulatory) subunit. |
| AT4G21100 | AT4G21100.1 | CAATTGGGCCGGGCCGAA | One of two closely related genes similar to a damaged DNA binding protein originally described in mammals. May form a complex with DET1 to regulate photomorphogenesis. Loss of function mutations are lethal. The DDB1b protein binds with a number of DWD-containing proteins and may form part of a CUL4-based E3 ubiquitin ligase. |
| AT4G21105 | AT4G21105.1 | TTCGGCCCGGCCCAATTG | cytochrome-c oxidase/ electron carrier; FUNCTIONS IN: electron carrier activity, cytochrome-c oxidase activity; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIIa (InterPro:IPR003177); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G21105.2 | TTCGGCCCGGCCCAATTG | cytochrome-c oxidase/ electron carrier; FUNCTIONS IN: electron carrier activity, cytochrome-c oxidase activity; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIIa (InterPro:IPR003177); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25550 | AT4G25550.1 | TTATGGGCCGGG | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cleavage and polyadenylation specificity factor, 25 kDa subunit (InterPro:IPR016706); BEST Arabidopsis thaliana protein match is: CFIM-25 (TAIR:AT4G29820.1); Has 291 Blast hits to 289 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 53; Plants - 42; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT4G26720 | AT4G26720.1 | TGTGGGCCGGGCCTTAT | Encodes catalytic subunit of protein phosphatase X. Expressed at very low levels in A. thaliana flowers, leaves, stems and roots. |
| AT4G28540 | AT4G28540.1 | AGTTGGGCCGGGCCTATT | CASEIN KINASE I-LIKE 6 (CKL6); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasmodesma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ADK1 (dual specificity kinase 1); kinase/ protein serine/threonine/tyrosine kinase (TAIR:AT1G03930.1); Has 46100 Blast hits to 45721 proteins in 1424 species: Archae - 12; Bacteria - 5612; Metazoa - 19980; Fungi - 4668; Plants - 5911; Viruses - 338; Other Eukaryotes - 9579 (source: NCBI BLink). |
| AT4G32660 | AT4G32660.1 | ATTTGGGCCGGG | Encodes protein kinase AME3. |
| AT4G32660.2 | ATTTGGGCCGGG | Encodes protein kinase AME3. |
| AT4G32660.3 | ATTTGGGCCGGG | Encodes protein kinase AME3. |
| AT4G35250 | AT4G35250.1 | CCCGGCCC | vestitone reductase-related; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: flavin reductase-related (TAIR:AT2G34460.1); Has 2853 Blast hits to 2853 proteins in 675 species: Archae - 20; Bacteria - 1994; Metazoa - 46; Fungi - 85; Plants - 272; Viruses - 0; Other Eukaryotes - 436 (source: NCBI BLink). |
| AT5G02770 | AT5G02770.1 | ATTTGGGCCGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 367 Blast hits to 255 proteins in 95 species: Archae - 0; Bacteria - 48; Metazoa - 197; Fungi - 19; Plants - 22; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink). |
| AT5G17520 | AT5G17520.1 | CCCGGCCCAAG | Encodes a maltose transporter that is expressed in leaves and roots. Mutations at the MEX1 locus cause accumulation of both starch and maltose in leaves, with maltose levels at least 40 times higher than that of wild-type. This gene encodes a protein located in the chloroplast envelope. |
| AT5G19310 | AT5G19310.1 | CCCGGCCCAAAA | homeotic gene regulator, putative; FUNCTIONS IN: helicase activity, DNA binding, ATP binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); BEST Arabidopsis thaliana protein match is: ATCHR12; ATP binding / DNA binding / helicase/ nucleic acid binding (TAIR:AT3G06010.1); Has 23543 Blast hits to 17298 proteins in 1325 species: Archae - 119; Bacteria - 3571; Metazoa - 8080; Fungi - 3584; Plants - 1110; Viruses - 211; Other Eukaryotes - 6868 (source: NCBI BLink). |
| AT5G20500 | AT5G20500.1 | AGATGGGCCGGGTTAAACCGT | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT1G77370.1); Has 4164 Blast hits to 4161 proteins in 811 species: Archae - 10; Bacteria - 1751; Metazoa - 378; Fungi - 232; Plants - 403; Viruses - 108; Other Eukaryotes - 1282 (source: NCBI BLink). |
| AT5G27460 | AT5G27460.1 | ATATGGGCCGGGTAAGCCCAACT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02150.1); Has 3781 Blast hits to 2103 proteins in 60 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 13; Plants - 3697; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G27470 | AT5G27470.1 | AGTTGGGCTTACCCGGCCCATAT | seryl-tRNA synthetase / serine--tRNA ligase; FUNCTIONS IN: serine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, seryl-tRNA aminoacylation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: tRNA-binding arm (InterPro:IPR010978), Seryl-tRNA synthetase, class IIa, N-terminal (InterPro:IPR015866), Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Seryl-tRNA synthetase, class IIa (InterPro:IPR002317), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Seryl-tRNA synthetase, class IIa, C-terminal (InterPro:IPR018156); BEST Arabidopsis thaliana protein match is: SRS (SERYL-TRNA SYNTHETASE); serine-tRNA ligase (TAIR:AT1G11870.2); Has 7169 Blast hits to 7168 proteins in 1635 species: Archae - 140; Bacteria - 3036; Metazoa - 295; Fungi - 180; Plants - 68; Viruses - 0; Other Eukaryotes - 3450 (source: NCBI BLink). |
| AT5G27640 | AT5G27640.1 | AATTGGGCTTACCCGGCCCATATA | encodes a member of eukaryotic translation initiation factor 3B family. |
| AT5G27640.2 | AATTGGGCTTACCCGGCCCATATA | encodes a member of eukaryotic translation initiation factor 3B family. |
| AT5G27650 | AT5G27650.1 | TATATGGGCCGGGTAAGCCCAATT | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G05430.1); Has 6970 Blast hits to 4442 proteins in 299 species: Archae - 10; Bacteria - 363; Metazoa - 3592; Fungi - 627; Plants - 302; Viruses - 141; Other Eukaryotes - 1935 (source: NCBI BLink). |
| AT5G39250 | AT5G39250.1 | CTAATGGGCTTTGGGCCGGGCCGTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G49270 | AT5G49270.1 | GTTTGGGCCGGG | Involved in successfully establishing tip growth in root hairs. |
| AT5G58005 | AT5G58005.1 | TTTTGGGCCGGGCCTAAATGGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 87 Blast hits to 87 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 28; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G58005.2 | TTTTGGGCCGGGCCTAAATGGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 87 Blast hits to 87 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 28; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G62930 | AT5G62930.1 | TAAAGGCCCGGCCCATAT | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Esterase, SGNH hydrolase-type, subgroup (InterPro:IPR013831), Lipase, GDSL (InterPro:IPR001087), Esterase, SGNH hydrolase-type (InterPro:IPR013830); BEST Arabidopsis thaliana protein match is: carboxylesterase/ hydrolase/ hydrolase, acting on ester bonds (TAIR:AT5G45920.1); Has 362 Blast hits to 361 proteins in 128 species: Archae - 0; Bacteria - 92; Metazoa - 65; Fungi - 98; Plants - 78; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |