| Locus | Gene model | Sequence | Description |
| AT1G01840 | AT1G01840.1 | TTAAAGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02060 | AT1G02060.1 | TAATTGGGCCTAAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G37230.1); Has 18912 Blast hits to 5842 proteins in 180 species: Archae - 4; Bacteria - 22; Metazoa - 373; Fungi - 390; Plants - 17444; Viruses - 0; Other Eukaryotes - 679 (source: NCBI BLink). |
| AT1G02090 | AT1G02090.1 | TGAGCCCAATTA | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. |
| AT1G02090.2 | TGAGCCCAATTA | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. |
| AT1G02090.3 | TGAGCCCAATTA | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. |
| AT1G02100 | AT1G02100.1 | TAATTGGGCTCA | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT1G02100.2 | TAATTGGGCTCA | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT1G02100.3 | TAATTGGGCTCA | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT1G02170 | AT1G02170.1 | AATTGGGCTTA | Metacaspase AtMCP1b. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam profile PF00656: ICE-like protease (caspase) p20 domain |
| AT1G02680 | AT1G02680.1 | TAAGCCCAATT | TBP-ASSOCIATED FACTOR 13 (TAF13); FUNCTIONS IN: RNA polymerase II transcription factor activity, DNA binding; INVOLVED IN: transcription initiation, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IID, 18 kDa subunit (InterPro:IPR003195), Histone-fold (InterPro:IPR009072); Has 401 Blast hits to 401 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 182; Fungi - 191; Plants - 19; Viruses - 2; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G02960 | AT1G02960.1 | AATTGGGCCTGTTAAAGCCCAATTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT1G02960.2 | AATTGGGCCTGTTAAAGCCCAATTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT1G02960.3 | AATTGGGCCTGTTAAAGCCCAATTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT1G03430 | AT1G03430.1 | GGGCCTAAGCCCAATTGGG | Encodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT1G04010 | AT1G04010.1 | CAAAGGCCCAATTAAAAGCCCATTT | phosphatidate-sterol O-acyltransferase/ phosphatidylcholine-sterol O-acyltransferase/ phosphatidylethanolamine-sterol O-acyltransferase; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity, phosphatidylethanolamine-sterol O-acyltransferase activity, phosphatidate-sterol O-acyltransferase activity; INVOLVED IN: sterol esterification, lipid metabolic process; LOCATED IN: microsome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: ATPDAT; phosphatidylcholine-sterol O-acyltransferase (TAIR:AT5G13640.1); Has 448 Blast hits to 445 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 76; Plants - 80; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT1G04020 | AT1G04020.1 | AAATGGGCTTTTAATTGGGCCTTTG | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G04020.2 | AAATGGGCTTTTAATTGGGCCTTTG | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G05140 | AT1G05140.1 | AATTGGGCCTAAG | membrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT2G32480.1); Has 6877 Blast hits to 5459 proteins in 1201 species: Archae - 28; Bacteria - 3634; Metazoa - 12; Fungi - 4; Plants - 40; Viruses - 0; Other Eukaryotes - 3159 (source: NCBI BLink). |
| AT1G05785 | AT1G05785.1 | GCCCAATTA | Got1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Got1-like protein (InterPro:IPR007305); BEST Arabidopsis thaliana protein match is: Got1-like family protein (TAIR:AT5G01430.1); Has 318 Blast hits to 318 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 137; Fungi - 75; Plants - 52; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
| AT1G05785.2 | GCCCAATTA | Got1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Got1-like protein (InterPro:IPR007305); BEST Arabidopsis thaliana protein match is: Got1-like family protein (TAIR:AT5G01430.1); Has 318 Blast hits to 318 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 137; Fungi - 75; Plants - 52; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
| AT1G06220 | AT1G06220.1 | AATTGGGCCGAT | Encodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS. |
| AT1G06220.2 | AATTGGGCCGAT | Encodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS. |
| AT1G06790 | AT1G06790.1 | TTGGCCCAATT | RNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G06790.2 | TTGGCCCAATT | RNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G07010 | AT1G07010.1 | AGAGGCCCAATT | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1). |
| AT1G07010.2 | AGAGGCCCAATT | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1). |
| AT1G07010.3 | AGAGGCCCAATT | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1). |
| AT1G07350 | AT1G07350.2 | CAATTGGGCCTTTT | transformer serine/arginine-rich ribonucleoprotein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT4G35785.2); Has 25544 Blast hits to 16897 proteins in 693 species: Archae - 12; Bacteria - 1110; Metazoa - 16477; Fungi - 2700; Plants - 2768; Viruses - 163; Other Eukaryotes - 2314 (source: NCBI BLink). |
| AT1G07910 | AT1G07910.1 | AATTGGGCT | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains — an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component— that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo. |
| AT1G07910.2 | AATTGGGCT | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains — an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component— that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo. |
| AT1G08350 | AT1G08350.1 | AATTGGGCCTTTA | endomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink). |
| AT1G08350.2 | AATTGGGCCTTTA | endomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink). |
| AT1G08360 | AT1G08360.1 | TAAAGGCCCAATT | 60S ribosomal protein L10A (RPL10aA); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: PGY1 (PIGGYBACK1); RNA binding / structural constituent of ribosome (TAIR:AT2G27530.2); Has 2469 Blast hits to 2469 proteins in 759 species: Archae - 186; Bacteria - 980; Metazoa - 354; Fungi - 122; Plants - 236; Viruses - 0; Other Eukaryotes - 591 (source: NCBI BLink). |
| AT1G09330 | AT1G09330.1 | TAATTGGGCCTAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF846, eukaryotic (InterPro:IPR008564); Has 381 Blast hits to 381 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 100; Plants - 39; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink). |
| AT1G09340 | AT1G09340.1 | GTTAGGCCCAATTA | Encodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein. CRB is important for the proper functioning of the chloroplast. Mutations in CRB also affects the circadian system, altering the expression of both oscillator and output genes. |
| AT1G09780 | AT1G09780.1 | GTGGCCCAATTG | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion, response to cold; LOCATED IN: cytosol, mitochondrial envelope, chloroplast, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT3G08590.2); Has 3363 Blast hits to 3360 proteins in 901 species: Archae - 36; Bacteria - 1671; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1228 (source: NCBI BLink). |
| AT1G10030 | AT1G10030.1 | GAAGCCCAATTGAAAAGCCCATTT | Arabidopsis homolog of yeast ergosterol28 (ERG28); INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Erg28-like (InterPro:IPR005352); Has 155 Blast hits to 155 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 64; Plants - 23; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G10210 | AT1G10210.1 | TAATTGGGCTCA | Encodes ATMPK1. |
| AT1G10210.2 | TAATTGGGCTCA | Encodes ATMPK1. |
| AT1G10950 | AT1G10950.1 | CAAGCCCAATTA | endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT2G01970.1); Has 1032 Blast hits to 991 proteins in 166 species: Archae - 0; Bacteria - 8; Metazoa - 443; Fungi - 164; Plants - 234; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink). |
| AT1G11240 | AT1G11240.1 | TTAAAGCCTAAAGCCCAATTAAAAGGCC | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 2452 Blast hits to 1845 proteins in 201 species: Archae - 0; Bacteria - 81; Metazoa - 1026; Fungi - 315; Plants - 107; Viruses - 18; Other Eukaryotes - 905 (source: NCBI BLink). |
| AT1G11710 | AT1G11710.1 | GCCCAATTG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G01110.1); Has 19625 Blast hits to 5674 proteins in 176 species: Archae - 2; Bacteria - 23; Metazoa - 403; Fungi - 262; Plants - 18143; Viruses - 0; Other Eukaryotes - 792 (source: NCBI BLink). |
| AT1G12000 | AT1G12000.1 | AATTGGGCCTTAA | pyrophosphate--fructose-6-phosphate 1-phosphotransferase beta subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, beta-subunit complex, cell wall, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: MEE51 (maternal effect embryo arrest 51); diphosphate-fructose-6-phosphate 1-phosphotransferase (TAIR:AT4G04040.1); Has 3585 Blast hits to 3515 proteins in 1006 species: Archae - 20; Bacteria - 2321; Metazoa - 52; Fungi - 90; Plants - 237; Viruses - 2; Other Eukaryotes - 863 (source: NCBI BLink). |
| AT1G12390 | AT1G12390.1 | TAATTGGGCTAA | cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G62880.1); Has 466 Blast hits to 466 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 278; Fungi - 110; Plants - 42; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). |
| AT1G12920 | AT1G12920.1 | TAATTGGGCCTTTT | Encodes a eukaryotic release factor one homolog. |
| AT1G13330 | AT1G13330.1 | TAATTGGGCCTGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tat binding protein 1-interacting (InterPro:IPR010776); Has 2425 Blast hits to 2142 proteins in 283 species: Archae - 50; Bacteria - 240; Metazoa - 929; Fungi - 179; Plants - 47; Viruses - 23; Other Eukaryotes - 957 (source: NCBI BLink). |
| AT1G14010 | AT1G14010.1 | TTAAAGCCCAATT | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT1G14380 | AT1G14380.1 | TAATTGGGCCCAGA | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G14380.2 | TAATTGGGCCCAGA | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G14380.3 | TAATTGGGCCCAGA | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G15810 | AT1G15810.1 | AATTGGGCCTTTT | ribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G80620.1); Has 5651 Blast hits to 5651 proteins in 1607 species: Archae - 0; Bacteria - 3067; Metazoa - 94; Fungi - 81; Plants - 397; Viruses - 0; Other Eukaryotes - 2012 (source: NCBI BLink). |
| AT1G15930 | AT1G15930.1 | AGCCCAATTAATAGGCCCATTTAAGCCCAAAT | 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| AT1G15930.2 | AGCCCAATTAATAGGCCCATTTAAGCCCAAAT | 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| AT1G16570 | AT1G16570.1 | GGGCCCAATTA | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink). |
| AT1G16570.2 | GGGCCCAATTA | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink). |
| AT1G16590 | AT1G16590.1 | TAATTGGGCCC | putative translesion synthesis polymerase zeta subunit, homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
| AT1G18040 | AT1G18040.1 | TAATTGGGC | CYCLIN-DEPENDENT KINASE D1;3 (CDKD1;3); FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CDKD1;1 (CYCLIN-DEPENDENT KINASE D1;1); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT1G73690.1); Has 86988 Blast hits to 85857 proteins in 2791 species: Archae - 31; Bacteria - 7397; Metazoa - 37676; Fungi - 8140; Plants - 16874; Viruses - 362; Other Eukaryotes - 16508 (source: NCBI BLink). |
| AT1G19140 | AT1G19140.1 | AAAACGCCCAATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT1G19140.2 | AAAACGCCCAATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT1G19150 | AT1G19150.1 | AATTGGGCGTTTT | PSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA, |
| AT1G20160 | AT1G20160.1 | GCCCAATT | ATSBT5.2; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: apoplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: subtilase family protein (TAIR:AT1G20150.1); Has 5222 Blast hits to 4440 proteins in 781 species: Archae - 163; Bacteria - 2880; Metazoa - 167; Fungi - 492; Plants - 899; Viruses - 0; Other Eukaryotes - 621 (source: NCBI BLink). |
| AT1G20160.2 | GCCCAATT | ATSBT5.2; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: apoplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: subtilase family protein (TAIR:AT1G20150.1); Has 5222 Blast hits to 4440 proteins in 781 species: Archae - 163; Bacteria - 2880; Metazoa - 167; Fungi - 492; Plants - 899; Viruses - 0; Other Eukaryotes - 621 (source: NCBI BLink). |
| AT1G20575 | AT1G20575.1 | ATTAGGCCCAATT | dolichyl-phosphate beta-D-mannosyltransferase, putative / dolichol-phosphate mannosyltransferase, putative / mannose-P-dolichol synthase, putative; FUNCTIONS IN: elongation factor-2 kinase activity, dolichyl-phosphate beta-D-mannosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 2 (InterPro:IPR001173); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 2 protein (TAIR:AT2G39630.1); Has 14265 Blast hits to 14249 proteins in 1426 species: Archae - 553; Bacteria - 8256; Metazoa - 255; Fungi - 173; Plants - 49; Viruses - 21; Other Eukaryotes - 4958 (source: NCBI BLink). |
| AT1G20580 | AT1G20580.1 | AATTGGGCCTAAT | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SmD3 (snRNP core protein SmD3) (TAIR:AT1G76300.1); Has 893 Blast hits to 893 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 219; Plants - 128; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| AT1G21560 | AT1G21560.1 | TGAGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01170.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G22200 | AT1G22200.1 | GAGCCCAAGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink). |
| AT1G22200.2 | GAGCCCAAGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink). |
| AT1G23280 | AT1G23280.1 | AATTGGGCT | MAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink). |
| AT1G23280.1 | TTGGCCCAATTA | MAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink). |
| AT1G23290 | AT1G23290.1 | AGCCCAATT | Encodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20. |
| AT1G23290.1 | TAATTGGGCCAA | Encodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20. |
| AT1G23400 | AT1G23400.1 | TTATGGGCCTGGCCTTAGGGCCCAATT | Promotes the splicing of chloroplast group II introns. |
| AT1G23710 | AT1G23710.1 | ATTGGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70420.1); Has 203 Blast hits to 197 proteins in 42 species: Archae - 0; Bacteria - 4; Metazoa - 16; Fungi - 9; Plants - 112; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT1G23750 | AT1G23750.1 | AATTGGGCTTTAT | DNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT1G25490 | AT1G25490.1 | AAAGCCCAAAATGGCCCAATTA | One of three genes encoding phosphoprotein phosphatase 2A regulatory subunit A; Recessive ethylene-response mutant EER1 displays increased ethylene sensitivity in the hypocotyl and stem |
| AT1G26110 | AT1G26110.1 | AATTGGGCTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45330.1); Has 43564 Blast hits to 18145 proteins in 930 species: Archae - 33; Bacteria - 8614; Metazoa - 16661; Fungi - 5004; Plants - 6818; Viruses - 592; Other Eukaryotes - 5842 (source: NCBI BLink). |
| AT1G26110.2 | AATTGGGCTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45330.1); Has 43564 Blast hits to 18145 proteins in 930 species: Archae - 33; Bacteria - 8614; Metazoa - 16661; Fungi - 5004; Plants - 6818; Viruses - 592; Other Eukaryotes - 5842 (source: NCBI BLink). |
| AT1G27390 | AT1G27390.1 | AAAAAGCCCAATTA | Form of TOM20, which is a component of the TOM complex, involved in transport of nuclear-encoded mitochondrial proteins |
| AT1G27400 | AT1G27400.1 | TAATTGGGCTTTTT | 60S ribosomal protein L17 (RPL17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane, chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17B) (TAIR:AT1G67430.1); Has 1647 Blast hits to 1647 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 401 (source: NCBI BLink). |
| AT1G29250 | AT1G29250.1 | CCCAATTGGGCCTATTGGGCT | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT2G34160.1); Has 89 Blast hits to 89 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT1G29260 | AT1G29260.1 | AGCCCAATAGGCCCAATTGGG | Encodes the peroxisomal targeting signal type 2 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS2 consensus sequence (RLX5HL or a variant) within the first 30 or so amino acids. RNAi experiments suggest that PEX7 is necessary for the maintenance of glyoxysomal but not leaf peroxisomal function. |
| AT1G30230 | AT1G30230.1 | TAATTGGGCCAC | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G30230.2 | TAATTGGGCCAC | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G30520 | AT1G30520.1 | TAATTGGGCCTGGCCTATA | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT1G30825 | AT1G30825.1 | TAATTGGGCCTATGGGCCAT | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT1G30880 | AT1G30880.1 | ATTTGGGCCTAAATTGGGCCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G30890 | AT1G30890.1 | ATTGGCCCAATTTAGGCCCAAAT | integral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT1G30890.2 | ATTGGCCCAATTTAGGCCCAAAT | integral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT1G33490 | AT1G33490.1 | ATAAAGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G33500 | AT1G33500.1 | TAATTGGGCTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink). |
| AT1G49850 | AT1G49850.1 | ATAGGCCCAATAATTGGGCTTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6256 Blast hits to 6238 proteins in 202 species: Archae - 0; Bacteria - 4; Metazoa - 2216; Fungi - 437; Plants - 2560; Viruses - 6; Other Eukaryotes - 1033 (source: NCBI BLink). |
| AT1G50170 | AT1G50170.1 | AAAAGCCCAATTG | encodes sirohydrochlorin ferrochelatase catalyzing the last step of the siroheme biosynthesis |
| AT1G51060 | AT1G51060.1 | AATTGGGCTC | Encodes HTA10, a histone H2A protein. |
| AT1G51150 | AT1G51150.1 | TAATTGGGCCTAAGCCCATTG | Encodes a putative DegP protease. |
| AT1G51360 | AT1G51360.1 | CCCATTAAGGCCCAATTA | Involved in defense against fungal pathogens and located in cytosol. |
| AT1G51400 | AT1G51400.1 | AATTGGGCTTTT | photosystem II 5 kD protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to UV-B, response to wounding, response to ozone; LOCATED IN: chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSBTN (photosystem II subunit T) (TAIR:AT3G21055.1); Has 59 Blast hits to 59 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G55325 | AT1G55325.1 | AATTGGGCCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAP240 (InterPro:IPR009401); Has 190 Blast hits to 182 proteins in 65 species: Archae - 0; Bacteria - 45; Metazoa - 113; Fungi - 3; Plants - 23; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G55325.1 | AATTGGGCCTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAP240 (InterPro:IPR009401); Has 190 Blast hits to 182 proteins in 65 species: Archae - 0; Bacteria - 45; Metazoa - 113; Fungi - 3; Plants - 23; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G58210 | AT1G58210.1 | AATTGGGCCTGG | EMBRYO DEFECTIVE 1674 (EMB1674); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT1G09720.1); Has 24624 Blast hits to 15362 proteins in 900 species: Archae - 370; Bacteria - 1847; Metazoa - 13466; Fungi - 2008; Plants - 1045; Viruses - 70; Other Eukaryotes - 5818 (source: NCBI BLink). |
| AT1G62690 | AT1G62690.1 | CAATTGGGCTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G62880 | AT1G62880.1 | TAATTGGGCTTA | cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G12390.1); Has 465 Blast hits to 465 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 110; Plants - 43; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G62880.2 | TAATTGGGCTTA | cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G12390.1); Has 465 Blast hits to 465 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 110; Plants - 43; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G64720 | AT1G64720.1 | AATTGGGCCTAC | membrane related protein CP5 |
| AT1G64880 | AT1G64880.1 | AATTGGGCCCATG | ribosomal protein S5 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, Golgi apparatus, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: ribosomal protein S5 family protein (TAIR:AT2G33800.1); Has 10105 Blast hits to 8747 proteins in 1649 species: Archae - 225; Bacteria - 3046; Metazoa - 1648; Fungi - 368; Plants - 134; Viruses - 59; Other Eukaryotes - 4625 (source: NCBI BLink). |
| AT1G65040 | AT1G65040.2 | TAATTGGGCCAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink). |
| AT1G65040.3 | TAATTGGGCCAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink). |
| AT1G66500 | AT1G66500.1 | AAGGCCCAATT | zinc finger (C2H2-type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: S-locus protein-related (TAIR:AT5G43620.1); Has 275 Blast hits to 273 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 85; Plants - 35; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT1G69510 | AT1G69510.1 | TTGGCCCAATTAAGGCCCAAAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G69510.2 | TTGGCCCAATTAAGGCCCAAAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G69510.3 | TTGGCCCAATTAAGGCCCAAAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G70985 | AT1G70985.1 | GTGGCCCAATT | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; EXPRESSED IN: cotyledon, leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.10 ten leaves visible, LP.08 eight leaves visible; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT1G23050.1); Has 1360 Blast hits to 767 proteins in 140 species: Archae - 2; Bacteria - 103; Metazoa - 226; Fungi - 91; Plants - 854; Viruses - 15; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT1G71090 | AT1G71090.1 | TTAATGGGCTTATAATTGGGCTTC | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G01990.1); Has 433 Blast hits to 370 proteins in 101 species: Archae - 9; Bacteria - 33; Metazoa - 0; Fungi - 220; Plants - 97; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G72280 | AT1G72280.1 | CAGGCCCAATTA | endoplasmic reticulum oxidoreductin |
| AT1G72320 | AT1G72320.1 | TAATTGGGCCCTA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.2 | TAATTGGGCCCTA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.3 | TAATTGGGCCCTA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72330 | AT1G72330.1 | TAGGGCCCAATTA | Encodes for alanine aminotransferase ALAAT2. |
| AT1G72330.2 | TAGGGCCCAATTA | Encodes for alanine aminotransferase ALAAT2. |
| AT1G73430 | AT1G73430.1 | TAATTGGGCCTTG | sec34-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: chloroplast, membrane, cis-Golgi network; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec34-like protein (InterPro:IPR007265); Has 256 Blast hits to 248 proteins in 121 species: Archae - 0; Bacteria - 4; Metazoa - 107; Fungi - 89; Plants - 19; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT1G73430.2 | TAATTGGGCCTTG | sec34-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: chloroplast, membrane, cis-Golgi network; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec34-like protein (InterPro:IPR007265); Has 256 Blast hits to 248 proteins in 121 species: Archae - 0; Bacteria - 4; Metazoa - 107; Fungi - 89; Plants - 19; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT1G73840 | AT1G73840.1 | TAATTGGGCCC | Resembles the CstF64 family of RNA processing factors that are conserved between yeast and mammals. In mammals, CstF64 is a component of the CstF complex which is required for mRNA 3'end formation along with other factors. |
| AT1G74230 | AT1G74230.1 | GCCCAATT | encodes a glycine-rich RNA binding protein. |
| AT1G74780 | AT1G74780.1 | TAATTGGGCTCA | nodulin family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT1G18940.1); Has 1801 Blast hits to 1756 proteins in 510 species: Archae - 9; Bacteria - 869; Metazoa - 40; Fungi - 217; Plants - 319; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink). |
| AT1G76200 | AT1G76200.1 | AATTGGGCCTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 59 Blast hits to 59 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 29; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G76570 | AT1G76570.1 | TAATTGGGCCTATA | chlorophyll A-B binding family protein; FUNCTIONS IN: chlorophyll binding; INVOLVED IN: response to blue light, response to far red light, photosynthesis; LOCATED IN: light-harvesting complex, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chlorophyll A-B binding protein (InterPro:IPR001344); BEST Arabidopsis thaliana protein match is: LHCB2.3; chlorophyll binding (TAIR:AT3G27690.1); Has 1746 Blast hits to 1686 proteins in 190 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 1525; Viruses - 0; Other Eukaryotes - 219 (source: NCBI BLink). |
| AT1G78680 | AT1G78680.1 | AATTGGGCCCT | The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G79550 | AT1G79550.1 | TAATTGGGCTAGCCCATTAAG | Encodes cytosolic phosphoglycerate kinase (PGK). |
| AT1G79550.2 | TAATTGGGCTAGCCCATTAAG | Encodes cytosolic phosphoglycerate kinase (PGK). |
| AT1G79610 | AT1G79610.1 | TAATTGGGCTCA | sodium proton exchanger, putative (NHX6); FUNCTIONS IN: solute:hydrogen antiporter activity, sodium:hydrogen antiporter activity; INVOLVED IN: cation transport, sodium ion transport, regulation of pH; LOCATED IN: integral to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Na+/H+ exchanger, subfamily (InterPro:IPR004709), Cation/H+ exchanger, conserved region (InterPro:IPR018422), Na+/H+ exchanger, isoform 5/6/8, conserved region (InterPro:IPR018409), Cation/H+ exchanger (InterPro:IPR006153), Na+/H+ exchanger, conserved region (InterPro:IPR018406); BEST Arabidopsis thaliana protein match is: NHX5; sodium ion transmembrane transporter/ sodium:hydrogen antiporter (TAIR:AT1G54370.1); Has 4010 Blast hits to 4005 proteins in 1041 species: Archae - 71; Bacteria - 2418; Metazoa - 735; Fungi - 95; Plants - 280; Viruses - 0; Other Eukaryotes - 411 (source: NCBI BLink). |
| AT2G01270 | AT2G01270.1 | AGCCCAATTGGGCCCAAAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT2G01870 | AT2G01870.1 | AAATGGGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G01870.1 | AATTGGGCCTTTAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G02790 | AT2G02790.1 | TAATTGGGCTCA | IQ-domain 29 (IQD29); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD28 (IQ67 DOMAIN PROTEIN 28); calmodulin binding (TAIR:AT1G14380.2); Has 7393 Blast hits to 5438 proteins in 475 species: Archae - 15; Bacteria - 609; Metazoa - 3092; Fungi - 719; Plants - 642; Viruses - 17; Other Eukaryotes - 2299 (source: NCBI BLink). |
| AT2G03270 | AT2G03270.1 | TTAAAGCCCAATTA | DNA-binding protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA helicase, putative (InterPro:IPR004483), DEAD-like helicase, N-terminal (InterPro:IPR014001); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT5G35970.1); Has 4398 Blast hits to 3880 proteins in 634 species: Archae - 141; Bacteria - 1267; Metazoa - 1124; Fungi - 651; Plants - 305; Viruses - 8; Other Eukaryotes - 902 (source: NCBI BLink). |
| AT2G03390 | AT2G03390.1 | GGCCTAAATTGGGCCTTAGAGCCCAA | uvrB/uvrC motif-containing protein; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: nucleotide-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hemimethylated DNA-binding region (InterPro:IPR011722), UvrB/UvrC protein (InterPro:IPR001943); Has 1297 Blast hits to 1297 proteins in 161 species: Archae - 0; Bacteria - 218; Metazoa - 81; Fungi - 25; Plants - 23; Viruses - 0; Other Eukaryotes - 950 (source: NCBI BLink). |
| AT2G06990 | AT2G06990.1 | CAATTGGGCTCA | encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl. |
| AT2G06990.1 | TAATTGGGCTTTT | encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl. |
| AT2G14660 | AT2G14660.1 | TAATTGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0310 (InterPro:IPR002740); Has 2334 Blast hits to 2333 proteins in 479 species: Archae - 5; Bacteria - 781; Metazoa - 60; Fungi - 50; Plants - 22; Viruses - 0; Other Eukaryotes - 1416 (source: NCBI BLink). |
| AT2G20210 | AT2G20210.1 | AATTGGGCCATA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, ribonuclease inhibitor subtype (InterPro:IPR003590); Has 1691 Blast hits to 1352 proteins in 107 species: Archae - 0; Bacteria - 100; Metazoa - 1035; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 421 (source: NCBI BLink). |
| AT2G20330 | AT2G20330.1 | GAAGCCCAATT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 23940 Blast hits to 14550 proteins in 496 species: Archae - 38; Bacteria - 4162; Metazoa - 9990; Fungi - 4392; Plants - 2081; Viruses - 20; Other Eukaryotes - 3257 (source: NCBI BLink). |
| AT2G20585 | AT2G20585.1 | AATTGGGCTTT | NUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G20585.2 | AATTGGGCTTT | NUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G20585.3 | AATTGGGCTTT | NUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G21150 | AT2G21150.1 | AAAAGCCCAATTATTGGGCCGAT | XAP5 family protein involved in light regulation of the circadian clock and photomorphogenesis. Nuclear localized. |
| AT2G21580 | AT2G21580.1 | TAATTGGGCTTA | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT2G21580.2 | TAATTGGGCTTA | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT2G22400 | AT2G22400.1 | TAAAGCCCAATTAAAAAGCC | NOL1/NOP2/sun family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314); BEST Arabidopsis thaliana protein match is: NOL1/NOP2/sun family protein (TAIR:AT4G40000.1); Has 5426 Blast hits to 5396 proteins in 1280 species: Archae - 185; Bacteria - 3179; Metazoa - 525; Fungi - 201; Plants - 119; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink). |
| AT2G23940 | AT2G23940.1 | CAATTGGGCCTATT | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF788 (InterPro:IPR008506); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30500.1); Has 231 Blast hits to 231 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 70; Plants - 27; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT2G24060 | AT2G24060.1 | TAATTGGGCCCT | translation initiation factor 3 (IF-3) family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 3 (InterPro:IPR001288); BEST Arabidopsis thaliana protein match is: translation initiation factor 3 (IF-3) family protein (TAIR:AT4G30690.1); Has 17514 Blast hits to 8661 proteins in 1545 species: Archae - 56; Bacteria - 6187; Metazoa - 2053; Fungi - 689; Plants - 758; Viruses - 336; Other Eukaryotes - 7435 (source: NCBI BLink). |
| AT2G26430 | AT2G26430.1 | GTAGGCCCAATTA | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. |
| AT2G26430.2 | GTAGGCCCAATTA | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. |
| AT2G26430.3 | GTAGGCCCAATTA | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. |
| AT2G26840 | AT2G26840.1 | CAAAGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43910.1); Has 799 Blast hits to 799 proteins in 14 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 2; Other Eukaryotes - 768 (source: NCBI BLink). |
| AT2G27285 | AT2G27285.1 | CAATTGGGCCGTA | unknown protein; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2040, coiled-coil (InterPro:IPR018612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27280.1); Has 35706 Blast hits to 21282 proteins in 1150 species: Archae - 208; Bacteria - 3585; Metazoa - 16311; Fungi - 2551; Plants - 911; Viruses - 174; Other Eukaryotes - 11966 (source: NCBI BLink). |
| AT2G28480 | AT2G28480.1 | GAGGCCCAATTA | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: group II intron splicing factor CRS1-related (TAIR:AT4G13070.1); Has 212 Blast hits to 192 proteins in 26 species: Archae - 0; Bacteria - 3; Metazoa - 27; Fungi - 0; Plants - 169; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT2G29580 | AT2G29580.1 | AATTGGGCCAA | zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT1G07360.1); Has 10655 Blast hits to 8392 proteins in 419 species: Archae - 8; Bacteria - 299; Metazoa - 5085; Fungi - 2309; Plants - 1897; Viruses - 119; Other Eukaryotes - 938 (source: NCBI BLink). |
| AT2G34590 | AT2G34590.1 | TAATTGGGCCGA | transketolase family protein; FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity, transketolase activity; INVOLVED IN: pollen tube development; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transketolase, C-terminal (InterPro:IPR005476), Transketolase C-terminal-like (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: PDH-E1 BETA (PYRUVATE DEHYDROGENASE E1 BETA); pyruvate dehydrogenase (acetyl-transferring) (TAIR:AT1G30120.1); Has 9465 Blast hits to 9457 proteins in 1366 species: Archae - 92; Bacteria - 4722; Metazoa - 387; Fungi - 143; Plants - 155; Viruses - 0; Other Eukaryotes - 3966 (source: NCBI BLink). |
| AT2G35320 | AT2G35320.1 | ATAATGGGCCTTTAATTGGGCCGA | homologue of the animal Eyes Absent genes. encodes a tyrosine-specific phosphatase. the protein sequence lacks the cys-containing signature of the classical tyrosine phosphatases. belongs to the aspartate-based phosphatases. The enzyme activity is strictly metal-dependent. |
| AT2G35750 | AT2G35750.1 | CTAATGGGCTTAATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G36130 | AT2G36130.1 | TAATTGGGCCGAA | peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 12476 Blast hits to 12426 proteins in 1530 species: Archae - 82; Bacteria - 4056; Metazoa - 2344; Fungi - 974; Plants - 734; Viruses - 0; Other Eukaryotes - 4286 (source: NCBI BLink). |
| AT2G36720 | AT2G36720.1 | AAATGGGCATTAGGCCCAATTG | PHD finger transcription factor, putative; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G27980.1); Has 3291 Blast hits to 2704 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 2475; Fungi - 268; Plants - 355; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). |
| AT2G37600 | AT2G37600.1 | AATAGGCCCAATTG | 60S ribosomal protein L36 (RPL36A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 94; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT2G37600.2 | AATAGGCCCAATTG | 60S ribosomal protein L36 (RPL36A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 94; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT2G38090 | AT2G38090.1 | GAAGCCCAATTG | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), SANT, eukarya (InterPro:IPR017884), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-related (InterPro:IPR012287), Myb-type HTH DNA-binding domain (InterPro:IPR017930); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT5G58900.1); Has 1110 Blast hits to 1107 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 2; Plants - 818; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). |
| AT2G38130 | AT2G38130.1 | CAATTGGGCTTAT | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. |
| AT2G38130.2 | CAATTGGGCTTAT | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. |
| AT2G38140 | AT2G38140.1 | ATAAGCCCAATTG | plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete |
| AT2G38310 | AT2G38310.1 | GCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G05440.1); Has 225 Blast hits to 221 proteins in 31 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 222; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G40290 | AT2G40290.1 | GTGGCCCAATTA | eukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). |
| AT2G40290.2 | GTGGCCCAATTA | eukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). |
| AT2G40290.3 | GTGGCCCAATTA | eukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). |
| AT2G42210 | AT2G42210.1 | TAATTGGGCTTT | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.2 | TAATTGGGCTTT | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.3 | TAATTGGGCTTT | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.4 | TAATTGGGCTTT | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42260 | AT2G42260.1 | AATTGGGCCACAAGCCCA | Encodes a novel plant-specific protein of unknown function. The UVI4 gene is expressed mainly in actively dividing cells. The hypocotyl cells in mutant seedlings undergo one extra round of endoreduplication. The uvi4 mutation also promoted the progression of endo-reduplication during leaf development. |
| AT2G42270 | AT2G42270.1 | TGGGCTTGTGGCCCAATT | U5 small nuclear ribonucleoprotein helicase, putative; FUNCTIONS IN: in 6 functions; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: emb1507 (embryo defective 1507); ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding / nucleoside-triphosphatase/ nucleotide binding (TAIR:AT1G20960.1); Has 13381 Blast hits to 8246 proteins in 1082 species: Archae - 1064; Bacteria - 4051; Metazoa - 2407; Fungi - 1500; Plants - 518; Viruses - 50; Other Eukaryotes - 3791 (source: NCBI BLink). |
| AT2G42300 | AT2G42300.1 | ATAAAGCCCAATAGGCCCAATT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT3G57800.2); Has 1141 Blast hits to 1141 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 3; Plants - 1128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G42300.2 | ATAAAGCCCAATAGGCCCAATT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT3G57800.2); Has 1141 Blast hits to 1141 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 3; Plants - 1128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G43360 | AT2G43360.1 | AATTGGGCTTAT | Catalyzes the conversion of dethiobiotin to biotin. |
| AT2G43370 | AT2G43370.1 | ATAAGCCCAATT | U1 small nuclear ribonucleoprotein 70 kDa, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: U1-70K (U1 SMALL NUCLEAR RIBONUCLEOPROTEIN-70K); RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G50670.1); Has 15940 Blast hits to 13539 proteins in 557 species: Archae - 10; Bacteria - 827; Metazoa - 9526; Fungi - 1771; Plants - 2091; Viruses - 3; Other Eukaryotes - 1712 (source: NCBI BLink). |
| AT2G43460 | AT2G43460.1 | AATTGGGC | 60S ribosomal protein L38 (RPL38A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L38e (InterPro:IPR002675); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L38 (RPL38B) (TAIR:AT3G59540.1); Has 458 Blast hits to 458 proteins in 191 species: Archae - 3; Bacteria - 0; Metazoa - 220; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G43720 | AT2G43720.1 | TAAATGGGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31725.1); Has 203 Blast hits to 203 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 158; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT2G44065 | AT2G44065.1 | AATTGGGCCTGT | ribosomal protein L2 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding, transferase activity; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Translation protein SH3-like, subgroup (InterPro:IPR014722), Ribosomal protein L2, bacterial-type (InterPro:IPR005880), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG01310.1); Has 7469 Blast hits to 7469 proteins in 2227 species: Archae - 235; Bacteria - 3117; Metazoa - 361; Fungi - 186; Plants - 960; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink). |
| AT2G44065.2 | AATTGGGCCTGT | ribosomal protein L2 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding, transferase activity; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Translation protein SH3-like, subgroup (InterPro:IPR014722), Ribosomal protein L2, bacterial-type (InterPro:IPR005880), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG01310.1); Has 7469 Blast hits to 7469 proteins in 2227 species: Archae - 235; Bacteria - 3117; Metazoa - 361; Fungi - 186; Plants - 960; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink). |
| AT2G44120 | AT2G44120.1 | CAAGCCCAATT | 60S ribosomal protein L7 (RPL7C); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7B) (TAIR:AT2G01250.1); Has 982 Blast hits to 980 proteins in 291 species: Archae - 151; Bacteria - 0; Metazoa - 383; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT2G44120.2 | CAAGCCCAATT | 60S ribosomal protein L7 (RPL7C); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7B) (TAIR:AT2G01250.1); Has 982 Blast hits to 980 proteins in 291 species: Archae - 151; Bacteria - 0; Metazoa - 383; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT2G44970 | AT2G44970.1 | TAATTGGGCCCAGTAGTGGCCCATAT | lipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G44970.2 | TAATTGGGCCCAGTAGTGGCCCATAT | lipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G45200 | AT2G45200.1 | GAGCCCAATT | Encodes a member of the GOS1 (Golgi SNARE) gene family. |
| AT2G45300 | AT2G45300.1 | TGAGGCCCAATT | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis |
| AT2G45530 | AT2G45530.1 | TATGGCCCAATTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G37950.1); Has 621 Blast hits to 621 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 262; Fungi - 5; Plants - 312; Viruses - 3; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT2G45690 | AT2G45690.1 | TGTTGGGCTATTTAATTGGGCCTAAA | Encodes a protein with similarity to yeast Pep16p, a membrane localized protein involved in peroxisome assembly and protein-trafficking. SSE1 mutant seeds do not accumulate oils and dessicated seeds have a shrunken appearance. Involved in protein and oil body biogenesis. SSE is expressed during seed development, reaching the highest peak in mature siliques. Expression in leaves and roots is low compared to cotyledons and flowers. Located in peroxisomes and endoplasmic reticulum. Homologous to the peroxin PEX16 and complements the pex16 mutants of the yeast Yarrowia lipolytica. |
| AT2G47170 | AT2G47170.1 | TAAATGGGCCGAATTGGGCTGA | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT2G47840 | AT2G47840.1 | TAAGTCGGCCCAATTA | tic20 protein-related; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55710.1); Has 272 Blast hits to 272 proteins in 73 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT3G01850 | AT3G01850.1 | CAATTGGGCCAA | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). |
| AT3G01850.2 | CAATTGGGCCAA | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). |
| AT3G02065 | AT3G02065.1 | GGGCCCAATTG | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.2 | GGGCCCAATTG | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.3 | GGGCCCAATTG | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02520 | AT3G02520.1 | CAAGGCCCAATTA | Encodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν). |
| AT3G03720 | AT3G03720.2 | TTAGCCCAATTG | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
| AT3G06470 | AT3G06470.1 | GTGGCCCAATT | GNS1/SUR4 membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GNS1/SUR4 membrane protein (InterPro:IPR002076); BEST Arabidopsis thaliana protein match is: GNS1/SUR4 membrane family protein (TAIR:AT3G06460.1); Has 1723 Blast hits to 1718 proteins in 184 species: Archae - 0; Bacteria - 0; Metazoa - 1179; Fungi - 248; Plants - 58; Viruses - 13; Other Eukaryotes - 225 (source: NCBI BLink). |
| AT3G07150 | AT3G07150.1 | ATAAAGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G07860 | AT3G07860.1 | TAATTGGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25340.1); Has 107 Blast hits to 107 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 67; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G07990 | AT3G07990.1 | GCCCAATTGCCCATCA | serine carboxypeptidase-like 27 (SCPL27); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl26 (serine carboxypeptidase-like 26); serine-type carboxypeptidase (TAIR:AT2G35780.1); Has 2491 Blast hits to 2440 proteins in 260 species: Archae - 0; Bacteria - 86; Metazoa - 579; Fungi - 564; Plants - 959; Viruses - 0; Other Eukaryotes - 303 (source: NCBI BLink). |
| AT3G09350 | AT3G09350.1 | TTAAAGGCCCAATT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G09350.2 | TTAAAGGCCCAATT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G09350.3 | TTAAAGGCCCAATT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G10020 | AT3G10020.1 | CAAAGGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G10020.2 | CAAAGGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G10405 | AT3G10405.1 | GCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: pollen development; LOCATED IN: chloroplast; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G11240 | AT3G11240.1 | AATTGGGCTTTAA | Encodes an arginyl-tRNA:protein arginyltransferase (ATE2), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. |
| AT3G11250 | AT3G11250.1 | TTAAAGCCCAATT | 60S acidic ribosomal protein P0 (RPP0C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, translation; LOCATED IN: cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0B) (TAIR:AT3G09200.1); Has 1503 Blast hits to 1500 proteins in 380 species: Archae - 223; Bacteria - 1; Metazoa - 578; Fungi - 277; Plants - 141; Viruses - 0; Other Eukaryotes - 283 (source: NCBI BLink). |
| AT3G11270 | AT3G11270.1 | TTTAGGCCCATATAATTGGGCTTTAT | maternal effect embryo arrest 34 (MEE34); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus, proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: RPN8A (RP NON-ATPASE SUBUNIT 8A) (TAIR:AT5G05780.1); Has 981 Blast hits to 977 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 446; Fungi - 210; Plants - 166; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT3G12010 | AT3G12010.1 | ACAGGCCCAATTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: Colon cancer-associated Mic1-like (InterPro:IPR009755); Has 126 Blast hits to 120 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT3G12012 | AT3G12012.1 | ACAGGCCCAATTG | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF20 represents a conserved upstream opening reading frame relative to major ORF AT3G12010.1 |
| AT3G12740 | AT3G12740.1 | TAAGCCCAATT | Physically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3. |
| AT3G13300 | AT3G13300.1 | GCCCAATT | Encodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development. |
| AT3G13300.2 | GCCCAATT | Encodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development. |
| AT3G13740 | AT3G13740.1 | AAAAGCCCAATT | URF 4-related; FUNCTIONS IN: RNA binding, ribonuclease III activity; INVOLVED IN: RNA processing; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonuclease III (InterPro:IPR000999); BEST Arabidopsis thaliana protein match is: RNA binding / ribonuclease III (TAIR:AT1G55140.1); Has 698 Blast hits to 697 proteins in 302 species: Archae - 0; Bacteria - 571; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink). |
| AT3G13882 | AT3G13882.1 | AATTGGGCCTGTGGCCCAAAGCCCAT | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34 (InterPro:IPR000271). |
| AT3G14390 | AT3G14390.1 | CCGGCCCAATT | diaminopimelate decarboxylase, putative / DAP carboxylase, putative; FUNCTIONS IN: diaminopimelate decarboxylase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: chloroplast; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Diaminopimelate decarboxylase (InterPro:IPR002986), Alanine racemase/group IV decarboxylase, C-terminal (InterPro:IPR009006), Orn/DAP/Arg decarboxylase 2 (InterPro:IPR000183); BEST Arabidopsis thaliana protein match is: diaminopimelate decarboxylase, putative / DAP carboxylase, putative (TAIR:AT5G11880.1); Has 9248 Blast hits to 9226 proteins in 1454 species: Archae - 98; Bacteria - 4313; Metazoa - 392; Fungi - 133; Plants - 315; Viruses - 27; Other Eukaryotes - 3970 (source: NCBI BLink). |
| AT3G15080 | AT3G15080.1 | GCCCAATTA | exonuclease family protein; FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1314 Blast hits to 1314 proteins in 179 species: Archae - 0; Bacteria - 14; Metazoa - 651; Fungi - 418; Plants - 111; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). |
| AT3G15120 | AT3G15120.1 | CTAAGCCCAATT | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: cell division cycle protein 48-related / CDC48-related (TAIR:AT1G05910.1); Has 65380 Blast hits to 45049 proteins in 2200 species: Archae - 999; Bacteria - 13338; Metazoa - 21190; Fungi - 6719; Plants - 3370; Viruses - 463; Other Eukaryotes - 19301 (source: NCBI BLink). |
| AT3G15840 | AT3G15840.1 | CAATTGGGCTCA | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15840.2 | CAATTGGGCTCA | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15840.3 | CAATTGGGCTCA | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15840.4 | CAATTGGGCTCA | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G16310 | AT3G16310.1 | AATAGGCCCAATT | mitotic phosphoprotein N' end (MPPN) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: MPPN (InterPro:IPR007846), Nucleoporin, NUP53 (InterPro:IPR017389); Has 170 Blast hits to 170 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 5; Plants - 32; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G17160 | AT3G17160.1 | TTAAGGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G47970.1); Has 52518 Blast hits to 22905 proteins in 895 species: Archae - 191; Bacteria - 9602; Metazoa - 17412; Fungi - 7793; Plants - 2829; Viruses - 960; Other Eukaryotes - 13731 (source: NCBI BLink). |
| AT3G17770 | AT3G17770.1 | AATTGGGCCTGGCCCATAT | dihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT1G48430.1); Has 2619 Blast hits to 2616 proteins in 532 species: Archae - 8; Bacteria - 1790; Metazoa - 84; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 554 (source: NCBI BLink). |
| AT3G17780 | AT3G17780.1 | CAATTGGGCCGTAAAAAGGCCCATCA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48440.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G18790 | AT3G18790.1 | AATTGGGCCTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isy1-like splicing (InterPro:IPR009360); Has 1075 Blast hits to 879 proteins in 176 species: Archae - 8; Bacteria - 11; Metazoa - 379; Fungi - 177; Plants - 27; Viruses - 9; Other Eukaryotes - 464 (source: NCBI BLink). |
| AT3G18850 | AT3G18850.1 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.2 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.3 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.4 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.5 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18860 | AT3G18860.1 | CAATTGGGCCGGGCTTTGAAAGCCCAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink). |
| AT3G18860.2 | CAATTGGGCCGGGCTTTGAAAGCCCAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink). |
| AT3G18880 | AT3G18880.1 | AATTGGGCTGA | ribosomal protein S17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: emb1129 (embryo defective 1129); structural constituent of ribosome (TAIR:AT1G49400.1); Has 4907 Blast hits to 4907 proteins in 1461 species: Archae - 81; Bacteria - 2923; Metazoa - 31; Fungi - 32; Plants - 65; Viruses - 0; Other Eukaryotes - 1775 (source: NCBI BLink). |
| AT3G19190 | AT3G19190.1 | GAGCCCAATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATG2, C-terminal (InterPro:IPR015412); Has 603 Blast hits to 514 proteins in 156 species: Archae - 0; Bacteria - 19; Metazoa - 326; Fungi - 168; Plants - 38; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G20890 | AT3G20890.1 | AAAAGCCCAATT | RNA binding / nucleic acid binding / nucleotide binding; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT5G66010.1); Has 18009 Blast hits to 6834 proteins in 573 species: Archae - 17; Bacteria - 2353; Metazoa - 8618; Fungi - 803; Plants - 4240; Viruses - 179; Other Eukaryotes - 1799 (source: NCBI BLink). |
| AT3G21110 | AT3G21110.1 | CAATTGGGCTTCAGCCCA | 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone. |
| AT3G21110.2 | CAATTGGGCTTCAGCCCA | 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone. |
| AT3G21390 | AT3G21390.1 | GCCCAATT | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT5G48970.1); Has 22049 Blast hits to 10311 proteins in 361 species: Archae - 0; Bacteria - 0; Metazoa - 10918; Fungi - 6094; Plants - 2986; Viruses - 0; Other Eukaryotes - 2051 (source: NCBI BLink). |
| AT3G22780 | AT3G22780.1 | TAATTGGGCCAA | putative DNA binding protein (tso1) mRNA, tso1-3 allele, |
| AT3G23400 | AT3G23400.1 | AATTGGGC | plastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity, transporter activity, binding; INVOLVED IN: transport; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Lipocalin (InterPro:IPR002345), PAP fibrillin (InterPro:IPR006843); Has 244 Blast hits to 244 proteins in 61 species: Archae - 0; Bacteria - 74; Metazoa - 0; Fungi - 0; Plants - 168; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G27230 | AT3G27230.1 | CTAAGCCCAATTA | LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: methyltransferase (TAIR:AT5G40830.2); Has 184 Blast hits to 183 proteins in 14 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 182; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G46790 | AT3G46790.1 | TCAGCCCAATT | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-H subfamily) with 9 pentatricopeptide (PPR) repeats. The protein is involved the intergenic processing of chloroplast RNA between rps7 and ndhB, which is essential for ndhB translation. |
| AT3G47450 | AT3G47450.1 | AATTGGGCCTT | Encodes a protein with similarity to the bacterial YqeH GTPase required for proper ribosome assembly. In Arabidopsis, mutant analyses show that this protein regulates growth and hormonal signaling in plants. It also attenuates oxidative stress and reactive oxygen species (ROS). It also seems to be involved in regulating leaf senescence and cell death. This gene product is also involved in nitric oxide biosynthesis in response to ABA but not exogenous H2O2. This protein also appears to be required for proper plastid biogenesis. Levels of several plastid-localized proteins, including RBCL, ClpP1, and the MEP biosynthesis enzymes DXS and DXR are altered in rif1-1 mutants. This protein was originally characterized as a mitrochondrial-localized nitric oxide synthase, but, the synthase activity was later disproven. In addition, new studies with GFP fusion proteins and chloroplast import assays suggest that this protein is found in chloroplasts. |
| AT3G47450.2 | AATTGGGCCTT | Encodes a protein with similarity to the bacterial YqeH GTPase required for proper ribosome assembly. In Arabidopsis, mutant analyses show that this protein regulates growth and hormonal signaling in plants. It also attenuates oxidative stress and reactive oxygen species (ROS). It also seems to be involved in regulating leaf senescence and cell death. This gene product is also involved in nitric oxide biosynthesis in response to ABA but not exogenous H2O2. This protein also appears to be required for proper plastid biogenesis. Levels of several plastid-localized proteins, including RBCL, ClpP1, and the MEP biosynthesis enzymes DXS and DXR are altered in rif1-1 mutants. This protein was originally characterized as a mitrochondrial-localized nitric oxide synthase, but, the synthase activity was later disproven. In addition, new studies with GFP fusion proteins and chloroplast import assays suggest that this protein is found in chloroplasts. |
| AT3G47610 | AT3G47610.1 | TAATTGGGCT | transcription regulator/ zinc ion binding; FUNCTIONS IN: transcription regulator activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2HC5-type (InterPro:IPR009349); Has 247 Blast hits to 233 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 80; Plants - 16; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT3G51420 | AT3G51420.1 | TAATTGGGCCTAAT | STRICTOSIDINE SYNTHASE-LIKE 4 (SSL4); FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 925 Blast hits to 920 proteins in 207 species: Archae - 3; Bacteria - 290; Metazoa - 196; Fungi - 4; Plants - 277; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| AT3G51430 | AT3G51430.1 | TAATTGGGCCTATTGGG | strictosidine synthase-like protein |
| AT3G52040 | AT3G52040.1 | AATTGGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52050 | AT3G52050.1 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.2 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.3 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.4 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.5 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52150 | AT3G52150.1 | CTAGGCCCAAATTATAGGCCTTAATAAGGCCCAATTA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 25844 Blast hits to 15833 proteins in 627 species: Archae - 20; Bacteria - 2067; Metazoa - 14187; Fungi - 2805; Plants - 3913; Viruses - 0; Other Eukaryotes - 2852 (source: NCBI BLink). |
| AT3G52150.2 | CTAGGCCCAAATTATAGGCCTTAATAAGGCCCAATTA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 25844 Blast hits to 15833 proteins in 627 species: Archae - 20; Bacteria - 2067; Metazoa - 14187; Fungi - 2805; Plants - 3913; Viruses - 0; Other Eukaryotes - 2852 (source: NCBI BLink). |
| AT3G55280 | AT3G55280.1 | AAAGCCCAATTA | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA |
| AT3G55280.2 | AAAGCCCAATTA | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA |
| AT3G55280.3 | AAAGCCCAATTA | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA |
| AT3G55800 | AT3G55800.1 | GCCCAATTGCCCATCA | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. |
| AT3G57030 | AT3G57030.1 | AATTGGGC | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: strictosidine synthase family protein (TAIR:AT5G22020.1); Has 821 Blast hits to 814 proteins in 170 species: Archae - 1; Bacteria - 197; Metazoa - 197; Fungi - 12; Plants - 301; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink). |
| AT3G57030.1 | AATTGGGCCGG | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: strictosidine synthase family protein (TAIR:AT5G22020.1); Has 821 Blast hits to 814 proteins in 170 species: Archae - 1; Bacteria - 197; Metazoa - 197; Fungi - 12; Plants - 301; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink). |
| AT3G60250 | AT3G60250.1 | CAAGGCCCAATTA | Regulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis |
| AT3G60250.2 | CAAGGCCCAATTA | Regulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis |
| AT3G60770 | AT3G60770.1 | TAATTGGGCCTAT | 40S ribosomal protein S13 (RPS13A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13/S15, N-terminal (InterPro:IPR012606), Ribosomal protein S15 (InterPro:IPR000589), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ATRPS13A (ARABIDOPSIS THALIANA RIBOSOMAL PROTEIN S13A); structural constituent of ribosome (TAIR:AT4G00100.1); Has 787 Blast hits to 787 proteins in 301 species: Archae - 177; Bacteria - 0; Metazoa - 232; Fungi - 99; Plants - 90; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT3G60880 | AT3G60880.1 | TTAAAGCCCAATT | Encodes a dihydropicolinate synthase involved in lysine biosynthesis. The enzyme is allosterically inhibited by lysine. It is predicted to localize to the cholorplast. |
| AT3G60880.2 | TTAAAGCCCAATT | Encodes a dihydropicolinate synthase involved in lysine biosynthesis. The enzyme is allosterically inhibited by lysine. It is predicted to localize to the cholorplast. |
| AT3G62800 | AT3G62800.1 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression. |
| AT3G62800.2 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression. |
| AT3G62800.3 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression. |
| AT3G62810 | AT3G62810.1 | TTAATGGGCCAAAATTGGGCTTAT | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 68 Blast hits to 68 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 22; Plants - 17; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT3G63150 | AT3G63150.1 | AAGGCCCAATTA | Encodes a calcium binding GTPases that is localized to the mitochondrion and is involved in salt stress response. |
| AT3G63460 | AT3G63460.1 | TTATTGGGCCCAATTG | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). |
| AT3G63460.2 | TTATTGGGCCCAATTG | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). |
| AT4G00058 | AT4G00058.1 | AAAAGGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown. |
| AT4G00550 | AT4G00550.1 | TAATTGGGCCTAC | encodes a UDP-galactose-dependent digalactosyldiacylglycerol(DGDG) synthase. Located in chloroplast outer membrane. |
| AT4G00810 | AT4G00810.1 | CAAAGGCCCAATTG | 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae - 60; Bacteria - 0; Metazoa - 672; Fungi - 360; Plants - 316; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink). |
| AT4G00810.2 | CAAAGGCCCAATTG | 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae - 60; Bacteria - 0; Metazoa - 672; Fungi - 360; Plants - 316; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink). |
| AT4G00860 | AT4G00860.1 | GTGGCCCAATTA | putative pathogenesis-related protein whose transcript level is induced in response to ozone and pathogenic Pseudomonas strains. |
| AT4G01010 | AT4G01010.1 | AATTGGGCTTTTA | member of Cyclic nucleotide gated channel family |
| AT4G01660 | AT4G01660.1 | TAATTGGGCCGG | Encodes an ABC1-like protein, member of the ATH subfamily; putative ABC transporter; isolated by functional complementation of a yeast abc1 mutant |
| AT4G02230 | AT4G02230.1 | AAAGCCCAATTA | 60S ribosomal protein L19 (RPL19C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: emb2386 (embryo defective 2386); structural constituent of ribosome (TAIR:AT1G02780.1); Has 848 Blast hits to 848 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 265; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink). |
| AT4G04740 | AT4G04740.1 | CTAAGGCCCAATTAAGGCC | member of Calcium Dependent Protein Kinase |
| AT4G07390 | AT4G07390.1 | AACGACGTAATTGGGCTGA | PQ-loop repeat family protein / transmembrane family protein; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Mannose-P-dolichol utilization defect 1 protein (InterPro:IPR016817); BEST Arabidopsis thaliana protein match is: PQ-loop repeat family protein / transmembrane family protein (TAIR:AT5G59470.1); Has 451 Blast hits to 449 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 81; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT4G08500 | AT4G08500.1 | TAAGCCCAATTAAAAAGCCCAGTA | Member of MAP Kinase Kinase gene family. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates AtMEK1. |
| AT4G12382 | AT4G12382.1 | AATTGGGCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00893.1); Has 86 Blast hits to 86 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G12382.2 | AATTGGGCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00893.1); Has 86 Blast hits to 86 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G13520 | AT4G13520.1 | CAATTGGGCCTAAG | Encodes a small acid protein (SMAP1) that mediates responses Arabidopsis root to the synthetic auxin 2,4-Dichlorophenoxyacetic acid. |
| AT4G13930 | AT4G13930.1 | CAATTGGGCCTTAA | Encodes a serine hydroxymethyltransferase maximally expressed in root |
| AT4G14455 | AT4G14455.1 | TAAAGCCCAGTAAGCCCAATT | Encodes a Bet1/Sft1-like SNARE protein, which can only partially suppresses the temperature-sensitive growth defect in <i>sft1-1</i> yeast cells; however, it cannot support the deletion of the yeast BET1 gene (<i>bet1Δ</i>). In yeast, Bet1p is the v-SNARE (soluble N-ethylmaleimide-sensitive factor adaptor protein receptor, V-type) involved in trafficking between the ER and Golgi. |
| AT4G15260 | AT4G15260.1 | TCGGCCCAATTA | UDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71B5 (UDP-GLUCOSYL TRANSFERASE 71B5); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT4G15280.1); Has 4447 Blast hits to 4433 proteins in 286 species: Archae - 0; Bacteria - 156; Metazoa - 1629; Fungi - 12; Plants - 2597; Viruses - 18; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT4G16695 | AT4G16695.1 | AATTGGGCCATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16695.1 | AATTGGGCCGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16695.2 | AATTGGGCCATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16695.2 | AATTGGGCCGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16695.3 | AATTGGGCCATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16695.3 | AATTGGGCCGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16710 | AT4G16710.1 | CCCAATTGGGCCTTTT | glycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT4G16710.2 | CCCAATTGGGCCTTTT | glycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT4G16720 | AT4G16720.1 | AGCCCAATT | 60S ribosomal protein L15 (RPL15A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15B) (TAIR:AT4G17390.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT4G21100 | AT4G21100.1 | CAATTGGGCCGGGCCGAA | One of two closely related genes similar to a damaged DNA binding protein originally described in mammals. May form a complex with DET1 to regulate photomorphogenesis. Loss of function mutations are lethal. The DDB1b protein binds with a number of DWD-containing proteins and may form part of a CUL4-based E3 ubiquitin ligase. |
| AT4G21105 | AT4G21105.1 | TTCGGCCCGGCCCAATTG | cytochrome-c oxidase/ electron carrier; FUNCTIONS IN: electron carrier activity, cytochrome-c oxidase activity; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIIa (InterPro:IPR003177); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G21105.2 | TTCGGCCCGGCCCAATTG | cytochrome-c oxidase/ electron carrier; FUNCTIONS IN: electron carrier activity, cytochrome-c oxidase activity; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIIa (InterPro:IPR003177); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G21300 | AT4G21300.1 | AATTGGGCCTAAA | pentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G03580.1); Has 19749 Blast hits to 5268 proteins in 182 species: Archae - 1; Bacteria - 4; Metazoa - 89; Fungi - 126; Plants - 19072; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink). |
| AT4G21980 | AT4G21980.1 | TAAAGGCCCAATTAGCCCAAAACGACAC | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. Highest expression in flowers. mRNA abundance increased during dark-induced carbon starvation. Predominantly cytoplasmic with or without N starvation. Upon concanamycin A the protein accumulates in the central vacuole as punctuate structures that resemble autophagic bodies. This localization is more abundant upon N starvation. |
| AT4G21980.2 | TAAAGGCCCAATTAGCCCAAAACGACAC | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. Highest expression in flowers. mRNA abundance increased during dark-induced carbon starvation. Predominantly cytoplasmic with or without N starvation. Upon concanamycin A the protein accumulates in the central vacuole as punctuate structures that resemble autophagic bodies. This localization is more abundant upon N starvation. |
| AT4G22756 | AT4G22756.1 | AATTGGGCCTAC | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha- methyl oxidase. |
| AT4G24570 | AT4G24570.1 | AAAAAGCCCAATTA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: UCP5 (UNCOUPLING PROTEIN 5); binding (TAIR:AT2G22500.1); Has 15369 Blast hits to 9513 proteins in 356 species: Archae - 0; Bacteria - 0; Metazoa - 7655; Fungi - 4171; Plants - 2183; Viruses - 0; Other Eukaryotes - 1360 (source: NCBI BLink). |
| AT4G26520 | AT4G26520.1 | AACGGCCCAATTA | fructose-bisphosphate aldolase, cytoplasmic; FUNCTIONS IN: fructose-bisphosphate aldolase activity; INVOLVED IN: pentose-phosphate shunt, response to hypoxia; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G26530.2); Has 4378 Blast hits to 4373 proteins in 736 species: Archae - 0; Bacteria - 421; Metazoa - 1256; Fungi - 2; Plants - 338; Viruses - 0; Other Eukaryotes - 2361 (source: NCBI BLink). |
| AT4G26670 | AT4G26670.1 | TAAGCCCAATT | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter/ protein transporter (TAIR:AT5G55510.1); Has 467 Blast hits to 467 proteins in 116 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 144; Plants - 82; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink). |
| AT4G26900 | AT4G26900.1 | TAAAAGCCCAATTA | encodes a glutamine amidotransferase and cyclase, catalyzes the fifth and sixth steps of the histidine biosynthetic pathway |
| AT4G28390 | AT4G28390.1 | AATTGGGCCCAGA | Encodes a mitochondrial ADP/ATP carrier protein. Shown in heterologous systems to be located in the plasma membrane. Has comparable affinity for ADP and ATP (in E.coli). |
| AT4G28470 | AT4G28470.1 | TATGGCCCAATGAATAGCCCAATT | encoding the RPN subunits of the 26S proteasome |
| AT4G28640 | AT4G28640.1 | AATTGGGC | Auxin induced gene, IAA11 (IAA11). |
| AT4G28640.2 | AATTGGGC | Auxin induced gene, IAA11 (IAA11). |
| AT4G28910 | AT4G28910.1 | AATTGGGCCCATG | LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT4G28910.2 | AATTGGGCCCATG | LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT4G28910.3 | AATTGGGCCCATG | LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT4G29330 | AT4G29330.1 | TTGGCCCAATT | DERLIN-1 (DER1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.2 (DERLIN-2.2) (TAIR:AT4G04860.1); Has 666 Blast hits to 665 proteins in 170 species: Archae - 0; Bacteria - 12; Metazoa - 290; Fungi - 127; Plants - 84; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). |
| AT4G31200 | AT4G31200.1 | GTGGCCCAATTA | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink). |
| AT4G31200.2 | GTGGCCCAATTA | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink). |
| AT4G31200.3 | GTGGCCCAATTA | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink). |
| AT4G31210 | AT4G31210.1 | TAATTGGGCCAC | DNA topoisomerase family protein; FUNCTIONS IN: DNA topoisomerase activity, DNA topoisomerase type I activity, DNA binding, nucleic acid binding; INVOLVED IN: DNA topological change, DNA unwinding during replication, DNA metabolic process; LOCATED IN: chromosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IA, zn finger (InterPro:IPR013498), DNA topoisomerase, type IA, core (InterPro:IPR000380), DNA topoisomerase, type IA, DNA-binding (InterPro:IPR003602), DNA topoisomerase, type IA, domain 2 (InterPro:IPR003601), DNA topoisomerase, type IA, central (InterPro:IPR013497), DNA topoisomerase, type IA, central region, subdomain 3 (InterPro:IPR013826), DNA topoisomerase I, bacterial-type (InterPro:IPR005733), Toprim subdomain (InterPro:IPR006154), DNA topoisomerase, type IA, central region, subdomain 1 (InterPro:IPR013824), TOPRIM (InterPro:IPR006171); BEST Arabidopsis thaliana protein match is: DNA topoisomerase III alpha, putative (TAIR:AT5G63920.1); Has 15959 Blast hits to 13205 proteins in 1711 species: Archae - 250; Bacteria - 5099; Metazoa - 1724; Fungi - 605; Plants - 147; Viruses - 34; Other Eukaryotes - 8100 (source: NCBI BLink). |
| AT4G31210.1 | TAATTGGGCCAC | DNA topoisomerase family protein; FUNCTIONS IN: DNA topoisomerase activity, DNA topoisomerase type I activity, DNA binding, nucleic acid binding; INVOLVED IN: DNA topological change, DNA unwinding during replication, DNA metabolic process; LOCATED IN: chromosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IA, zn finger (InterPro:IPR013498), DNA topoisomerase, type IA, core (InterPro:IPR000380), DNA topoisomerase, type IA, DNA-binding (InterPro:IPR003602), DNA topoisomerase, type IA, domain 2 (InterPro:IPR003601), DNA topoisomerase, type IA, central (InterPro:IPR013497), DNA topoisomerase, type IA, central region, subdomain 3 (InterPro:IPR013826), DNA topoisomerase I, bacterial-type (InterPro:IPR005733), Toprim subdomain (InterPro:IPR006154), DNA topoisomerase, type IA, central region, subdomain 1 (InterPro:IPR013824), TOPRIM (InterPro:IPR006171); BEST Arabidopsis thaliana protein match is: DNA topoisomerase III alpha, putative (TAIR:AT5G63920.1); Has 15959 Blast hits to 13205 proteins in 1711 species: Archae - 250; Bacteria - 5099; Metazoa - 1724; Fungi - 605; Plants - 147; Viruses - 34; Other Eukaryotes - 8100 (source: NCBI BLink). |
| AT4G31930 | AT4G31930.1 | AATTGGGCTTTAA | mitochondrial glycoprotein family protein / MAM33 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 212 Blast hits to 212 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 66; Plants - 109; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT4G32680 | AT4G32680.1 | TAATTGGGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G32690 | AT4G32690.1 | GCCCAATTA | Encodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast. |
| AT4G32930 | AT4G32930.1 | AATTGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF866, eukaryotic (InterPro:IPR008584); Has 275 Blast hits to 274 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 73; Plants - 42; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT4G33060 | AT4G33060.1 | AATTGGGCCTC | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 18511 Blast hits to 16644 proteins in 1616 species: Archae - 90; Bacteria - 4190; Metazoa - 5100; Fungi - 1622; Plants - 926; Viruses - 34; Other Eukaryotes - 6549 (source: NCBI BLink). |
| AT4G33500 | AT4G33500.1 | AGCCCAATTA | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic (TAIR:AT4G16580.1); Has 6922 Blast hits to 4689 proteins in 525 species: Archae - 32; Bacteria - 1170; Metazoa - 2745; Fungi - 1059; Plants - 300; Viruses - 25; Other Eukaryotes - 1591 (source: NCBI BLink). |
| AT4G33510 | AT4G33510.1 | TAATTGGGCT | Enzyme catalyzing the first committed step in aromatic amino acid biosynthesis |
| AT4G33510.2 | TAATTGGGCT | Enzyme catalyzing the first committed step in aromatic amino acid biosynthesis |
| AT4G34720 | AT4G34720.1 | AATTGGGCTTTTA | vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p1) |
| AT4G34900 | AT4G34900.1 | TAATTGGGCTTTT | XXANTHINE DEHYDROGENASE 2 (XDH2); FUNCTIONS IN: in 8 functions; INVOLVED IN: allantoin biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Aldehyde oxidase/xanthine dehydrogenase (InterPro:IPR016208), Ferredoxin (InterPro:IPR001041), Molybdopterin dehydrogenase, FAD-binding (InterPro:IPR002346), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), [2Fe-2S]-binding (InterPro:IPR002888), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167), FAD-binding, type 2 (InterPro:IPR016166), CO dehydrogenase flavoprotein, C-terminal (InterPro:IPR005107), 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (InterPro:IPR016169), Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead (InterPro:IPR000674), Aldehyde oxidase and xanthine dehydrogenase, molybdopterin binding (InterPro:IPR008274); BEST Arabidopsis thaliana protein match is: XDH1 (XANTHINE DEHYDROGENASE 1); xanthine dehydrogenase (TAIR:AT4G34890.1); Has 15600 Blast hits to 15136 proteins in 810 species: Archae - 184; Bacteria - 7544; Metazoa - 1009; Fungi - 62; Plants - 139; Viruses - 0; Other Eukaryotes - 6662 (source: NCBI BLink). |
| AT4G34910 | AT4G34910.1 | AAAAGCCCAATTA | DEAD/DEAH box helicase, putative (RH16); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 23736 Blast hits to 23298 proteins in 1666 species: Archae - 321; Bacteria - 8811; Metazoa - 4714; Fungi - 2993; Plants - 1279; Viruses - 4; Other Eukaryotes - 5614 (source: NCBI BLink). |
| AT4G35760 | AT4G35760.1 | GTAAGGCCCAATTG | LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vitamin K epoxide reductase (InterPro:IPR012932), Thioredoxin-like fold (InterPro:IPR012336); Has 447 Blast hits to 447 proteins in 86 species: Archae - 0; Bacteria - 179; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink). |
| AT4G35770 | AT4G35770.1 | CAATTGGGCCTTAC | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT4G35770.2 | CAATTGGGCCTTAC | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT4G35770.3 | CAATTGGGCCTTAC | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT4G35800 | AT4G35800.1 | AGCCCAATTA | Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit. |
| AT4G36130 | AT4G36130.1 | GTTTGGGCTTCATAAGGCCCAATTA | 60S ribosomal protein L8 (RPL8C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, vacuole; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein L2, domain 3 (InterPro:IPR014726), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: EMB2296 (embryo defective 2296); structural constituent of ribosome (TAIR:AT2G18020.1); Has 7437 Blast hits to 7435 proteins in 2204 species: Archae - 236; Bacteria - 3125; Metazoa - 339; Fungi - 188; Plants - 929; Viruses - 0; Other Eukaryotes - 2620 (source: NCBI BLink). |
| AT4G36280 | AT4G36280.1 | GAGCCCAATTA | ATP-binding region, ATPase-like domain-containing protein; FUNCTIONS IN: ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATP-binding region, ATPase-like (InterPro:IPR003594); BEST Arabidopsis thaliana protein match is: ATP-binding region, ATPase-like domain-containing protein (TAIR:AT4G36290.1); Has 306 Blast hits to 292 proteins in 51 species: Archae - 0; Bacteria - 16; Metazoa - 167; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT4G36690 | AT4G36690.1 | AATTGGGCCAA | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). |
| AT4G36690.2 | AATTGGGCCAA | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). |
| AT4G36690.3 | AATTGGGCCAA | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). |
| AT4G37000 | AT4G37000.1 | GCCCAATTA | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
| AT4G39150 | AT4G39150.1 | GAGCCCAATT | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G21510.1); Has 15752 Blast hits to 15663 proteins in 1939 species: Archae - 106; Bacteria - 5221; Metazoa - 3289; Fungi - 1398; Plants - 1148; Viruses - 18; Other Eukaryotes - 4572 (source: NCBI BLink). |
| AT4G39240 | AT4G39240.1 | TAATTGGGCTTTA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G14905.2); Has 1294 Blast hits to 1212 proteins in 90 species: Archae - 10; Bacteria - 44; Metazoa - 634; Fungi - 4; Plants - 571; Viruses - 7; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT4G39420 | AT4G39420.1 | AAAGCCCAATTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible. |
| AT4G39420.2 | AAAGCCCAATTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible. |
| AT4G39470 | AT4G39470.1 | TTGGCCCAATTA | chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: tetratricopeptide repeat (TPR)-containing protein (TAIR:AT3G18420.1); Has 1025 Blast hits to 856 proteins in 182 species: Archae - 118; Bacteria - 326; Metazoa - 111; Fungi - 9; Plants - 62; Viruses - 0; Other Eukaryotes - 399 (source: NCBI BLink). |
| AT4G39550 | AT4G39550.1 | AATTGGGCCTAG | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2334 Blast hits to 1835 proteins in 108 species: Archae - 6; Bacteria - 90; Metazoa - 1470; Fungi - 6; Plants - 681; Viruses - 3; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT5G01020 | AT5G01020.1 | ATGGCCCAATTG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G05940.1); Has 84930 Blast hits to 83819 proteins in 2999 species: Archae - 48; Bacteria - 7829; Metazoa - 37401; Fungi - 6493; Plants - 18635; Viruses - 347; Other Eukaryotes - 14177 (source: NCBI BLink). |
| AT5G01110 | AT5G01110.1 | TAATTGGGCCAT | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05670.2); Has 28807 Blast hits to 6228 proteins in 193 species: Archae - 4; Bacteria - 24; Metazoa - 956; Fungi - 844; Plants - 25427; Viruses - 0; Other Eukaryotes - 1552 (source: NCBI BLink). |
| AT5G01110.1 | TCAGCCCAATTAAAACCGGAT | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05670.2); Has 28807 Blast hits to 6228 proteins in 193 species: Archae - 4; Bacteria - 24; Metazoa - 956; Fungi - 844; Plants - 25427; Viruses - 0; Other Eukaryotes - 1552 (source: NCBI BLink). |
| AT5G01360 | AT5G01360.1 | AATTGGGC | EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: ESK1 (ESKIMO 1) (TAIR:AT3G55990.1); Has 710 Blast hits to 702 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 2; Plants - 705; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G01360.2 | AATTGGGC | EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: ESK1 (ESKIMO 1) (TAIR:AT3G55990.1); Has 710 Blast hits to 702 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 2; Plants - 705; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G01881 | AT5G01881.1 | TAATTGGGCCTAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G02050 | AT5G02050.1 | TATGGCCCATTAAGTAATTGGGCCTTAT | mitochondrial glycoprotein family protein / MAM33 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, mitochondrial matrix; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT3G55605.1); Has 329 Blast hits to 328 proteins in 116 species: Archae - 0; Bacteria - 2; Metazoa - 39; Fungi - 94; Plants - 115; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT5G02150 | AT5G02150.1 | CAATTGGGCCTGTTAAGCCCATTAT | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 416 Blast hits to 414 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT5G02150.2 | CAATTGGGCCTGTTAAGCCCATTAT | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 416 Blast hits to 414 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT5G02160 | AT5G02160.1 | ATAATGGGCTTAACAGGCCCAATTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G03290 | AT5G03290.1 | TAATTGGGCCGAT | isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink). |
| AT5G04270 | AT5G04270.1 | CAAGCCCAATT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G09320.1); Has 3947 Blast hits to 3944 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1934; Fungi - 520; Plants - 397; Viruses - 0; Other Eukaryotes - 1096 (source: NCBI BLink). |
| AT5G06340 | AT5G06340.1 | TAATTGGGCTTTTA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27 (ATNUDX27); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 3191 Blast hits to 3191 proteins in 724 species: Archae - 2; Bacteria - 1483; Metazoa - 9; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1660 (source: NCBI BLink). |
| AT5G06370 | AT5G06370.1 | ACAGGCCCAATT | NC domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein (TAIR:AT3G02700.1); Has 102 Blast hits to 101 proteins in 29 species: Archae - 0; Bacteria - 28; Metazoa - 4; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G07340 | AT5G07340.1 | TAATTGGGCCCAG | calnexin, putative; FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: protein folding; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: calnexin 1 (CNX1) (TAIR:AT5G61790.1); Has 1287 Blast hits to 1216 proteins in 289 species: Archae - 0; Bacteria - 58; Metazoa - 600; Fungi - 146; Plants - 196; Viruses - 11; Other Eukaryotes - 276 (source: NCBI BLink). |
| AT5G08180 | AT5G08180.1 | AAGGCCCAAATAATTGGGCCAT | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT5G20160.1); Has 1570 Blast hits to 1570 proteins in 296 species: Archae - 226; Bacteria - 0; Metazoa - 560; Fungi - 291; Plants - 151; Viruses - 0; Other Eukaryotes - 342 (source: NCBI BLink). |
| AT5G08650 | AT5G08650.1 | ACAGGCCCAATTG | GTP-binding protein LepA, putative; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding protein LepA (InterPro:IPR006297), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), GTP-binding protein LepA, C-terminal (InterPro:IPR013842), Elongation factor G, III and V (InterPro:IPR009022), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: GTP binding / GTPase/ translation elongation factor (TAIR:AT5G39900.1); Has 58694 Blast hits to 51359 proteins in 6862 species: Archae - 845; Bacteria - 29013; Metazoa - 5946; Fungi - 3236; Plants - 868; Viruses - 0; Other Eukaryotes - 18786 (source: NCBI BLink). |
| AT5G09390 | AT5G09390.1 | TCAGCCCATTAATACGGCCCAATT | CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT5G09390.2 | TCAGCCCATTAATACGGCCCAATT | CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT5G09740 | AT5G09740.1 | TATAGGCCCAATTA | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. |
| AT5G09740.2 | TATAGGCCCAATTA | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. |
| AT5G10160 | AT5G10160.1 | TAATTGGGCCTAAAAAAGCCCAACT | beta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: hydro-lyase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT2G22230.1); Has 4912 Blast hits to 4909 proteins in 1231 species: Archae - 0; Bacteria - 2978; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1890 (source: NCBI BLink). |
| AT5G10360 | AT5G10360.1 | GTAGGCCCAATT | embryo defective 3010 (EMB3010); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S6e (InterPro:IPR001377), Ribosomal protein S6, eukaryotic (InterPro:IPR014401), Ribosomal protein S6e, conserved site (InterPro:IPR018282); BEST Arabidopsis thaliana protein match is: RPS6 (RIBOSOMAL PROTEIN S6); structural constituent of ribosome (TAIR:AT4G31700.1); Has 832 Blast hits to 830 proteins in 304 species: Archae - 152; Bacteria - 0; Metazoa - 342; Fungi - 112; Plants - 80; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT5G10730 | AT5G10730.1 | ATAAGCCCAATTA | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: dehydrogenase-related (TAIR:AT5G15910.1); Has 2817 Blast hits to 2817 proteins in 746 species: Archae - 59; Bacteria - 1671; Metazoa - 115; Fungi - 146; Plants - 119; Viruses - 0; Other Eukaryotes - 707 (source: NCBI BLink). |
| AT5G10730.1 | TTCGGCCCAATT | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: dehydrogenase-related (TAIR:AT5G15910.1); Has 2817 Blast hits to 2817 proteins in 746 species: Archae - 59; Bacteria - 1671; Metazoa - 115; Fungi - 146; Plants - 119; Viruses - 0; Other Eukaryotes - 707 (source: NCBI BLink). |
| AT5G10740 | AT5G10740.1 | AATAGGCCCATTAGCCCAATTG | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT5G24940.1); Has 5631 Blast hits to 5529 proteins in 624 species: Archae - 9; Bacteria - 1045; Metazoa - 1489; Fungi - 552; Plants - 1360; Viruses - 11; Other Eukaryotes - 1165 (source: NCBI BLink). |
| AT5G10745 | AT5G10745.1 | CAATTGGGCTAATGGGCCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G12050 | AT5G12050.1 | AATTGGGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 394 Blast hits to 270 proteins in 56 species: Archae - 0; Bacteria - 6; Metazoa - 148; Fungi - 21; Plants - 52; Viruses - 0; Other Eukaryotes - 167 (source: NCBI BLink). |
| AT5G13780 | AT5G13780.1 | CAAGGCCCAATTG | GCN5-related N-acetyltransferase, putative; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT1G03150.1); Has 1600 Blast hits to 1599 proteins in 383 species: Archae - 137; Bacteria - 234; Metazoa - 600; Fungi - 262; Plants - 103; Viruses - 0; Other Eukaryotes - 264 (source: NCBI BLink). |
| AT5G14030 | AT5G14030.1 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.2 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.3 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.4 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14100 | AT5G14100.1 | AAAAGCCCAATTAAGGCCCATTC | member of NAP subfamily |
| AT5G14200 | AT5G14200.1 | TAAAGGCCCAATTA | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. |
| AT5G14200.2 | TAAAGGCCCAATTA | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. |
| AT5G14200.3 | TAAAGGCCCAATTA | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. |
| AT5G15260 | AT5G15260.1 | AATTGGGCTTC | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT3G01170.1); Has 39 Blast hits to 39 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G15700 | AT5G15700.1 | TAATTGGGCTC | DNA-directed RNA polymerase (RPOT2); FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: DNA-directed RNA polymerase, bacteriophage type (InterPro:IPR002092); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase, mitochondrial (RPOMT) (TAIR:AT1G68990.1); Has 1079 Blast hits to 1064 proteins in 245 species: Archae - 0; Bacteria - 22; Metazoa - 122; Fungi - 163; Plants - 126; Viruses - 102; Other Eukaryotes - 544 (source: NCBI BLink). |
| AT5G16210 | AT5G16210.1 | GCCCAATTA | HEAT repeat-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), LisH dimerisation motif (InterPro:IPR006594), Armadillo-type fold (InterPro:IPR016024); Has 5435 Blast hits to 4228 proteins in 406 species: Archae - 36; Bacteria - 578; Metazoa - 2571; Fungi - 341; Plants - 173; Viruses - 14; Other Eukaryotes - 1722 (source: NCBI BLink). |
| AT5G17060 | AT5G17060.1 | AATTGGGCT | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster), other ARFs and ARF-like proteins. |
| AT5G17510 | AT5G17510.1 | TAAAAGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03460.1); Has 22577 Blast hits to 10768 proteins in 507 species: Archae - 4; Bacteria - 485; Metazoa - 8864; Fungi - 2539; Plants - 1455; Viruses - 66; Other Eukaryotes - 9164 (source: NCBI BLink). |
| AT5G18770 | AT5G18770.1 | CAATTGGGC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G18780.1); Has 1198 Blast hits to 1165 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1198; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G19380 | AT5G19380.1 | GTTAGGCCCAATTA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12170.2). |
| AT5G19380.2 | GTTAGGCCCAATTA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12170.2). |
| AT5G19875 | AT5G19875.1 | AGGGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31940.1); Has 63 Blast hits to 63 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G21280 | AT5G21280.1 | AATTGGGCT | hydroxyproline-rich glycoprotein family protein; Has 6155 Blast hits to 3771 proteins in 331 species: Archae - 6; Bacteria - 473; Metazoa - 2380; Fungi - 745; Plants - 1401; Viruses - 261; Other Eukaryotes - 889 (source: NCBI BLink). |
| AT5G22040 | AT5G22040.1 | CCGACCCGGAGGCCCAATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G62330.1); Has 34 Blast hits to 34 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G22040.2 | CCGACCCGGAGGCCCAATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G62330.1); Has 34 Blast hits to 34 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G23550 | AT5G23550.1 | CAATTGGGCTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SFT2-like (InterPro:IPR011691); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24170.1); Has 455 Blast hits to 455 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 96; Plants - 62; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT5G25630 | AT5G25630.1 | TAATTGGGCT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G21222.1); Has 19068 Blast hits to 5732 proteins in 184 species: Archae - 3; Bacteria - 21; Metazoa - 595; Fungi - 399; Plants - 17210; Viruses - 0; Other Eukaryotes - 840 (source: NCBI BLink). |
| AT5G26760 | AT5G26760.2 | TCGGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF408 (InterPro:IPR007308); Has 247 Blast hits to 205 proteins in 87 species: Archae - 0; Bacteria - 73; Metazoa - 105; Fungi - 29; Plants - 21; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G27395 | AT5G27395.1 | TTAGCCCAATTG | P-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim44 (InterPro:IPR007379); Has 247 Blast hits to 247 proteins in 89 species: Archae - 0; Bacteria - 90; Metazoa - 76; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G27395.2 | TTAGCCCAATTG | P-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim44 (InterPro:IPR007379); Has 247 Blast hits to 247 proteins in 89 species: Archae - 0; Bacteria - 90; Metazoa - 76; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G27640 | AT5G27640.1 | AATTGGGCTTACCCGGCCCATATA | encodes a member of eukaryotic translation initiation factor 3B family. |
| AT5G27640.2 | AATTGGGCTTACCCGGCCCATATA | encodes a member of eukaryotic translation initiation factor 3B family. |
| AT5G27650 | AT5G27650.1 | TATATGGGCCGGGTAAGCCCAATT | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G05430.1); Has 6970 Blast hits to 4442 proteins in 299 species: Archae - 10; Bacteria - 363; Metazoa - 3592; Fungi - 627; Plants - 302; Viruses - 141; Other Eukaryotes - 1935 (source: NCBI BLink). |
| AT5G28060 | AT5G28060.1 | GTAAGGCCCAATTA | 40S ribosomal protein S24 (RPS24B); FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S24e (InterPro:IPR001976), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal S24e conserved site (InterPro:IPR018098); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S24 (RPS24A) (TAIR:AT3G04920.1); Has 644 Blast hits to 644 proteins in 256 species: Archae - 59; Bacteria - 0; Metazoa - 306; Fungi - 104; Plants - 74; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT5G39250 | AT5G39250.1 | TAATTGGGCTTCTATATGGGCTAAGGCCTTTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G41520 | AT5G41520.1 | ATCGGCCCAATTA | 40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT5G41520.2 | ATCGGCCCAATTA | 40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT5G41940 | AT5G41940.1 | TGGGCCCAATT | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1); Has 3483 Blast hits to 2868 proteins in 186 species: Archae - 2; Bacteria - 83; Metazoa - 1894; Fungi - 490; Plants - 337; Viruses - 5; Other Eukaryotes - 672 (source: NCBI BLink). |
| AT5G42850 | AT5G42850.1 | AATTGGGCCTTAA | INVOLVED IN: cell redox homeostasis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336), Protein of unknown function DUF953, thioredoxin-like (InterPro:IPR010357); Has 237 Blast hits to 237 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 174; Fungi - 29; Plants - 21; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT5G42850.2 | AATTGGGCCTTAA | INVOLVED IN: cell redox homeostasis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336), Protein of unknown function DUF953, thioredoxin-like (InterPro:IPR010357); Has 237 Blast hits to 237 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 174; Fungi - 29; Plants - 21; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT5G43750 | AT5G43750.1 | AATTGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G43970 | AT5G43970.1 | TAATTGGGCTTTTATGGCCCAAT | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion. |
| AT5G44430 | AT5G44430.1 | AAAGCCCAATTG | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT5G44440 | AT5G44440.1 | AGCCCAATT | FAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, petal, sepal, flower, pedicel; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT5G44410.1); Has 3215 Blast hits to 3107 proteins in 522 species: Archae - 13; Bacteria - 1477; Metazoa - 1; Fungi - 1131; Plants - 356; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink). |
| AT5G45680 | AT5G45680.1 | GAAGCCCAATT | FK506-binding protein 1 (FKBP13); FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative (TAIR:AT4G39710.1); Has 6942 Blast hits to 6551 proteins in 1120 species: Archae - 86; Bacteria - 3279; Metazoa - 1434; Fungi - 355; Plants - 420; Viruses - 0; Other Eukaryotes - 1368 (source: NCBI BLink). |
| AT5G47010 | AT5G47010.1 | TAATTGGGCCCAATAT | Required for nonsense-mediated mRNA decay. Involved in RNA interference. lba1 mutants has reduced sugar-induced expression of Atb- amylase, is hypersensitive to glucose and abscisic acid and resistant to mannose, and shows early flowering, short day-sensitive growth, and seed germination phenotypes. |
| AT5G47580 | AT5G47580.1 | TAATTGGGCCGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17250.1); Has 17 Blast hits to 16 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G47860 | AT5G47860.1 | GAAGCCCAATTA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1350 (InterPro:IPR010765); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43540.1); Has 289 Blast hits to 289 proteins in 66 species: Archae - 0; Bacteria - 111; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). |
| AT5G51940 | AT5G51940.1 | TGTGGGCCTAAATTGGGCTTG | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At2g04630. |
| AT5G53330 | AT5G53330.1 | TATGGGCCTTAATGGCCCAATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940); Has 28 Blast hits to 28 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G53540 | AT5G53540.1 | AATTGGGCTTT | MSP1 protein, putative / intramitochondrial sorting protein, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: MSP1 protein, putative / intramitochondrial sorting protein, putative (TAIR:AT4G27680.1); Has 21950 Blast hits to 20239 proteins in 1757 species: Archae - 878; Bacteria - 6604; Metazoa - 4050; Fungi - 2359; Plants - 1467; Viruses - 23; Other Eukaryotes - 6569 (source: NCBI BLink). |
| AT5G53560 | AT5G53560.1 | CAAAGCCCAATT | Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase. |
| AT5G54520 | AT5G54520.1 | TGGCCCAATTAAAGCCCACTA | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G10580.1); Has 17905 Blast hits to 12742 proteins in 467 species: Archae - 38; Bacteria - 2465; Metazoa - 8443; Fungi - 2995; Plants - 1496; Viruses - 0; Other Eukaryotes - 2468 (source: NCBI BLink). |
| AT5G54600 | AT5G54600.1 | CAAGGCCCAATTA | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). |
| AT5G54600.2 | CAAGGCCCAATTA | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). |
| AT5G54900 | AT5G54900.1 | AATTGGGCCTATAAAAAAGCC | RNA-binding protein 45A (ATRBP45A); FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 26274 Blast hits to 15473 proteins in 616 species: Archae - 10; Bacteria - 1663; Metazoa - 15334; Fungi - 2743; Plants - 3912; Viruses - 0; Other Eukaryotes - 2612 (source: NCBI BLink). |
| AT5G55000 | AT5G55000.1 | AATTGGGCTTTTA | FH protein interacting protein FIP2 |
| AT5G55000.2 | AATTGGGCTTTTA | FH protein interacting protein FIP2 |
| AT5G55140 | AT5G55140.1 | TAATTGGGCCCAGATAAAGCCCAAAT | ribosomal protein L30 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L30, bacterial-type (InterPro:IPR005996), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); Has 388 Blast hits to 388 proteins in 155 species: Archae - 0; Bacteria - 328; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT5G57300 | AT5G57300.1 | TAAAAGCCCAATT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57300.2 | TAAAAGCCCAATT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G58230 | AT5G58230.1 | TAATTGGGCCTTTT | Encodes a WD-40 repeat containing protein that functions in chromatin assembly as part of the CAF1 and FIE complex. Mutants exhibit parthenogenetic development that includes proliferation of unfertilized endosperm and embryos. In heterozygous plants 50% of embryos abort. Of the aborted embryos the early aborted class are homozygous and the later aborting lass are heterozygotes in which the defective allele is maternally transmitted. Other phenotypes include defects in ovule morphogenesis and organ initiation,as well as increased levels of heterochromatic DNA. MSI1 is needed for the transition to flowering. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. In the ovule, the MSI1 transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization. MSI is biallelically expressed, the paternall allele is expressed in the endosperm and embryo and is not imprinted. MSI1 forms a complex with RBR1 that is required for activation of the imprinted genes FIS2 and FWA. This activation is mediated by MSI1/RBR1 mediated repression of MET1. |
| AT5G58410 | AT5G58410.1 | TAATTGGGCCTAAA | binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Armadillo-type fold (InterPro:IPR016024); Has 531 Blast hits to 394 proteins in 135 species: Archae - 0; Bacteria - 2; Metazoa - 226; Fungi - 140; Plants - 48; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT5G58490 | AT5G58490.1 | AATTGGGCTTGGGCTTC | cinnamoyl-CoA reductase family; FUNCTIONS IN: 3-beta-hydroxy-delta5-steroid dehydrogenase activity, binding, cinnamoyl-CoA reductase activity, catalytic activity; INVOLVED IN: lignin biosynthetic process, steroid biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-beta hydroxysteroid dehydrogenase/isomerase (InterPro:IPR002225), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: cinnamoyl-CoA reductase family (TAIR:AT2G02400.1); Has 8253 Blast hits to 8243 proteins in 1158 species: Archae - 140; Bacteria - 2986; Metazoa - 418; Fungi - 574; Plants - 1442; Viruses - 7; Other Eukaryotes - 2686 (source: NCBI BLink). |
| AT5G58710 | AT5G58710.1 | GGGCCCAATTA | Encodes cyclophilin ROC7. |
| AT5G60160 | AT5G60160.1 | CAATTGGGCTTTGTAATGGGCCAAT | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: response to cadmium ion, proteolysis; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G04710.1); Has 1278 Blast hits to 1277 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 41; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT5G61228 | AT5G61228.1 | AATTGGGCCAAT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF15 represents a conserved upstream opening reading frame relative to major ORF AT5G61230.1 |
| AT5G62810 | AT5G62810.1 | AATTGGGC | mutant has a defect in the intracellular transport of thiolase from the cytosol to glyoxysomes (formerly known as ped2) |
| AT5G63890 | AT5G63890.1 | TAAAGGCCCAATTA | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
| AT5G63890.2 | TAAAGGCCCAATTA | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
| AT5G64270 | AT5G64270.1 | TAATTGGGCTTATGGGCTTTG | splicing factor, putative; FUNCTIONS IN: binding; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Splicing factor 3B subunit 1 (InterPro:IPR015016), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A regulator (TAIR:AT1G25490.1); Has 1441 Blast hits to 1324 proteins in 270 species: Archae - 12; Bacteria - 198; Metazoa - 607; Fungi - 267; Plants - 142; Viruses - 10; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT5G65260 | AT5G65260.1 | AATTGGGCCTTATTAGGCCCATTAAG | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G10350.1); Has 5533 Blast hits to 5115 proteins in 414 species: Archae - 6; Bacteria - 543; Metazoa - 2461; Fungi - 1041; Plants - 837; Viruses - 0; Other Eukaryotes - 645 (source: NCBI BLink). |
| AT5G65270 | AT5G65270.1 | CTTAATGGGCCTAATAAGGCCCAATT | Arabidopsis Rab GTPase homolog A4a (AtRABA4a); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: RABA4B (RAB GTPASE HOMOLOG A4B); GTP binding (TAIR:AT4G39990.1); Has 23029 Blast hits to 22998 proteins in 639 species: Archae - 17; Bacteria - 108; Metazoa - 12691; Fungi - 2978; Plants - 2157; Viruses - 19; Other Eukaryotes - 5059 (source: NCBI BLink). |
| AT5G65480 | AT5G65480.1 | GAGGCCCAATTAAAACGGCCTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38060.2); Has 29 Blast hits to 29 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G65840 | AT5G65840.1 | AATTGGGCTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37240.1); Has 167 Blast hits to 165 proteins in 51 species: Archae - 0; Bacteria - 28; Metazoa - 51; Fungi - 13; Plants - 59; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G66030 | AT5G66030.1 | TAATTGGGCCATA | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization. |
| AT5G66030.2 | TAATTGGGCCATA | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization. |
| AT5G66040 | AT5G66040.2 | TATGGCCCAATTA | SULFURTRANSFERASE PROTEIN 16 (STR16); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: aging; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: SEN1 (SENESCENCE 1) (TAIR:AT4G35770.1); Has 2229 Blast hits to 2226 proteins in 583 species: Archae - 32; Bacteria - 1489; Metazoa - 53; Fungi - 31; Plants - 139; Viruses - 0; Other Eukaryotes - 485 (source: NCBI BLink). |