AtREG408

Summary of AtREG408 (All List)

Organism Arabidopsis thaliana
ID AtREG408
Sequence CACGTGGA
Annotation ABA
PPDB Motif ACGT bZIP-binding motif, environmental responses
PLACE Motif ACGT ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;
ACGTG ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;
CACGTG "CACGTG motif"; "G-box"; Binding site of Arabidopsis GBF4; C. roseus G-box binding factor 1 (CrGBF1) and 1 (CrGBF2) can act as transcriptional repressors of the Str promoter via direct interaction with the G-box; See S000345; Essential for expression of beta-phaseolin gene during embryogenesis in bean, tobacco, Arabidopsis; Tomato Pti4 (ERF) regulates defense-related gene expression via GCC box and non-GCC box cis-element (Myb1 (GTTAGTT) and G-box (CACGTG)); A prominent hit by in silico analysis in both induced and repressed phyA-responsive promoters (Hudson and Quail 2003); Review by Terzaghi WB, Cashmore AR. "Light-regulated transcription" in Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995);
Total Entry Count 356

Organism	Arabidopsis thaliana
ID	AtREG408
Sequence	`CACGTGGA`
Annotation	`ABA`
PPDB Motif	`ACGT`	`bZIP-binding motif, environmental responses`
PLACE Motif	`ACGT`	`ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;`
`ACGTG`	`ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;`
`CACGTG`	"CACGTG motif"; "G-box"; Binding site of Arabidopsis GBF4; C. roseus G-box binding factor 1 (CrGBF1) and 1 (CrGBF2) can act as transcriptional repressors of the Str promoter via direct interaction with the G-box; See S000345; Essential for expression of beta-phaseolin gene during embryogenesis in bean, tobacco, Arabidopsis; Tomato Pti4 (ERF) regulates defense-related gene expression via GCC box and non-GCC box cis-element (Myb1 (GTTAGTT) and G-box (CACGTG)); A prominent hit by in silico analysis in both induced and repressed phyA-responsive promoters (Hudson and Quail 2003); Review by Terzaghi WB, Cashmore AR. "Light-regulated transcription" in Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995);
Total Entry Count	`356`

Entry Sequences (356 entries)

Locus Gene model Sequence Description
AT1G02930 AT1G02930.1 ATCCACGTGGAC Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).

AT1G04250 AT1G04250.1 ATCCACGTGTCT Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components.

AT1G04630 AT1G04630.1 CACGTGACTCCACGTGAC maternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).

AT1G04635 AT1G04635.1 GTCACGTGGAGTCACGTG EMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).

AT1G07150 AT1G07150.1 ATCCACGTGGG member of MEKK subfamily

AT1G07510 AT1G07510.1 TACACGTGGA encodes an FtsH protease that is localized to the mitochondrion

AT1G08320 AT1G08320.2 TTCCACGTG bZIP family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: bZIP family transcription factor (TAIR:AT5G06839.1); Has 758 Blast hits to 757 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 28; Plants - 577; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).

AT1G09795 AT1G09795.1 ATCCACGTGTAC ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis

AT1G10090 AT1G10090.1 TTCCACGTGTCAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).

AT1G10560 AT1G10560.1 ACCACGTGGAT Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.

AT1G11480 AT1G11480.1 ATCCACGTGTG eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).

AT1G11480.2 ATCCACGTGTG eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).

AT1G13000 AT1G13000.1 ACCACGTGGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26440.2); Has 194 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).

AT1G13000.2 ACCACGTGGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26440.2); Has 194 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).

AT1G13080 AT1G13080.1 AACACGTGGAT cytochrome P450 monooxygenase

AT1G13080.2 AACACGTGGAT cytochrome P450 monooxygenase

AT1G13250 AT1G13250.1 AACACGTGGAA Encodes a protein with putative galacturonosyltransferase activity.

AT1G14010 AT1G14010.1 TCCACGTGTT emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).

AT1G14120 AT1G14120.1 CACGTGGAA 2-oxoglutarate-dependent dioxygenase, putative; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate-dependent dioxygenase, putative (TAIR:AT1G14130.1); Has 4142 Blast hits to 4099 proteins in 511 species: Archae - 0; Bacteria - 408; Metazoa - 75; Fungi - 270; Plants - 2846; Viruses - 0; Other Eukaryotes - 543 (source: NCBI BLink).

AT1G14290 AT1G14290.1 TTAAAGCCACGTGGAA Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth.

AT1G14360 AT1G14360.1 TACACGTGGAA UDP-GALACTOSE TRANSPORTER 3 (UTR3); FUNCTIONS IN: pyrimidine nucleotide sugar transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: UTR1 (UDP-GALACTOSE TRANSPORTER 1); UDP-galactose transmembrane transporter/ UDP-glucose transmembrane transporter/ pyrimidine nucleotide sugar transmembrane transporter (TAIR:AT2G02810.1); Has 750 Blast hits to 744 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 423; Fungi - 103; Plants - 108; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).

AT1G15140 AT1G15140.1 ATCCACGTGGCAA oxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink).

AT1G15140.2 ATCCACGTGGCAA oxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink).

AT1G15140.3 ATCCACGTGGCAA oxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink).

AT1G15180 AT1G15180.1 GTGACACGTGGAC MATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MATE family transporter related protein (InterPro:IPR015521), Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G15170.1); Has 4248 Blast hits to 4206 proteins in 991 species: Archae - 55; Bacteria - 2461; Metazoa - 126; Fungi - 208; Plants - 689; Viruses - 0; Other Eukaryotes - 709 (source: NCBI BLink).

AT1G15180.2 GTGACACGTGGAC MATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MATE family transporter related protein (InterPro:IPR015521), Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G15170.1); Has 4248 Blast hits to 4206 proteins in 991 species: Archae - 55; Bacteria - 2461; Metazoa - 126; Fungi - 208; Plants - 689; Viruses - 0; Other Eukaryotes - 709 (source: NCBI BLink).

AT1G15820 AT1G15820.1 TTCCACGTGTCAT Lhcb6 protein (Lhcb6), light harvesting complex of photosystem II.

AT1G16190 AT1G16190.1 CACGTGGA DNA repair protein RAD23, putative; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, base-excision repair, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: RAD23; damaged DNA binding (TAIR:AT1G79650.2); Has 6642 Blast hits to 3540 proteins in 541 species: Archae - 2; Bacteria - 30; Metazoa - 2967; Fungi - 872; Plants - 1499; Viruses - 130; Other Eukaryotes - 1142 (source: NCBI BLink).

AT1G17760 AT1G17760.1 ATCCACGTGGAC Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit.

AT1G17810 AT1G17810.1 ATCCACGTGTT beta-tonoplast intrinsic protein (beta-TIP) mRNA, complete

AT1G18040 AT1G18040.1 AACACGTGGAT CYCLIN-DEPENDENT KINASE D1;3 (CDKD1;3); FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CDKD1;1 (CYCLIN-DEPENDENT KINASE D1;1); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT1G73690.1); Has 86988 Blast hits to 85857 proteins in 2791 species: Archae - 31; Bacteria - 7397; Metazoa - 37676; Fungi - 8140; Plants - 16874; Viruses - 362; Other Eukaryotes - 16508 (source: NCBI BLink).

AT1G18500 AT1G18500.1 TTCCACGTGGGTCAAA Encodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040).

AT1G19310 AT1G19310.1 CCCACGTGGAA zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G23780.1); Has 3650 Blast hits to 3643 proteins in 226 species: Archae - 0; Bacteria - 2; Metazoa - 2420; Fungi - 377; Plants - 427; Viruses - 21; Other Eukaryotes - 403 (source: NCBI BLink).

AT1G19720 AT1G19720.1 TTCCACGTGTT pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast, cytoplasm; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 22413 Blast hits to 5958 proteins in 201 species: Archae - 3; Bacteria - 14; Metazoa - 387; Fungi - 330; Plants - 20974; Viruses - 0; Other Eukaryotes - 705 (source: NCBI BLink).

AT1G21440 AT1G21440.1 ATGACACGTGGAT mutase family protein; FUNCTIONS IN: isocitrate lyase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Isocitrate lyase and phosphorylmutase, conserved site (InterPro:IPR018523), Isocitrate lyase and phosphorylmutase (InterPro:IPR000918); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 6447 Blast hits to 6447 proteins in 860 species: Archae - 75; Bacteria - 2907; Metazoa - 29; Fungi - 322; Plants - 109; Viruses - 0; Other Eukaryotes - 3005 (source: NCBI BLink).

AT1G23310 AT1G23310.1 AAAACGACGGACACGTGGAT Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.

AT1G23310.2 AAAACGACGGACACGTGGAT Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.

AT1G25520 AT1G25520.1 ATCCACGTGGT unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0016 (InterPro:IPR001727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68650.1); Has 1239 Blast hits to 1181 proteins in 440 species: Archae - 13; Bacteria - 667; Metazoa - 131; Fungi - 99; Plants - 104; Viruses - 0; Other Eukaryotes - 225 (source: NCBI BLink).

AT1G27990 AT1G27990.1 CACGTGGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52420.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G28960 AT1G28960.1 AACACGTGGAC ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink).

AT1G28960.2 AACACGTGGAC ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink).

AT1G28960.3 AACACGTGGAC ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink).

AT1G28960.4 AACACGTGGAC ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink).

AT1G28960.5 AACACGTGGAC ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink).

AT1G32550 AT1G32550.1 TTCCACGTGTT ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).

AT1G32550.2 TTCCACGTGTT ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).

AT1G32560 AT1G32560.1 AACACGTGGAA late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT2G35300.1); Has 190 Blast hits to 190 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 145; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT1G48300 AT1G48300.1 TTCCACGTGGCAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 68 Blast hits to 62 proteins in 29 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 2; Plants - 37; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).

AT1G48920 AT1G48920.1 TCCACGTGGAC Encodes the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants.

AT1G50575 AT1G50575.1 ATCCACGTGTA lysine decarboxylase family protein; FUNCTIONS IN: carboxy-lyase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP00730 (InterPro:IPR005269); Has 2104 Blast hits to 2104 proteins in 559 species: Archae - 2; Bacteria - 1299; Metazoa - 4; Fungi - 31; Plants - 102; Viruses - 0; Other Eukaryotes - 666 (source: NCBI BLink).

AT1G52220 AT1G52220.1 ATGCCACGTGGAT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT1G52220.2 ATGCCACGTGGAT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT1G52220.3 ATGCCACGTGGAT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT1G52230 AT1G52230.1 ATCCACGTGGCAT PHOTOSYSTEM I SUBUNIT H2 (PSAH2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem I reaction centre subunit VI (InterPro:IPR004928); BEST Arabidopsis thaliana protein match is: PSAH-1 (photosystem I subunit H-1) (TAIR:AT3G16140.1); Has 72 Blast hits to 72 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT1G55820 AT1G55820.1 GTCCACGTGTCT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1296 (InterPro:IPR009719); BEST Arabidopsis thaliana protein match is: GIP1 (GBF-INTERACTING PROTEIN 1); unfolded protein binding (TAIR:AT3G13222.1); Has 1009 Blast hits to 462 proteins in 111 species: Archae - 0; Bacteria - 42; Metazoa - 245; Fungi - 90; Plants - 135; Viruses - 12; Other Eukaryotes - 485 (source: NCBI BLink).

AT1G56220 AT1G56220.1 ATCCACGTGGCAC dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT1G56220.2 ATCCACGTGGCAC dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT1G56220.3 ATCCACGTGGCAC dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT1G56220.4 ATCCACGTGGCAC dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT1G57540 AT1G57540.1 AGACACGTGGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G57540.2 AGACACGTGGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G57540.3 AGACACGTGGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G58200 AT1G58200.1 CACGTGGAA A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity.

AT1G58200.2 CACGTGGAA A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity.

AT1G61520 AT1G61520.1 ATTGCCACGTGGAC PSI type III chlorophyll a/b-binding protein (Lhca3*1)

AT1G61520.2 ATTGCCACGTGGAC PSI type III chlorophyll a/b-binding protein (Lhca3*1)

AT1G61780 AT1G61780.1 ACCACGTGGAA postsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).

AT1G61780.1 ACCACGTGGAT postsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).

AT1G61790 AT1G61790.1 ATCCACGTGGT OST3/OST6 family protein; FUNCTIONS IN: oligosaccharide transmembrane transporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: OST3/OST6 (InterPro:IPR006844); BEST Arabidopsis thaliana protein match is: OST3/OST6 family protein (TAIR:AT1G11560.1); Has 268 Blast hits to 268 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 171; Fungi - 49; Plants - 34; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).

AT1G61790.1 TTCCACGTGGT OST3/OST6 family protein; FUNCTIONS IN: oligosaccharide transmembrane transporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: OST3/OST6 (InterPro:IPR006844); BEST Arabidopsis thaliana protein match is: OST3/OST6 family protein (TAIR:AT1G11560.1); Has 268 Blast hits to 268 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 171; Fungi - 49; Plants - 34; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).

AT1G62305 AT1G62305.1 TACACGTGGAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11940.1); Has 342 Blast hits to 342 proteins in 16 species: Archae - 0; Bacteria - 9; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).

AT1G62305.2 TACACGTGGAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11940.1); Has 342 Blast hits to 342 proteins in 16 species: Archae - 0; Bacteria - 9; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).

AT1G65730 AT1G65730.1 GTCCACGTG Arabidopsis thaliana metal-nicotianamine transporter YSL4

AT1G67090 AT1G67090.1 TTCCACGTGGCAT RIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN 1A (RBCS1A); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity, copper ion binding; INVOLVED IN: response to blue light, response to cold, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 10 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, seedling growth; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1759 Blast hits to 1738 proteins in 405 species: Archae - 0; Bacteria - 340; Metazoa - 0; Fungi - 0; Plants - 872; Viruses - 0; Other Eukaryotes - 547 (source: NCBI BLink).

AT1G67090.2 TTCCACGTGGCAT RIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN 1A (RBCS1A); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity, copper ion binding; INVOLVED IN: response to blue light, response to cold, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 10 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, seedling growth; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1759 Blast hits to 1738 proteins in 405 species: Archae - 0; Bacteria - 340; Metazoa - 0; Fungi - 0; Plants - 872; Viruses - 0; Other Eukaryotes - 547 (source: NCBI BLink).

AT1G69870 AT1G69870.1 CACGTGGA proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: response to salt stress, oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: NRT1.6 (NITRATE TRANSPORTER 1.6); low affinity nitrate transmembrane transporter/ transporter (TAIR:AT1G27080.1); Has 2739 Blast hits to 2630 proteins in 509 species: Archae - 0; Bacteria - 693; Metazoa - 468; Fungi - 272; Plants - 1130; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink).

AT1G70710 AT1G70710.1 TCCACGTGGT endo-1,4-beta-glucanase. Involved in cell elongation.

AT1G70760 AT1G70760.1 ATGACACGTGGAA a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity.

AT1G72020 AT1G72020.1 TACACGTGGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G72500 AT1G72500.1 TTCCACGTGTAC inter-alpha-trypsin inhibitor heavy chain-related; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: inter-alpha-trypsin inhibitor heavy chain-related (TAIR:AT1G19110.1); Has 1082 Blast hits to 1082 proteins in 207 species: Archae - 2; Bacteria - 371; Metazoa - 410; Fungi - 36; Plants - 60; Viruses - 0; Other Eukaryotes - 203 (source: NCBI BLink).

AT1G73120 AT1G73120.1 ATGCCACGTGGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; EXPRESSED IN: root, cultured cell; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G73170 AT1G73170.1 GTCCACGTGGT ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).

AT1G73170.2 GTCCACGTGGT ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).

AT1G74450 AT1G74450.1 TTCCACGTG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF793 (InterPro:IPR008511); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G18740.1); Has 121 Blast hits to 121 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 121; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G74780 AT1G74780.1 TCCACGTGTCAT nodulin family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT1G18940.1); Has 1801 Blast hits to 1756 proteins in 510 species: Archae - 9; Bacteria - 869; Metazoa - 40; Fungi - 217; Plants - 319; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink).

AT1G74930 AT1G74930.1 CACGTGGAA encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.

AT1G75080 AT1G75080.1 TACACGTGGAC Encodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities.

AT1G75080.2 TACACGTGGAC Encodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities.

AT1G75560 AT1G75560.1 TTCCACGTG zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink).

AT1G75560.2 TTCCACGTG zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink).

AT1G75760 AT1G75760.1 ATCCACGTGTCAC ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT1G19970.1); Has 627 Blast hits to 627 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 264; Fungi - 115; Plants - 120; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).

AT1G77120 AT1G77120.1 ATGCCACGTGGAC Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.

AT1G77510 AT1G77510.1 TCCACGTGTA Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response.

AT1G79440 AT1G79440.1 CGGTTAAACTGCCACGTGGAT Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004).

AT1G79650 AT1G79650.1 TGTCACGTGGAT putative DNA repair protein RAD23

AT1G79650.2 TGTCACGTGGAT putative DNA repair protein RAD23

AT1G79650.3 TGTCACGTGGAT putative DNA repair protein RAD23

AT1G80030 AT1G80030.1 ATCCACGTG DNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT3G17830.1); Has 20943 Blast hits to 20164 proteins in 2101 species: Archae - 124; Bacteria - 6520; Metazoa - 3750; Fungi - 1621; Plants - 1440; Viruses - 18; Other Eukaryotes - 7470 (source: NCBI BLink).

AT1G80030.2 ATCCACGTG DNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT3G17830.1); Has 20943 Blast hits to 20164 proteins in 2101 species: Archae - 124; Bacteria - 6520; Metazoa - 3750; Fungi - 1621; Plants - 1440; Viruses - 18; Other Eukaryotes - 7470 (source: NCBI BLink).

AT1G80030.3 ATCCACGTG DNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT3G17830.1); Has 20943 Blast hits to 20164 proteins in 2101 species: Archae - 124; Bacteria - 6520; Metazoa - 3750; Fungi - 1621; Plants - 1440; Viruses - 18; Other Eukaryotes - 7470 (source: NCBI BLink).

AT2G01490 AT2G01490.1 ATCCACGTGGAA phytanoyl-CoA dioxygenase (PhyH) family protein; FUNCTIONS IN: phytanoyl-CoA dioxygenase activity; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phytanoyl-CoA dioxygenase (InterPro:IPR008775); Has 2632 Blast hits to 2624 proteins in 223 species: Archae - 0; Bacteria - 300; Metazoa - 320; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 1913 (source: NCBI BLink).

AT2G02180 AT2G02180.1 GTGCCACGTGGA Necessary for the efficient multiplication of tobamoviruses.

AT2G02810 AT2G02810.1 TTCCACGTGGAA Encodes a multitransmembrane hydrophobic protein that functions as transporter of UDP-galactose and UDP-glucose into the Golgi. Localized in the ER. Involved in the unfolded protein response, a mechanism that controls proper protein folding in the ER.

AT2G03820 AT2G03820.1 ATGACACGTGGAT nonsense-mediated mRNA decay NMD3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: nuclear-transcribed mRNA catabolic process, nonsense-mediated decay; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NMD3 (InterPro:IPR007064); Has 355 Blast hits to 345 proteins in 156 species: Archae - 8; Bacteria - 0; Metazoa - 129; Fungi - 90; Plants - 42; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).

AT2G04350 AT2G04350.1 ATCCACGTGTCC long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).

AT2G04350.2 ATCCACGTGTCC long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).

AT2G04550 AT2G04550.1 TCCACGTGGCAC Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid.

AT2G04550.3 TCCACGTGGCAC Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid.

AT2G16600 AT2G16600.1 TCCACGTGTCA Encodes cytosolic cyclophilin ROC3.

AT2G16600.2 TCCACGTGTCA Encodes cytosolic cyclophilin ROC3.

AT2G21330 AT2G21330.1 ATCCACGTGGCAA fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink).

AT2G21330.2 ATCCACGTGGCAA fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink).

AT2G21330.3 ATCCACGTGGCAA fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink).

AT2G27860 AT2G27860.1 CACGTGGAA Encodes UDP-d-apiose/UDP-d-xylose synthase that requires NAD+ for enzymatic activity and is strongly inhibited by UDP-d-galacturonate.

AT2G30570 AT2G30570.1 ATGACACGTGGA Encodes a protein similar to photosystem II reaction center subunit W.

AT2G32510 AT2G32510.1 ATCCACGTGTG member of MEKK subfamily

AT2G33380 AT2G33380.1 ACCACGTGGAT Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers.

AT2G33380.2 ACCACGTGGAT Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers.

AT2G34620 AT2G34620.1 GTGCCACGTGGAA mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G03050.1); Has 469 Blast hits to 329 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 0; Plants - 400; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).

AT2G35260 AT2G35260.1 TCCACGTGTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17840.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G37880 AT2G37880.1 TTCCACGTGTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21050.1); Has 134 Blast hits to 134 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 134; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G37880.1 TTCCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21050.1); Has 134 Blast hits to 134 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 134; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G39730 AT2G39730.1 TTCCACGTGGAC Rubisco activase, a nuclear-encoded chloroplast protein that consists of two isoforms arising from alternative splicing in most plants. Required for the light activation of rubisco.

AT2G39730.2 TTCCACGTGGAC Rubisco activase, a nuclear-encoded chloroplast protein that consists of two isoforms arising from alternative splicing in most plants. Required for the light activation of rubisco.

AT2G39730.3 TTCCACGTGGAC Rubisco activase, a nuclear-encoded chloroplast protein that consists of two isoforms arising from alternative splicing in most plants. Required for the light activation of rubisco.

AT2G41430 AT2G41430.1 TACACGTGGAC Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.

AT2G41430.2 TACACGTGGAC Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.

AT2G41430.3 TACACGTGGAC Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.

AT2G41430.4 TACACGTGGAC Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.

AT2G42560 AT2G42560.1 TCCACGTG late embryogenesis abundant domain-containing protein / LEA domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein (InterPro:IPR004238); BEST Arabidopsis thaliana protein match is: ATECP63 (EMBRYONIC CELL PROTEIN 63) (TAIR:AT2G36640.1); Has 12374 Blast hits to 7501 proteins in 1066 species: Archae - 63; Bacteria - 4676; Metazoa - 2087; Fungi - 744; Plants - 1442; Viruses - 129; Other Eukaryotes - 3233 (source: NCBI BLink).

AT2G42790 AT2G42790.1 TACACGTGGAT Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development.

AT2G45730 AT2G45730.1 TTCCACGTGGAT eukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).

AT2G45740 AT2G45740.1 ATCCACGTGGAA member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.

AT2G45740.2 ATCCACGTGGAA member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.

AT2G45740.3 ATCCACGTGGAA member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.

AT3G01060 AT3G01060.1 TTAAACCGGTCCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink).

AT3G01060.2 TTAAACCGGTCCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink).

AT3G01060.3 TTAAACCGGTCCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink).

AT3G01680 AT3G01680.1 CACGTGGAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01670.1); Has 49 Blast hits to 46 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G02480 AT3G02480.1 AACACGTGGAT ABA-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38760.1); Has 144 Blast hits to 124 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G02480.1 CGACACGTGGA ABA-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38760.1); Has 144 Blast hits to 124 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G02570 AT3G02570.1 GTCCACGTGGAC Encodes a protein with phosphomannose isomerase activity.

AT3G03150 AT3G03150.1 AGACACGTGGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G03160 AT3G03160.1 ATCCACGTGTCT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G04940 AT3G04940.1 GTCCACGTGAC Encodes cysteine synthase CysD1.

AT3G05200 AT3G05200.1 TTGCCACGTGGAA Encodes a putative RING-H2 zinc finger protein ATL6 (ATL6).

AT3G05260 AT3G05260.1 CCCACGTGGAC short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: binding / catalytic/ oxidoreductase (TAIR:AT1G54870.1); Has 80754 Blast hits to 80610 proteins in 2221 species: Archae - 465; Bacteria - 44840; Metazoa - 4442; Fungi - 3990; Plants - 1473; Viruses - 7; Other Eukaryotes - 25537 (source: NCBI BLink).

AT3G05380 AT3G05380.1 ATCCACGTGGAC DNA binding / nucleic acid binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding, nucleic acid binding; CONTAINS InterPro DOMAIN/s: Myb, DNA-binding (InterPro:IPR014778), Tudor (InterPro:IPR002999), DIRP (InterPro:IPR010561); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT5G27610.1); Has 3053 Blast hits to 2257 proteins in 222 species: Archae - 0; Bacteria - 292; Metazoa - 1632; Fungi - 288; Plants - 143; Viruses - 7; Other Eukaryotes - 691 (source: NCBI BLink).

AT3G05380.2 ATCCACGTGGAC DNA binding / nucleic acid binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding, nucleic acid binding; CONTAINS InterPro DOMAIN/s: Myb, DNA-binding (InterPro:IPR014778), Tudor (InterPro:IPR002999), DIRP (InterPro:IPR010561); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT5G27610.1); Has 3053 Blast hits to 2257 proteins in 222 species: Archae - 0; Bacteria - 292; Metazoa - 1632; Fungi - 288; Plants - 143; Viruses - 7; Other Eukaryotes - 691 (source: NCBI BLink).

AT3G05858 AT3G05858.1 GTCCACGTGTCT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G26620.1); Has 26 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G05890 AT3G05890.1 ACCACGTGGAT RARE-COLD-INDUCIBLE 2B (RCI2B); INVOLVED IN: response to cold; LOCATED IN: integral to membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: RCI2A (RARE-COLD-INDUCIBLE 2A) (TAIR:AT3G05880.1); Has 905 Blast hits to 905 proteins in 327 species: Archae - 0; Bacteria - 464; Metazoa - 38; Fungi - 185; Plants - 185; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).

AT3G06868 AT3G06868.1 GGACACGTGGAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49100.1); Has 1032 Blast hits to 474 proteins in 98 species: Archae - 0; Bacteria - 49; Metazoa - 464; Fungi - 149; Plants - 38; Viruses - 14; Other Eukaryotes - 318 (source: NCBI BLink).

AT3G09150 AT3G09150.1 TTCCACGTGGCGG Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast.

AT3G09150.2 TTCCACGTGGCGG Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast.

AT3G09150.3 TTCCACGTGGCGG Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast.

AT3G09670 AT3G09670.1 CCGCCACGTGGAC PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT5G02950.1); Has 722 Blast hits to 638 proteins in 104 species: Archae - 0; Bacteria - 10; Metazoa - 436; Fungi - 38; Plants - 69; Viruses - 0; Other Eukaryotes - 169 (source: NCBI BLink).

AT3G09670.2 CCGCCACGTGGAC PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT5G02950.1); Has 722 Blast hits to 638 proteins in 104 species: Archae - 0; Bacteria - 10; Metazoa - 436; Fungi - 38; Plants - 69; Viruses - 0; Other Eukaryotes - 169 (source: NCBI BLink).

AT3G10330 AT3G10330.1 AGACACGTGGAC transcription initiation factor IIB-2 / general transcription factor TFIIB-2 (TFIIB2); FUNCTIONS IN: protein binding, RNA polymerase II transcription factor activity, transcription regulator activity, zinc ion binding, translation initiation factor activity; INVOLVED IN: translational initiation, regulation of transcription, DNA-dependent, transcription initiation, regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor TFIIB related (InterPro:IPR000812), Cyclin-like (InterPro:IPR011028), Transcription factor TFIIB, cyclin-related (InterPro:IPR013150), Cyclin-related (InterPro:IPR013763), Zinc finger, TFIIB-type (InterPro:IPR013137), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: TFIIB (TRANSCRIPTION FACTOR II B); RNA polymerase II transcription factor/ protein binding / transcription regulator/ translation initiation factor/ zinc ion binding (TAIR:AT2G41630.1); Has 1521 Blast hits to 1508 proteins in 255 species: Archae - 348; Bacteria - 0; Metazoa - 268; Fungi - 189; Plants - 107; Viruses - 10; Other Eukaryotes - 599 (source: NCBI BLink).

AT3G10420 AT3G10420.1 TCCACGTGGCGCCACGTG sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase (TAIR:AT1G73170.1); Has 837 Blast hits to 828 proteins in 331 species: Archae - 16; Bacteria - 586; Metazoa - 12; Fungi - 5; Plants - 64; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).

AT3G10420.2 TCCACGTGGCGCCACGTG sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase (TAIR:AT1G73170.1); Has 837 Blast hits to 828 proteins in 331 species: Archae - 16; Bacteria - 586; Metazoa - 12; Fungi - 5; Plants - 64; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).

AT3G10500 AT3G10500.1 TTCCACGTGTCA Arabidopsis NAC domain containing protein 53 (anac053); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC2; transcription factor (TAIR:AT5G04410.1); Has 1637 Blast hits to 1630 proteins in 61 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 3; Plants - 1621; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).

AT3G11050 AT3G11050.1 TTCCACGTGTCC ferritin 2 (ATFER2); FUNCTIONS IN: oxidoreductase activity, ferric iron binding, binding, transition metal ion binding; INVOLVED IN: response to oxidative stress, cellular iron ion homeostasis, response to abscisic acid stimulus, iron ion transport; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Ferritin, N-terminal (InterPro:IPR001519), Ferritin-related (InterPro:IPR012347), Ferritin-like (InterPro:IPR009040), Ferritin, conserved site (InterPro:IPR014034), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Ferritin and Dps (InterPro:IPR008331); BEST Arabidopsis thaliana protein match is: ATFER4 (ferritin 4); binding / ferric iron binding / oxidoreductase/ transition metal ion binding (TAIR:AT2G40300.1); Has 2388 Blast hits to 2383 proteins in 603 species: Archae - 119; Bacteria - 761; Metazoa - 1101; Fungi - 6; Plants - 217; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).

AT3G11590 AT3G11590.1 ACCACGTGGAC unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22310.1); Has 18950 Blast hits to 12386 proteins in 794 species: Archae - 267; Bacteria - 1381; Metazoa - 9845; Fungi - 1311; Plants - 683; Viruses - 61; Other Eukaryotes - 5402 (source: NCBI BLink).

AT3G11670 AT3G11670.1 TTCCACGTGTT Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE).

AT3G11670.2 TTCCACGTGTT Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE).

AT3G11910 AT3G11910.1 TACACGTGGA UBIQUITIN-SPECIFIC PROTEASE 13 (UBP13); FUNCTIONS IN: ubiquitin-specific protease activity, ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (InterPro:IPR018200), MATH (InterPro:IPR002083), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: UBP12 (UBIQUITIN-SPECIFIC PROTEASE 12); ubiquitin thiolesterase/ ubiquitin-specific protease (TAIR:AT5G06600.1); Has 5914 Blast hits to 5327 proteins in 200 species: Archae - 0; Bacteria - 15; Metazoa - 3076; Fungi - 783; Plants - 832; Viruses - 7; Other Eukaryotes - 1201 (source: NCBI BLink).

AT3G12510 AT3G12510.1 GTACACGTGGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte, flower, pollen tube, seed; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, E expanded cotyledon stage; Has 36 Blast hits to 36 proteins in 5 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G14180 AT3G14180.1 TTCCACGTGTCC transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).

AT3G15280 AT3G15280.1 GTCCACGTGTCG unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G15290 AT3G15290.1 CGACACGTGGAC 3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink).

AT3G15420 AT3G15420.1 TGACACGTGGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80745.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G15430 AT3G15430.1 TTCCACGTGTCA regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink).

AT3G15430.2 TTCCACGTGTCA regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink).

AT3G15500 AT3G15500.1 ATCCACGTGTCAT Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3.

AT3G15540 AT3G15540.1 TCCACGTGTCG IAA induced protein 19

AT3G16140 AT3G16140.1 TTCCACGTGGCAT Encodes subunit H of photosystem I reaction center subunit VI.

AT3G18570 AT3G18570.1 TCCACGTGTT glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: glycine-rich protein / oleosin (TAIR:AT1G48990.1); Has 235 Blast hits to 235 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 235; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G19540 AT3G19540.1 ATCCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G49840.1); Has 153 Blast hits to 150 proteins in 31 species: Archae - 0; Bacteria - 3; Metazoa - 14; Fungi - 12; Plants - 117; Viruses - 5; Other Eukaryotes - 2 (source: NCBI BLink).

AT3G19840 AT3G19840.1 ATCCACGTGCG FF domain-containing protein / WW domain-containing protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FF (InterPro:IPR002713), WW/Rsp5/WWP (InterPro:IPR001202); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G44910.2); Has 6807 Blast hits to 5122 proteins in 338 species: Archae - 15; Bacteria - 265; Metazoa - 3466; Fungi - 821; Plants - 326; Viruses - 6; Other Eukaryotes - 1908 (source: NCBI BLink).

AT3G20910 AT3G20910.1 CACGTGGAC NUCLEAR FACTOR Y, SUBUNIT A9 (NF-YA9); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289), CCAAT-binding factor, conserved site (InterPro:IPR018362); BEST Arabidopsis thaliana protein match is: NF-YA1 (NUCLEAR FACTOR Y, SUBUNIT A1); transcription factor (TAIR:AT5G12840.4); Has 452 Blast hits to 452 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 97; Plants - 214; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).

AT3G21890 AT3G21890.1 ATCCACGTGTCC zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: response to UV-B, regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G15248.1); Has 963 Blast hits to 745 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 953; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).

AT3G23230 AT3G23230.1 ACCACGTGGAA encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.

AT3G24190 AT3G24190.1 TTGCCACGTGGAC ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Aminoglycoside phosphotransferase (InterPro:IPR002575), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7527 Blast hits to 7489 proteins in 1103 species: Archae - 67; Bacteria - 2650; Metazoa - 374; Fungi - 312; Plants - 357; Viruses - 14; Other Eukaryotes - 3753 (source: NCBI BLink).

AT3G29575 AT3G29575.1 TTCCACGTGTCGTT ABI FIVE BINDING PROTEIN 3 (AFP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: TMAC2 (TWO OR MORE ABRES-CONTAINING GENE 2) (TAIR:AT3G02140.1); Has 97 Blast hits to 94 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).

AT3G29575.3 TTCCACGTGTCGTT ABI FIVE BINDING PROTEIN 3 (AFP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: TMAC2 (TWO OR MORE ABRES-CONTAINING GENE 2) (TAIR:AT3G02140.1); Has 97 Blast hits to 94 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).

AT3G29575.4 TTCCACGTGTCGTT ABI FIVE BINDING PROTEIN 3 (AFP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: TMAC2 (TWO OR MORE ABRES-CONTAINING GENE 2) (TAIR:AT3G02140.1); Has 97 Blast hits to 94 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).

AT3G44880 AT3G44880.1 TCCACGTGTT Encodes a pheide a oxygenase (PAO). Accelerated cell death (acd1) mutants show rapid, spreading necrotic responses to both virulent and avirulent Pseudomonas syringae pv. maculicola or pv. tomato pathogens and to ethylene.

AT3G47340 AT3G47340.1 AACACGTGGAA encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.

AT3G47340.2 AACACGTGGAA encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.

AT3G47340.3 AACACGTGGAA encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.

AT3G48530 AT3G48530.1 TTCCACGTGTCA SNF1-RELATED PROTEIN KINASE REGULATORY SUBUNIT GAMMA 1 (KING1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT1G69800.2); Has 1838 Blast hits to 1829 proteins in 530 species: Archae - 94; Bacteria - 923; Metazoa - 290; Fungi - 92; Plants - 72; Viruses - 0; Other Eukaryotes - 367 (source: NCBI BLink).

AT3G49530 AT3G49530.1 TTCCACGTGTCAT Arabidopsis NAC domain containing protein 62 (anac062); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: TIP (TCV-INTERACTING PROTEIN); transcription coactivator/ transcription factor (TAIR:AT5G24590.2); Has 1568 Blast hits to 1566 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1568; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G50860 AT3G50860.1 TACACGTGGA clathrin adaptor complex small chain family protein; FUNCTIONS IN: protein transporter activity, protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport, protein transport; LOCATED IN: membrane coat, clathrin vesicle coat; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex, sigma subunit (InterPro:IPR016635), Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT2G19790.1); Has 1471 Blast hits to 1469 proteins in 183 species: Archae - 0; Bacteria - 0; Metazoa - 751; Fungi - 281; Plants - 166; Viruses - 0; Other Eukaryotes - 273 (source: NCBI BLink).

AT3G50920 AT3G50920.1 ATGCCACGTGGAA phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).

AT3G50920.2 ATGCCACGTGGAA phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).

AT3G52090 AT3G52090.1 AACACGTGGA Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB11 and the E. oli RNA polymerase alpha subunit.

AT3G53180 AT3G53180.1 CACGTGGACACGTG catalytic/ glutamate-ammonia ligase; FUNCTIONS IN: glutamate-ammonia ligase activity, catalytic activity; INVOLVED IN: nitrogen compound metabolic process, N-terminal protein myristoylation, nitrogen fixation, metabolic process, glutamine biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutamine synthetase, catalytic region (InterPro:IPR008146), Glutamine synthetase, beta-Grasp (InterPro:IPR008147), Glutamine synthetase/guanido kinase, catalytic region (InterPro:IPR014746), Amidohydrolase 2 (InterPro:IPR006992); Has 10584 Blast hits to 10580 proteins in 1411 species: Archae - 190; Bacteria - 5115; Metazoa - 86; Fungi - 146; Plants - 34; Viruses - 0; Other Eukaryotes - 5013 (source: NCBI BLink).

AT3G53180.1 GGACACGTGGA catalytic/ glutamate-ammonia ligase; FUNCTIONS IN: glutamate-ammonia ligase activity, catalytic activity; INVOLVED IN: nitrogen compound metabolic process, N-terminal protein myristoylation, nitrogen fixation, metabolic process, glutamine biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutamine synthetase, catalytic region (InterPro:IPR008146), Glutamine synthetase, beta-Grasp (InterPro:IPR008147), Glutamine synthetase/guanido kinase, catalytic region (InterPro:IPR014746), Amidohydrolase 2 (InterPro:IPR006992); Has 10584 Blast hits to 10580 proteins in 1411 species: Archae - 190; Bacteria - 5115; Metazoa - 86; Fungi - 146; Plants - 34; Viruses - 0; Other Eukaryotes - 5013 (source: NCBI BLink).

AT3G54760 AT3G54760.1 AGCCACGTGGAT dentin sialophosphoprotein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: guard cell, cultured cell; BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT5G02950.1); Has 22290 Blast hits to 12629 proteins in 895 species: Archae - 109; Bacteria - 4489; Metazoa - 8055; Fungi - 2114; Plants - 799; Viruses - 230; Other Eukaryotes - 6494 (source: NCBI BLink).

AT3G54960 AT3G54960.1 ATCCACGTGAC Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.

AT3G54960.2 ATCCACGTGAC Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.

AT3G55140 AT3G55140.1 GTCCACGTGAC pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).

AT3G55140.2 GTCCACGTGAC pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).

AT3G55240 AT3G55240.1 CACGTGGA Overexpression leads to PEL (Pseudo-Etiolation in Light) phenotype.

AT3G57050 AT3G57050.1 TCCACGTGTT Encodes second enzyme in the methionine biosynthetic pathway

AT3G57050.2 TCCACGTGTT Encodes second enzyme in the methionine biosynthetic pathway

AT3G57050.3 TCCACGTGTT Encodes second enzyme in the methionine biosynthetic pathway

AT3G57560 AT3G57560.1 TCCACGTGGAC encodes a N-acetylglutamate kinase, involved in arginine biosynthesis

AT3G57570 AT3G57570.1 GTCCACGTGGA binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 29 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).

AT3G58980 AT3G58980.1 TTGCCACGTGGAA F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58920.1); Has 1321 Blast hits to 1026 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 1320; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G61260 AT3G61260.1 CACGTGGAT DNA-binding family protein / remorin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G45820.1); Has 7363 Blast hits to 4653 proteins in 692 species: Archae - 12; Bacteria - 1846; Metazoa - 1409; Fungi - 602; Plants - 495; Viruses - 172; Other Eukaryotes - 2827 (source: NCBI BLink).

AT3G61860 AT3G61860.1 TCCACGTGTCA encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined.

AT3G61870 AT3G61870.1 TGACACGTGGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).

AT3G61870.2 TGACACGTGGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).

AT3G62600 AT3G62600.1 ATCCACGTGGCT J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast.

AT3G63070 AT3G63070.1 CACGTGGAT PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G48160.1); Has 977 Blast hits to 907 proteins in 123 species: Archae - 0; Bacteria - 34; Metazoa - 607; Fungi - 134; Plants - 84; Viruses - 0; Other Eukaryotes - 118 (source: NCBI BLink).

AT4G00490 AT4G00490.1 ACGCCACGTGGAT Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. Mutant of BAM2 has no visible phenotype.

AT4G00570 AT4G00570.1 GTCCACGTGGCGA malate oxidoreductase, putative; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor, malic enzyme activity, ATP binding; INVOLVED IN: oxidation reduction, malate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Malic oxidoreductase (InterPro:IPR001891), Malic enzyme, NAD-binding (InterPro:IPR012302), Malic enzyme, conserved site (InterPro:IPR015884), Malic enzyme, N-terminal (InterPro:IPR012301), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: malate oxidoreductase, putative (TAIR:AT2G13560.1); Has 5867 Blast hits to 5857 proteins in 1333 species: Archae - 86; Bacteria - 3255; Metazoa - 553; Fungi - 155; Plants - 271; Viruses - 0; Other Eukaryotes - 1547 (source: NCBI BLink).

AT4G00710 AT4G00710.1 CACGTGGAT Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized.

AT4G01050 AT4G01050.1 TTCCACGTGTCA hydroxyproline-rich glycoprotein family protein, contains a rhodanese homology domain.

AT4G01150 AT4G01150.1 TTCCACGTGTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38100.1); Has 229 Blast hits to 229 proteins in 43 species: Archae - 0; Bacteria - 81; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).

AT4G01150.2 TTCCACGTGTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38100.1); Has 229 Blast hits to 229 proteins in 43 species: Archae - 0; Bacteria - 81; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).

AT4G04020 AT4G04020.1 ATCCACGTGTCA Fibrillin precursor protein. The fibrillin preprotein, but not the mature protein interacts with ABI2. Regulated by abscisic acid response regulators. Involved in abscisic acid-mediated photoprotection.

AT4G04870 AT4G04870.1 ATCCACGTGTT Encodes a protein with cardiolipin synthase activity that is localized to the mitochondiria.

AT4G09650 AT4G09650.1 TCCACGTGTCG Encodes the chloroplast ATPase delta-subunit.

AT4G10310 AT4G10310.1 TTCCACGTG encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots.

AT4G11570 AT4G11570.1 GGACACGTGGAT haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).

AT4G11570.2 GGACACGTGGAT haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).

AT4G11600 AT4G11600.1 ATCCACGTGTCT Encodes glutathione peroxidase.

AT4G12790 AT4G12790.1 ATCCACGTGAGACACGT ATP-binding family protein; FUNCTIONS IN: nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, ATP binding (InterPro:IPR004130); BEST Arabidopsis thaliana protein match is: QQT1 (QUATRE-QUART 1); ATP binding / nucleotide binding (TAIR:AT5G22370.2); Has 1073 Blast hits to 1063 proteins in 199 species: Archae - 79; Bacteria - 0; Metazoa - 345; Fungi - 272; Plants - 80; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink).

AT4G12790.2 ATCCACGTGAGACACGT ATP-binding family protein; FUNCTIONS IN: nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, ATP binding (InterPro:IPR004130); BEST Arabidopsis thaliana protein match is: QQT1 (QUATRE-QUART 1); ATP binding / nucleotide binding (TAIR:AT5G22370.2); Has 1073 Blast hits to 1063 proteins in 199 species: Archae - 79; Bacteria - 0; Metazoa - 345; Fungi - 272; Plants - 80; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink).

AT4G12790.3 ATCCACGTGAGACACGT ATP-binding family protein; FUNCTIONS IN: nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, ATP binding (InterPro:IPR004130); BEST Arabidopsis thaliana protein match is: QQT1 (QUATRE-QUART 1); ATP binding / nucleotide binding (TAIR:AT5G22370.2); Has 1073 Blast hits to 1063 proteins in 199 species: Archae - 79; Bacteria - 0; Metazoa - 345; Fungi - 272; Plants - 80; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink).

AT4G12790.4 ATCCACGTGAGACACGT ATP-binding family protein; FUNCTIONS IN: nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, ATP binding (InterPro:IPR004130); BEST Arabidopsis thaliana protein match is: QQT1 (QUATRE-QUART 1); ATP binding / nucleotide binding (TAIR:AT5G22370.2); Has 1073 Blast hits to 1063 proteins in 199 species: Archae - 79; Bacteria - 0; Metazoa - 345; Fungi - 272; Plants - 80; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink).

AT4G12790.5 ATCCACGTGAGACACGT ATP-binding family protein; FUNCTIONS IN: nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, ATP binding (InterPro:IPR004130); BEST Arabidopsis thaliana protein match is: QQT1 (QUATRE-QUART 1); ATP binding / nucleotide binding (TAIR:AT5G22370.2); Has 1073 Blast hits to 1063 proteins in 199 species: Archae - 79; Bacteria - 0; Metazoa - 345; Fungi - 272; Plants - 80; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink).

AT4G13160 AT4G13160.1 TGTCACGTGGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF593 (InterPro:IPR007656); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G13630.1); Has 3849 Blast hits to 2651 proteins in 230 species: Archae - 12; Bacteria - 138; Metazoa - 1303; Fungi - 201; Plants - 240; Viruses - 104; Other Eukaryotes - 1851 (source: NCBI BLink).

AT4G15120 AT4G15120.1 ATCCACGTGTCC VQ motif-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, flower, root, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: VQ motif-containing protein (TAIR:AT3G22160.1); Has 167 Blast hits to 165 proteins in 26 species: Archae - 2; Bacteria - 0; Metazoa - 18; Fungi - 12; Plants - 102; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).

AT4G16370 AT4G16370.1 CGACACGTGGAT Encodes an oligopeptide transporter involved in metal homeostasis.

AT4G16500 AT4G16500.1 TCGCCACGTGGAC cysteine protease inhibitor family protein / cystatin family protein; FUNCTIONS IN: enzyme regulator activity, cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT5G47550.1); Has 461 Blast hits to 440 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 452; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).

AT4G16590 AT4G16590.1 AACACGTGGAA encodes a gene similar to cellulose synthase

AT4G16660 AT4G16660.1 TCACACGTGGAA heat shock protein 70, putative / HSP70, putative; FUNCTIONS IN: ATP binding; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: heat shock protein, putative (TAIR:AT1G11660.1); Has 18930 Blast hits to 18189 proteins in 2776 species: Archae - 119; Bacteria - 6307; Metazoa - 3629; Fungi - 1186; Plants - 638; Viruses - 97; Other Eukaryotes - 6954 (source: NCBI BLink).

AT4G16760 AT4G16760.1 TTCCACGTGGG Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate.

AT4G17730 AT4G17730.1 ATCCACGTGTCC member of SYP2 Gene Family

AT4G17730.2 ATCCACGTGTCC member of SYP2 Gene Family

AT4G22220 AT4G22220.1 CTAAACCGTCCACGTGTCC Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein.

AT4G23420 AT4G23420.1 TCCACGTG short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G23430.2); Has 36520 Blast hits to 36480 proteins in 1771 species: Archae - 235; Bacteria - 21258; Metazoa - 3640; Fungi - 2170; Plants - 961; Viruses - 0; Other Eukaryotes - 8256 (source: NCBI BLink).

AT4G23420.2 TCCACGTG short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G23430.2); Has 36520 Blast hits to 36480 proteins in 1771 species: Archae - 235; Bacteria - 21258; Metazoa - 3640; Fungi - 2170; Plants - 961; Viruses - 0; Other Eukaryotes - 8256 (source: NCBI BLink).

AT4G24350 AT4G24350.1 CACGTGGAA phosphorylase family protein; FUNCTIONS IN: catalytic activity, nutrient reservoir activity; INVOLVED IN: response to wounding; LOCATED IN: plant-type cell wall; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphorylase (InterPro:IPR000845), Nucleoside phosphorylase, family 1 (InterPro:IPR018017); BEST Arabidopsis thaliana protein match is: phosphorylase family protein (TAIR:AT4G24340.1); Has 1246 Blast hits to 1222 proteins in 533 species: Archae - 2; Bacteria - 1140; Metazoa - 0; Fungi - 2; Plants - 62; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).

AT4G24350.2 CACGTGGAA phosphorylase family protein; FUNCTIONS IN: catalytic activity, nutrient reservoir activity; INVOLVED IN: response to wounding; LOCATED IN: plant-type cell wall; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphorylase (InterPro:IPR000845), Nucleoside phosphorylase, family 1 (InterPro:IPR018017); BEST Arabidopsis thaliana protein match is: phosphorylase family protein (TAIR:AT4G24340.1); Has 1246 Blast hits to 1222 proteins in 533 species: Archae - 2; Bacteria - 1140; Metazoa - 0; Fungi - 2; Plants - 62; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).

AT4G24480 AT4G24480.1 ATCCACGTGTCAC serine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.12 twelve leaves visible; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CTR1 (CONSTITUTIVE TRIPLE RESPONSE 1); kinase/ protein binding / protein serine/threonine kinase/ protein serine/threonine/tyrosine kinase (TAIR:AT5G03730.2); Has 84626 Blast hits to 83310 proteins in 3213 species: Archae - 47; Bacteria - 6763; Metazoa - 38110; Fungi - 6771; Plants - 18285; Viruses - 390; Other Eukaryotes - 14260 (source: NCBI BLink).

AT4G24740 AT4G24740.1 TACACGTGGAC a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins.

AT4G25450 AT4G25450.1 GTCCACGTGGCTTTTT member of NAP subfamily

AT4G25450.2 GTCCACGTGGCTTTTT member of NAP subfamily

AT4G25450.3 GTCCACGTGGCTTTTT member of NAP subfamily

AT4G25470 AT4G25470.1 ATCCACGTGGCAT Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway.

AT4G25570 AT4G25570.1 ATCCACGTGGCGA Encodes cytochrome b561.

AT4G27840 AT4G27840.1 TTCCACGTGTCAT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: vesicle-associated membrane protein-related (TAIR:AT5G52990.1); Has 165 Blast hits to 165 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G30310 AT4G30310.1 CACGTGGAC ribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink).

AT4G30310.2 CACGTGGAC ribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink).

AT4G30310.3 CACGTGGAC ribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink).

AT4G30620 AT4G30620.1 TTCCACGTGGCAC unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0133 (InterPro:IPR004401); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24020.1); Has 1303 Blast hits to 1303 proteins in 522 species: Archae - 0; Bacteria - 1050; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).

AT4G31080 AT4G31080.1 CACGTGGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24330.1); Has 251 Blast hits to 245 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 75; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).

AT4G31115 AT4G31115.1 ATGACACGTGGAA unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04440.1); Has 127 Blast hits to 127 proteins in 28 species: Archae - 0; Bacteria - 38; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).

AT4G31115.2 ATGACACGTGGAA unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04440.1); Has 127 Blast hits to 127 proteins in 28 species: Archae - 0; Bacteria - 38; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).

AT4G31360 AT4G31360.1 CACGTGGAT selenium binding; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenium binding (TAIR:AT2G24440.1); Has 199 Blast hits to 172 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 101; Fungi - 17; Plants - 36; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).

AT4G33010 AT4G33010.1 TACACGTGGAA Arabidopsis thaliana glycine decarboxylase P-protein 1 (AtGLDP1); FUNCTIONS IN: glycine dehydrogenase (decarboxylating) activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: glycine catabolic process, glycine decarboxylation via glycine cleavage system; LOCATED IN: mitochondrion, apoplast, glycine cleavage complex, chloroplast, chloroplast envelope; EXPRESSED IN: 31 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Glycine cleavage system P-protein (InterPro:IPR003437), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: AtGLDP2 (Arabidopsis thaliana glycine decarboxylase P-protein 2); ATP binding / glycine dehydrogenase (decarboxylating) (TAIR:AT2G26080.1); Has 9787 Blast hits to 8954 proteins in 1113 species: Archae - 131; Bacteria - 2880; Metazoa - 122; Fungi - 158; Plants - 73; Viruses - 0; Other Eukaryotes - 6423 (source: NCBI BLink).

AT4G33010.2 TACACGTGGAA Arabidopsis thaliana glycine decarboxylase P-protein 1 (AtGLDP1); FUNCTIONS IN: glycine dehydrogenase (decarboxylating) activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: glycine catabolic process, glycine decarboxylation via glycine cleavage system; LOCATED IN: mitochondrion, apoplast, glycine cleavage complex, chloroplast, chloroplast envelope; EXPRESSED IN: 31 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Glycine cleavage system P-protein (InterPro:IPR003437), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: AtGLDP2 (Arabidopsis thaliana glycine decarboxylase P-protein 2); ATP binding / glycine dehydrogenase (decarboxylating) (TAIR:AT2G26080.1); Has 9787 Blast hits to 8954 proteins in 1113 species: Archae - 131; Bacteria - 2880; Metazoa - 122; Fungi - 158; Plants - 73; Viruses - 0; Other Eukaryotes - 6423 (source: NCBI BLink).

AT4G33520 AT4G33520.1 CACACGTGGAC Encodes a putative metal-transporting P-type ATPase.

AT4G33520.2 CACACGTGGAC Encodes a putative metal-transporting P-type ATPase.

AT4G33520.3 CACACGTGGAC Encodes a putative metal-transporting P-type ATPase.

AT4G34860 AT4G34860.1 GTACACGTGGACCCAC beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: sucrose catabolic process, using beta-fructofuranosidase; LOCATED IN: cytosol; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT4G09510.1); Has 530 Blast hits to 529 proteins in 80 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).

AT4G34860.2 GTACACGTGGACCCAC beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: sucrose catabolic process, using beta-fructofuranosidase; LOCATED IN: cytosol; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT4G09510.1); Has 530 Blast hits to 529 proteins in 80 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).

AT4G36780 AT4G36780.1 GGACACGTGGAA transcription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: BES1 (BRI1-EMS-SUPPRESSOR 1); protein binding / transcription factor/ transcription regulator (TAIR:AT1G19350.6); Has 110 Blast hits to 110 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G36980 AT4G36980.1 GGACACGTGGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 17658 Blast hits to 10230 proteins in 432 species: Archae - 0; Bacteria - 201; Metazoa - 12139; Fungi - 1445; Plants - 942; Viruses - 234; Other Eukaryotes - 2697 (source: NCBI BLink).

AT4G36980.2 GGACACGTGGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 17658 Blast hits to 10230 proteins in 432 species: Archae - 0; Bacteria - 201; Metazoa - 12139; Fungi - 1445; Plants - 942; Viruses - 234; Other Eukaryotes - 2697 (source: NCBI BLink).

AT4G37370 AT4G37370.1 AACACGTGGA member of CYP81D

AT4G37390 AT4G37390.1 GTCCACGTGGAC Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity.

AT4G37980 AT4G37980.1 CACGTGGAC ELICITOR-ACTIVATED GENE 3-1 (ELI3-1); FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: response to bacterium, plant-type hypersensitive response; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ELI3-2 (ELICITOR-ACTIVATED GENE 3-2); aryl-alcohol dehydrogenase/ mannitol dehydrogenase (TAIR:AT4G37990.1); Has 24573 Blast hits to 24551 proteins in 1866 species: Archae - 389; Bacteria - 13994; Metazoa - 1153; Fungi - 1912; Plants - 2273; Viruses - 3; Other Eukaryotes - 4849 (source: NCBI BLink).

AT4G37980.2 CACGTGGAC ELICITOR-ACTIVATED GENE 3-1 (ELI3-1); FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: response to bacterium, plant-type hypersensitive response; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ELI3-2 (ELICITOR-ACTIVATED GENE 3-2); aryl-alcohol dehydrogenase/ mannitol dehydrogenase (TAIR:AT4G37990.1); Has 24573 Blast hits to 24551 proteins in 1866 species: Archae - 389; Bacteria - 13994; Metazoa - 1153; Fungi - 1912; Plants - 2273; Viruses - 3; Other Eukaryotes - 4849 (source: NCBI BLink).

AT4G38810 AT4G38810.1 CACGTGGAT calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G28830.1); Has 189 Blast hits to 127 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 186; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).

AT4G39990 AT4G39990.1 TTCCACGTGTCAT GTP-binding protein ATGB3

AT5G01260 AT5G01260.1 ATTGCCACGTGGAC glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).

AT5G01260.2 ATTGCCACGTGGAC glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).

AT5G01600 AT5G01600.1 TCCACGTGGAT Encodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.

AT5G02380 AT5G02380.1 TGACACGTGGAC cysteine-rich protein with copper-binding activity

AT5G02500 AT5G02500.1 CACGTGGAA encodes a member of heat shock protein 70 family.

AT5G02500.2 CACGTGGAA encodes a member of heat shock protein 70 family.

AT5G03140 AT5G03140.1 TTCCACGTGTCA lectin protein kinase family protein; FUNCTIONS IN: carbohydrate binding, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Legume lectin, beta domain (InterPro:IPR001220), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase-related (InterPro:IPR017442), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: lectin protein kinase family protein (TAIR:AT3G53380.1); Has 86443 Blast hits to 85431 proteins in 3024 species: Archae - 50; Bacteria - 7703; Metazoa - 37587; Fungi - 6804; Plants - 19480; Viruses - 384; Other Eukaryotes - 14435 (source: NCBI BLink).

AT5G03160 AT5G03160.1 TTCCACGTGGG J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast.

AT5G03495 AT5G03495.1 GGACACGTGGA nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT5G03480.1); Has 94 Blast hits to 60 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT5G04040 AT5G04040.1 ATCCACGTGGG Encodes a triacylglycerol lipase that is involved in storage lipid breakdown during seed germination. The mutant plant exhibits a much slower rate of postgerminative growth than the wild type.

AT5G04090 AT5G04090.2 ATCCACGTGGCAG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G10250.2); Has 131 Blast hits to 129 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 118; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).

AT5G04090.2 TTCCACGTGGG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G10250.2); Has 131 Blast hits to 129 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 118; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).

AT5G04830 AT5G04830.1 TGTCACGTGGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 53 Blast hits to 51 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 21; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT5G04830.2 TGTCACGTGGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 53 Blast hits to 51 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 21; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT5G05200 AT5G05200.1 TTCCACGTGGCAT ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink).

AT5G05210 AT5G05210.1 ATGCCACGTGGAA nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).

AT5G05210.2 ATGCCACGTGGAA nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).

AT5G05290 AT5G05290.1 GTCCACGTGGCAT Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)

AT5G05370 AT5G05370.1 GTCCACGTGGAT ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT3G10860.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G05380 AT5G05380.1 ATCCACGTGGAC PRENYLATED RAB ACCEPTOR 1.B3 (PRA1.B3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 371 Blast hits to 371 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 59; Plants - 178; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).

AT5G06980 AT5G06980.1 AACACGTGGAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12320.1); Has 22 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT5G06980.2 AACACGTGGAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12320.1); Has 22 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT5G07270 AT5G07270.1 ACGCCACGTGGAC ankyrin repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: XBAT32; protein binding / zinc ion binding (TAIR:AT5G57740.1); Has 44282 Blast hits to 18491 proteins in 678 species: Archae - 43; Bacteria - 2745; Metazoa - 24300; Fungi - 3186; Plants - 1469; Viruses - 375; Other Eukaryotes - 12164 (source: NCBI BLink).

AT5G07320 AT5G07320.1 CACGTGGA mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), Mitochondrial substrate carrier (InterPro:IPR001993), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248), Mitochondrial carrier protein (InterPro:IPR002067), EF-HAND 2 (InterPro:IPR018249), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT5G61810.1); Has 25974 Blast hits to 15681 proteins in 989 species: Archae - 0; Bacteria - 9; Metazoa - 12328; Fungi - 6441; Plants - 4249; Viruses - 5; Other Eukaryotes - 2942 (source: NCBI BLink).

AT5G08430 AT5G08430.1 GGACACGTGGAA SWIB complex BAF60b domain-containing protein / plus-3 domain-containing protein / GYF domain-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: histone modification, transcription initiation; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121), Plus-3 domain, subgroup (InterPro:IPR018144), Plus-3 (InterPro:IPR004343), GYF (InterPro:IPR003169); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G23480.1); Has 234 Blast hits to 221 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 15; Plants - 101; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).

AT5G08580 AT5G08580.1 ACCACGTGGA calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT4G27790.1); Has 1683 Blast hits to 1652 proteins in 245 species: Archae - 0; Bacteria - 5; Metazoa - 858; Fungi - 86; Plants - 540; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).

AT5G08590 AT5G08590.1 TCCACGTGGT Encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Similar to the calcium/calmodulin-dependent protein kinase subfamily and the SNF1 kinase subfamily.

AT5G09440 AT5G09440.1 ATCCACGTGGCAT EXORDIUM LIKE 4 (EXL4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphate-induced protein 1 conserved region (InterPro:IPR006766); BEST Arabidopsis thaliana protein match is: EXL2 (EXORDIUM LIKE 2) (TAIR:AT5G64260.1); Has 233 Blast hits to 233 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 231; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G09590 AT5G09590.1 TTCCACGTGGCAAT heat shock protein 70 (Hsc70-5); nuclear

AT5G09620 AT5G09620.1 TTCCACGTGTA octicosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT5G64430.1); Has 17878 Blast hits to 10318 proteins in 471 species: Archae - 0; Bacteria - 445; Metazoa - 7320; Fungi - 1844; Plants - 1595; Viruses - 152; Other Eukaryotes - 6522 (source: NCBI BLink).

AT5G09970 AT5G09970.1 TCCACGTG member of CYP78A

AT5G10190 AT5G10190.1 GTCCACGTGTCAT transporter-related; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: UNE2 (unfertilized embryo sac 2); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G78130.1); Has 8728 Blast hits to 8693 proteins in 1166 species: Archae - 209; Bacteria - 6596; Metazoa - 315; Fungi - 290; Plants - 194; Viruses - 2; Other Eukaryotes - 1122 (source: NCBI BLink).

AT5G11420 AT5G11420.1 CCCACGTGGAT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25460.1); Has 185 Blast hits to 157 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 185; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G13400 AT5G13400.1 GTCCACGTG proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: PTR5 (PEPTIDE TRANSPORTER 5); dipeptide transporter/ transporter (TAIR:AT5G01180.1); Has 3261 Blast hits to 3191 proteins in 658 species: Archae - 0; Bacteria - 1099; Metazoa - 461; Fungi - 209; Plants - 1123; Viruses - 0; Other Eukaryotes - 369 (source: NCBI BLink).

AT5G13630 AT5G13630.1 GTCCACGTGTCC Encodes magnesium chelatase involved in plastid-to-nucleus signal transduction.

AT5G13630.2 GTCCACGTGTCC Encodes magnesium chelatase involved in plastid-to-nucleus signal transduction.

AT5G13820 AT5G13820.1 TCCACGTGTCAT Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding domain in C-terminus that prefers the sequence TTTAGGG.

AT5G15910 AT5G15910.1 ATGACACGTGGAT dehydrogenase-related; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 4174 Blast hits to 4174 proteins in 940 species: Archae - 63; Bacteria - 2510; Metazoa - 105; Fungi - 172; Plants - 313; Viruses - 2; Other Eukaryotes - 1009 (source: NCBI BLink).

AT5G15948 AT5G15948.1 ATCCACGTGTCAC Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF10 represents a conserved upstream opening reading frame relative to major ORF AT5G15950.1

AT5G15950 AT5G15950.1 ATCCACGTGTCAC adenosylmethionine decarboxylase family protein; FUNCTIONS IN: adenosylmethionine decarboxylase activity; INVOLVED IN: spermidine biosynthetic process, spermine biosynthetic process, polyamine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine decarboxylase, core (InterPro:IPR016067), S-adenosylmethionine decarboxylase (InterPro:IPR001985), S-adenosylmethionine decarboxylase, conserved site (InterPro:IPR018166), S-adenosylmethionine decarboxylase subgroup (InterPro:IPR018167); BEST Arabidopsis thaliana protein match is: SAMDC (S-ADENOSYLMETHIONINE DECARBOXYLASE); adenosylmethionine decarboxylase (TAIR:AT3G02470.4); Has 830 Blast hits to 816 proteins in 205 species: Archae - 0; Bacteria - 50; Metazoa - 174; Fungi - 104; Plants - 446; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).

AT5G15950.2 ATCCACGTGTCAC adenosylmethionine decarboxylase family protein; FUNCTIONS IN: adenosylmethionine decarboxylase activity; INVOLVED IN: spermidine biosynthetic process, spermine biosynthetic process, polyamine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine decarboxylase, core (InterPro:IPR016067), S-adenosylmethionine decarboxylase (InterPro:IPR001985), S-adenosylmethionine decarboxylase, conserved site (InterPro:IPR018166), S-adenosylmethionine decarboxylase subgroup (InterPro:IPR018167); BEST Arabidopsis thaliana protein match is: SAMDC (S-ADENOSYLMETHIONINE DECARBOXYLASE); adenosylmethionine decarboxylase (TAIR:AT3G02470.4); Has 830 Blast hits to 816 proteins in 205 species: Archae - 0; Bacteria - 50; Metazoa - 174; Fungi - 104; Plants - 446; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).

AT5G15960 AT5G15960.1 ATCCACGTGGT cold and ABA inducible protein kin1, possibly functions as an anti-freeze protein. Transcript level of this gene is induced by cold, ABA, dehydration and osmoticum (mannitol). However, protein activity of GUS fused to the promoter of this gene is inhibited by cold treatment, suggesting an inhibition of the protein by increased transcript level.

AT5G15970 AT5G15970.1 ATCCACGTGGT Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance.

AT5G16340 AT5G16340.1 CACGTGGAT AMP-binding protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: AAE5 (ACYL ACTIVATING ENZYME 5); catalytic (TAIR:AT5G16370.1); Has 50913 Blast hits to 47428 proteins in 2194 species: Archae - 554; Bacteria - 27741; Metazoa - 2839; Fungi - 2171; Plants - 1249; Viruses - 1; Other Eukaryotes - 16358 (source: NCBI BLink).

AT5G16990 AT5G16990.1 GTCCACGTGTCAC molecular function has not been defined, was shown involved in oxidative stress tolerance.

AT5G17520 AT5G17520.1 GTCCACGTG Encodes a maltose transporter that is expressed in leaves and roots. Mutations at the MEX1 locus cause accumulation of both starch and maltose in leaves, with maltose levels at least 40 times higher than that of wild-type. This gene encodes a protein located in the chloroplast envelope.

AT5G19520 AT5G19520.1 ATCCACGTG MECHANOSENSITIVE CHANNEL OF SMALL CONDUCTANCE-LIKE 9 (MSL9); FUNCTIONS IN: mechanically-gated ion channel activity; INVOLVED IN: detection of mechanical stimulus; LOCATED IN: nucleus, plasma membrane, membrane; EXPRESSED IN: root tip, root; CONTAINS InterPro DOMAIN/s: Membrane protein, At2g17000, predicted (InterPro:IPR016688), Mechanosensitive ion channel MscS (InterPro:IPR006685), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: MSL10 (MECHANOSENSITIVE CHANNEL OF SMALL CONDUCTANCE-LIKE 10); mechanically-gated ion channel (TAIR:AT5G12080.3); Has 1950 Blast hits to 1947 proteins in 608 species: Archae - 62; Bacteria - 1279; Metazoa - 0; Fungi - 123; Plants - 84; Viruses - 2; Other Eukaryotes - 400 (source: NCBI BLink).

AT5G19875 AT5G19875.1 ATCCACGTGGT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31940.1); Has 63 Blast hits to 63 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G22545 AT5G22545.1 TCCACGTGTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22520.1); Has 10 Blast hits to 10 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G23820 AT5G23820.1 ATCCACGTG MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G23840.1); Has 35 Blast hits to 35 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G23830 AT5G23830.1 ATCCACGTG MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G23840.1); Has 35 Blast hits to 35 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G23830.2 ATCCACGTG MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G23840.1); Has 35 Blast hits to 35 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G27420 AT5G27420.1 GTCCACGTGGCAT zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin, response to abscisic acid stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ATL6; protein binding / zinc ion binding (TAIR:AT3G05200.1); Has 6369 Blast hits to 6350 proteins in 217 species: Archae - 0; Bacteria - 0; Metazoa - 2077; Fungi - 469; Plants - 2661; Viruses - 39; Other Eukaryotes - 1123 (source: NCBI BLink).

AT5G27920 AT5G27920.1 ATCCACGTGGAT F-box family protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL3) (TAIR:AT5G01720.1); Has 10236 Blast hits to 3505 proteins in 207 species: Archae - 0; Bacteria - 631; Metazoa - 4869; Fungi - 921; Plants - 2316; Viruses - 19; Other Eukaryotes - 1480 (source: NCBI BLink).

AT5G37260 AT5G37260.1 TCCACGTGTCAT Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis.

AT5G39530 AT5G39530.1 ATGCCACGTGGAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39520.1); Has 172 Blast hits to 172 proteins in 54 species: Archae - 0; Bacteria - 88; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).

AT5G42810 AT5G42810.1 GTCCACGTGGAT Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds.

AT5G43750 AT5G43750.1 TTCCACGTGAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G44720 AT5G44720.1 ATCCACGTG molybdenum cofactor sulfurase family protein; FUNCTIONS IN: molybdenum ion binding, Mo-molybdopterin cofactor sulfurase activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), MOSC, N-terminal beta barrel (InterPro:IPR005303), Molybdenum cofactor sulfurase, C-terminal (InterPro:IPR005302); BEST Arabidopsis thaliana protein match is: molybdenum cofactor sulfurase family protein (TAIR:AT1G30910.1); Has 1262 Blast hits to 1242 proteins in 421 species: Archae - 2; Bacteria - 632; Metazoa - 290; Fungi - 178; Plants - 53; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).

AT5G44720.2 ATCCACGTG molybdenum cofactor sulfurase family protein; FUNCTIONS IN: molybdenum ion binding, Mo-molybdopterin cofactor sulfurase activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), MOSC, N-terminal beta barrel (InterPro:IPR005303), Molybdenum cofactor sulfurase, C-terminal (InterPro:IPR005302); BEST Arabidopsis thaliana protein match is: molybdenum cofactor sulfurase family protein (TAIR:AT1G30910.1); Has 1262 Blast hits to 1242 proteins in 421 species: Archae - 2; Bacteria - 632; Metazoa - 290; Fungi - 178; Plants - 53; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).

AT5G47120 AT5G47120.1 ATCCACGTGGAT Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta.

AT5G47420 AT5G47420.1 TCCACGTGTCA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF124 (InterPro:IPR002838), Tryptophan RNA-binding attenuator protein-like (InterPro:IPR016031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17420.1); Has 568 Blast hits to 568 proteins in 252 species: Archae - 56; Bacteria - 410; Metazoa - 0; Fungi - 8; Plants - 37; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).

AT5G49550 AT5G49550.1 TCCACGTGTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 122 Blast hits to 122 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT5G50240 AT5G50240.3 GTCCACGTGGCAA L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced.

AT5G51760 AT5G51760.1 TCCACGTGGAC Encodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination.

AT5G52200 AT5G52200.1 ATCCACGTGGCGG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 509 Blast hits to 471 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 232; Fungi - 109; Plants - 74; Viruses - 6; Other Eukaryotes - 88 (source: NCBI BLink).

AT5G54940 AT5G54940.1 ATCCACGTGTCT eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink).

AT5G54940.2 ATCCACGTGTCT eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink).

AT5G56100 AT5G56100.1 ATCCACGTGTCA glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G56100.1 ATCCACGTGTCGT glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G58070 AT5G58070.1 TTCCACGTGGCAT Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane.

AT5G63620 AT5G63620.1 TACACGTGGAT oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: alcohol dehydrogenase, putative (TAIR:AT1G64710.1); Has 32783 Blast hits to 32696 proteins in 2070 species: Archae - 429; Bacteria - 18028; Metazoa - 1724; Fungi - 2557; Plants - 2783; Viruses - 3; Other Eukaryotes - 7259 (source: NCBI BLink).

AT5G63620.2 TACACGTGGAT oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: alcohol dehydrogenase, putative (TAIR:AT1G64710.1); Has 32783 Blast hits to 32696 proteins in 2070 species: Archae - 429; Bacteria - 18028; Metazoa - 1724; Fungi - 2557; Plants - 2783; Viruses - 3; Other Eukaryotes - 7259 (source: NCBI BLink).

AT5G63680 AT5G63680.1 TTCCACGTGGAA pyruvate kinase, putative; FUNCTIONS IN: pyruvate kinase activity, potassium ion binding, magnesium ion binding, catalytic activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, C-terminal-like (InterPro:IPR015795), Pyruvate kinase, active site (InterPro:IPR018209), Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), Pyruvate kinase, alpha/beta (InterPro:IPR015794), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate kinase (InterPro:IPR001697), Pyruvate kinase, barrel (InterPro:IPR015793); BEST Arabidopsis thaliana protein match is: pyruvate kinase, putative (TAIR:AT5G08570.1); Has 6905 Blast hits to 6826 proteins in 1520 species: Archae - 99; Bacteria - 3257; Metazoa - 489; Fungi - 169; Plants - 284; Viruses - 0; Other Eukaryotes - 2607 (source: NCBI BLink).

AT5G64050 AT5G64050.1 GTCCACGTGTCT Glutamate-tRNA ligase. Targeted to mitochondria and chloroplast. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.

AT5G64260 AT5G64260.1 TCCACGTGGCAAT EXORDIUM LIKE 2 (EXL2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphate-induced protein 1 conserved region (InterPro:IPR006766); BEST Arabidopsis thaliana protein match is: EXL4 (EXORDIUM LIKE 4) (TAIR:AT5G09440.1); Has 233 Blast hits to 233 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 231; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).