Organism | Arabidopsis thaliana | |
ID | AtREG406 | |
Sequence | GGTCCCAC | |
Annotation | ||
PPDB Motif | GGGACCC | function unknown |
PLACE Motif | ||
Total Entry Count | 128 |
Locus | Gene model | Sequence | Description |
AT1G02660 | AT1G02660.1 | GTGGGTCCCACGTGGG | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT3G62590.1); Has 601 Blast hits to 595 proteins in 116 species: Archae - 0; Bacteria - 17; Metazoa - 188; Fungi - 136; Plants - 92; Viruses - 14; Other Eukaryotes - 154 (source: NCBI BLink).  |
AT1G03560 | AT1G03560.1 | GGTCCCAC | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 22539 Blast hits to 6065 proteins in 191 species: Archae - 3; Bacteria - 41; Metazoa - 565; Fungi - 536; Plants - 20393; Viruses - 0; Other Eukaryotes - 1001 (source: NCBI BLink).  |
AT1G04310 | AT1G04310.1 | TGGGTCCCAC | encodes an ethylene receptor related to bacterial two-component histidine kinases.  |
AT1G06040 | AT1G06040.1 | GTGGGACCC | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.  |
AT1G06040.2 | GTGGGACCC | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.  | |
AT1G10960 | AT1G10960.1 | GTGGGACC | FERREDOXIN 1 (ATFD1); FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: FED A; 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G60950.1); Has 5347 Blast hits to 5345 proteins in 903 species: Archae - 63; Bacteria - 3637; Metazoa - 8; Fungi - 9; Plants - 447; Viruses - 2; Other Eukaryotes - 1181 (source: NCBI BLink).  |
AT1G14290 | AT1G14290.1 | TGGGTCCCAC | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth.  |
AT1G15740 | AT1G15740.1 | GTGGGACC | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT4G23840.1); Has 25965 Blast hits to 13594 proteins in 578 species: Archae - 6; Bacteria - 5108; Metazoa - 10615; Fungi - 448; Plants - 7228; Viruses - 79; Other Eukaryotes - 2481 (source: NCBI BLink).  |
AT1G20880 | AT1G20880.1 | GTGGGACCCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT1G76460.1); Has 11636 Blast hits to 9514 proteins in 483 species: Archae - 0; Bacteria - 541; Metazoa - 6778; Fungi - 1119; Plants - 2221; Viruses - 0; Other Eukaryotes - 977 (source: NCBI BLink).  |
AT1G24160 | AT1G24160.1 | GGTCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: guard cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70100.3); Has 4520 Blast hits to 3464 proteins in 329 species: Archae - 12; Bacteria - 317; Metazoa - 1888; Fungi - 343; Plants - 154; Viruses - 31; Other Eukaryotes - 1775 (source: NCBI BLink).  |
AT1G25520 | AT1G25520.1 | TGGGTCCCAC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0016 (InterPro:IPR001727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68650.1); Has 1239 Blast hits to 1181 proteins in 440 species: Archae - 13; Bacteria - 667; Metazoa - 131; Fungi - 99; Plants - 104; Viruses - 0; Other Eukaryotes - 225 (source: NCBI BLink).  |
AT1G27460 | AT1G27460.1 | GTGGGACC | encodes a calmodulin-binding protein that is expressed in pollen, suspension culture cells, flowers, and fruits.  |
AT1G30690 | AT1G30690.1 | GTGGGACC | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 52659 Blast hits to 27496 proteins in 1404 species: Archae - 277; Bacteria - 6323; Metazoa - 18776; Fungi - 4501; Plants - 1964; Viruses - 383; Other Eukaryotes - 20435 (source: NCBI BLink).  |
AT1G30690.2 | GTGGGACC | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 52659 Blast hits to 27496 proteins in 1404 species: Archae - 277; Bacteria - 6323; Metazoa - 18776; Fungi - 4501; Plants - 1964; Viruses - 383; Other Eukaryotes - 20435 (source: NCBI BLink).  | |
AT1G31320 | AT1G31320.1 | TGGGTCCCAC | LOB DOMAIN-CONTAINING PROTEIN 4 (LBD4); INVOLVED IN: biological_process unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); BEST Arabidopsis thaliana protein match is: ASL5; DNA binding / protein binding (TAIR:AT2G30130.1); Has 595 Blast hits to 592 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 595; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G56220 | AT1G56220.1 | GGGTCCCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G56220.2 | GGGTCCCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G56220.3 | GGGTCCCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G56220.4 | GGGTCCCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G60940 | AT1G60940.1 | GGTCCCAC | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress.  |
AT1G60940.2 | GGTCCCAC | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress.  | |
AT1G62290 | AT1G62290.1 | GTGGGTCCCAC | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink).  |
AT1G62290.2 | GTGGGTCCCAC | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink).  | |
AT1G65930 | AT1G65930.1 | GTGGGACCC | isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NADP+) activity, copper ion binding; INVOLVED IN: response to cadmium ion, response to salt stress, metabolic process; LOCATED IN: apoplast, plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NADP-dependent, eukaryotic (InterPro:IPR004790); BEST Arabidopsis thaliana protein match is: ICDH (ISOCITRATE DEHYDROGENASE); isocitrate dehydrogenase (NADP+)/ oxidoreductase, acting on the CH-OH group of donors, NAD or NADP as acceptor (TAIR:AT1G54340.1); Has 4101 Blast hits to 4085 proteins in 611 species: Archae - 17; Bacteria - 632; Metazoa - 448; Fungi - 160; Plants - 247; Viruses - 0; Other Eukaryotes - 2597 (source: NCBI BLink).  |
AT1G68740 | AT1G68740.1 | GGTCCCAC | Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation.  |
AT1G70760 | AT1G70760.1 | GTGGGACC | a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity.  |
AT1G71030 | AT1G71030.1 | GTGGGACC | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves.  |
AT1G72175 | AT1G72175.1 | GGGTCCCAC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1232 (InterPro:IPR010652), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G22510.1); Has 591 Blast hits to 591 proteins in 84 species: Archae - 0; Bacteria - 8; Metazoa - 474; Fungi - 32; Plants - 29; Viruses - 2; Other Eukaryotes - 46 (source: NCBI BLink).  |
AT1G75440 | AT1G75440.1 | GGTCCCAC | ubiquitin-conjugating enzyme 16 (UBC16); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC18 (ubiquitin-conjugating enzyme 18); small conjugating protein ligase/ ubiquitin-protein ligase (TAIR:AT5G42990.1); Has 6497 Blast hits to 6496 proteins in 295 species: Archae - 0; Bacteria - 2; Metazoa - 3150; Fungi - 1284; Plants - 976; Viruses - 16; Other Eukaryotes - 1069 (source: NCBI BLink).  |
AT2G01150 | AT2G01150.1 | ATAATGGGTCCCACAACACGTGGC | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils.  |
AT2G01180 | AT2G01180.1 | GTGGGACC | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.  |
AT2G01180.2 | GTGGGACC | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.  | |
AT2G04880 | AT2G04880.1 | TGGGTCCCAC | Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1.  |
AT2G04880.2 | TGGGTCCCAC | Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1.  | |
AT2G23980 | AT2G23980.1 | GTGGGACCCGAC | member of Cyclic nucleotide gated channel family  |
AT2G25260 | AT2G25260.1 | GTGGGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25265.1); Has 110 Blast hits to 96 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT2G25520 | AT2G25520.1 | GGGTCCCAC | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT4G32390.1); Has 1588 Blast hits to 1588 proteins in 185 species: Archae - 0; Bacteria - 8; Metazoa - 446; Fungi - 283; Plants - 685; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink).  |
AT2G35190 | AT2G35190.1 | CGATGTCGTGGCGGGTCCCAC | plant-specific SNARE located in cell plate of dividing cells. cofractionates with the cytokinesis-specific syntaxin, KNOLLE, which is required for the formation of the cell plate.  |
AT2G39570 | AT2G39570.1 | AGACACGTAGGTCCCAC | ACT domain-containing protein; FUNCTIONS IN: amino acid binding; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: ACT domain-containing protein (TAIR:AT2G36840.1); Has 256 Blast hits to 222 proteins in 28 species: Archae - 0; Bacteria - 28; Metazoa - 0; Fungi - 0; Plants - 199; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT2G41630 | AT2G41630.1 | GGTCCCAC | Encodes the transcription factor TFIIB.  |
AT2G42790 | AT2G42790.1 | GTGGGTCCCAC | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development.  |
AT2G43360 | AT2G43360.1 | GGTCCCAC | Catalyzes the conversion of dethiobiotin to biotin.  |
AT2G43370 | AT2G43370.1 | GTGGGACC | U1 small nuclear ribonucleoprotein 70 kDa, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: U1-70K (U1 SMALL NUCLEAR RIBONUCLEOPROTEIN-70K); RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G50670.1); Has 15940 Blast hits to 13539 proteins in 557 species: Archae - 10; Bacteria - 827; Metazoa - 9526; Fungi - 1771; Plants - 2091; Viruses - 3; Other Eukaryotes - 1712 (source: NCBI BLink).  |
AT2G46020 | AT2G46020.1 | GTGGGACC | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D.  |
AT2G46020.2 | GTGGGACC | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D.  | |
AT2G47180 | AT2G47180.1 | GGTCCCAC | Arabidopsis thaliana galactinol synthase 1 (AtGolS1); FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, carbohydrate biosynthetic process, response to heat; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: AtGolS2 (Arabidopsis thaliana galactinol synthase 2); transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G56600.1); Has 818 Blast hits to 817 proteins in 194 species: Archae - 0; Bacteria - 56; Metazoa - 224; Fungi - 185; Plants - 235; Viruses - 68; Other Eukaryotes - 50 (source: NCBI BLink).  |
AT3G09920 | AT3G09920.1 | GTGGGACC | PHOSPHATIDYL INOSITOL MONOPHOSPHATE 5 KINASE (PIP5K9); FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity, ATP binding; INVOLVED IN: amino acid metabolic process, carbohydrate metabolic process; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, plant (InterPro:IPR017163), MORN motif (InterPro:IPR003409), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT1G60890.1); Has 21682 Blast hits to 6213 proteins in 379 species: Archae - 0; Bacteria - 2219; Metazoa - 3466; Fungi - 306; Plants - 724; Viruses - 0; Other Eukaryotes - 14967 (source: NCBI BLink).  |
AT3G09920.2 | GTGGGACC | PHOSPHATIDYL INOSITOL MONOPHOSPHATE 5 KINASE (PIP5K9); FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity, ATP binding; INVOLVED IN: amino acid metabolic process, carbohydrate metabolic process; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, plant (InterPro:IPR017163), MORN motif (InterPro:IPR003409), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT1G60890.1); Has 21682 Blast hits to 6213 proteins in 379 species: Archae - 0; Bacteria - 2219; Metazoa - 3466; Fungi - 306; Plants - 724; Viruses - 0; Other Eukaryotes - 14967 (source: NCBI BLink).  | |
AT3G10985 | AT3G10985.1 | GGTCCCAC | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis.  |
AT3G12685 | AT3G12685.1 | GGTCCCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24350.1); Has 607 Blast hits to 607 proteins in 199 species: Archae - 0; Bacteria - 356; Metazoa - 0; Fungi - 0; Plants - 100; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink).  |
AT3G13360 | AT3G13360.1 | GTGGGTCCCAC | WPP-domain Interacting Protein 3 (WIP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 130 Blast hits to 126 proteins in 35 species: Archae - 0; Bacteria - 7; Metazoa - 18; Fungi - 8; Plants - 43; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).  |
AT3G13750 | AT3G13750.1 | GGTCCCAC | beta-galactosidase, glycosyl hydrolase family 35  |
AT3G13750.1 | GTGGGACCCA | beta-galactosidase, glycosyl hydrolase family 35  | |
AT3G14410 | AT3G14410.1 | GTGGGACCCAC | transporter-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: organic anion transmembrane transporter (TAIR:AT1G53660.1); Has 1496 Blast hits to 1495 proteins in 199 species: Archae - 4; Bacteria - 38; Metazoa - 438; Fungi - 259; Plants - 598; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT3G14415 | AT3G14415.1 | GTGGGTCCCAC | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: cotyledon, fruit, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14420.2); Has 8872 Blast hits to 8856 proteins in 1094 species: Archae - 112; Bacteria - 3084; Metazoa - 295; Fungi - 423; Plants - 161; Viruses - 0; Other Eukaryotes - 4797 (source: NCBI BLink).  |
AT3G14590 | AT3G14590.1 | GTGGGACC | NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).  |
AT3G14590.2 | GTGGGACC | NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).  | |
AT3G15500 | AT3G15500.1 | GTGGGACCC | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3.  |
AT3G15580 | AT3G15580.1 | ATGACGTGGGACCCA | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition.  |
AT3G17611 | AT3G17611.1 | GTGGGTCCCAC | ARABIDOPSIS RHOMBOID-LIKE PROTEIN 14 (ATRBL14); FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S54, rhomboid (InterPro:IPR002610), Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: ATRBL15 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 15) (TAIR:AT3G58460.1); Has 479 Blast hits to 479 proteins in 160 species: Archae - 8; Bacteria - 189; Metazoa - 73; Fungi - 28; Plants - 84; Viruses - 3; Other Eukaryotes - 94 (source: NCBI BLink).  |
AT3G17611.2 | GTGGGTCCCAC | ARABIDOPSIS RHOMBOID-LIKE PROTEIN 14 (ATRBL14); FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S54, rhomboid (InterPro:IPR002610), Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: ATRBL15 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 15) (TAIR:AT3G58460.1); Has 479 Blast hits to 479 proteins in 160 species: Archae - 8; Bacteria - 189; Metazoa - 73; Fungi - 28; Plants - 84; Viruses - 3; Other Eukaryotes - 94 (source: NCBI BLink).  | |
AT3G17611.3 | GTGGGTCCCAC | ARABIDOPSIS RHOMBOID-LIKE PROTEIN 14 (ATRBL14); FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S54, rhomboid (InterPro:IPR002610), Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: ATRBL15 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 15) (TAIR:AT3G58460.1); Has 479 Blast hits to 479 proteins in 160 species: Archae - 8; Bacteria - 189; Metazoa - 73; Fungi - 28; Plants - 84; Viruses - 3; Other Eukaryotes - 94 (source: NCBI BLink).  | |
AT3G18640 | AT3G18640.1 | GTGGGACC | zinc finger protein-related; FUNCTIONS IN: zinc ion binding, nucleic acid binding; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26850.2); Has 2001 Blast hits to 1797 proteins in 176 species: Archae - 1; Bacteria - 29; Metazoa - 857; Fungi - 186; Plants - 139; Viruses - 45; Other Eukaryotes - 744 (source: NCBI BLink).  |
AT3G20080 | AT3G20080.1 | GGTCCCAC | member of CYP705A  |
AT3G20080.2 | GGTCCCAC | member of CYP705A  | |
AT3G20080.3 | GGTCCCAC | member of CYP705A  | |
AT3G23150 | AT3G23150.1 | GTGGGACC | Involved in ethylene perception in Arabidopsis  |
AT3G24520 | AT3G24520.1 | GGTCCCAC | member of Heat Stress Transcription Factor (Hsf) family  |
AT3G27210 | AT3G27210.1 | GTGGGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40860.1); Has 132 Blast hits to 70 proteins in 18 species: Archae - 0; Bacteria - 6; Metazoa - 65; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT3G27350 | AT3G27350.1 | GTGGGACCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40700.1); Has 156 Blast hits to 128 proteins in 29 species: Archae - 0; Bacteria - 3; Metazoa - 69; Fungi - 4; Plants - 63; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT3G27770 | AT3G27770.1 | GGTCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G27770.2 | GGTCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT3G27820 | AT3G27820.1 | GGTCCCAC | Encodes a peroxisome membrane-bound monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2  |
AT3G28920 | AT3G28920.1 | GGTCCCAC | ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 34 (AtHB34); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox domain, ZF-HD class (InterPro:IPR006455), ZF-HD homeobox protein Cys/His-rich dimerisation region (InterPro:IPR006456), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: AtHB23 (ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 23); DNA binding / transcription factor (TAIR:AT5G39760.1); Has 369 Blast hits to 363 proteins in 70 species: Archae - 0; Bacteria - 8; Metazoa - 31; Fungi - 30; Plants - 274; Viruses - 5; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT3G46620 | AT3G46620.1 | GGTCCCAC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Protein of unknown function DUF1117 (InterPro:IPR010543); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G59550.1); Has 5953 Blast hits to 5931 proteins in 209 species: Archae - 0; Bacteria - 6; Metazoa - 2088; Fungi - 498; Plants - 2518; Viruses - 31; Other Eukaryotes - 812 (source: NCBI BLink).  |
AT3G53800 | AT3G53800.1 | GGTCCCAC | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 461 Blast hits to 458 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 134; Plants - 93; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  |
AT3G54000 | AT3G54000.1 | GGTCCCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G54000.2 | GGTCCCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G54000.3 | GGTCCCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G55850 | AT3G55850.1 | GTGGGACCCA | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids.  |
AT3G63010 | AT3G63010.1 | GTGGGACCCAC | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4.  |
AT4G01330 | AT4G01330.1 | GGTCCCAC | ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G01540.2); Has 62408 Blast hits to 61982 proteins in 2735 species: Archae - 19; Bacteria - 4713; Metazoa - 27742; Fungi - 4275; Plants - 16191; Viruses - 174; Other Eukaryotes - 9294 (source: NCBI BLink).  |
AT4G03390 | AT4G03390.1 | GGTCCCAC | STRUBBELIG-RECEPTOR FAMILY 3 (SRF3); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: SRF1 (strubbelig receptor family 1); kinase (TAIR:AT2G20850.1); Has 104562 Blast hits to 78934 proteins in 2893 species: Archae - 52; Bacteria - 7276; Metazoa - 35203; Fungi - 5374; Plants - 43078; Viruses - 296; Other Eukaryotes - 13283 (source: NCBI BLink).  |
AT4G04190 | AT4G04190.1 | GTGGGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G04190.2 | GTGGGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G17340 | AT4G17340.1 | GTGGGACC | TONOPLAST INTRINSIC PROTEIN 2;2 (TIP2;2); FUNCTIONS IN: water channel activity; INVOLVED IN: transport, response to salt stress; LOCATED IN: plasma membrane, chloroplast, vacuole, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Aquaporin (InterPro:IPR012269), Major intrinsic protein (InterPro:IPR000425); BEST Arabidopsis thaliana protein match is: AtTIP2;3; ammonia transporter/ methylammonium transmembrane transporter/ water channel (TAIR:AT5G47450.1); Has 6879 Blast hits to 6845 proteins in 1255 species: Archae - 57; Bacteria - 2652; Metazoa - 1285; Fungi - 264; Plants - 1472; Viruses - 2; Other Eukaryotes - 1147 (source: NCBI BLink).  |
AT4G17720 | AT4G17720.1 | GGTCCCAC | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: oxidoreductase activity, nucleotide binding, nucleic acid binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G46870.1); Has 381 Blast hits to 361 proteins in 83 species: Archae - 2; Bacteria - 16; Metazoa - 30; Fungi - 84; Plants - 147; Viruses - 12; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT4G20930 | AT4G20930.1 | TGGGTCCCAC | 3-hydroxyisobutyrate dehydrogenase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: pentose-phosphate shunt, valine metabolic process, valine catabolic process, metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), 3-hydroxyisobutyrate dehydrogenase (InterPro:IPR011548), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyisobutyrate dehydrogenase-related, conserved site (InterPro:IPR002204); BEST Arabidopsis thaliana protein match is: GLYR2 (GLYOXYLATE REDUCTASE 2); glyoxylate reductase (NADP)/ phosphogluconate dehydrogenase (decarboxylating) (TAIR:AT1G17650.1); Has 10362 Blast hits to 10344 proteins in 1053 species: Archae - 94; Bacteria - 4661; Metazoa - 269; Fungi - 232; Plants - 134; Viruses - 2; Other Eukaryotes - 4970 (source: NCBI BLink).  |
AT4G24780 | AT4G24780.1 | GTGGGACC | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT5G63180.1); Has 863 Blast hits to 860 proteins in 162 species: Archae - 0; Bacteria - 350; Metazoa - 0; Fungi - 105; Plants - 397; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT4G25050 | AT4G25050.1 | GTGGGACCCAC | encodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light.  |
AT4G25070 | AT4G25070.1 | TGGGTCCCAC | unknown protein; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G48860.2); Has 11240 Blast hits to 8282 proteins in 751 species: Archae - 101; Bacteria - 1089; Metazoa - 6264; Fungi - 802; Plants - 358; Viruses - 71; Other Eukaryotes - 2555 (source: NCBI BLink).  |
AT4G25070.2 | TGGGTCCCAC | unknown protein; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G48860.2); Has 11240 Blast hits to 8282 proteins in 751 species: Archae - 101; Bacteria - 1089; Metazoa - 6264; Fungi - 802; Plants - 358; Viruses - 71; Other Eukaryotes - 2555 (source: NCBI BLink).  | |
AT4G26140 | AT4G26140.1 | TGGGTCCCAC | putative beta-galactosidase  |
AT4G26140.2 | TGGGTCCCAC | putative beta-galactosidase  | |
AT4G26555 | AT4G26555.1 | GTGGGTCCCAC | immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT4G19830.1); Has 2159 Blast hits to 2148 proteins in 673 species: Archae - 12; Bacteria - 1209; Metazoa - 160; Fungi - 145; Plants - 239; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink).  |
AT4G30780 | AT4G30780.1 | GTGGGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24100.1); Has 52 Blast hits to 52 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT4G30940 | AT4G30940.1 | GGTCCCAC | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT2G24240.1); Has 948 Blast hits to 933 proteins in 91 species: Archae - 0; Bacteria - 2; Metazoa - 800; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
AT4G32030 | AT4G32030.1 | TGGGTCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 35 Blast hits to 33 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT4G32030.2 | TGGGTCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 35 Blast hits to 33 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT4G35730 | AT4G35730.1 | GTGGGACC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 510 Blast hits to 497 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 187; Fungi - 123; Plants - 153; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
AT4G35880 | AT4G35880.1 | GTGGGACCCA | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT2G17760.1); Has 1593 Blast hits to 1587 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 284; Fungi - 199; Plants - 1019; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink).  |
AT4G38825 | AT4G38825.1 | GGTCCCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT5G18030.1); Has 584 Blast hits to 581 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 583; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT4G38830 | AT4G38830.1 | GGTCCCAC | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: stem, root; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Protein of unknown function DUF26 (InterPro:IPR002902), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G21410.1); Has 89734 Blast hits to 88617 proteins in 3182 species: Archae - 49; Bacteria - 7747; Metazoa - 38997; Fungi - 7320; Plants - 19858; Viruses - 404; Other Eukaryotes - 15359 (source: NCBI BLink).  |
AT4G39800 | AT4G39800.1 | GTGGGACCCA | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.  |
AT5G01760 | AT5G01760.1 | GTGGGACC | VHS domain-containing protein / GAT domain-containing protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT2G38410.1); Has 1339 Blast hits to 1327 proteins in 151 species: Archae - 0; Bacteria - 8; Metazoa - 746; Fungi - 331; Plants - 152; Viruses - 2; Other Eukaryotes - 100 (source: NCBI BLink).  |
AT5G08330 | AT5G08330.1 | GTGGGACCC | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT5G23280.1); Has 741 Blast hits to 732 proteins in 146 species: Archae - 0; Bacteria - 2; Metazoa - 30; Fungi - 0; Plants - 703; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT5G10100 | AT5G10100.1 | CCCATTATTAGGCCCAGTAGGTCCCAC | trehalose-6-phosphate phosphatase, putative; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: embryo, root; EXPRESSED DURING: C globular stage; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: trehalose-6-phosphate phosphatase, putative (TAIR:AT5G65140.1); Has 1468 Blast hits to 1466 proteins in 515 species: Archae - 29; Bacteria - 765; Metazoa - 195; Fungi - 100; Plants - 258; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).  |
AT5G10110 | AT5G10110.1 | GTGGGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65120.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G19140 | AT5G19140.1 | GGTCCCAC | AILP1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to aluminum ion, response to auxin stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43830.1); Has 1128 Blast hits to 1128 proteins in 380 species: Archae - 4; Bacteria - 553; Metazoa - 42; Fungi - 34; Plants - 256; Viruses - 3; Other Eukaryotes - 236 (source: NCBI BLink).  |
AT5G19140.2 | GGTCCCAC | AILP1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to aluminum ion, response to auxin stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43830.1); Has 1128 Blast hits to 1128 proteins in 380 species: Archae - 4; Bacteria - 553; Metazoa - 42; Fungi - 34; Plants - 256; Viruses - 3; Other Eukaryotes - 236 (source: NCBI BLink).  | |
AT5G19780 | AT5G19780.1 | GTGGGACCCA | Encodes an isoform of alpha tubulin. Closely related to adjacent gene TUA3 suggesting recent duplication.  |
AT5G24610 | AT5G24610.1 | GTGGGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49550.1); Has 29 Blast hits to 29 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G24610.1 | GTGGGACCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49550.1); Has 29 Blast hits to 29 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G24760 | AT5G24760.1 | GTGGGACC | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink).  |
AT5G24760.2 | GTGGGACC | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink).  | |
AT5G24760.3 | GTGGGACC | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink).  | |
AT5G44110 | AT5G44110.1 | GTGGGACC | Encodes a member of the NAP subfamily of ABC transporters.  |
AT5G44110.2 | GTGGGACC | Encodes a member of the NAP subfamily of ABC transporters.  | |
AT5G44110.3 | GTGGGACC | Encodes a member of the NAP subfamily of ABC transporters.  | |
AT5G51110 | AT5G51110.1 | AGTCGGTCCCAC | 4-alpha-hydroxytetrahydrobiopterin dehydratase; FUNCTIONS IN: 4-alpha-hydroxytetrahydrobiopterin dehydratase activity; INVOLVED IN: tetrahydrobiopterin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional coactivator/pterin dehydratase (InterPro:IPR001533); BEST Arabidopsis thaliana protein match is: dehydratase family (TAIR:AT1G29810.1); Has 1563 Blast hits to 1563 proteins in 256 species: Archae - 17; Bacteria - 489; Metazoa - 0; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1013 (source: NCBI BLink).  |
AT5G51120 | AT5G51120.1 | GTGGGACCGACT | Encodes a homolog of the protein PABN1, a polyadenylation factor subunit.  |
AT5G53880 | AT5G53880.1 | GTGGGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1379 Blast hits to 641 proteins in 104 species: Archae - 20; Bacteria - 31; Metazoa - 673; Fungi - 150; Plants - 69; Viruses - 10; Other Eukaryotes - 426 (source: NCBI BLink).  |
AT5G55230 | AT5G55230.1 | TGGGTCCCAC | Binds and bundles microtubules. Plays a role in stabilizing anti-parallel microtubules in the central spindle at anaphase to early cytokinesis but is not essential at the midline of the phragmoplast at later stages. The timing with which the MAP65-1 was targeted to the spindle appears to be regulated by a phosphorylation sensitive switch. Enhances microtubule polymerization, promotes nucleation and stabilizes microtubules against cold treatment and dilution.  |
AT5G56460 | AT5G56460.1 | GTGGGACCCA | protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G01020.1); Has 80161 Blast hits to 79301 proteins in 2452 species: Archae - 44; Bacteria - 7377; Metazoa - 35060; Fungi - 5996; Plants - 18115; Viruses - 334; Other Eukaryotes - 13235 (source: NCBI BLink).  |
AT5G61170 | AT5G61170.1 | GTGGGACC | 40S ribosomal protein S19 (RPS19C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 883 Blast hits to 883 proteins in 288 species: Archae - 134; Bacteria - 5; Metazoa - 345; Fungi - 97; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT5G62020 | AT5G62020.1 | GTGGGACC | member of Heat Stress Transcription Factor (Hsf) family  |
AT5G62570 | AT5G62570.1 | GTGGGTCCCAC | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Calmodulin binding protein-like (InterPro:IPR012416); BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT4G25800.2); Has 164 Blast hits to 160 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 164; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G64740 | AT5G64740.1 | TTAATGGGTCCCAC | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles.  |