Organism | Arabidopsis thaliana | |
ID | AtREG405 | |
Sequence | ACCCGACC | |
Annotation | ||
PPDB Motif | CCGAC | DRE core, stress response |
PLACE Motif | CCGAC | Core of low temperature responsive element (LTRE) of cor15a gene in Arabidopsis (A.t.); A portion of repeat-C (C-repeat), TGGCCGAC, which is repeated twice in cor15a promoter (Baker et al., 1994); ABA responsiveness; Involved in cold induction of BN115 gene from winter Brassica napus; LTRE; See S000157, S000152; Light signaling mediated by phytochrome is necessary for cold- or drought- induced gene expression through the C/DRE in Arabidopsis; See S000152; |
Total Entry Count | 178 |
Locus | Gene model | Sequence | Description |
AT1G01080 | AT1G01080.1 | TGACCCGACCCG | 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).  |
AT1G01080.2 | TGACCCGACCCG | 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).  | |
AT1G02560 | AT1G02560.1 | AACCCGACCCGA | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).  |
AT1G03250 | AT1G03250.1 | GGTCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 29; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT1G04790 | AT1G04790.1 | AACCCGACCC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6374 Blast hits to 6356 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2257; Fungi - 483; Plants - 2544; Viruses - 68; Other Eukaryotes - 1022 (source: NCBI BLink).  |
AT1G04790.1 | ACCCGACCCGG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6374 Blast hits to 6356 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2257; Fungi - 483; Plants - 2544; Viruses - 68; Other Eukaryotes - 1022 (source: NCBI BLink).  | |
AT1G05410 | AT1G05410.1 | CCGACCCGACCCGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT1G05410.2 | CCGACCCGACCCGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  | |
AT1G06220 | AT1G06220.1 | GACCCGACCC | Encodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS.  |
AT1G06220.2 | GACCCGACCC | Encodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS.  | |
AT1G09130 | AT1G09130.1 | AACCCGACCC | ATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink).  |
AT1G09130.2 | AACCCGACCC | ATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink).  | |
AT1G09940 | AT1G09940.1 | AACCCGACCCGG | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins  |
AT1G14230 | AT1G14230.1 | AACCCGACCCGGT | nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1089 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 22; Metazoa - 528; Fungi - 214; Plants - 198; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).  |
AT1G14850 | AT1G14850.1 | AACCCGACCCGGG | Encodes a protein similar to nucleoporin, a a major component of the nuclear pore complex (NPC) involved in cellular nucleo-cytoplasmic transport  |
AT1G16020 | AT1G16020.1 | AACCCGACCCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G16020.2 | AACCCGACCCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  | |
AT1G16740 | AT1G16740.1 | CGACCCGACCCGATCGACCCGG | ribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).  |
AT1G17455 | AT1G17455.1 | CGGGTCGGGTT | ELF4-Like 4 (ELF4-L4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1313 (InterPro:IPR009741); BEST Arabidopsis thaliana protein match is: ELF4-L2 (ELF4-Like 2) (TAIR:AT1G72630.1); Has 69 Blast hits to 68 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G17455.2 | CGGGTCGGGTT | ELF4-Like 4 (ELF4-L4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1313 (InterPro:IPR009741); BEST Arabidopsis thaliana protein match is: ELF4-L2 (ELF4-Like 2) (TAIR:AT1G72630.1); Has 69 Blast hits to 68 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G19430 | AT1G19430.1 | AACCCGACC | dehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT5G64030.1); Has 7615 Blast hits to 5355 proteins in 417 species: Archae - 11; Bacteria - 419; Metazoa - 2915; Fungi - 818; Plants - 766; Viruses - 126; Other Eukaryotes - 2560 (source: NCBI BLink).  |
AT1G20460 | AT1G20460.1 | AACCCGACCCGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76185.1); Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G21600 | AT1G21600.1 | TTCGGGTCGGGTCGGGTCGG | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression.  |
AT1G21600.2 | TTCGGGTCGGGTCGGGTCGG | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression.  | |
AT1G27470 | AT1G27470.1 | TATGGCCCAATGGGTCGGGTCGACCCGACC | transducin-related / WD-40 repeat protein-related; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G07410.1); Has 6753 Blast hits to 4580 proteins in 346 species: Archae - 8; Bacteria - 2018; Metazoa - 1907; Fungi - 1463; Plants - 459; Viruses - 0; Other Eukaryotes - 898 (source: NCBI BLink).  |
AT1G27480 | AT1G27480.1 | GGTCGGGTCGACCCGACCCATTGGGCCATA | lecithin:cholesterol acyltransferase family protein / LACT family protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); Has 852 Blast hits to 847 proteins in 171 species: Archae - 0; Bacteria - 22; Metazoa - 582; Fungi - 0; Plants - 127; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).  |
AT1G28281 | AT1G28281.1 | CGGGTCGGGT | unknown protein; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).  |
AT1G48420 | AT1G48420.1 | CCAAACCGACCCGACCCGA | Encodes an enzyme that decomposes D-cysteine into pyruvate, H2S, and NH3. Only D-cysteine but not L-cysteine was converted by D-CDes to pyruvate, H2S, and NH3. Unlike homologous bacterial enzymes, it does not have 1-aminocyclopropane-1-carboxylate deaminase activity.  |
AT1G53165 | AT1G53165.1 | GGTCGGGTCGGGTCGGGTCG | ATMAP4K ALPHA1; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response, response to wounding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G15220.1); Has 96724 Blast hits to 95040 proteins in 2970 species: Archae - 80; Bacteria - 8655; Metazoa - 42218; Fungi - 8499; Plants - 18630; Viruses - 533; Other Eukaryotes - 18109 (source: NCBI BLink).  |
AT1G53165.2 | GGTCGGGTCGGGTCGGGTCG | ATMAP4K ALPHA1; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response, response to wounding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G15220.1); Has 96724 Blast hits to 95040 proteins in 2970 species: Archae - 80; Bacteria - 8655; Metazoa - 42218; Fungi - 8499; Plants - 18630; Viruses - 533; Other Eukaryotes - 18109 (source: NCBI BLink).  | |
AT1G56440 | AT1G56440.1 | TGACCCGACC | serine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink).  |
AT1G56440.1 | TTTGACCCGACC | serine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink).  | |
AT1G56450 | AT1G56450.1 | GGTCGGGTCA | 20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds  |
AT1G56450.1 | GGTCGGGTCAAA | 20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds  | |
AT1G63290 | AT1G63290.1 | GGGTCGGGTT | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT3G01850.2); Has 6133 Blast hits to 6130 proteins in 1420 species: Archae - 32; Bacteria - 2852; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink).  |
AT1G65540 | AT1G65540.1 | CGGACCCGACCCGA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), LETM1-like (InterPro:IPR011685); BEST Arabidopsis thaliana protein match is: calcium-binding mitochondrial protein-related (TAIR:AT3G59820.1); Has 5986 Blast hits to 5091 proteins in 515 species: Archae - 39; Bacteria - 659; Metazoa - 2946; Fungi - 435; Plants - 306; Viruses - 24; Other Eukaryotes - 1577 (source: NCBI BLink).  |
AT1G65540.1 | TCGACCCGACCCGAA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), LETM1-like (InterPro:IPR011685); BEST Arabidopsis thaliana protein match is: calcium-binding mitochondrial protein-related (TAIR:AT3G59820.1); Has 5986 Blast hits to 5091 proteins in 515 species: Archae - 39; Bacteria - 659; Metazoa - 2946; Fungi - 435; Plants - 306; Viruses - 24; Other Eukaryotes - 1577 (source: NCBI BLink).  | |
AT1G71070 | AT1G71070.1 | ACCCGACC | glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein (TAIR:AT5G39990.1); Has 699 Blast hits to 696 proteins in 86 species: Archae - 0; Bacteria - 16; Metazoa - 469; Fungi - 0; Plants - 190; Viruses - 14; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT1G72090 | AT1G72090.1 | TCGACCCGACCCAGGCCCATTA | radical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), Aldolase-type TIM barrel (InterPro:IPR013785), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792), MiaB-like tRNA modifying enzyme, archaeal-type (InterPro:IPR006466); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT4G36390.1); Has 10341 Blast hits to 10323 proteins in 1298 species: Archae - 269; Bacteria - 4639; Metazoa - 269; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5110 (source: NCBI BLink).  |
AT1G72280 | AT1G72280.1 | ATAAGCCCAACCCGACCC | endoplasmic reticulum oxidoreductin  |
AT1G73885 | AT1G73885.1 | GGTCGGGTCGGGTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G75510 | AT1G75510.1 | CGGGTCGGGTCA | transcription initiation factor IIF beta subunit (TFIIF-beta) family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, general RNA polymerase II transcription factor activity, catalytic activity, ATP binding, ATP-dependent helicase activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIF complex, mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039), Transcription initiation factor IIF, beta subunit (InterPro:IPR003196), Transcription initiation factor IIF, beta subunit, subgroup (InterPro:IPR016640); BEST Arabidopsis thaliana protein match is: ATP binding / RNA polymerase II transcription factor (TAIR:AT3G52270.1); Has 230 Blast hits to 230 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 84; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT1G79200 | AT1G79200.1 | GACCCGACCCGACCCGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; Has 3292 Blast hits to 2186 proteins in 154 species: Archae - 0; Bacteria - 21; Metazoa - 1599; Fungi - 418; Plants - 200; Viruses - 0; Other Eukaryotes - 1054 (source: NCBI BLink).  |
AT1G80670 | AT1G80670.1 | ACCCGACCCGAACCGA | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  |
AT1G80850 | AT1G80850.1 | CCGGGTCGGGT | methyladenine glycosylase family protein; FUNCTIONS IN: DNA-3-methyladenine glycosylase I activity, catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), Methyladenine glycosylase (InterPro:IPR005019); BEST Arabidopsis thaliana protein match is: methyladenine glycosylase family protein (TAIR:AT1G15970.1); Has 1956 Blast hits to 1956 proteins in 800 species: Archae - 7; Bacteria - 1545; Metazoa - 4; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink).  |
AT2G01860 | AT2G01860.1 | CAATTGGGTCGGGTCA | EMBRYO DEFECTIVE 975 (EMB975); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G38420.1); Has 2464 Blast hits to 1412 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 8; Plants - 2414; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  |
AT2G03140 | AT2G03140.1 | TGACCCGACC | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G50790.1); Has 23018 Blast hits to 13463 proteins in 1126 species: Archae - 80; Bacteria - 6803; Metazoa - 6863; Fungi - 2179; Plants - 631; Viruses - 123; Other Eukaryotes - 6339 (source: NCBI BLink).  |
AT2G04630 | AT2G04630.1 | CCGAACCGAACCCGACCCGAA | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940.  |
AT2G04630.1 | CCGACCCGACCCTGACCCGAA | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940.  | |
AT2G16500 | AT2G16500.1 | TTCGGGTCGGGTCGGGTCG | encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements.  |
AT2G17190 | AT2G17190.1 | GACCCGACCCGGCCCAAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17200.1); Has 8273 Blast hits to 4684 proteins in 635 species: Archae - 6; Bacteria - 189; Metazoa - 3590; Fungi - 1163; Plants - 1579; Viruses - 154; Other Eukaryotes - 1592 (source: NCBI BLink).  |
AT2G17200 | AT2G17200.1 | TTTGACCCGACCCGGT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17190.1); Has 11842 Blast hits to 6071 proteins in 720 species: Archae - 6; Bacteria - 2895; Metazoa - 3957; Fungi - 1228; Plants - 1619; Viruses - 162; Other Eukaryotes - 1975 (source: NCBI BLink).  |
AT2G17340 | AT2G17340.1 | ACCCGACCC | pantothenate kinase-related; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Domain of unknown function DUF89 (InterPro:IPR002791), Uncharacterised conserved protein UCP030210 (InterPro:IPR016949); BEST Arabidopsis thaliana protein match is: pantothenate kinase family protein (TAIR:AT4G35360.1); Has 221 Blast hits to 221 proteins in 82 species: Archae - 33; Bacteria - 28; Metazoa - 87; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT2G19080 | AT2G19080.1 | AACCCGACCGACT | metaxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein targeting to mitochondrion; LOCATED IN: mitochondrial outer membrane, mitochondrion, mitochondrial inner membrane, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metaxin (InterPro:IPR017410); Has 384 Blast hits to 384 proteins in 77 species: Archae - 0; Bacteria - 46; Metazoa - 295; Fungi - 14; Plants - 20; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT2G20060 | AT2G20060.1 | GACCCGACCCG | ribosomal protein L4 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4 (InterPro:IPR015498), Ribosomal protein L4/L1e, bacterial-type (InterPro:IPR013005), Ribosomal protein L4/L1e (InterPro:IPR002136); BEST Arabidopsis thaliana protein match is: RPL4; poly(U) binding / structural constituent of ribosome (TAIR:AT1G07320.4); Has 5451 Blast hits to 5451 proteins in 1497 species: Archae - 63; Bacteria - 2944; Metazoa - 100; Fungi - 82; Plants - 60; Viruses - 0; Other Eukaryotes - 2202 (source: NCBI BLink).  |
AT2G21840 | AT2G21840.1 | TGACCCGACCCGAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular signaling cascade; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G21850.1); Has 2278 Blast hits to 530 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 0; Plants - 2227; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT2G26570 | AT2G26570.1 | CCGGGTCGGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G33390.1); Has 116898 Blast hits to 58103 proteins in 2191 species: Archae - 1417; Bacteria - 21958; Metazoa - 54071; Fungi - 9153; Plants - 5267; Viruses - 512; Other Eukaryotes - 24520 (source: NCBI BLink).  |
AT2G31725 | AT2G31725.1 | AACCCGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05730.1); Has 199 Blast hits to 199 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT2G36880 | AT2G36880.1 | CCGGGTCGGGT | methionine adenosyltransferase 3 (MAT3); FUNCTIONS IN: copper ion binding, methionine adenosyltransferase activity; INVOLVED IN: one-carbon compound metabolic process, S-adenosylmethionine biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine synthetase (InterPro:IPR002133); BEST Arabidopsis thaliana protein match is: MTO3 (METHIONINE OVER-ACCUMULATOR 3); methionine adenosyltransferase (TAIR:AT3G17390.1); Has 8009 Blast hits to 8008 proteins in 1637 species: Archae - 6; Bacteria - 2990; Metazoa - 309; Fungi - 109; Plants - 502; Viruses - 0; Other Eukaryotes - 4093 (source: NCBI BLink).  |
AT2G36880.2 | CCGGGTCGGGT | methionine adenosyltransferase 3 (MAT3); FUNCTIONS IN: copper ion binding, methionine adenosyltransferase activity; INVOLVED IN: one-carbon compound metabolic process, S-adenosylmethionine biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine synthetase (InterPro:IPR002133); BEST Arabidopsis thaliana protein match is: MTO3 (METHIONINE OVER-ACCUMULATOR 3); methionine adenosyltransferase (TAIR:AT3G17390.1); Has 8009 Blast hits to 8008 proteins in 1637 species: Archae - 6; Bacteria - 2990; Metazoa - 309; Fungi - 109; Plants - 502; Viruses - 0; Other Eukaryotes - 4093 (source: NCBI BLink).  | |
AT2G37230 | AT2G37230.1 | AAATACCCGACCCGG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02060.1); Has 17936 Blast hits to 5762 proteins in 186 species: Archae - 4; Bacteria - 20; Metazoa - 375; Fungi - 355; Plants - 16510; Viruses - 0; Other Eukaryotes - 672 (source: NCBI BLink).  |
AT2G38000 | AT2G38000.1 | TGACCCGACCCGA | chaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).  |
AT2G40800 | AT2G40800.1 | AACCCGACCCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56430.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G40800.1 | TGACCCGACCCGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56430.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G46180 | AT2G46180.1 | AACCCGACCCGTCCGA | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein.  |
AT2G46540 | AT2G46540.1 | ATTTGGGCCCAGTAACCCGACCCGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G01370 | AT3G01370.1 | CCGACCCGACCCGAA | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing.  |
AT3G01850 | AT3G01850.1 | TAAATGGGTCGGGTCG | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink).  |
AT3G01850.2 | TAAATGGGTCGGGTCG | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink).  | |
AT3G03600 | AT3G03600.1 | CCGACCCGACCCGAC | Structural component of the mitochondrial ribosome small subunit  |
AT3G03610 | AT3G03610.1 | GTCGGGTCGGGTCGG | phagocytosis and cell motility protein ELMO1-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: phagocytosis; LOCATED IN: cytoskeleton; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Engulfment and cell motility, ELMO (InterPro:IPR006816); BEST Arabidopsis thaliana protein match is: phagocytosis and cell motility protein ELMO1-related (TAIR:AT1G03620.1); Has 636 Blast hits to 636 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 422; Fungi - 25; Plants - 106; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).  |
AT3G04120 | AT3G04120.1 | ACCCGACCCG | encodes cytosolic GADPH (C subunit) involved in the glycolytic pathway but also interacts with H2O2 potentially placing it in a signalling cascade induced by ROS.  |
AT3G06270 | AT3G06270.1 | ACCCGACCCGAA | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: ATP binding / cAMP-dependent protein kinase regulator/ catalytic/ protein kinase/ protein serine/threonine phosphatase (TAIR:AT2G20050.1); Has 3686 Blast hits to 3670 proteins in 257 species: Archae - 2; Bacteria - 83; Metazoa - 1132; Fungi - 383; Plants - 1219; Viruses - 4; Other Eukaryotes - 863 (source: NCBI BLink).  |
AT3G07050 | AT3G07050.1 | CGGGTCGGGT | GTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), Small GTP-binding protein (InterPro:IPR005225), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917), GNL3L/Grn1 putative GTPase (InterPro:IPR014813); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT1G52980.1); Has 8737 Blast hits to 6941 proteins in 1045 species: Archae - 97; Bacteria - 2936; Metazoa - 2440; Fungi - 644; Plants - 338; Viruses - 29; Other Eukaryotes - 2253 (source: NCBI BLink).  |
AT3G07170 | AT3G07170.1 | TCGACCCGACCCGACCCG | sterile alpha motif (SAM) domain-containing protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: sterile alpha motif (SAM) domain-containing protein (TAIR:AT5G48680.1); Has 396 Blast hits to 395 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 293; Fungi - 2; Plants - 89; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT3G08920 | AT3G08920.1 | AAATACCCGACCGGTTC | rhodanese-like domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT2G42220.1); Has 151 Blast hits to 151 proteins in 36 species: Archae - 0; Bacteria - 36; Metazoa - 1; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
AT3G11050 | AT3G11050.1 | GGGTCGGGTT | ferritin 2 (ATFER2); FUNCTIONS IN: oxidoreductase activity, ferric iron binding, binding, transition metal ion binding; INVOLVED IN: response to oxidative stress, cellular iron ion homeostasis, response to abscisic acid stimulus, iron ion transport; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Ferritin, N-terminal (InterPro:IPR001519), Ferritin-related (InterPro:IPR012347), Ferritin-like (InterPro:IPR009040), Ferritin, conserved site (InterPro:IPR014034), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Ferritin and Dps (InterPro:IPR008331); BEST Arabidopsis thaliana protein match is: ATFER4 (ferritin 4); binding / ferric iron binding / oxidoreductase/ transition metal ion binding (TAIR:AT2G40300.1); Has 2388 Blast hits to 2383 proteins in 603 species: Archae - 119; Bacteria - 761; Metazoa - 1101; Fungi - 6; Plants - 217; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  |
AT3G11130 | AT3G11130.1 | AACCCGACCCG | clathrin heavy chain, putative; FUNCTIONS IN: protein binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: male gametophyte, guard cell, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Clathrin, heavy chain (InterPro:IPR016341), Clathrin, heavy chain, linker and propeller (InterPro:IPR016025), Tetratricopeptide-like helical (InterPro:IPR011990), Clathrin, heavy chain, propeller, N-terminal (InterPro:IPR001473), Clathrin, heavy chain, linker, core motif (InterPro:IPR015348), Armadillo-type fold (InterPro:IPR016024), Clathrin, heavy chain/VPS, 7-fold repeat (InterPro:IPR000547); BEST Arabidopsis thaliana protein match is: clathrin heavy chain, putative (TAIR:AT3G08530.1); Has 1310 Blast hits to 1193 proteins in 365 species: Archae - 0; Bacteria - 34; Metazoa - 776; Fungi - 123; Plants - 60; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink).  |
AT3G13677 | AT3G13677.1 | CCCGGGTCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G13677.1 | CGGGTCGGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G13677.2 | CCCGGGTCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G13677.2 | CGGGTCGGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G19010 | AT3G19010.1 | TGACCCGACCC | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: flavonol synthase activity, oxidoreductase activity, iron ion binding; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G19000.1); Has 6168 Blast hits to 6134 proteins in 688 species: Archae - 0; Bacteria - 727; Metazoa - 131; Fungi - 671; Plants - 3106; Viruses - 0; Other Eukaryotes - 1533 (source: NCBI BLink).  |
AT3G19010.2 | TGACCCGACCC | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: flavonol synthase activity, oxidoreductase activity, iron ion binding; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G19000.1); Has 6168 Blast hits to 6134 proteins in 688 species: Archae - 0; Bacteria - 727; Metazoa - 131; Fungi - 671; Plants - 3106; Viruses - 0; Other Eukaryotes - 1533 (source: NCBI BLink).  | |
AT3G21220 | AT3G21220.1 | GACCCGACC | Encodes a mitogen-activated kinase kinase, dual specific protein kinase that is expressed in vegetative tissues and floral buds. Involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK4.In plants with both MKK5 and MKK6 levels reduced by RNAi plants, floral organs do not abscise suggestion a role for both proteins in mediating floral organ abscission.  |
AT3G21290 | AT3G21290.1 | TTCGGGTCGGGTT | dentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Occludin and RNA polymerase II elongation factor ELL domain (InterPro:IPR010844); Has 15416 Blast hits to 7392 proteins in 559 species: Archae - 48; Bacteria - 5567; Metazoa - 4037; Fungi - 1335; Plants - 339; Viruses - 108; Other Eukaryotes - 3982 (source: NCBI BLink).  |
AT3G22680 | AT3G22680.1 | CCGGGTCGGGTCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1950 (InterPro:IPR015270); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G26340 | AT3G26340.1 | AACCCGACCCG | 20S proteasome beta subunit E, putative; FUNCTIONS IN: endopeptidase activity, threonine-type endopeptidase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome core complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Proteasome, beta-type subunit, conserved site (InterPro:IPR016050), Peptidase T1A, proteasome beta-subunit (InterPro:IPR000243), 20S proteasome, A and B subunits (InterPro:IPR001353); BEST Arabidopsis thaliana protein match is: PBE1; endopeptidase/ peptidase/ threonine-type endopeptidase (TAIR:AT1G13060.1); Has 4428 Blast hits to 4424 proteins in 409 species: Archae - 476; Bacteria - 181; Metazoa - 1589; Fungi - 914; Plants - 555; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).  |
AT3G26730 | AT3G26730.1 | CCGGGTCGGGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 5616 Blast hits to 1874 proteins in 214 species: Archae - 3; Bacteria - 108; Metazoa - 2179; Fungi - 373; Plants - 239; Viruses - 6; Other Eukaryotes - 2708 (source: NCBI BLink).  |
AT3G42790 | AT3G42790.1 | TGACCCGACCCGAACCA | AL3 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  |
AT3G47500 | AT3G47500.1 | AACCCGACAACCCGACCCGGT | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions.  |
AT3G48420 | AT3G48420.1 | AACCCGACCCG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G39970.1); Has 7388 Blast hits to 7387 proteins in 1159 species: Archae - 34; Bacteria - 5445; Metazoa - 112; Fungi - 80; Plants - 209; Viruses - 3; Other Eukaryotes - 1505 (source: NCBI BLink).  |
AT3G50590 | AT3G50590.1 | AACCCGACCC | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink).  |
AT3G50690 | AT3G50690.1 | AACCCGACCCGAACCGA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 79321 Blast hits to 33428 proteins in 1262 species: Archae - 436; Bacteria - 8197; Metazoa - 29512; Fungi - 13019; Plants - 4257; Viruses - 1007; Other Eukaryotes - 22893 (source: NCBI BLink).  |
AT3G51130 | AT3G51130.1 | AACCCGACCCG | unknown protein; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0183 (InterPro:IPR005373); Has 201 Blast hits to 198 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 55; Plants - 18; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT3G56440 | AT3G56440.1 | GGGCCGGGTCGGGTCGGGTCG | AtATG18d; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18c (TAIR:AT2G40810.2); Has 1093 Blast hits to 1046 proteins in 176 species: Archae - 0; Bacteria - 24; Metazoa - 508; Fungi - 305; Plants - 110; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
AT3G57400 | AT3G57400.1 | AACCCGACCCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52500.1); Has 23 Blast hits to 23 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G61060 | AT3G61060.1 | AACCCGACCCGACCCGA | Arabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G61060.2 | AACCCGACCCGACCCGA | Arabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G62000 | AT3G62000.1 | TTTGACCCGACCCGGTT | O-methyltransferase family 3 protein; FUNCTIONS IN: O-methyltransferase activity; LOCATED IN: cytosol; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: O-methyltransferase family 3 protein (TAIR:AT3G61990.1); Has 3642 Blast hits to 3640 proteins in 775 species: Archae - 31; Bacteria - 1513; Metazoa - 236; Fungi - 112; Plants - 446; Viruses - 0; Other Eukaryotes - 1304 (source: NCBI BLink).  |
AT3G62600 | AT3G62600.1 | GTACACGTAACCCGACC | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast.  |
AT4G00090 | AT4G00090.1 | AACCCGACCCGACCCGGTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink).  |
AT4G00500 | AT4G00500.1 | CCGACCCGACCCGACCCGACCCGACCCGAC | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).  |
AT4G00500.2 | CCGACCCGACCCGACCCGACCCGACCCGAC | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).  | |
AT4G00520 | AT4G00520.2 | GTCGGGTCGGGTCGGGTCGGGTCGGGTCGG | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink).  |
AT4G00520.3 | GTCGGGTCGGGTCGGGTCGGGTCGGGTCGG | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink).  | |
AT4G07410 | AT4G07410.1 | GGTCGGGTCGA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin-related / WD-40 repeat protein-related (TAIR:AT1G27470.1); Has 7930 Blast hits to 5136 proteins in 341 species: Archae - 14; Bacteria - 2432; Metazoa - 2063; Fungi - 1810; Plants - 493; Viruses - 0; Other Eukaryotes - 1118 (source: NCBI BLink).  |
AT4G07410.2 | GGTCGGGTCGA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin-related / WD-40 repeat protein-related (TAIR:AT1G27470.1); Has 7930 Blast hits to 5136 proteins in 341 species: Archae - 14; Bacteria - 2432; Metazoa - 2063; Fungi - 1810; Plants - 493; Viruses - 0; Other Eukaryotes - 1118 (source: NCBI BLink).  | |
AT4G08310 | AT4G08310.1 | TTTAACCGAACCCGACCCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G44780.2); Has 49375 Blast hits to 29075 proteins in 1129 species: Archae - 121; Bacteria - 2824; Metazoa - 24551; Fungi - 5614; Plants - 1764; Viruses - 442; Other Eukaryotes - 14059 (source: NCBI BLink).  |
AT4G09680 | AT4G09680.1 | AACCCGGTCGGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G09680.2 | AACCCGGTCGGGTCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G11010 | AT4G11010.1 | AACCCGACCCGAA | nucleoside diphosphate kinase 3 (ndpk3), located to the inter-membrane space in mitochondria  |
AT4G15240 | AT4G15240.1 | AACCCGACC | fringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT1G05280.1); Has 368 Blast hits to 364 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 109; Plants - 125; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT4G17300 | AT4G17300.1 | GGGTCGGGT | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis.  |
AT4G17300.1 | GGTCGGGTT | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis.  | |
AT4G17620 | AT4G17620.1 | GGTCGGGT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink).  |
AT4G17620.2 | GGTCGGGT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink).  | |
AT4G18060 | AT4G18060.1 | TCGACCCGACCCG | clathrin binding; FUNCTIONS IN: clathrin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neutrophil cytosol factor 2 (InterPro:IPR000108), Src homology-3 domain (InterPro:IPR001452); BEST Arabidopsis thaliana protein match is: SH3 domain-containing protein 2 (SH3P2) (TAIR:AT4G34660.1); Has 2031 Blast hits to 1692 proteins in 137 species: Archae - 0; Bacteria - 6; Metazoa - 1668; Fungi - 93; Plants - 91; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink).  |
AT4G18780 | AT4G18780.1 | AACCCGACCCGAATAAACCGGAT | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling.  |
AT4G22380 | AT4G22380.1 | AACCCGACCCGA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT5G20160.1); Has 1361 Blast hits to 1361 proteins in 295 species: Archae - 226; Bacteria - 7; Metazoa - 464; Fungi - 191; Plants - 162; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink).  |
AT4G22840 | AT4G22840.1 | GGGTCGGGTC | bile acid:sodium symporter family protein; FUNCTIONS IN: transporter activity, bile acid:sodium symporter activity; INVOLVED IN: sodium ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bile acid:sodium symporter (InterPro:IPR002657); BEST Arabidopsis thaliana protein match is: bile acid:sodium symporter family protein (TAIR:AT4G12030.2); Has 2570 Blast hits to 2568 proteins in 443 species: Archae - 24; Bacteria - 852; Metazoa - 337; Fungi - 0; Plants - 149; Viruses - 0; Other Eukaryotes - 1208 (source: NCBI BLink).  |
AT4G22850 | AT4G22850.1 | AACCCGACCCGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).  |
AT4G22850.2 | AACCCGACCCGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).  | |
AT4G26690 | AT4G26690.1 | CCGACCCGACC | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development.  |
AT4G30920 | AT4G30920.1 | TCGGGTCGGGT | cytosol aminopeptidase family protein; FUNCTIONS IN: manganese ion binding, metalloexopeptidase activity, aminopeptidase activity; INVOLVED IN: proteolysis, protein metabolic process; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Peptidase M17, leucyl aminopeptidase, C-terminal (InterPro:IPR000819), Peptidase M17, leucyl aminopeptidase, N-terminal (InterPro:IPR008283), Peptidase M17, leucyl aminopeptidase (InterPro:IPR011356); BEST Arabidopsis thaliana protein match is: cytosol aminopeptidase family protein (TAIR:AT4G30910.1); Has 7361 Blast hits to 7357 proteins in 1222 species: Archae - 15; Bacteria - 3183; Metazoa - 618; Fungi - 19; Plants - 75; Viruses - 0; Other Eukaryotes - 3451 (source: NCBI BLink).  |
AT4G31150 | AT4G31150.1 | TGACCCGACCCG | endonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
AT4G31150.2 | TGACCCGACCCG | endonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT4G31200 | AT4G31200.1 | TCGGGTCGGGT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  |
AT4G31200.1 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  | |
AT4G31200.2 | TCGGGTCGGGT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  | |
AT4G31200.2 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  | |
AT4G31200.3 | TCGGGTCGGGT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  | |
AT4G31200.3 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).  | |
AT4G31210 | AT4G31210.1 | AACCCGACCCGAA | DNA topoisomerase family protein; FUNCTIONS IN: DNA topoisomerase activity, DNA topoisomerase type I activity, DNA binding, nucleic acid binding; INVOLVED IN: DNA topological change, DNA unwinding during replication, DNA metabolic process; LOCATED IN: chromosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IA, zn finger (InterPro:IPR013498), DNA topoisomerase, type IA, core (InterPro:IPR000380), DNA topoisomerase, type IA, DNA-binding (InterPro:IPR003602), DNA topoisomerase, type IA, domain 2 (InterPro:IPR003601), DNA topoisomerase, type IA, central (InterPro:IPR013497), DNA topoisomerase, type IA, central region, subdomain 3 (InterPro:IPR013826), DNA topoisomerase I, bacterial-type (InterPro:IPR005733), Toprim subdomain (InterPro:IPR006154), DNA topoisomerase, type IA, central region, subdomain 1 (InterPro:IPR013824), TOPRIM (InterPro:IPR006171); BEST Arabidopsis thaliana protein match is: DNA topoisomerase III alpha, putative (TAIR:AT5G63920.1); Has 15959 Blast hits to 13205 proteins in 1711 species: Archae - 250; Bacteria - 5099; Metazoa - 1724; Fungi - 605; Plants - 147; Viruses - 34; Other Eukaryotes - 8100 (source: NCBI BLink).  |
AT4G31210.1 | ACCCGACCCGA | DNA topoisomerase family protein; FUNCTIONS IN: DNA topoisomerase activity, DNA topoisomerase type I activity, DNA binding, nucleic acid binding; INVOLVED IN: DNA topological change, DNA unwinding during replication, DNA metabolic process; LOCATED IN: chromosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IA, zn finger (InterPro:IPR013498), DNA topoisomerase, type IA, core (InterPro:IPR000380), DNA topoisomerase, type IA, DNA-binding (InterPro:IPR003602), DNA topoisomerase, type IA, domain 2 (InterPro:IPR003601), DNA topoisomerase, type IA, central (InterPro:IPR013497), DNA topoisomerase, type IA, central region, subdomain 3 (InterPro:IPR013826), DNA topoisomerase I, bacterial-type (InterPro:IPR005733), Toprim subdomain (InterPro:IPR006154), DNA topoisomerase, type IA, central region, subdomain 1 (InterPro:IPR013824), TOPRIM (InterPro:IPR006171); BEST Arabidopsis thaliana protein match is: DNA topoisomerase III alpha, putative (TAIR:AT5G63920.1); Has 15959 Blast hits to 13205 proteins in 1711 species: Archae - 250; Bacteria - 5099; Metazoa - 1724; Fungi - 605; Plants - 147; Viruses - 34; Other Eukaryotes - 8100 (source: NCBI BLink).  | |
AT4G31560 | AT4G31560.1 | TCGGGTCGGGTCA | Encodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane.  |
AT4G36040 | AT4G36040.1 | ACCCGACCCG | DNAJ heat shock N-terminal domain-containing protein (J11); FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT2G17880.1); Has 12724 Blast hits to 12724 proteins in 1824 species: Archae - 85; Bacteria - 4544; Metazoa - 2505; Fungi - 1062; Plants - 954; Viruses - 5; Other Eukaryotes - 3569 (source: NCBI BLink).  |
AT5G04750 | AT5G04750.1 | ACCCGACCCGGT | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G04750.2 | ACCCGACCCGGT | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G07120 | AT5G07120.1 | CGGGTCGGGTCAAA | SORTING NEXIN 2b (SNX2b); FUNCTIONS IN: protein binding, phosphoinositide binding; INVOLVED IN: intracellular signaling cascade, cell communication; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2a (SORTING NEXIN 2a); phosphoinositide binding (TAIR:AT5G58440.1); Has 1877 Blast hits to 1867 proteins in 192 species: Archae - 11; Bacteria - 46; Metazoa - 1184; Fungi - 380; Plants - 83; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink).  |
AT5G07890 | AT5G07890.1 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink).  |
AT5G07890.2 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink).  | |
AT5G07890.3 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink).  | |
AT5G07900 | AT5G07900.1 | GGTCGGGTCGGTTCGGGTCAAA | mitochondrial transcription termination factor family protein / mTERF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G21150.1); Has 434 Blast hits to 369 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G08650 | AT5G08650.1 | TCGGGTCGGGT | GTP-binding protein LepA, putative; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding protein LepA (InterPro:IPR006297), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), GTP-binding protein LepA, C-terminal (InterPro:IPR013842), Elongation factor G, III and V (InterPro:IPR009022), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: GTP binding / GTPase/ translation elongation factor (TAIR:AT5G39900.1); Has 58694 Blast hits to 51359 proteins in 6862 species: Archae - 845; Bacteria - 29013; Metazoa - 5946; Fungi - 3236; Plants - 868; Viruses - 0; Other Eukaryotes - 18786 (source: NCBI BLink).  |
AT5G10780 | AT5G10780.1 | GACCCGACC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  |
AT5G10780.2 | GACCCGACC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  | |
AT5G13640 | AT5G13640.1 | GGTCGGGTC | arabidopsis phospholipid:diacylglycerol acyltransferase (PDAT)  |
AT5G14170 | AT5G14170.1 | CGGGTCGGGTC | CHC1 is predicted to encode a protein that belongs to the chromodomain remodeling complex. Two RNAi knock-down lines have a dwarf phenotype and reduced rates of Agrobacterium-mediated transformation. The low rate of root-mediated transformation rate may result from altered root morphology or reduced root growth rates.  |
AT5G15700 | AT5G15700.1 | CCCGGGTCGGGT | DNA-directed RNA polymerase (RPOT2); FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: DNA-directed RNA polymerase, bacteriophage type (InterPro:IPR002092); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase, mitochondrial (RPOMT) (TAIR:AT1G68990.1); Has 1079 Blast hits to 1064 proteins in 245 species: Archae - 0; Bacteria - 22; Metazoa - 122; Fungi - 163; Plants - 126; Viruses - 102; Other Eukaryotes - 544 (source: NCBI BLink).  |
AT5G15760 | AT5G15760.1 | CCGACCCGACCCGACC | plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast, plastid; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, PSRP-3/Ycf65 (InterPro:IPR006924); BEST Arabidopsis thaliana protein match is: plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative (TAIR:AT1G68590.2); Has 330 Blast hits to 330 proteins in 86 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 175 (source: NCBI BLink).  |
AT5G16220 | AT5G16220.1 | ACCCGACCCGGTT | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT2G01190.1); Has 247 Blast hits to 246 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 12; Plants - 175; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT5G17070 | AT5G17070.1 | GTCGGGTCGGGTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; Has 156 Blast hits to 156 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 14; Plants - 18; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT5G19390 | AT5G19390.1 | GACCCGACCCG | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.  |
AT5G19390.2 | GACCCGACCCG | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.  | |
AT5G19390.3 | GACCCGACCCG | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.  | |
AT5G19390.4 | GACCCGACCCG | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.  | |
AT5G20720 | AT5G20720.1 | CGACCCGACCCGACC | Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES.  |
AT5G20720.2 | CGACCCGACCCGACC | Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES.  | |
AT5G25780 | AT5G25780.1 | TGACCCGACCCGACCCGTCCGA | member of eIF3b - eukaryotic initiation factor 3b  |
AT5G42000 | AT5G42000.1 | CGGGTCGGGTCGGAAAACCGGT | ORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT5G42000.2 | CGGGTCGGGTCGGAAAACCGGT | ORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  | |
AT5G43940 | AT5G43940.1 | CGACCCGACCCGACTCGACCCGG | Encodes a glutathione-dependent formaldehyde dehydrogenase (also known as class III type alcohol dehydrogenase) reduces S-nitrosoglutathione (GSNO), the condensation product of glutathione and NO, that is a naturally occurring NO reservoir and also a reactive nitrogen intermediate. Gene expression is reduced by wounding and induced by salicylic acid. Is required for the acclimation of plants to high temperature and for fertility.  |
AT5G44920 | AT5G44920.1 | ACCCGACCC | Toll-Interleukin-Resistance (TIR) domain-containing protein; FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: signal transduction, defense response, innate immune response; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR class), putative (TAIR:AT4G19920.1); Has 830 Blast hits to 796 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 827; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G44920.2 | ACCCGACCC | Toll-Interleukin-Resistance (TIR) domain-containing protein; FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: signal transduction, defense response, innate immune response; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR class), putative (TAIR:AT4G19920.1); Has 830 Blast hits to 796 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 827; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT5G45390 | AT5G45390.1 | AACCCGACCCG | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).  |
AT5G45900 | AT5G45900.1 | ATAAAGCCGACCCGACCCGG | Component of autophagy conjugation pathway. Required for proper senescence.  |
AT5G46210 | AT5G46210.1 | TCGGGTCGGGTC | Arabidopsis CULLIN4 (CUL4) forms an E3 ubiquitin ligase with the CDD complex and a common catalytic subunit RBX1 in mediating light control of development. This CUL4-based E3 ligase is essential for the repression of photomorphogenesis. The partial loss of CUL4 function resulted in a constitutive photomorphogenic phenotype with respect to morphogenesis and light-regulated gene expression. CUL4 exhibits a synergistic genetic interaction with COP10 and DET1.  |
AT5G46840 | AT5G46840.2 | AACCCGACCCGGT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink).  |
AT5G48030 | AT5G48030.1 | CCGGGTCGGGT | encodes a mitochondrially targeted DNAJ protein involved in female gametophyte development.  |
AT5G48240 | AT5G48240.1 | AACCCGACCTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  |
AT5G48240.2 | AACCCGACCTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  | |
AT5G48240.3 | AACCCGACCTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  | |
AT5G50810 | AT5G50810.1 | TTAAACCGGTCGGGTCCG | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.  |
AT5G51340 | AT5G51340.1 | CGGGTCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 149 Blast hits to 96 proteins in 39 species: Archae - 0; Bacteria - 2; Metazoa - 115; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT5G57120 | AT5G57120.1 | CCGGGTCGGGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif (InterPro:IPR006594), SRP40, C-terminal (InterPro:IPR007718); Has 90949 Blast hits to 45608 proteins in 1620 species: Archae - 300; Bacteria - 8281; Metazoa - 37603; Fungi - 8095; Plants - 3374; Viruses - 548; Other Eukaryotes - 32748 (source: NCBI BLink).  |
AT5G63400 | AT5G63400.1 | AACCCGACCCGGT | encodes a protein similar to adenylate kinase.  |
AT5G63400.2 | AACCCGACCCGGT | encodes a protein similar to adenylate kinase.  |