| Locus | Gene model | Sequence | Description |
| AT1G01510 | AT1G01510.1 | ACGGCGTCGTTTA | Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. |
| AT1G01730 | AT1G01730.1 | ACGGCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 4; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02660 | AT1G02660.1 | TAAACGACGACGT | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT3G62590.1); Has 601 Blast hits to 595 proteins in 116 species: Archae - 0; Bacteria - 17; Metazoa - 188; Fungi - 136; Plants - 92; Viruses - 14; Other Eukaryotes - 154 (source: NCBI BLink). |
| AT1G02870 | AT1G02870.1 | AACGACGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 46; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G02920 | AT1G02920.1 | GAAACGACGA | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G02930 | AT1G02930.1 | GAAACGACGA | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G03780 | AT1G03780.1 | GAAACGACGTCGTT | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase. |
| AT1G03780.2 | GAAACGACGTCGTT | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase. |
| AT1G04710 | AT1G04710.1 | ACGACGTCGTTTA | EC2.3.1.16 thiolase. |
| AT1G06580 | AT1G06580.1 | ACGTCGTCGTTTT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: stem, embryo, flower, seed; EXPRESSED DURING: F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G64580.1); Has 24093 Blast hits to 5935 proteins in 175 species: Archae - 4; Bacteria - 16; Metazoa - 695; Fungi - 411; Plants - 21894; Viruses - 0; Other Eukaryotes - 1073 (source: NCBI BLink). |
| AT1G08110 | AT1G08110.1 | AACGACGTCGTTTA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.2 | AACGACGTCGTTTA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.3 | AACGACGTCGTTTA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.4 | AACGACGTCGTTTA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08820 | AT1G08820.1 | ACGTCGTCGTTTT | Encodes VAP33-like protein that interacts with cowpea mosaic virus protein 60K. Is a SNARE-like protein that may be involved in vesicular transport to or from the ER. |
| AT1G08820.2 | ACGTCGTCGTTTT | Encodes VAP33-like protein that interacts with cowpea mosaic virus protein 60K. Is a SNARE-like protein that may be involved in vesicular transport to or from the ER. |
| AT1G09310 | AT1G09310.1 | ACGTCGTTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: apoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56580.1); Has 197 Blast hits to 195 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 4; Plants - 191; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G11475 | AT1G11475.1 | ACGACGTCGTTTA | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB10. |
| AT1G11475.1 | CGTCGTTT | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB10. |
| AT1G11940 | AT1G11940.1 | ACGTGTACGTGGCTTACGACGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62305.1); Has 329 Blast hits to 329 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 304; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT1G12310 | AT1G12310.1 | AAAACGACGCC | calmodulin, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT1G62820.1); Has 12140 Blast hits to 10293 proteins in 1212 species: Archae - 0; Bacteria - 26; Metazoa - 5264; Fungi - 3120; Plants - 2025; Viruses - 0; Other Eukaryotes - 1705 (source: NCBI BLink). |
| AT1G12800 | AT1G12800.1 | AAAACGACGT | S1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink). |
| AT1G13900 | AT1G13900.1 | ACGTCGTCGTTTA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity, metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP9 (PURPLE ACID PHOSPHATASE 9); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G03450.1); Has 1052 Blast hits to 1042 proteins in 232 species: Archae - 0; Bacteria - 259; Metazoa - 179; Fungi - 58; Plants - 399; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT1G13910 | AT1G13910.1 | TAAACGACGACGT | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT5G61240.1); Has 54187 Blast hits to 17810 proteins in 751 species: Archae - 26; Bacteria - 3393; Metazoa - 14506; Fungi - 646; Plants - 32565; Viruses - 0; Other Eukaryotes - 3051 (source: NCBI BLink). |
| AT1G14140 | AT1G14140.1 | GAAACGACGTCGTC | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink). |
| AT1G14380 | AT1G14380.1 | AAACGACGTC | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G14380.2 | AAACGACGTC | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G14380.3 | AAACGACGTC | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G14780 | AT1G14780.1 | TCGTCGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin/complement C9 (InterPro:IPR001862); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G24290.2); Has 119 Blast hits to 118 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 105; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G16250 | AT1G16250.1 | AAAACGACGCGGTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G63220.2); Has 7013 Blast hits to 3858 proteins in 178 species: Archae - 4; Bacteria - 338; Metazoa - 5746; Fungi - 21; Plants - 596; Viruses - 32; Other Eukaryotes - 276 (source: NCBI BLink). |
| AT1G16560 | AT1G16560.1 | ACGTCGTTTA | Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G16560.2 | ACGTCGTTTA | Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G16560.3 | ACGTCGTTTA | Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G16560.4 | ACGTCGTTTA | Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G17270 | AT1G17270.1 | AAAACGACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G50420.1); Has 68 Blast hits to 68 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G18060 | AT1G18060.1 | GAAACGACGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 16 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G18570 | AT1G18570.1 | TAAACGACGACGT | Encodes a member of the R2R3-MYB transcription family. Involved in indole glucosinolate biosynthesis. |
| AT1G19770 | AT1G19770.1 | AAAACGACGA | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G19990 | AT1G19990.1 | TAAACGACGCCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11600.1); Has 10416 Blast hits to 6328 proteins in 368 species: Archae - 4; Bacteria - 381; Metazoa - 4559; Fungi - 839; Plants - 384; Viruses - 34; Other Eukaryotes - 4215 (source: NCBI BLink). |
| AT1G20300 | AT1G20300.1 | TAAACGACGCC | pentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G77360.1); Has 19529 Blast hits to 6019 proteins in 192 species: Archae - 5; Bacteria - 22; Metazoa - 563; Fungi - 464; Plants - 17637; Viruses - 0; Other Eukaryotes - 838 (source: NCBI BLink). |
| AT1G20760 | AT1G20760.1 | AAAACGACGT | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EPS15 homology (EH) (InterPro:IPR000261), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G21630.1); Has 10692 Blast hits to 4147 proteins in 323 species: Archae - 12; Bacteria - 3271; Metazoa - 3323; Fungi - 1334; Plants - 262; Viruses - 16; Other Eukaryotes - 2474 (source: NCBI BLink). |
| AT1G21100 | AT1G21100.1 | AAACGACGT | O-methyltransferase, putative; FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol; EXPRESSED IN: stem, cotyledon, hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: O-methyltransferase, putative (TAIR:AT1G21130.1); Has 2126 Blast hits to 2123 proteins in 426 species: Archae - 0; Bacteria - 600; Metazoa - 84; Fungi - 432; Plants - 916; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink). |
| AT1G22140 | AT1G22140.1 | GAAACGACGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 27 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G22140.2 | GAAACGACGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 27 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G22970 | AT1G22970.1 | AAACGACGTCGTT | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G71150.1); Has 102 Blast hits to 102 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 62; Fungi - 9; Plants - 27; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G23310 | AT1G23310.1 | AAAACGACGGACACGTGGAT | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway. |
| AT1G23310.2 | AAAACGACGGACACGTGGAT | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway. |
| AT1G24180 | AT1G24180.1 | TAAACGACGC | Arabidopsis thaliana pyruvate dehydrogenase E1a-like subunit. 81% identical to a previously characterized Arabidopsis mitochondrial PDH E1a-subunit, At1g59900 |
| AT1G26340 | AT1G26340.1 | TAAACGACGTCGTT | encodes a member of the cytochromes b5 family of proteins that localizes to the outer envelope of the chloroplast. The C-terminal portion of the protein appears to be capable of inserting into a plant microsomal membrane in vitro. |
| AT1G27000 | AT1G27000.1 | GACGACGTCGTTTC | bZIP family transcription factor; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02730.2); Has 122 Blast hits to 113 proteins in 16 species: Archae - 0; Bacteria - 8; Metazoa - 2; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT1G27120 | AT1G27120.1 | AAAACGACGT | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galectin, carbohydrate recognition domain (InterPro:IPR001079), Glycosyl transferase, family 31 (InterPro:IPR002659), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT5G62620.1); Has 1776 Blast hits to 1771 proteins in 89 species: Archae - 0; Bacteria - 2; Metazoa - 1406; Fungi - 2; Plants - 337; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT1G29220 | AT1G29220.1 | ACGTCGTTTT | transcriptional regulator family protein; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HCNGP-like (InterPro:IPR012479); Has 10343 Blast hits to 2896 proteins in 211 species: Archae - 2; Bacteria - 122; Metazoa - 7536; Fungi - 402; Plants - 244; Viruses - 187; Other Eukaryotes - 1850 (source: NCBI BLink). |
| AT1G29470 | AT1G29470.1 | AAAACGACGCCGTTT | dehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT2G34300.2); Has 60693 Blast hits to 25760 proteins in 1331 species: Archae - 209; Bacteria - 12823; Metazoa - 19500; Fungi - 5083; Plants - 2714; Viruses - 653; Other Eukaryotes - 19711 (source: NCBI BLink). |
| AT1G29470.2 | AAAACGACGCCGTTT | dehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT2G34300.2); Has 60693 Blast hits to 25760 proteins in 1331 species: Archae - 209; Bacteria - 12823; Metazoa - 19500; Fungi - 5083; Plants - 2714; Viruses - 653; Other Eukaryotes - 19711 (source: NCBI BLink). |
| AT1G29890 | AT1G29890.2 | AAAACGACGTC | acetyltransferase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Cas1p-like (InterPro:IPR012419); BEST Arabidopsis thaliana protein match is: O-acetyltransferase family protein (TAIR:AT2G34410.2); Has 188 Blast hits to 184 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 99; Fungi - 25; Plants - 57; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G30810 | AT1G30810.1 | AAAACGACGCGTTTTG | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), FY-rich, C-terminal (InterPro:IPR003889), FY-rich, N-terminal (InterPro:IPR003888), Transcription factor jumonji, JmjN (InterPro:IPR003349), Zinc finger, C5HC2-type (InterPro:IPR004198), FY-rich, C-terminal subgroup (InterPro:IPR018516), Transcription factor jumonji (InterPro:IPR013129), FY-rich, N-terminal subgroup (InterPro:IPR018518); BEST Arabidopsis thaliana protein match is: MEE27 (maternal effect embryo arrest 27); transcription factor (TAIR:AT2G34880.1); Has 1543 Blast hits to 1140 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 960; Fungi - 297; Plants - 152; Viruses - 0; Other Eukaryotes - 134 (source: NCBI BLink). |
| AT1G31160 | AT1G31160.1 | AAAACGACGACGT | zinc-binding protein, putative / protein kinase C inhibitor, putative; FUNCTIONS IN: protein kinase C binding, zinc ion binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histidine triad-like motif (InterPro:IPR011146), Histidine triad (HIT) protein (InterPro:IPR001310), Histidine triad motif (InterPro:IPR011151); BEST Arabidopsis thaliana protein match is: zinc-binding protein, putative / protein kinase C inhibitor, putative (TAIR:AT3G56490.1); Has 5594 Blast hits to 5592 proteins in 1456 species: Archae - 103; Bacteria - 2673; Metazoa - 341; Fungi - 103; Plants - 63; Viruses - 0; Other Eukaryotes - 2311 (source: NCBI BLink). |
| AT1G31160.1 | AAATGACGTCGTTT | zinc-binding protein, putative / protein kinase C inhibitor, putative; FUNCTIONS IN: protein kinase C binding, zinc ion binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histidine triad-like motif (InterPro:IPR011146), Histidine triad (HIT) protein (InterPro:IPR001310), Histidine triad motif (InterPro:IPR011151); BEST Arabidopsis thaliana protein match is: zinc-binding protein, putative / protein kinase C inhibitor, putative (TAIR:AT3G56490.1); Has 5594 Blast hits to 5592 proteins in 1456 species: Archae - 103; Bacteria - 2673; Metazoa - 341; Fungi - 103; Plants - 63; Viruses - 0; Other Eukaryotes - 2311 (source: NCBI BLink). |
| AT1G31170 | AT1G31170.1 | ACGTCGTCGTTTT | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT1G31170.1 | GAAACGACGCCGT | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT1G31170.2 | ACGTCGTCGTTTT | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT1G31170.2 | GAAACGACGCCGT | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT1G31170.3 | ACGTCGTCGTTTT | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT1G31170.3 | GAAACGACGCCGT | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT1G32210 | AT1G32210.1 | AAAACGACGCCGTT | Encodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation. |
| AT1G32210.1 | TAAACGACGT | Encodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation. |
| AT1G32220 | AT1G32220.1 | AACGGCGTCGTTTT | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT1G32220.1 | GATGACGTCGTTTA | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT1G32490 | AT1G32490.1 | AAAACGACGC | Encodes a homolog of the yeast PRP2 protein, one of four related DEAH RNA helicases identified as essential cofactors for RNA splicing. |
| AT1G32870 | AT1G32870.1 | CCGACCCGAAAAAACGACGTC | Arabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT1G32870.2 | CCGACCCGAAAAAACGACGTC | Arabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT1G33390 | AT1G33390.1 | AAAACGACGA | helicase domain-containing protein; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: helicase domain-containing protein (TAIR:AT1G48650.2); Has 11093 Blast hits to 6432 proteins in 948 species: Archae - 0; Bacteria - 3704; Metazoa - 3089; Fungi - 1453; Plants - 542; Viruses - 298; Other Eukaryotes - 2007 (source: NCBI BLink). |
| AT1G35580 | AT1G35580.1 | TCGTCGTTTAGTCCACGTAG | Encodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. |
| AT1G35580.2 | TCGTCGTTTAGTCCACGTAG | Encodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. |
| AT1G35580.3 | TCGTCGTTTAGTCCACGTAG | Encodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. |
| AT1G43245 | AT1G43245.1 | AACGACGTCGTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214); Has 432 Blast hits to 430 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 212; Fungi - 80; Plants - 47; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT1G44224 | AT1G44224.1 | AAAACGACGT | Encodes a ECA1 gametogenesis related family protein |
| AT1G48460 | AT1G48460.1 | TCGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63040.2); Has 36 Blast hits to 36 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G49330 | AT1G49330.1 | CGTCGTTTT | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16190.1); Has 840 Blast hits to 686 proteins in 130 species: Archae - 0; Bacteria - 47; Metazoa - 222; Fungi - 69; Plants - 342; Viruses - 66; Other Eukaryotes - 94 (source: NCBI BLink). |
| AT1G53320 | AT1G53320.1 | ATCCGGTTTAGTCGTCGTTTCCGGTTTAG | Member of TLP family |
| AT1G54370 | AT1G54370.1 | AAAACGACG | NHX5; FUNCTIONS IN: sodium:hydrogen antiporter activity, sodium ion transmembrane transporter activity; INVOLVED IN: lithium ion transport, sodium ion transport; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Na+/H+ exchanger, subfamily (InterPro:IPR004709), Na+/H+ exchanger, isoform 5/6/8, conserved region (InterPro:IPR018409), Cation/H+ exchanger, conserved region (InterPro:IPR018422), Cation/H+ exchanger (InterPro:IPR006153), Na+/H+ exchanger, conserved region (InterPro:IPR018406); BEST Arabidopsis thaliana protein match is: sodium proton exchanger, putative (NHX6) (TAIR:AT1G79610.1); Has 4120 Blast hits to 4115 proteins in 1050 species: Archae - 70; Bacteria - 2497; Metazoa - 747; Fungi - 105; Plants - 279; Viruses - 0; Other Eukaryotes - 422 (source: NCBI BLink). |
| AT1G55080 | AT1G55080.1 | GAAACGACGGCGTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29580.1); Has 64498 Blast hits to 23302 proteins in 980 species: Archae - 12; Bacteria - 3118; Metazoa - 24455; Fungi - 7046; Plants - 5363; Viruses - 296; Other Eukaryotes - 24208 (source: NCBI BLink). |
| AT1G56190 | AT1G56190.1 | TAAACGACGT | phosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). |
| AT1G56190.2 | TAAACGACGT | phosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). |
| AT1G58025 | AT1G58025.1 | AAAACGACGACGT | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Bromodomain, conserved site (InterPro:IPR018359), Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: GTE6 (GENERAL TRANSCRIPTION FACTOR GROUP E6); DNA binding / H3/H4 histone acetyltransferase (TAIR:AT3G52280.1); Has 1681 Blast hits to 1341 proteins in 127 species: Archae - 0; Bacteria - 31; Metazoa - 1070; Fungi - 94; Plants - 24; Viruses - 13; Other Eukaryotes - 449 (source: NCBI BLink). |
| AT1G60380 | AT1G60380.1 | ACGGCGTCGTTTT | apical meristem formation protein-related; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac024 (Arabidopsis NAC domain containing protein 24); transcription factor (TAIR:AT1G60350.1); Has 227 Blast hits to 222 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 227; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G61100 | AT1G61100.1 | AAAACGACGA | disease resistance protein (TIR class), putative; INVOLVED IN: defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: CIP7 (COP1-INTERACTING PROTEIN 7); transcription activator (TAIR:AT4G27430.2); Has 1483 Blast hits to 1173 proteins in 180 species: Archae - 4; Bacteria - 96; Metazoa - 658; Fungi - 133; Plants - 105; Viruses - 8; Other Eukaryotes - 479 (source: NCBI BLink). |
| AT1G62820 | AT1G62820.1 | AAAACGACGACGT | calmodulin, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: response to cold; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT1G12310.1); Has 12799 Blast hits to 10828 proteins in 1248 species: Archae - 0; Bacteria - 22; Metazoa - 5376; Fungi - 3677; Plants - 2002; Viruses - 0; Other Eukaryotes - 1722 (source: NCBI BLink). |
| AT1G63690 | AT1G63690.1 | CGTCGTTTT | protease-associated (PA) domain-containing protein; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: aspartic-type endopeptidase/ peptidase (TAIR:AT1G01650.1); Has 1356 Blast hits to 1341 proteins in 210 species: Archae - 0; Bacteria - 123; Metazoa - 670; Fungi - 109; Plants - 251; Viruses - 0; Other Eukaryotes - 203 (source: NCBI BLink). |
| AT1G63690.2 | CGTCGTTTT | protease-associated (PA) domain-containing protein; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: aspartic-type endopeptidase/ peptidase (TAIR:AT1G01650.1); Has 1356 Blast hits to 1341 proteins in 210 species: Archae - 0; Bacteria - 123; Metazoa - 670; Fungi - 109; Plants - 251; Viruses - 0; Other Eukaryotes - 203 (source: NCBI BLink). |
| AT1G64300 | AT1G64300.1 | AAAACGACGACGT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF1221 (InterPro:IPR010632), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G41730.1); Has 57758 Blast hits to 57382 proteins in 1547 species: Archae - 35; Bacteria - 3482; Metazoa - 27181; Fungi - 4162; Plants - 12706; Viruses - 211; Other Eukaryotes - 9981 (source: NCBI BLink). |
| AT1G64300.2 | AAAACGACGACGT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF1221 (InterPro:IPR010632), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G41730.1); Has 57758 Blast hits to 57382 proteins in 1547 species: Archae - 35; Bacteria - 3482; Metazoa - 27181; Fungi - 4162; Plants - 12706; Viruses - 211; Other Eukaryotes - 9981 (source: NCBI BLink). |
| AT1G65260 | AT1G65260.1 | AAAACGACGT | PLASTID TRANSCRIPTIONALLY ACTIVE4 (PTAC4); INVOLVED IN: biological_process unknown; LOCATED IN: in 8 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PspA/IM30 (InterPro:IPR007157); Has 1986 Blast hits to 1960 proteins in 677 species: Archae - 19; Bacteria - 1376; Metazoa - 142; Fungi - 53; Plants - 51; Viruses - 92; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT1G65280 | AT1G65280.1 | TAAACGACGC | heat shock protein binding; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G22080.1); Has 22647 Blast hits to 16088 proteins in 1412 species: Archae - 102; Bacteria - 2761; Metazoa - 9875; Fungi - 2142; Plants - 1453; Viruses - 33; Other Eukaryotes - 6281 (source: NCBI BLink). |
| AT1G65290 | AT1G65290.1 | AACGACGTCGTTTT | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. As part of the mitochondrial matrix, it is likely to be involved in fatty acid or lipoic acid biogenesis. |
| AT1G65445 | AT1G65445.1 | AAAACGACGTC | transferase-related; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: HCT (HYDROXYCINNAMOYL-COA SHIKIMATE/QUINATE HYDROXYCINNAMOYL TRANSFERASE); quinate O-hydroxycinnamoyltransferase/ shikimate O-hydroxycinnamoyltransferase/ transferase (TAIR:AT5G48930.1); Has 438 Blast hits to 437 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 435; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G66980 | AT1G66980.1 | AAAACGACG | protein kinase family protein / glycerophosphoryl diester phosphodiesterase family protein; FUNCTIONS IN: kinase activity, glycerophosphodiester phosphodiesterase activity; INVOLVED IN: protein amino acid phosphorylation, glycerol metabolic process, lipid metabolic process; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), Glycerophosphoryl diester phosphodiesterase (InterPro:IPR004129); BEST Arabidopsis thaliana protein match is: SVL2 (SHV3-LIKE 2); glycerophosphodiester phosphodiesterase/ kinase (TAIR:AT1G66970.1); Has 83198 Blast hits to 81593 proteins in 3160 species: Archae - 72; Bacteria - 7405; Metazoa - 36840; Fungi - 6415; Plants - 18473; Viruses - 266; Other Eukaryotes - 13727 (source: NCBI BLink). |
| AT1G67865 | AT1G67865.1 | AAAACGACGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G69330 | AT1G69330.1 | TGTCGTTTTCGTCGTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ubiquitin-protein ligase (TAIR:AT3G29270.2); Has 225 Blast hits to 225 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 95; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G69340 | AT1G69340.1 | AAACGACGAAAACGACA | appr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT2G40600.1); Has 2230 Blast hits to 2187 proteins in 671 species: Archae - 43; Bacteria - 984; Metazoa - 848; Fungi - 95; Plants - 99; Viruses - 7; Other Eukaryotes - 154 (source: NCBI BLink). |
| AT1G69640 | AT1G69640.1 | ACGGCGTCGTTTC | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT1G70490 | AT1G70490.1 | GAAACGACGAATAAACCGGT | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT1G70490.2 | GAAACGACGAATAAACCGGT | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT1G70490.3 | GAAACGACGAATAAACCGGT | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT1G70530 | AT1G70530.1 | ACGGCGTCGTTTT | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF26 (InterPro:IPR002902), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G40380.1); Has 86025 Blast hits to 84934 proteins in 3436 species: Archae - 55; Bacteria - 7756; Metazoa - 37741; Fungi - 6539; Plants - 18862; Viruses - 424; Other Eukaryotes - 14648 (source: NCBI BLink). |
| AT1G70610 | AT1G70610.1 | GAAACGACGCGTTTTA | member of TAP subfamily |
| AT1G71840 | AT1G71840.1 | AAACGACGTCGTTTA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 67893 Blast hits to 26212 proteins in 696 species: Archae - 58; Bacteria - 6808; Metazoa - 32655; Fungi - 12563; Plants - 6168; Viruses - 0; Other Eukaryotes - 9641 (source: NCBI BLink). |
| AT1G71840.1 | GCGTCGTTTA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 67893 Blast hits to 26212 proteins in 696 species: Archae - 58; Bacteria - 6808; Metazoa - 32655; Fungi - 12563; Plants - 6168; Viruses - 0; Other Eukaryotes - 9641 (source: NCBI BLink). |
| AT1G72175 | AT1G72175.1 | AACGACGTCGTTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1232 (InterPro:IPR010652), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G22510.1); Has 591 Blast hits to 591 proteins in 84 species: Archae - 0; Bacteria - 8; Metazoa - 474; Fungi - 32; Plants - 29; Viruses - 2; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT1G75180 | AT1G75180.1 | GCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75180.2 | GCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75180.3 | GCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G79830 | AT1G79830.1 | GAAACGACGCCGTTT | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). |
| AT1G79830.2 | GAAACGACGCCGTTT | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). |
| AT1G79990 | AT1G79990.3 | AAAACGACGTC | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat, endomembrane system, COPI vesicle coat; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Coatomer, WD associated region (InterPro:IPR006692), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: coatomer protein complex, subunit beta 2 (beta prime), putative (TAIR:AT1G52360.1); Has 55918 Blast hits to 24188 proteins in 622 species: Archae - 40; Bacteria - 5752; Metazoa - 25846; Fungi - 10921; Plants - 5304; Viruses - 8; Other Eukaryotes - 8047 (source: NCBI BLink). |
| AT1G79990.5 | AAAACGACGTC | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat, endomembrane system, COPI vesicle coat; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Coatomer, WD associated region (InterPro:IPR006692), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: coatomer protein complex, subunit beta 2 (beta prime), putative (TAIR:AT1G52360.1); Has 55918 Blast hits to 24188 proteins in 622 species: Archae - 40; Bacteria - 5752; Metazoa - 25846; Fungi - 10921; Plants - 5304; Viruses - 8; Other Eukaryotes - 8047 (source: NCBI BLink). |
| AT2G01110 | AT2G01110.1 | AACGACGTCGTTTA | mutant is Albino and pale green; Chloroplast Protein Translocation (tatC). Core subunit of the chloroplast Tat translocase. Integral chloroplast thylakoid membrane protein. |
| AT2G01120 | AT2G01120.1 | TAAACGACGTCGTT | Origin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
| AT2G04850 | AT2G04850.1 | GAAACGACGTCGTTTA | auxin-responsive protein-related; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive family protein (TAIR:AT3G25290.2); Has 374 Blast hits to 374 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 72; Fungi - 47; Plants - 246; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT2G04890 | AT2G04890.1 | AAAACGACGTCGT | Encodes a scarecrow-like protein (SCL21). Member of GRAS gene family. |
| AT2G05260 | AT2G05260.1 | TAAAACGCCGTCGTTTC | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT4G10955.1); Has 115 Blast hits to 115 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G05260.2 | TAAAACGCCGTCGTTTC | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT4G10955.1); Has 115 Blast hits to 115 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G05830 | AT2G05830.1 | AAAACGACGTC | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: cellular biosynthetic process, translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative translation initiation factor, aIF-2BI/5-methylthioribose-1-phosphate isomerase (InterPro:IPR005251), Initiation factor 2B related (InterPro:IPR000649), Initiation factor 2B alpha/beta/delta (InterPro:IPR011559); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 2B family protein / eIF-2B family protein (TAIR:AT3G07300.3); Has 3649 Blast hits to 3647 proteins in 608 species: Archae - 219; Bacteria - 965; Metazoa - 445; Fungi - 250; Plants - 116; Viruses - 0; Other Eukaryotes - 1654 (source: NCBI BLink). |
| AT2G05830.2 | AAAACGACGTC | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: cellular biosynthetic process, translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative translation initiation factor, aIF-2BI/5-methylthioribose-1-phosphate isomerase (InterPro:IPR005251), Initiation factor 2B related (InterPro:IPR000649), Initiation factor 2B alpha/beta/delta (InterPro:IPR011559); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 2B family protein / eIF-2B family protein (TAIR:AT3G07300.3); Has 3649 Blast hits to 3647 proteins in 608 species: Archae - 219; Bacteria - 965; Metazoa - 445; Fungi - 250; Plants - 116; Viruses - 0; Other Eukaryotes - 1654 (source: NCBI BLink). |
| AT2G05830.3 | AAAACGACGTC | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: cellular biosynthetic process, translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative translation initiation factor, aIF-2BI/5-methylthioribose-1-phosphate isomerase (InterPro:IPR005251), Initiation factor 2B related (InterPro:IPR000649), Initiation factor 2B alpha/beta/delta (InterPro:IPR011559); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 2B family protein / eIF-2B family protein (TAIR:AT3G07300.3); Has 3649 Blast hits to 3647 proteins in 608 species: Archae - 219; Bacteria - 965; Metazoa - 445; Fungi - 250; Plants - 116; Viruses - 0; Other Eukaryotes - 1654 (source: NCBI BLink). |
| AT2G05830.4 | AAAACGACGTC | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: cellular biosynthetic process, translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative translation initiation factor, aIF-2BI/5-methylthioribose-1-phosphate isomerase (InterPro:IPR005251), Initiation factor 2B related (InterPro:IPR000649), Initiation factor 2B alpha/beta/delta (InterPro:IPR011559); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 2B family protein / eIF-2B family protein (TAIR:AT3G07300.3); Has 3649 Blast hits to 3647 proteins in 608 species: Archae - 219; Bacteria - 965; Metazoa - 445; Fungi - 250; Plants - 116; Viruses - 0; Other Eukaryotes - 1654 (source: NCBI BLink). |
| AT2G17630 | AT2G17630.1 | ACGTCGTTTT | phosphoserine aminotransferase, putative; FUNCTIONS IN: pyridoxal phosphate binding, transaminase activity, catalytic activity, O-phospho-L-serine:2-oxoglutarate aminotransferase activity; INVOLVED IN: response to cadmium ion; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase, class V/Cysteine desulfurase (InterPro:IPR000192), Phosphoserine aminotransferase (InterPro:IPR003248), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (InterPro:IPR015422); BEST Arabidopsis thaliana protein match is: PSAT; O-phospho-L-serine:2-oxoglutarate aminotransferase (TAIR:AT4G35630.1); Has 3399 Blast hits to 3398 proteins in 981 species: Archae - 32; Bacteria - 1822; Metazoa - 150; Fungi - 92; Plants - 37; Viruses - 0; Other Eukaryotes - 1266 (source: NCBI BLink). |
| AT2G19560 | AT2G19560.1 | CGTCGTTTT | encodes a protein with a PAM domain involved in ethylene signaling. eer5 mutants show ethylene hypersensitivity in relation to hypocotyl elongation. EER5 interacts with EIN2 and with COP9 in Y2H assays. EIN3 protein levels are the same in WT and eer5-1 mutants. EER5 may be involved in promoting a dampening of the ethylene response. |
| AT2G20450 | AT2G20450.1 | TAAACGACGTC | 60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT2G20820 | AT2G20820.1 | ACGGCGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 28 Blast hits to 28 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G20820.2 | ACGGCGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 28 Blast hits to 28 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G21250 | AT2G21250.1 | TAAACGACGT | mannose 6-phosphate reductase (NADPH-dependent), putative; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: cultured cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: mannose 6-phosphate reductase (NADPH-dependent), putative (TAIR:AT2G21260.1); Has 13388 Blast hits to 13358 proteins in 1330 species: Archae - 187; Bacteria - 7678; Metazoa - 1798; Fungi - 1191; Plants - 907; Viruses - 0; Other Eukaryotes - 1627 (source: NCBI BLink). |
| AT2G21250.2 | TAAACGACGT | mannose 6-phosphate reductase (NADPH-dependent), putative; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: cultured cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: mannose 6-phosphate reductase (NADPH-dependent), putative (TAIR:AT2G21260.1); Has 13388 Blast hits to 13358 proteins in 1330 species: Archae - 187; Bacteria - 7678; Metazoa - 1798; Fungi - 1191; Plants - 907; Viruses - 0; Other Eukaryotes - 1627 (source: NCBI BLink). |
| AT2G24060 | AT2G24060.1 | GAAACGACGT | translation initiation factor 3 (IF-3) family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 3 (InterPro:IPR001288); BEST Arabidopsis thaliana protein match is: translation initiation factor 3 (IF-3) family protein (TAIR:AT4G30690.1); Has 17514 Blast hits to 8661 proteins in 1545 species: Archae - 56; Bacteria - 6187; Metazoa - 2053; Fungi - 689; Plants - 758; Viruses - 336; Other Eukaryotes - 7435 (source: NCBI BLink). |
| AT2G24250 | AT2G24250.1 | AAAACGACGTCATC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G64840.1); Has 60 Blast hits to 58 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G24250.2 | AAAACGACGTCATC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G64840.1); Has 60 Blast hits to 58 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G24360 | AT2G24360.1 | TAAATGGGAAACGACGA | serine/threonine/tyrosine kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G31170.3); Has 96787 Blast hits to 95023 proteins in 3525 species: Archae - 68; Bacteria - 8423; Metazoa - 42926; Fungi - 8081; Plants - 19355; Viruses - 602; Other Eukaryotes - 17332 (source: NCBI BLink). |
| AT2G25720 | AT2G25720.1 | TCGTCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G26780 | AT2G26780.1 | ACGACGTCGTTTA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 325 Blast hits to 275 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 149; Fungi - 125; Plants - 34; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT2G27500 | AT2G27500.3 | AAAACGACGTCGT | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to plasma membrane, nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT1G32860.1); Has 1391 Blast hits to 1379 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 1379; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G29440 | AT2G29440.1 | TCGTCGTTT | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29450 | AT2G29450.1 | TCGTCGTTTT | Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002) |
| AT2G29460 | AT2G29460.1 | CGTCGTTTT | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29630 | AT2G29630.1 | GAAACGACGT | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene. |
| AT2G29630.2 | GAAACGACGT | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene. |
| AT2G30520 | AT2G30520.1 | TAAACGACGA | light inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis |
| AT2G30520.2 | TAAACGACGA | light inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis |
| AT2G30520.3 | TAAACGACGA | light inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis |
| AT2G31200 | AT2G31200.1 | AACGACGTCGTTTC | Encodes actin depolymerizing factor 6 (ADF6). |
| AT2G31670 | AT2G31670.1 | TCGTCGTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisome, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Stress responsive alpha-beta barrel (InterPro:IPR013097), Dimeric alpha-beta barrel (InterPro:IPR011008); BEST Arabidopsis thaliana protein match is: DABB1 (DIMERIC A/B BARREL DOMAINS-PROTEIN 1) (TAIR:AT1G51360.1); Has 138 Blast hits to 135 proteins in 38 species: Archae - 0; Bacteria - 51; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G32520 | AT2G32520.1 | ACGTCGTCGTTTT | dienelactone hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase (InterPro:IPR002155), Dienelactone hydrolase (InterPro:IPR002925); BEST Arabidopsis thaliana protein match is: dienelactone hydrolase family protein (TAIR:AT1G35420.1); Has 2362 Blast hits to 2362 proteins in 596 species: Archae - 20; Bacteria - 1757; Metazoa - 54; Fungi - 12; Plants - 53; Viruses - 0; Other Eukaryotes - 466 (source: NCBI BLink). |
| AT2G33040 | AT2G33040.1 | GAAACGACGTCGT | ATP synthase gamma chain, mitochondrial (ATPC); FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, gamma subunit (InterPro:IPR000131); BEST Arabidopsis thaliana protein match is: ATPC1; enzyme regulator (TAIR:AT4G04640.1); Has 6854 Blast hits to 6853 proteins in 1574 species: Archae - 5; Bacteria - 3135; Metazoa - 212; Fungi - 103; Plants - 101; Viruses - 0; Other Eukaryotes - 3298 (source: NCBI BLink). |
| AT2G34040 | AT2G34040.1 | TGAACCGGCGTCGTTTT | apoptosis inhibitory 5 (API5) family protein; FUNCTIONS IN: binding; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Apoptosis inhibitory 5 (InterPro:IPR008383), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: apoptosis inhibitory 5 (API5) family protein (TAIR:AT1G29030.1); Has 245 Blast hits to 233 proteins in 69 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 14; Plants - 56; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT2G34040.2 | TGAACCGGCGTCGTTTT | apoptosis inhibitory 5 (API5) family protein; FUNCTIONS IN: binding; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Apoptosis inhibitory 5 (InterPro:IPR008383), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: apoptosis inhibitory 5 (API5) family protein (TAIR:AT1G29030.1); Has 245 Blast hits to 233 proteins in 69 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 14; Plants - 56; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT2G35320 | AT2G35320.1 | TAAACGACGCC | homologue of the animal Eyes Absent genes. encodes a tyrosine-specific phosphatase. the protein sequence lacks the cys-containing signature of the classical tyrosine phosphatases. belongs to the aspartate-based phosphatases. The enzyme activity is strictly metal-dependent. |
| AT2G37400 | AT2G37400.1 | AAAACGACGCCGT | chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast thylakoid lumen, plastid, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT3G53560.1); Has 1554 Blast hits to 1284 proteins in 289 species: Archae - 132; Bacteria - 762; Metazoa - 103; Fungi - 19; Plants - 70; Viruses - 0; Other Eukaryotes - 468 (source: NCBI BLink). |
| AT2G37510 | AT2G37510.1 | GAAACGACGACGT | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G54580.1); Has 15344 Blast hits to 11875 proteins in 560 species: Archae - 10; Bacteria - 833; Metazoa - 8796; Fungi - 1697; Plants - 2692; Viruses - 0; Other Eukaryotes - 1316 (source: NCBI BLink). |
| AT2G38080 | AT2G38080.1 | AAAACGACGTC | Encodes a protein with similarity to putative laccase, a member of laccase family (17 members in Arabidopsis). Might be involved in cell wall biosynthesis. Mutants have a mild irregular xylem phenotype. |
| AT2G40620 | AT2G40620.1 | AAACGACGC | bZIP transcription factor family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: AtbZIP52 (Arabidopsis thaliana basic leucine zipper 52); DNA binding / transcription factor (TAIR:AT1G06850.1); Has 1256 Blast hits to 1226 proteins in 140 species: Archae - 0; Bacteria - 14; Metazoa - 289; Fungi - 48; Plants - 766; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT2G42280 | AT2G42280.1 | AAAACGACGTC | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G51140.1); Has 932 Blast hits to 932 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 924; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G42280.2 | AAAACGACGTC | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G51140.1); Has 932 Blast hits to 932 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 924; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G43100 | AT2G43100.1 | GAAACGACGT | aconitase C-terminal domain-containing protein; FUNCTIONS IN: hydro-lyase activity, 3-isopropylmalate dehydratase activity; INVOLVED IN: leucine biosynthetic process, metabolic process; LOCATED IN: 3-isopropylmalate dehydratase complex, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: 3-isopropylmalate dehydratase, small subunit (InterPro:IPR012305), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase-like core (InterPro:IPR015937); BEST Arabidopsis thaliana protein match is: aconitase C-terminal domain-containing protein (TAIR:AT2G43090.1); Has 5949 Blast hits to 5949 proteins in 1261 species: Archae - 224; Bacteria - 3135; Metazoa - 7; Fungi - 224; Plants - 45; Viruses - 0; Other Eukaryotes - 2314 (source: NCBI BLink). |
| AT2G43360 | AT2G43360.1 | ACGTCGTCGTTT | Catalyzes the conversion of dethiobiotin to biotin. |
| AT2G43370 | AT2G43370.1 | AAACGACGACGT | U1 small nuclear ribonucleoprotein 70 kDa, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: U1-70K (U1 SMALL NUCLEAR RIBONUCLEOPROTEIN-70K); RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G50670.1); Has 15940 Blast hits to 13539 proteins in 557 species: Archae - 10; Bacteria - 827; Metazoa - 9526; Fungi - 1771; Plants - 2091; Viruses - 3; Other Eukaryotes - 1712 (source: NCBI BLink). |
| AT2G43750 | AT2G43750.1 | GACGTCGTTTT | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasB, the key enzyme for fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. |
| AT2G43760 | AT2G43760.1 | AAAACGACGTC | molybdopterin biosynthesis MoaE family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: Mo-molybdopterin cofactor biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molybdopterin biosynthesis MoaE (InterPro:IPR003448); Has 3000 Blast hits to 3000 proteins in 933 species: Archae - 109; Bacteria - 1683; Metazoa - 112; Fungi - 47; Plants - 25; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink). |
| AT2G43760.2 | AAAACGACGTC | molybdopterin biosynthesis MoaE family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: Mo-molybdopterin cofactor biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molybdopterin biosynthesis MoaE (InterPro:IPR003448); Has 3000 Blast hits to 3000 proteins in 933 species: Archae - 109; Bacteria - 1683; Metazoa - 112; Fungi - 47; Plants - 25; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink). |
| AT2G43760.3 | AAAACGACGTC | molybdopterin biosynthesis MoaE family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: Mo-molybdopterin cofactor biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molybdopterin biosynthesis MoaE (InterPro:IPR003448); Has 3000 Blast hits to 3000 proteins in 933 species: Archae - 109; Bacteria - 1683; Metazoa - 112; Fungi - 47; Plants - 25; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink). |
| AT2G44440 | AT2G44440.1 | GAAACGACG | emsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G13020.1); Has 355 Blast hits to 341 proteins in 54 species: Archae - 0; Bacteria - 6; Metazoa - 159; Fungi - 14; Plants - 166; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT2G45010 | AT2G45010.1 | AAAACGACGACGTGGCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51400.1); Has 322 Blast hits to 321 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 15; Plants - 299; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G45010.2 | AAAACGACGACGTGGCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51400.1); Has 322 Blast hits to 321 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 15; Plants - 299; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G46490 | AT2G46490.1 | AACGGCGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35110.1); Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G46900 | AT2G46900.1 | AAAACGACGTCGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix, Nulp1-type (InterPro:IPR006994); Has 3014 Blast hits to 2357 proteins in 239 species: Archae - 2; Bacteria - 96; Metazoa - 1166; Fungi - 321; Plants - 100; Viruses - 47; Other Eukaryotes - 1282 (source: NCBI BLink). |
| AT2G47170 | AT2G47170.1 | TCGTCGTTTT | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT3G01280 | AT3G01280.1 | TAAACGACGCCGTTTA | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
| AT3G01450 | AT3G01450.1 | AAAACGACGTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G14790.1); Has 188 Blast hits to 188 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 97; Fungi - 6; Plants - 61; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT3G01910 | AT3G01910.1 | AAAACGACGCCGTT | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT3G01910.2 | AAAACGACGCCGTT | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT3G01910.3 | AAAACGACGCCGTT | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT3G02080 | AT3G02080.1 | AAAACGACGTCATTT | 40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae - 134; Bacteria - 4; Metazoa - 345; Fungi - 96; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT3G02090 | AT3G02090.1 | AAATGACGTCGTTTT | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT3G02090.2 | AAATGACGTCGTTTT | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT3G02460 | AT3G02460.1 | ACGGCGTCGTTTC | plant adhesion molecule, putative; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: PAM1 (plant adhesion molecule 1); RAB GTPase activator (TAIR:AT5G15930.1); Has 4072 Blast hits to 4066 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 2318; Fungi - 725; Plants - 269; Viruses - 0; Other Eukaryotes - 760 (source: NCBI BLink). |
| AT3G02460.2 | ACGGCGTCGTTTC | plant adhesion molecule, putative; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: PAM1 (plant adhesion molecule 1); RAB GTPase activator (TAIR:AT5G15930.1); Has 4072 Blast hits to 4066 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 2318; Fungi - 725; Plants - 269; Viruses - 0; Other Eukaryotes - 760 (source: NCBI BLink). |
| AT3G03740 | AT3G03740.1 | AAACGACGTCGTT | BTB-POZ and MATH domain 4 (ATBPM4); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083), BTB/POZ fold (InterPro:IPR011333), BTB/POZ (InterPro:IPR013069), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: ATBPM5 (BTB-POZ and MATH domain 5); protein binding (TAIR:AT5G21010.1); Has 4765 Blast hits to 4690 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 3585; Fungi - 73; Plants - 877; Viruses - 41; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT3G05727 | AT3G05727.1 | GAAACGACGACGT | Encodes a defensin-like (DEFL) family protein. |
| AT3G06300 | AT3G06300.1 | AACGACGTCGTTTT | Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins. |
| AT3G06590 | AT3G06590.1 | AAAACGACGCC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT3G17100.2); Has 141 Blast hits to 141 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G06590.2 | AAAACGACGCC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT3G17100.2); Has 141 Blast hits to 141 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G07090 | AT3G07090.1 | TAAACGACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25170.1); Has 596 Blast hits to 596 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 84; Plants - 173; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT3G07200 | AT3G07200.1 | GAAACGACGA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G48655.3); Has 4419 Blast hits to 4404 proteins in 583 species: Archae - 0; Bacteria - 0; Metazoa - 3082; Fungi - 473; Plants - 291; Viruses - 27; Other Eukaryotes - 546 (source: NCBI BLink). |
| AT3G07200.2 | GAAACGACGA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G48655.3); Has 4419 Blast hits to 4404 proteins in 583 species: Archae - 0; Bacteria - 0; Metazoa - 3082; Fungi - 473; Plants - 291; Viruses - 27; Other Eukaryotes - 546 (source: NCBI BLink). |
| AT3G07680 | AT3G07680.1 | GACGTCGTTTA | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 protein-related (TAIR:AT3G22845.1); Has 672 Blast hits to 672 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 151; Plants - 95; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). |
| AT3G08520 | AT3G08520.1 | TCGTCGTTTT | 60S ribosomal protein L41 (RPL41D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G09570 | AT3G09570.1 | ACGGCGTCGTTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18520.1); Has 385 Blast hits to 385 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 216; Fungi - 12; Plants - 132; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT3G09650 | AT3G09650.1 | TCAAAACGACGACGT | RNA binding protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD transcript unit. |
| AT3G10210 | AT3G10210.1 | AAAACGACGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251); BEST Arabidopsis thaliana protein match is: Rho-GTPase-activating protein-related (TAIR:AT4G35750.1); Has 305 Blast hits to 305 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 230; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G10970 | AT3G10970.1 | AAAACGACGT | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G10970.2 | AAAACGACGT | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G10970.3 | AAAACGACGT | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G11500 | AT3G11500.1 | CCCATTAACAATGGGCTTGAAACGACG | small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SNRNP-G (PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G) (TAIR:AT2G23930.1); Has 921 Blast hits to 921 proteins in 197 species: Archae - 84; Bacteria - 0; Metazoa - 385; Fungi - 191; Plants - 117; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink). |
| AT3G11510 | AT3G11510.1 | AAACGACGACGT | 40S ribosomal protein S14 (RPS14B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971), Ribosomal S11, conserved site (InterPro:IPR018102); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S14 (RPS14A) (TAIR:AT2G36160.1); Has 6246 Blast hits to 6246 proteins in 1750 species: Archae - 169; Bacteria - 2829; Metazoa - 487; Fungi - 108; Plants - 517; Viruses - 0; Other Eukaryotes - 2136 (source: NCBI BLink). |
| AT3G11620 | AT3G11620.1 | AAAACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11620.2 | AAAACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11620.3 | AAAACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11620.4 | AAAACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11630 | AT3G11630.1 | GACGTCGTTTT | Encodes a 2-Cys peroxiredoxin (2-Cys PrxA) that contains two catalytic Cys residues. |
| AT3G12260 | AT3G12260.1 | GAAACGACGTCGTC | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G13410 | AT3G13410.1 | AAAACGACGCCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55546.1); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13845 | AT3G13845.1 | GAAACGACGCCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 11 Blast hits to 11 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G14980 | AT3G14980.1 | AAAACGACGA | PHD finger transcription factor, putative; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding, N-acetyltransferase activity; INVOLVED IN: regulation of transcription, DNA-dependent, metabolic process; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G05380.2); Has 3590 Blast hits to 2959 proteins in 154 species: Archae - 1; Bacteria - 6; Metazoa - 2815; Fungi - 238; Plants - 319; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT3G15770 | AT3G15770.1 | TCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25360.1); Has 74 Blast hits to 74 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G15770.2 | TCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25360.1); Has 74 Blast hits to 74 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G15990 | AT3G15990.1 | GAAACGACGC | Encodes sulfate transporter Sultr3;4. |
| AT3G16750 | AT3G16750.1 | ACGGCGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4694 Blast hits to 1384 proteins in 164 species: Archae - 36; Bacteria - 1175; Metazoa - 1347; Fungi - 379; Plants - 64; Viruses - 23; Other Eukaryotes - 1670 (source: NCBI BLink). |
| AT3G17205 | AT3G17205.1 | AAAACGACGTC | UBIQUITIN PROTEIN LIGASE 6 (UPL6); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein modification process, protein ubiquitination; LOCATED IN: ubiquitin ligase complex, intracellular; CONTAINS InterPro DOMAIN/s: HECT (InterPro:IPR000569), IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: UPL7; ubiquitin-protein ligase (TAIR:AT3G53090.2); Has 3380 Blast hits to 3333 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 2123; Fungi - 505; Plants - 160; Viruses - 0; Other Eukaryotes - 592 (source: NCBI BLink). |
| AT3G17205.2 | AAAACGACGTC | UBIQUITIN PROTEIN LIGASE 6 (UPL6); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein modification process, protein ubiquitination; LOCATED IN: ubiquitin ligase complex, intracellular; CONTAINS InterPro DOMAIN/s: HECT (InterPro:IPR000569), IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: UPL7; ubiquitin-protein ligase (TAIR:AT3G53090.2); Has 3380 Blast hits to 3333 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 2123; Fungi - 505; Plants - 160; Viruses - 0; Other Eukaryotes - 592 (source: NCBI BLink). |
| AT3G19440 | AT3G19440.1 | CGTCGTTTC | pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase (InterPro:IPR006145); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT1G78910.1); Has 11580 Blast hits to 11569 proteins in 1450 species: Archae - 12; Bacteria - 7208; Metazoa - 223; Fungi - 139; Plants - 126; Viruses - 0; Other Eukaryotes - 3872 (source: NCBI BLink). |
| AT3G20060 | AT3G20060.2 | AAAACGACGACGT | Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in dividing cells, but also in other non-dividing cells. Protein is localized to the cytoplasm as well as to the nucleus. |
| AT3G20270 | AT3G20270.1 | GAAACGACGTCGTC | lipid-binding serum glycoprotein family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Bactericidal permeability-increasing protein, alpha/beta domain (InterPro:IPR017943), Lipid-binding serum glycoprotein, N-terminal (InterPro:IPR017942), Lipid-binding serum glycoprotein, C-terminal (InterPro:IPR001124); BEST Arabidopsis thaliana protein match is: lipid-binding serum glycoprotein family protein (TAIR:AT1G04970.1); Has 353 Blast hits to 347 proteins in 49 species: Archae - 2; Bacteria - 0; Metazoa - 298; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT3G21400 | AT3G21400.1 | TCAAAACGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G22550 | AT3G22550.1 | AAAACGACGT | senescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: MARD1 (TAIR:AT3G63210.1); Has 303 Blast hits to 303 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 303; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G24200 | AT3G24200.1 | AAACGGCGTCGTTT | FAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink). |
| AT3G24200.2 | AAACGGCGTCGTTT | FAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink). |
| AT3G24315 | AT3G24315.1 | ACGTCGTTTT | AtSec20; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sec20 (InterPro:IPR005606); Has 205 Blast hits to 205 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 64; Plants - 27; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G25805 | AT3G25805.1 | AAAACGACGTCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 32 species: Archae - 0; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G26410 | AT3G26410.1 | AAACGACGC | methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT3G26630 | AT3G26630.1 | AAAACGACGACGT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 11770 Blast hits to 4443 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 21; Plants - 11596; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| AT3G26935 | AT3G26935.1 | AAAACGACG | zinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT5G41060.1); Has 3999 Blast hits to 3989 proteins in 185 species: Archae - 0; Bacteria - 0; Metazoa - 1952; Fungi - 537; Plants - 411; Viruses - 0; Other Eukaryotes - 1099 (source: NCBI BLink). |
| AT3G27770 | AT3G27770.1 | GACGTCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G27770.2 | GACGTCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G46020 | AT3G46020.1 | ACGTCGTCGTTTC | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae - 8; Bacteria - 979; Metazoa - 12428; Fungi - 2358; Plants - 2944; Viruses - 0; Other Eukaryotes - 2115 (source: NCBI BLink). |
| AT3G46620 | AT3G46620.1 | AAAACGACGACGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Protein of unknown function DUF1117 (InterPro:IPR010543); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G59550.1); Has 5953 Blast hits to 5931 proteins in 209 species: Archae - 0; Bacteria - 6; Metazoa - 2088; Fungi - 498; Plants - 2518; Viruses - 31; Other Eukaryotes - 812 (source: NCBI BLink). |
| AT3G46830 | AT3G46830.1 | GACGTCGTTTC | ARABIDOPSIS RAB GTPASE HOMOLOG A2C (ATRABA2C); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: endosome, plasma membrane, cell plate; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: ATRABA2D (HOARABIDOPSIS RAB GTPASE HOMOLOG A2D); GTP binding (TAIR:AT5G59150.1); Has 23118 Blast hits to 23078 proteins in 640 species: Archae - 19; Bacteria - 105; Metazoa - 12740; Fungi - 3037; Plants - 2133; Viruses - 19; Other Eukaryotes - 5065 (source: NCBI BLink). |
| AT3G48425 | AT3G48425.1 | AAACGACG | endonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: hydrolase activity, nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135), Exodeoxyribonuclease III xth (InterPro:IPR004808); BEST Arabidopsis thaliana protein match is: ARP; DNA-(apurinic or apyrimidinic site) lyase (TAIR:AT2G41460.1); Has 3937 Blast hits to 3936 proteins in 1101 species: Archae - 54; Bacteria - 2118; Metazoa - 201; Fungi - 59; Plants - 62; Viruses - 0; Other Eukaryotes - 1443 (source: NCBI BLink). |
| AT3G48680 | AT3G48680.1 | AAAACGACGA | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. |
| AT3G50808 | AT3G50808.1 | GAAACGACGACGT | unknown protein. |
| AT3G52050 | AT3G52050.1 | TCGTCGTTTC | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.2 | TCGTCGTTTC | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.3 | TCGTCGTTTC | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.4 | TCGTCGTTTC | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.5 | TCGTCGTTTC | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52090 | AT3G52090.1 | AAAACGACGTCGT | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB11 and the E. oli RNA polymerase alpha subunit. |
| AT3G53580 | AT3G53580.1 | AAAACGACGTGG | diaminopimelate epimerase family protein; FUNCTIONS IN: diaminopimelate epimerase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Diaminopimelate epimerase, active site (InterPro:IPR018510), Diaminopimelate epimerase (InterPro:IPR001653); Has 5079 Blast hits to 5075 proteins in 1167 species: Archae - 51; Bacteria - 2343; Metazoa - 5; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 2658 (source: NCBI BLink). |
| AT3G59190 | AT3G59190.1 | AAACGGCGTCGTTTC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, embryo, seed; EXPRESSED DURING: D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G59200.1); Has 1274 Blast hits to 1236 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1274; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G60240 | AT3G60240.2 | GCGTCGTTTC | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
| AT3G60240.3 | GCGTCGTTTC | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
| AT3G60240.4 | GCGTCGTTTC | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
| AT3G61070 | AT3G61070.1 | AAAACGACGT | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT3G61070.2 | AAAACGACGT | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT3G61670 | AT3G61670.1 | AAAACGACGTCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46380.1); Has 197 Blast hits to 162 proteins in 30 species: Archae - 0; Bacteria - 2; Metazoa - 13; Fungi - 15; Plants - 161; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G61670.1 | AAAACGCCGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46380.1); Has 197 Blast hits to 162 proteins in 30 species: Archae - 0; Bacteria - 2; Metazoa - 13; Fungi - 15; Plants - 161; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G63140 | AT3G63140.1 | TAAACGACG | Encodes a protein with ribonuclease activity that is involved in plastid rRNA maturation. |
| AT3G63150 | AT3G63150.1 | AAAACGACG | Encodes a calcium binding GTPases that is localized to the mitochondrion and is involved in salt stress response. |
| AT3G63220 | AT3G63220.1 | AAAACGACGACGT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G16250.1); Has 4947 Blast hits to 3281 proteins in 155 species: Archae - 4; Bacteria - 274; Metazoa - 3818; Fungi - 8; Plants - 628; Viruses - 20; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT3G63220.2 | AAAACGACGACGT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G16250.1); Has 4947 Blast hits to 3281 proteins in 155 species: Archae - 4; Bacteria - 274; Metazoa - 3818; Fungi - 8; Plants - 628; Viruses - 20; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT4G00290 | AT4G00290.1 | AAAACGACGTC | mechanosensitive ion channel domain-containing protein / MS ion channel domain-containing protein; LOCATED IN: chloroplast, membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Mechanosensitive ion channel MscS, transmembrane-2 (InterPro:IPR011014), Mechanosensitive ion channel MscS (InterPro:IPR006685), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00234.1); Has 8044 Blast hits to 8044 proteins in 1230 species: Archae - 282; Bacteria - 5483; Metazoa - 2; Fungi - 2; Plants - 99; Viruses - 0; Other Eukaryotes - 2176 (source: NCBI BLink). |
| AT4G01560 | AT4G01560.1 | ACGGCGTCGTTTA | maternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 218; Fungi - 225; Plants - 59; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT4G01810 | AT4G01810.1 | AACGACGTCGTTTC | protein transport protein-related; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular protein transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895); BEST Arabidopsis thaliana protein match is: transport protein, putative (TAIR:AT2G21630.1); Has 7526 Blast hits to 4938 proteins in 507 species: Archae - 16; Bacteria - 861; Metazoa - 2084; Fungi - 961; Plants - 2123; Viruses - 449; Other Eukaryotes - 1032 (source: NCBI BLink). |
| AT4G03120 | AT4G03120.1 | GAAACGACGTC | proline-rich family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, U1-C type (InterPro:IPR013085), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 34224 Blast hits to 17252 proteins in 759 species: Archae - 8; Bacteria - 3549; Metazoa - 17424; Fungi - 3540; Plants - 5278; Viruses - 776; Other Eukaryotes - 3649 (source: NCBI BLink). |
| AT4G03200 | AT4G03200.2 | AACGACGTCGTTTT | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF255 (InterPro:IPR004879), Thioredoxin fold (InterPro:IPR012335), Six-hairpin glycosidase-like (InterPro:IPR008928), Thioredoxin-like fold (InterPro:IPR012336); Has 2027 Blast hits to 2020 proteins in 379 species: Archae - 84; Bacteria - 613; Metazoa - 108; Fungi - 47; Plants - 17; Viruses - 0; Other Eukaryotes - 1158 (source: NCBI BLink). |
| AT4G03430 | AT4G03430.1 | AAACGACGTCGTTTA | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT4G03490 | AT4G03490.1 | CGTCGTTTT | protein binding; FUNCTIONS IN: protein binding; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G03500.1); Has 19395 Blast hits to 9360 proteins in 384 species: Archae - 23; Bacteria - 1025; Metazoa - 12359; Fungi - 1194; Plants - 1122; Viruses - 91; Other Eukaryotes - 3581 (source: NCBI BLink). |
| AT4G04190 | AT4G04190.1 | TAAACGACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G04190.2 | TAAACGACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G04350 | AT4G04350.1 | AACGGCGTCGTTTC | EMBRYO DEFECTIVE 2369 (EMB2369); FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, leucine-tRNA ligase activity, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Leucyl-tRNA synthetase, class Ia, bacterial/mitochondrial (InterPro:IPR002302), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Aminoacyl-tRNA synthetase, class Ia (InterPro:IPR002300), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: OVA2 (ovule abortion 2); ATP binding / aminoacyl-tRNA ligase/ isoleucine-tRNA ligase/ nucleotide binding (TAIR:AT5G49030.2); Has 28364 Blast hits to 26241 proteins in 1865 species: Archae - 900; Bacteria - 12390; Metazoa - 742; Fungi - 524; Plants - 168; Viruses - 3; Other Eukaryotes - 13637 (source: NCBI BLink). |
| AT4G05400 | AT4G05400.1 | AAAACGACGTCGTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21140.1); Has 31 Blast hits to 31 proteins in 12 species: Archae - 5; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G05400.2 | AAAACGACGTCGTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21140.1); Has 31 Blast hits to 31 proteins in 12 species: Archae - 5; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G09040 | AT4G09040.1 | ACGTCGTTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). |
| AT4G09040.1 | TAAACGACGTC | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). |
| AT4G09040.2 | ACGTCGTTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). |
| AT4G09040.2 | TAAACGACGTC | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). |
| AT4G10790 | AT4G10790.1 | AAAACGACGTCGT | UBX domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UAS (InterPro:IPR006577), UBX (InterPro:IPR001012); BEST Arabidopsis thaliana protein match is: SAY1 (TAIR:AT4G11740.1); Has 16384 Blast hits to 7928 proteins in 781 species: Archae - 7; Bacteria - 2234; Metazoa - 5947; Fungi - 1696; Plants - 733; Viruses - 184; Other Eukaryotes - 5583 (source: NCBI BLink). |
| AT4G10800 | AT4G10800.1 | ACGACGTCGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT3G05675.2); Has 114 Blast hits to 114 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G10925 | AT4G10925.1 | TAAACGACGA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G10925.2 | TAAACGACGA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G11740 | AT4G11740.1 | AAAACGACGA | Isolated as a suppressor of a dominant mutant in the Ara4 gene that was expressed in yeast ypt1 mutant strains. A novel protein with a small region of similarity to coil-coiled domain of yeast VSP27 protein. |
| AT4G12650 | AT4G12650.1 | CGTCGTTTA | LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35160.1); Has 983 Blast hits to 980 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 434; Fungi - 144; Plants - 228; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT4G12700 | AT4G12700.1 | GACGTCGTTTTAGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G04280.1); Has 77 Blast hits to 77 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G14145 | AT4G14145.1 | ACGTCGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G14200 | AT4G14200.1 | TCGTCGTTTA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; Has 1311 Blast hits to 831 proteins in 209 species: Archae - 4; Bacteria - 342; Metazoa - 470; Fungi - 179; Plants - 56; Viruses - 0; Other Eukaryotes - 260 (source: NCBI BLink). |
| AT4G14500 | AT4G14500.1 | ACGTCGTTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G23080.1); Has 257 Blast hits to 256 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT4G14500.2 | ACGTCGTTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G23080.1); Has 257 Blast hits to 256 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT4G14905 | AT4G14905.1 | TCGTCGTTTC | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT4G14905.2 | TCGTCGTTTC | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT4G15010 | AT4G15010.1 | AAAACGACGTCATTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT4G15010.2 | AAAACGACGTCATTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT4G15010.3 | AAAACGACGTCATTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT4G15830 | AT4G15830.1 | GAAACGACGTCGT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT3G01450.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 5; Plants - 61; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT4G15840 | AT4G15840.1 | ACGACGTCGTTTC | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); Has 305 Blast hits to 303 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 12; Plants - 22; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT4G15930 | AT4G15930.1 | AAAACGACGTGG | microtubule motor; FUNCTIONS IN: microtubule motor activity; INVOLVED IN: microtubule-based process; LOCATED IN: microtubule associated complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dynein light chain, type 1 and 2 (InterPro:IPR001372); BEST Arabidopsis thaliana protein match is: dynein light chain, putative (TAIR:AT5G20110.1); Has 980 Blast hits to 980 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 538; Fungi - 74; Plants - 124; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT4G16190 | AT4G16190.1 | TCGTCGTTTT | cysteine proteinase, putative; FUNCTIONS IN: cysteine-type peptidase activity, cysteine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: RD19 (RESPONSIVE TO DEHYDRATION 19); cysteine-type endopeptidase/ cysteine-type peptidase (TAIR:AT4G39090.1); Has 6049 Blast hits to 6013 proteins in 589 species: Archae - 27; Bacteria - 106; Metazoa - 2786; Fungi - 4; Plants - 1188; Viruses - 126; Other Eukaryotes - 1812 (source: NCBI BLink). |
| AT4G18040 | AT4G18040.1 | AAAACGACGTCGT | eIF4E protein. The cum1 mutation affects the local spreading of CMV within the inoculated leaf, delaying accumulation of cucumber mosaic virus coat protein. |
| AT4G21150 | AT4G21150.1 | CGTCGTTTC | HAPLESS 6 (HAP6); FUNCTIONS IN: dolichyl-diphosphooligosaccharide-protein glycotransferase activity; INVOLVED IN: protein amino acid terminal N-glycosylation, response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribophorin II (InterPro:IPR008814); Has 203 Blast hits to 203 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 36; Plants - 21; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT4G22235 | AT4G22235.1 | TAAACGACGA | Encodes a defensin-like (DEFL) family protein. |
| AT4G22235.2 | TAAACGACGA | Encodes a defensin-like (DEFL) family protein. |
| AT4G22720 | AT4G22720.1 | TCGTCGTTTC | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). |
| AT4G22720.1 | TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). |
| AT4G22720.2 | TCGTCGTTTC | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). |
| AT4G22720.2 | TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). |
| AT4G23620 | AT4G23620.1 | GAAACGACGACGTCGTTTT | 50S ribosomal protein-related; FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L25 (InterPro:IPR001021), Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G66860.1); Has 2862 Blast hits to 2862 proteins in 613 species: Archae - 0; Bacteria - 1307; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1515 (source: NCBI BLink). |
| AT4G23930 | AT4G23930.1 | ACGTCGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G64450.1); Has 183 Blast hits to 177 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G23930.2 | ACGTCGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G64450.1); Has 183 Blast hits to 177 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25290 | AT4G25290.1 | ACGACGTCGTTTTGA | DNA photolyase; FUNCTIONS IN: DNA photolyase activity; INVOLVED IN: DNA repair; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), DNA photolyase, N-terminal (InterPro:IPR006050), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G36530.2); Has 4147 Blast hits to 4144 proteins in 685 species: Archae - 35; Bacteria - 2248; Metazoa - 244; Fungi - 30; Plants - 260; Viruses - 0; Other Eukaryotes - 1330 (source: NCBI BLink). |
| AT4G25300 | AT4G25300.1 | TCAAAACGACGTCGT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G25310.1); Has 5835 Blast hits to 5806 proteins in 680 species: Archae - 0; Bacteria - 700; Metazoa - 111; Fungi - 623; Plants - 3093; Viruses - 0; Other Eukaryotes - 1308 (source: NCBI BLink). |
| AT4G25300.2 | TCAAAACGACGTCGT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G25310.1); Has 5835 Blast hits to 5806 proteins in 680 species: Archae - 0; Bacteria - 700; Metazoa - 111; Fungi - 623; Plants - 3093; Viruses - 0; Other Eukaryotes - 1308 (source: NCBI BLink). |
| AT4G26000 | AT4G26000.1 | AAAACGACGTCGT | Encodes a novel Arabidopsis gene encoding a polypeptide with K-homology (KH) RNA-binding modules, which acts on vegetative growth and pistil development. Genetic studies suggest that PEP interacts with element(s) of the CLAVATA signaling pathway. |
| AT4G26310 | AT4G26310.1 | AAACGACGCCGT | elongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT3G08740.1); Has 6706 Blast hits to 6706 proteins in 1428 species: Archae - 6; Bacteria - 4287; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 2373 (source: NCBI BLink). |
| AT4G26420 | AT4G26420.1 | AAAACGACGA | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes GAMT1, a methyltransferase that uses S-adenosine-L-methionine (SAM) as a methyl donor to methylate the carboxyl group of GAs, resulting in the methyl esters of GAs (MeGAs). Expressed most highly in the siliques during seed development. |
| AT4G26420.2 | AAAACGACGA | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes GAMT1, a methyltransferase that uses S-adenosine-L-methionine (SAM) as a methyl donor to methylate the carboxyl group of GAs, resulting in the methyl esters of GAs (MeGAs). Expressed most highly in the siliques during seed development. |
| AT4G26550 | AT4G26550.1 | GAAACGACGCCGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SFT2-like (InterPro:IPR011691); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56020.1); Has 452 Blast hits to 452 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 198; Fungi - 89; Plants - 61; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). |
| AT4G26750 | AT4G26750.1 | GACGTCGTTTC | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF605 (InterPro:IPR006745); BEST Arabidopsis thaliana protein match is: ATGSL11 (glucan synthase-like 11); 1,3-beta-glucan synthase/ transferase, transferring glycosyl groups (TAIR:AT3G59100.1); Has 27093 Blast hits to 16071 proteins in 790 species: Archae - 16; Bacteria - 1458; Metazoa - 10297; Fungi - 5609; Plants - 4452; Viruses - 743; Other Eukaryotes - 4518 (source: NCBI BLink). |
| AT4G26900 | AT4G26900.1 | GAAACGACGTCGTT | encodes a glutamine amidotransferase and cyclase, catalyzes the fifth and sixth steps of the histidine biosynthetic pathway |
| AT4G27090 | AT4G27090.1 | AAAACGACGCCGTTTT | 60S ribosomal protein L14 (RPL14B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14A) (TAIR:AT2G20450.1); Has 520 Blast hits to 520 proteins in 229 species: Archae - 47; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT4G27340 | AT4G27340.1 | GAAACGACGTCGTTTA | Met-10+ like family protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function Met10 (InterPro:IPR003402); BEST Arabidopsis thaliana protein match is: Met-10+ like family protein (TAIR:AT3G56120.1); Has 1006 Blast hits to 996 proteins in 336 species: Archae - 244; Bacteria - 250; Metazoa - 158; Fungi - 92; Plants - 67; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT4G27390 | AT4G27390.1 | TAAACGACGCGTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 63 Blast hits to 63 proteins in 30 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G27440 | AT4G27440.1 | TAAACGACGACGTGGCAG | light-dependent NADPH:protochlorophyllide oxidoreductase B |
| AT4G27440.2 | TAAACGACGACGTGGCAG | light-dependent NADPH:protochlorophyllide oxidoreductase B |
| AT4G27960 | AT4G27960.1 | TAAACGACGA | ubiquitin conjugating enzyme |
| AT4G27960.2 | TAAACGACGA | ubiquitin conjugating enzyme |
| AT4G28025 | AT4G28025.1 | AAACGACGACGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G28590 | AT4G28590.1 | AAACGACGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31840.1); Has 81 Blast hits to 81 proteins in 33 species: Archae - 2; Bacteria - 0; Metazoa - 16; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT4G28610 | AT4G28610.1 | AAAACGACG | Similar to phosphate starvation response gene from Chlamydomonas. Weakly responsive to phosphate starvation. Acts upstream of PHO2 in phosphate signaling. |
| AT4G29820 | AT4G29820.1 | GCGTCGTTTT | Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit. |
| AT4G29830 | AT4G29830.1 | AAAACGACGC | The protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin. |
| AT4G29850 | AT4G29850.1 | AAACGACGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0414 (InterPro:IPR008590); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19350.1); Has 188 Blast hits to 188 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G30190 | AT4G30190.1 | TCGTCGTTTT | belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal dom |
| AT4G30260 | AT4G30260.1 | GAAACGACGTCGTTTA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT2G18840.1); Has 733 Blast hits to 718 proteins in 145 species: Archae - 0; Bacteria - 8; Metazoa - 377; Fungi - 147; Plants - 99; Viruses - 4; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT4G30480 | AT4G30480.1 | ACGTCGTCGTTTA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). |
| AT4G30480.2 | ACGTCGTCGTTTA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). |
| AT4G30480.3 | ACGTCGTCGTTTA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). |
| AT4G31040 | AT4G31040.1 | AAAACGACG | proton extrusion protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CemA (InterPro:IPR004282); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00530.1); Has 625 Blast hits to 625 proteins in 222 species: Archae - 0; Bacteria - 116; Metazoa - 0; Fungi - 4; Plants - 455; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). |
| AT4G31290 | AT4G31290.1 | CGAACCGAAACGACGCCGTT | ChaC-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ChaC-like protein (InterPro:IPR006840); BEST Arabidopsis thaliana protein match is: ChaC-like family protein (TAIR:AT5G26220.1); Has 1092 Blast hits to 1086 proteins in 379 species: Archae - 0; Bacteria - 540; Metazoa - 194; Fungi - 85; Plants - 75; Viruses - 0; Other Eukaryotes - 198 (source: NCBI BLink). |
| AT4G32060 | AT4G32060.1 | TAAACGACGCCGT | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); Has 902 Blast hits to 878 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 729; Fungi - 55; Plants - 46; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT4G32060.2 | TAAACGACGCCGT | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); Has 902 Blast hits to 878 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 729; Fungi - 55; Plants - 46; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT4G32320 | AT4G32320.1 | CGTCGTTTT | Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT4G32520 | AT4G32520.1 | GACGACGTCGTTTC | SERINE HYDROXYMETHYLTRANSFERASE 3 (SHM3); FUNCTIONS IN: pyridoxal phosphate binding, glycine hydroxymethyltransferase activity, catalytic activity; INVOLVED IN: glycine metabolic process, L-serine metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Glycine hydroxymethyltransferase (InterPro:IPR001085); BEST Arabidopsis thaliana protein match is: SHM1 (SERINE TRANSHYDROXYMETHYLTRANSFERASE 1); glycine hydroxymethyltransferase/ poly(U) binding (TAIR:AT4G37930.1); Has 8367 Blast hits to 8354 proteins in 1625 species: Archae - 143; Bacteria - 3516; Metazoa - 292; Fungi - 187; Plants - 212; Viruses - 6; Other Eukaryotes - 4011 (source: NCBI BLink). |
| AT4G32520.2 | GACGACGTCGTTTC | SERINE HYDROXYMETHYLTRANSFERASE 3 (SHM3); FUNCTIONS IN: pyridoxal phosphate binding, glycine hydroxymethyltransferase activity, catalytic activity; INVOLVED IN: glycine metabolic process, L-serine metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Glycine hydroxymethyltransferase (InterPro:IPR001085); BEST Arabidopsis thaliana protein match is: SHM1 (SERINE TRANSHYDROXYMETHYLTRANSFERASE 1); glycine hydroxymethyltransferase/ poly(U) binding (TAIR:AT4G37930.1); Has 8367 Blast hits to 8354 proteins in 1625 species: Archae - 143; Bacteria - 3516; Metazoa - 292; Fungi - 187; Plants - 212; Viruses - 6; Other Eukaryotes - 4011 (source: NCBI BLink). |
| AT4G32840 | AT4G32840.1 | AAAACGACGTC | PHOSPHOFRUCTOKINASE 6 (PFK6); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: cytosol, 6-phosphofructokinase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK1 (PHOSPHOFRUCTOKINASE 1); 6-phosphofructokinase (TAIR:AT4G29220.1); Has 4932 Blast hits to 4525 proteins in 1180 species: Archae - 20; Bacteria - 2587; Metazoa - 575; Fungi - 273; Plants - 227; Viruses - 2; Other Eukaryotes - 1248 (source: NCBI BLink). |
| AT4G32900 | AT4G32900.1 | GCGTCGTTTT | aminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 486 Blast hits to 486 proteins in 195 species: Archae - 103; Bacteria - 0; Metazoa - 148; Fungi - 84; Plants - 38; Viruses - 6; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT4G32900.2 | GCGTCGTTTT | aminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 486 Blast hits to 486 proteins in 195 species: Archae - 103; Bacteria - 0; Metazoa - 148; Fungi - 84; Plants - 38; Viruses - 6; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT4G32910 | AT4G32910.1 | AAAACGACGC | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoporin, Nup85-like (InterPro:IPR011502); Has 161 Blast hits to 158 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 128; Fungi - 10; Plants - 21; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G32960 | AT4G32960.1 | TAAACGACGACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32970.1); Has 78 Blast hits to 78 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G33100 | AT4G33100.1 | GAAACGACGTCGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial distribution and morphology family 35/apoptosis (InterPro:IPR007918); Has 160 Blast hits to 160 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 46; Plants - 13; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT4G33690 | AT4G33690.1 | AAAACGACGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: pollen tube; Has 499 Blast hits to 464 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 283; Fungi - 48; Plants - 38; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). |
| AT4G33920 | AT4G33920.1 | AAAACGACGC | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: mitochondrion, protein serine/threonine phosphatase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51370.1); Has 3521 Blast hits to 3519 proteins in 216 species: Archae - 0; Bacteria - 7; Metazoa - 1157; Fungi - 386; Plants - 1254; Viruses - 3; Other Eukaryotes - 714 (source: NCBI BLink). |
| AT4G34370 | AT4G34370.1 | AAAACGACGACGT | ARIADNE (ARI1); FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, C6HC-type (InterPro:IPR002867), Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger protein-related (TAIR:AT2G16090.1); Has 2246 Blast hits to 2231 proteins in 160 species: Archae - 0; Bacteria - 0; Metazoa - 1159; Fungi - 347; Plants - 351; Viruses - 7; Other Eukaryotes - 382 (source: NCBI BLink). |
| AT4G35070 | AT4G35070.1 | ACGTCGTTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: S-ribonuclease binding protein, SBP1, pollen (InterPro:IPR017066); BEST Arabidopsis thaliana protein match is: SBP1 (s-ribonuclease binding protein 1); protein binding / zinc ion binding (TAIR:AT1G45976.1); Has 762 Blast hits to 716 proteins in 103 species: Archae - 2; Bacteria - 18; Metazoa - 250; Fungi - 8; Plants - 213; Viruses - 21; Other Eukaryotes - 250 (source: NCBI BLink). |
| AT4G35070.2 | ACGTCGTTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: S-ribonuclease binding protein, SBP1, pollen (InterPro:IPR017066); BEST Arabidopsis thaliana protein match is: SBP1 (s-ribonuclease binding protein 1); protein binding / zinc ion binding (TAIR:AT1G45976.1); Has 762 Blast hits to 716 proteins in 103 species: Archae - 2; Bacteria - 18; Metazoa - 250; Fungi - 8; Plants - 213; Viruses - 21; Other Eukaryotes - 250 (source: NCBI BLink). |
| AT4G35740 | AT4G35740.1 | AAACGGCGTCGTTTC | RecQl3; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA recombination; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DNA helicase, ATP-dependent, RecQ type (InterPro:IPR004589), DNA helicase, ATP-dependent, RecQ type, N-terminal region (InterPro:IPR018329), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RECQL2 (ARABIDOPSIS RECQ HELICASE L2); 3'-5' DNA helicase/ ATP-dependent helicase/ four-way junction helicase/ protein binding (TAIR:AT1G31360.1); Has 20515 Blast hits to 20463 proteins in 1611 species: Archae - 344; Bacteria - 10151; Metazoa - 3213; Fungi - 2195; Plants - 965; Viruses - 10; Other Eukaryotes - 3637 (source: NCBI BLink). |
| AT4G35740.2 | AAACGGCGTCGTTTC | RecQl3; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA recombination; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DNA helicase, ATP-dependent, RecQ type (InterPro:IPR004589), DNA helicase, ATP-dependent, RecQ type, N-terminal region (InterPro:IPR018329), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RECQL2 (ARABIDOPSIS RECQ HELICASE L2); 3'-5' DNA helicase/ ATP-dependent helicase/ four-way junction helicase/ protein binding (TAIR:AT1G31360.1); Has 20515 Blast hits to 20463 proteins in 1611 species: Archae - 344; Bacteria - 10151; Metazoa - 3213; Fungi - 2195; Plants - 965; Viruses - 10; Other Eukaryotes - 3637 (source: NCBI BLink). |
| AT4G36660 | AT4G36660.1 | AAAACGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65650.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G37020 | AT4G37020.1 | AAACGACGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1219 Blast hits to 1219 proteins in 256 species: Archae - 0; Bacteria - 99; Metazoa - 480; Fungi - 272; Plants - 177; Viruses - 1; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT4G37820 | AT4G37820.1 | AAATGACGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G22795.1); Has 363989 Blast hits to 137148 proteins in 2858 species: Archae - 1191; Bacteria - 38325; Metazoa - 151130; Fungi - 38393; Plants - 14217; Viruses - 2059; Other Eukaryotes - 118674 (source: NCBI BLink). |
| AT4G38160 | AT4G38160.1 | AAAACGACG | pigment defective 191 (pde191); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT4G02990.1); Has 767 Blast hits to 459 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 0; Plants - 624; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT4G38160.2 | AAAACGACG | pigment defective 191 (pde191); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT4G02990.1); Has 767 Blast hits to 459 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 0; Plants - 624; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT4G38470 | AT4G38470.1 | CGTCGTTTT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein kinase activity; INVOLVED IN: protein amino acid phosphorylation, metabolic process; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Amino acid-binding ACT (InterPro:IPR002912), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G35780.1); Has 97982 Blast hits to 96223 proteins in 3577 species: Archae - 79; Bacteria - 8432; Metazoa - 43587; Fungi - 8194; Plants - 19438; Viruses - 506; Other Eukaryotes - 17746 (source: NCBI BLink). |
| AT4G39350 | AT4G39350.1 | GCGTCGTTTT | Encodes a cellulose synthase isomer, related to CESA6. |
| AT4G39680 | AT4G39680.1 | GAAACGACGCCGT | SAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26630.2); Has 10132 Blast hits to 6217 proteins in 537 species: Archae - 24; Bacteria - 931; Metazoa - 3852; Fungi - 1124; Plants - 2077; Viruses - 539; Other Eukaryotes - 1585 (source: NCBI BLink). |
| AT4G39680.2 | GAAACGACGCCGT | SAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26630.2); Has 10132 Blast hits to 6217 proteins in 537 species: Archae - 24; Bacteria - 931; Metazoa - 3852; Fungi - 1124; Plants - 2077; Viruses - 539; Other Eukaryotes - 1585 (source: NCBI BLink). |
| AT4G39690 | AT4G39690.1 | ACGGCGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; Has 6265 Blast hits to 4855 proteins in 651 species: Archae - 26; Bacteria - 1226; Metazoa - 2506; Fungi - 658; Plants - 238; Viruses - 35; Other Eukaryotes - 1576 (source: NCBI BLink). |
| AT5G01110 | AT5G01110.1 | ACGTCGTCGTTTA | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05670.2); Has 28807 Blast hits to 6228 proteins in 193 species: Archae - 4; Bacteria - 24; Metazoa - 956; Fungi - 844; Plants - 25427; Viruses - 0; Other Eukaryotes - 1552 (source: NCBI BLink). |
| AT5G01400 | AT5G01400.1 | AAACGACGT | Encodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64. |
| AT5G02502 | AT5G02502.1 | AAAACGACGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12587.1); Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G03380 | AT5G03380.1 | ACGTCGTCGTTTA | heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink). |
| AT5G03380.2 | ACGTCGTCGTTTA | heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink). |
| AT5G03570 | AT5G03570.1 | TAAACGACGA | Encodes a tonoplast localized nickel transport protein. |
| AT5G04885 | AT5G04885.1 | AAAACGACGCC | glycosyl hydrolase family 3 protein; FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 7 plant structures; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 3 protein (TAIR:AT5G20950.2); Has 5829 Blast hits to 5471 proteins in 844 species: Archae - 20; Bacteria - 2907; Metazoa - 6; Fungi - 873; Plants - 279; Viruses - 0; Other Eukaryotes - 1744 (source: NCBI BLink). |
| AT5G05610 | AT5G05610.1 | ACGTCGTTTT | AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. |
| AT5G05610.2 | ACGTCGTTTT | AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. |
| AT5G05740 | AT5G05740.1 | AAAACGACGA | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442–454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171–179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
| AT5G05740.2 | AAAACGACGA | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442–454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171–179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
| AT5G06660 | AT5G06660.1 | TCAAAACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF841, eukaryotic (InterPro:IPR008559); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12030.1); Has 193 Blast hits to 193 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT5G07000 | AT5G07000.1 | GACGTCGTTTT | Encodes a member of the sulfotransferase family of proteins. Although it has 85% amino acid identity with ST2A (At5g07010), this protein is not able to transfer a sulfate group to 11- or 12-hydroxyjasmonic acid in vitro. It may be able to act on structurally related jasmonates. |
| AT5G08050 | AT5G08050.1 | TAGGGCTTTTAAAACGACGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1118 (InterPro:IPR009500), Uncharacterised conserved protein UCP022207 (InterPro:IPR016801); Has 41 Blast hits to 41 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G09230 | AT5G09230.1 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.2 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.3 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.4 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.5 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.6 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.7 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09310 | AT5G09310.1 | ACGTGGAAACGACGTCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 124 Blast hits to 124 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G09590 | AT5G09590.1 | TAAACGACGTCGTTTC | heat shock protein 70 (Hsc70-5); nuclear |
| AT5G10240 | AT5G10240.1 | TCAAAACGCGTCGTTTT | Encodes asparagine synthetase (ASN3). |
| AT5G10240.2 | TCAAAACGCGTCGTTTT | Encodes asparagine synthetase (ASN3). |
| AT5G10470 | AT5G10470.1 | ACGTCGTCGTTT | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT5G65460.1); Has 10636 Blast hits to 9695 proteins in 419 species: Archae - 26; Bacteria - 319; Metazoa - 5207; Fungi - 1022; Plants - 952; Viruses - 6; Other Eukaryotes - 3104 (source: NCBI BLink). |
| AT5G10470.2 | ACGTCGTCGTTT | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT5G65460.1); Has 10636 Blast hits to 9695 proteins in 419 species: Archae - 26; Bacteria - 319; Metazoa - 5207; Fungi - 1022; Plants - 952; Viruses - 6; Other Eukaryotes - 3104 (source: NCBI BLink). |
| AT5G11270 | AT5G11270.1 | TAAACGACGTCGTTTA | Encodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance. |
| AT5G11280 | AT5G11280.1 | AAAACGACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80200.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G11280.1 | TAAACGACGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80200.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G11630 | AT5G11630.1 | ACGTCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.1); Has 60 Blast hits to 60 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G11630.2 | ACGTCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.1); Has 60 Blast hits to 60 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G13300 | AT5G13300.1 | GAAACGACGTCGT | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. |
| AT5G13420 | AT5G13420.1 | TCGTCGTTT | transaldolase, putative; FUNCTIONS IN: catalytic activity, transaldolase activity; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transaldolase subfamily (InterPro:IPR004732), Aldolase-type TIM barrel (InterPro:IPR013785), Transaldolase, active site (InterPro:IPR018225), Transaldolase, bacterial/plant type (InterPro:IPR014634), Transaldolase (InterPro:IPR001585); Has 1901 Blast hits to 1901 proteins in 693 species: Archae - 22; Bacteria - 1417; Metazoa - 23; Fungi - 13; Plants - 39; Viruses - 0; Other Eukaryotes - 387 (source: NCBI BLink). |
| AT5G14440 | AT5G14440.1 | TAAACGACGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). |
| AT5G14440.2 | TAAACGACGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). |
| AT5G15400 | AT5G15400.1 | TAAACGACGTCGTT | U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 761 Blast hits to 744 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 440; Fungi - 133; Plants - 86; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT5G15450 | AT5G15450.1 | GGCGTCGTTTA | Encodes a chloroplast-targeted Hsp101 homologue. Functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. APG6 expression is upregulated in response to heat shock in various organs, but not in response to other abiotic stresses. Apg6 mutants have a pale-green phenotype. |
| AT5G16210 | AT5G16210.1 | AAACGACGT | HEAT repeat-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), LisH dimerisation motif (InterPro:IPR006594), Armadillo-type fold (InterPro:IPR016024); Has 5435 Blast hits to 4228 proteins in 406 species: Archae - 36; Bacteria - 578; Metazoa - 2571; Fungi - 341; Plants - 173; Viruses - 14; Other Eukaryotes - 1722 (source: NCBI BLink). |
| AT5G17270 | AT5G17270.1 | AAACGACGTCGTT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G37130.1); Has 5379 Blast hits to 3587 proteins in 480 species: Archae - 397; Bacteria - 1752; Metazoa - 604; Fungi - 281; Plants - 148; Viruses - 0; Other Eukaryotes - 2197 (source: NCBI BLink). |
| AT5G17700 | AT5G17700.1 | AAAACGACGC | MATE efflux family protein; FUNCTIONS IN: drug transporter activity, antiporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT3G03620.1); Has 5190 Blast hits to 5101 proteins in 1067 species: Archae - 107; Bacteria - 3403; Metazoa - 117; Fungi - 210; Plants - 710; Viruses - 0; Other Eukaryotes - 643 (source: NCBI BLink). |
| AT5G18480 | AT5G18480.1 | AAAACGACG | PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 6 (PGSIP6); FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process, biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: PGSIP5 (PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 5); transferase, transferring glycosyl groups (TAIR:AT1G08990.1); Has 919 Blast hits to 918 proteins in 192 species: Archae - 0; Bacteria - 38; Metazoa - 226; Fungi - 219; Plants - 300; Viruses - 72; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G18480.1 | GAAACGACGT | PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 6 (PGSIP6); FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process, biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: PGSIP5 (PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 5); transferase, transferring glycosyl groups (TAIR:AT1G08990.1); Has 919 Blast hits to 918 proteins in 192 species: Archae - 0; Bacteria - 38; Metazoa - 226; Fungi - 219; Plants - 300; Viruses - 72; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G19400 | AT5G19400.1 | GAAACGACGACGT | SMG7; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28260.2); Has 471 Blast hits to 456 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 104; Plants - 44; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT5G20120 | AT5G20120.1 | AAAACGACGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 36 Blast hits to 36 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT5G22510 | AT5G22510.1 | AGACACGTCGTCGTTTCACACGCGT | beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT1G56560.1); Has 513 Blast hits to 512 proteins in 79 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 230 (source: NCBI BLink). |
| AT5G22650 | AT5G22650.1 | AAAACGACGCCGT | Encodes a member of a plant-specific class of histone deacetylases. Controls the development of adaxial/abaxial leaf polarity. Its mRNA is widely expressed in stems, leaves, flowers and young siliques. Plant lines expressing RNAi constructs directed against this gene showed a marked reduction in agrobacterium-mediated root transformation. |
| AT5G22650.2 | AAAACGACGCCGT | Encodes a member of a plant-specific class of histone deacetylases. Controls the development of adaxial/abaxial leaf polarity. Its mRNA is widely expressed in stems, leaves, flowers and young siliques. Plant lines expressing RNAi constructs directed against this gene showed a marked reduction in agrobacterium-mediated root transformation. |
| AT5G24150 | AT5G24150.1 | TCGTCGTTT | squalene monooxygenase gene homolog |
| AT5G24150.2 | TCGTCGTTT | squalene monooxygenase gene homolog |
| AT5G25440 | AT5G25440.1 | GAAACGACGCC | protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G11410.1); Has 37433 Blast hits to 37026 proteins in 1128 species: Archae - 24; Bacteria - 1745; Metazoa - 15094; Fungi - 1709; Plants - 13857; Viruses - 129; Other Eukaryotes - 4875 (source: NCBI BLink). |
| AT5G27120 | AT5G27120.1 | ACGACGTCGTTTA | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein |
| AT5G27710 | AT5G27710.1 | TCGTCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G38410 | AT5G38410.1 | TAAACGACGT | ribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G38410.2 | TAAACGACGT | ribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G38410.3 | TAAACGACGT | ribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G38920 | AT5G38920.1 | ACGTCGTTTT | nucleic acid binding / ribonuclease H; FUNCTIONS IN: ribonuclease H activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT2G34320.1); Has 54 Blast hits to 54 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G41150 | AT5G41150.1 | TAAACGACGCCGTTTTGA | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G41150.2 | TAAACGACGCCGTTTTGA | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G42080 | AT5G42080.1 | TCGTCGTTTT | Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. |
| AT5G42080.2 | TCGTCGTTTT | Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. |
| AT5G42765 | AT5G42765.1 | GACGTCGTTTT | INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Twin-arginine translocation pathway signal (InterPro:IPR006311); Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G44110 | AT5G44110.1 | CGTCGTTTT | Encodes a member of the NAP subfamily of ABC transporters. |
| AT5G44110.2 | CGTCGTTTT | Encodes a member of the NAP subfamily of ABC transporters. |
| AT5G44110.3 | CGTCGTTTT | Encodes a member of the NAP subfamily of ABC transporters. |
| AT5G47690 | AT5G47690.1 | TCAAAACGACGTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47690.2 | TCAAAACGACGTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47690.3 | TCAAAACGACGTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G48710 | AT5G48710.1 | AAAACGACGA | ubiquitin-related; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ubiquitin-related (TAIR:AT5G48700.1); Has 703 Blast hits to 702 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 438; Fungi - 87; Plants - 102; Viruses - 1; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT5G50390 | AT5G50390.1 | AAAACGACGT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 13594 Blast hits to 4870 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 36; Fungi - 34; Plants - 13330; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink). |
| AT5G51720 | AT5G51720.1 | ACGACGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 215 Blast hits to 215 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G52920 | AT5G52920.1 | CGTCGTTTT | encodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. |
| AT5G53300 | AT5G53300.1 | GCGTCGTTTC | Encodes a ubiquitin conjugating enzyme. |
| AT5G53300.2 | GCGTCGTTTC | Encodes a ubiquitin conjugating enzyme. |
| AT5G53300.3 | GCGTCGTTTC | Encodes a ubiquitin conjugating enzyme. |
| AT5G53310 | AT5G53310.1 | GAAACGACGC | myosin heavy chain-related; FUNCTIONS IN: motor activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Myosin tail 2 (InterPro:IPR010926); Has 312 Blast hits to 312 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 37; Plants - 16; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G53570 | AT5G53570.1 | GAAACGACGC | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1). |
| AT5G53570.2 | GAAACGACGC | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1). |
| AT5G53650 | AT5G53650.1 | CCACGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G54500 | AT5G54500.1 | AACGGCGTCGTTTT | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
| AT5G55280 | AT5G55280.1 | ACGTCGTCGTTT | Encodes one of two FtsZ proteins, tubulin-like proteins, in Arabidopsis. It is involved in chloroplast division. |
| AT5G55310 | AT5G55310.1 | TAAACGACGTC | Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality. |
| AT5G56160 | AT5G56160.1 | AAAACGACGTC | transporter; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G55690.2); Has 1407 Blast hits to 1405 proteins in 173 species: Archae - 3; Bacteria - 0; Metazoa - 460; Fungi - 292; Plants - 404; Viruses - 0; Other Eukaryotes - 248 (source: NCBI BLink). |
| AT5G56160.1 | AAAACGACGTC | transporter; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G55690.2); Has 1407 Blast hits to 1405 proteins in 173 species: Archae - 3; Bacteria - 0; Metazoa - 460; Fungi - 292; Plants - 404; Viruses - 0; Other Eukaryotes - 248 (source: NCBI BLink). |
| AT5G57210 | AT5G57210.1 | ACGTCGTTTT | microtubule-associated protein-related; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular, chloroplast; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: microtubule-associated protein (TAIR:AT4G29950.1); Has 1303 Blast hits to 1018 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 627; Fungi - 236; Plants - 151; Viruses - 0; Other Eukaryotes - 289 (source: NCBI BLink). |
| AT5G57460 | AT5G57460.1 | AAACGACGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to 121 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G58340 | AT5G58340.1 | GACGTCGTTTT | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: TRFL5 (TRF-LIKE 5); DNA binding / transcription factor (TAIR:AT1G15720.1); Has 281 Blast hits to 279 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 51; Fungi - 13; Plants - 202; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT5G58510 | AT5G58510.1 | AAACGACGACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55060.1); Has 187 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 2; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT5G58570 | AT5G58570.1 | AAAACGACGTC | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G59730 | AT5G59730.1 | AAAAAGCCGTCGTTTC | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G59730.2 | AAAAAGCCGTCGTTTC | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G59850 | AT5G59850.1 | TAAACGACG | 40S ribosomal protein S15A (RPS15aF); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: RPS15A (ribosomal protein s15a); structural constituent of ribosome (TAIR:AT1G07770.2); Has 2190 Blast hits to 2190 proteins in 758 species: Archae - 184; Bacteria - 927; Metazoa - 327; Fungi - 130; Plants - 162; Viruses - 0; Other Eukaryotes - 460 (source: NCBI BLink). |
| AT5G60640 | AT5G60640.1 | AAAACGACGACGT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. |
| AT5G60640.2 | AAAACGACGACGT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. |
| AT5G60870 | AT5G60870.1 | CGTCGTTTC | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15979 Blast hits to 4615 proteins in 300 species: Archae - 95; Bacteria - 1703; Metazoa - 6193; Fungi - 797; Plants - 1473; Viruses - 2; Other Eukaryotes - 5716 (source: NCBI BLink). |
| AT5G60870.2 | CGTCGTTTC | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15979 Blast hits to 4615 proteins in 300 species: Archae - 95; Bacteria - 1703; Metazoa - 6193; Fungi - 797; Plants - 1473; Viruses - 2; Other Eukaryotes - 5716 (source: NCBI BLink). |
| AT5G60870.3 | CGTCGTTTC | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15979 Blast hits to 4615 proteins in 300 species: Archae - 95; Bacteria - 1703; Metazoa - 6193; Fungi - 797; Plants - 1473; Viruses - 2; Other Eukaryotes - 5716 (source: NCBI BLink). |
| AT5G61840 | AT5G61840.1 | AAACGACGT | GUT1; FUNCTIONS IN: glucuronoxylan glucuronosyltransferase activity, catalytic activity; INVOLVED IN: secondary cell wall biogenesis, glucuronoxylan biosynthetic process; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 30 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: GUT2; catalytic/ glucuronoxylan glucuronosyltransferase (TAIR:AT1G27440.1); Has 853 Blast hits to 845 proteins in 89 species: Archae - 0; Bacteria - 12; Metazoa - 227; Fungi - 4; Plants - 512; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G61900 | AT5G61900.1 | ACGTCGTTTA | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
| AT5G61900.3 | ACGTCGTTTA | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
| AT5G63510 | AT5G63510.1 | GAAACGACGACGT | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. |
| AT5G63870 | AT5G63870.1 | GACGTCGTTT | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G63870.2 | GACGTCGTTT | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G63870.3 | GACGTCGTTT | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G64300 | AT5G64300.1 | TAAACGACGA | encodes GTP cyclohydrolase II that can functionally complement E. coli mutant deficient in this gene. It also has 3,4-dihydroxy-2-butanone-4-phosphate synthase activity which makes it a bifunctional enzyme involved in the formation of the pyrimidine and of the carbohydrate from GTP and ribulose-5-phosphate, respectively |
| AT5G65005 | AT5G65005.1 | GACGTCGTTTT | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT1G52990.1). |
| AT5G65430 | AT5G65430.1 | AACGACGTCGTTTA | member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT5G65430.2 | AACGACGTCGTTTA | member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT5G65770 | AT5G65770.1 | TAAAACGCCGTCGTTTGGGC | LITTLE NUCLEI4 (LINC4); EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LINC1 (LITTLE NUCLEI1) (TAIR:AT1G67230.1). |
| AT5G65770.2 | TAAAACGCCGTCGTTTGGGC | LITTLE NUCLEI4 (LINC4); EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LINC1 (LITTLE NUCLEI1) (TAIR:AT1G67230.1). |
| AT5G65840 | AT5G65840.1 | AAAACGACGCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37240.1); Has 167 Blast hits to 165 proteins in 51 species: Archae - 0; Bacteria - 28; Metazoa - 51; Fungi - 13; Plants - 59; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G66160 | AT5G66160.1 | ACGTCGTCGTTTT | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Co-localizes with DIP positive vesicles. |
| AT5G66160.2 | ACGTCGTCGTTTT | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Co-localizes with DIP positive vesicles. |
| AT5G66680 | AT5G66680.1 | AAAACGCCGTCGTTT | Encodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins. |