Organism | Arabidopsis thaliana | |
ID | AtREG422 | |
Sequence | TGGGCCCA | |
Annotation | ||
PPDB Motif | GCCCA | Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression |
PLACE Motif | GGGCC | one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs); | TGGGCY | "Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);) |
Total Entry Count | 215 |
Locus | Gene model | Sequence | Description |
AT1G01730 | AT1G01730.1 | ATATGGGCCCAGAAAGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 4; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G03106 | AT1G03106.1 | TTATGGGCCCATTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G03110 | AT1G03110.1 | CAATGGGCCCATAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / katanin p80 subunit, putative (TAIR:AT1G61210.1); Has 10142 Blast hits to 5991 proteins in 342 species: Archae - 38; Bacteria - 2987; Metazoa - 3498; Fungi - 1909; Plants - 650; Viruses - 0; Other Eukaryotes - 1060 (source: NCBI BLink).  |
AT1G04130 | AT1G04130.1 | ATTTGGGCCCATAA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase-related (TAIR:AT1G56440.1); Has 3930 Blast hits to 3426 proteins in 259 species: Archae - 8; Bacteria - 133; Metazoa - 1878; Fungi - 572; Plants - 573; Viruses - 0; Other Eukaryotes - 766 (source: NCBI BLink).  |
AT1G04270 | AT1G04270.1 | TGGGCCCACA | Encodes cytosolic ribosomal protein S15.  |
AT1G04270.2 | TGGGCCCACA | Encodes cytosolic ribosomal protein S15.  | |
AT1G05940 | AT1G05940.1 | TGTTGGGCCCAATG | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters.  |
AT1G07700 | AT1G07700.1 | CATGGGCCCATCT | thioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).  |
AT1G07700.2 | CATGGGCCCATCT | thioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).  | |
AT1G07700.3 | CATGGGCCCATCT | thioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).  | |
AT1G09995 | AT1G09995.1 | AAATGGGCCCAGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: helicase-related (TAIR:AT1G79890.1); Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G10417 | AT1G10417.1 | TACTGGGCCCATATA | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens.  |
AT1G10840 | AT1G10840.1 | TAATGGGCCCATG | Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1).  |
AT1G10840.2 | TAATGGGCCCATG | Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1).  | |
AT1G13090 | AT1G13090.1 | CATTGGGCCCATAA | putative cytochrome P450  |
AT1G14140 | AT1G14140.1 | CATGGGCCCATAA | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink).  |
AT1G14380 | AT1G14380.1 | TAATTGGGCCCAGA | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink).  |
AT1G14380.2 | TAATTGGGCCCAGA | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink).  | |
AT1G14380.3 | TAATTGGGCCCAGA | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink).  | |
AT1G16790 | AT1G16790.1 | TGGGCCCAAGCCCAACA | ribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 4 Blast hits to 4 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G26940 | AT1G26940.1 | CATTGGGCCCAATA | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 7846 Blast hits to 7844 proteins in 1250 species: Archae - 78; Bacteria - 3271; Metazoa - 1001; Fungi - 616; Plants - 300; Viruses - 0; Other Eukaryotes - 2580 (source: NCBI BLink).  |
AT1G29880 | AT1G29880.1 | CTTGGGCCCAAA | glycyl-tRNA synthetase / glycine--tRNA ligase; FUNCTIONS IN: glycine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, glycyl-tRNA aminoacylation; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Glycyl-tRNA synthetase, alpha2 dimer (InterPro:IPR002315), Anticodon-binding (InterPro:IPR004154), Glycyl-tRNA synthetase, alpha2 dimer, C-terminal (InterPro:IPR018160), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: tRNA synthetase class II (G, H, P and S) family protein (TAIR:AT1G29870.1); Has 4267 Blast hits to 3231 proteins in 634 species: Archae - 169; Bacteria - 1528; Metazoa - 158; Fungi - 116; Plants - 33; Viruses - 0; Other Eukaryotes - 2263 (source: NCBI BLink).  |
AT1G31420 | AT1G31420.1 | TAATGGGCCTTAAAAATGGGCCCAATG | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.  |
AT1G32530 | AT1G32530.1 | TATATGGGCCCAAAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink).  |
AT1G33250 | AT1G33250.1 | TACTGGGCCCATATTAGGCCC | fringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740), Fringe-like (InterPro:IPR003378); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT4G23490.1); Has 492 Blast hits to 488 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 119; Plants - 128; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT1G36990 | AT1G36990.1 | TTATGGGCCCATCT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08510.1); Has 4597 Blast hits to 1552 proteins in 255 species: Archae - 0; Bacteria - 986; Metazoa - 1160; Fungi - 777; Plants - 63; Viruses - 27; Other Eukaryotes - 1584 (source: NCBI BLink).  |
AT1G53690 | AT1G53690.1 | TATATGGGCCCATAT | Protein of unknown function that is homologous to At5g41010, which encodes a non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12.  |
AT1G54310 | AT1G54310.1 | AAATGGGCCCAATAA | RNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: plasma membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: PUA (InterPro:IPR002478); Has 3651 Blast hits to 3638 proteins in 946 species: Archae - 69; Bacteria - 3053; Metazoa - 33; Fungi - 6; Plants - 28; Viruses - 0; Other Eukaryotes - 462 (source: NCBI BLink).  |
AT1G54360 | AT1G54360.1 | GATGGGCCCATTT | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6.  |
AT1G54360.2 | GATGGGCCCATTT | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6.  | |
AT1G54360.3 | GATGGGCCCATTT | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6.  | |
AT1G58200 | AT1G58200.1 | GAATGGGCCTAACGATGGGCCCATTT | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity.  |
AT1G58200.2 | GAATGGGCCTAACGATGGGCCCATTT | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity.  | |
AT1G58210 | AT1G58210.1 | AAATGGGCCCATCGTTAGGCCCATTC | EMBRYO DEFECTIVE 1674 (EMB1674); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT1G09720.1); Has 24624 Blast hits to 15362 proteins in 900 species: Archae - 370; Bacteria - 1847; Metazoa - 13466; Fungi - 2008; Plants - 1045; Viruses - 70; Other Eukaryotes - 5818 (source: NCBI BLink).  |
AT1G62830 | AT1G62830.1 | CATTGGGCCCAG | Encodes a homolog of human Lysine-Specific Demethylase1. Involved in H3K4 methylation of target genes including the flowering time loci FLC and FWA. Located in nucleus. Negatively regulates root elongation. Involved in repression of LRP1 via histone deacetylation.  |
AT1G64880 | AT1G64880.1 | AATTGGGCCCATG | ribosomal protein S5 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, Golgi apparatus, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: ribosomal protein S5 family protein (TAIR:AT2G33800.1); Has 10105 Blast hits to 8747 proteins in 1649 species: Archae - 225; Bacteria - 3046; Metazoa - 1648; Fungi - 368; Plants - 134; Viruses - 59; Other Eukaryotes - 4625 (source: NCBI BLink).  |
AT1G65820 | AT1G65820.1 | ATTGGGCCCAATG | microsomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129).  |
AT1G65820.2 | ATTGGGCCCAATG | microsomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129).  | |
AT1G65820.3 | ATTGGGCCCAATG | microsomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129).  | |
AT1G67320 | AT1G67320.1 | ATATGGGCCCATTAATAGGCCCAACA | DNA primase, large subunit family; FUNCTIONS IN: DNA primase activity; INVOLVED IN: DNA replication, synthesis of RNA primer; LOCATED IN: alpha DNA polymerase:primase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA primase, large subunit, eukaryotic (InterPro:IPR016558), DNA primase, large subunit, eukaryotic/archaeal (InterPro:IPR007238); Has 329 Blast hits to 325 proteins in 153 species: Archae - 6; Bacteria - 0; Metazoa - 133; Fungi - 93; Plants - 26; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  |
AT1G73430 | AT1G73430.1 | TCTGGGCCCAATGGCCTTTT | sec34-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: chloroplast, membrane, cis-Golgi network; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec34-like protein (InterPro:IPR007265); Has 256 Blast hits to 248 proteins in 121 species: Archae - 0; Bacteria - 4; Metazoa - 107; Fungi - 89; Plants - 19; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
AT1G73430.2 | TCTGGGCCCAATGGCCTTTT | sec34-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: chloroplast, membrane, cis-Golgi network; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec34-like protein (InterPro:IPR007265); Has 256 Blast hits to 248 proteins in 121 species: Archae - 0; Bacteria - 4; Metazoa - 107; Fungi - 89; Plants - 19; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  | |
AT1G76300 | AT1G76300.1 | CTAATGGGCCCAATAA | snRNP core protein SmD3 (SmD3); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nuclear body, nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 890 Blast hits to 890 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 227; Plants - 127; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  |
AT1G79710 | AT1G79710.1 | CAATGGGCCCAAAT | integral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT5G25050.1); Has 694 Blast hits to 685 proteins in 112 species: Archae - 4; Bacteria - 113; Metazoa - 0; Fungi - 0; Plants - 141; Viruses - 0; Other Eukaryotes - 436 (source: NCBI BLink).  |
AT1G79870 | AT1G79870.1 | TTATGGGCCCAAAAATAGGCCCATCT | oxidoreductase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region (InterPro:IPR006139), D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: oxidoreductase family protein (TAIR:AT1G12550.1); Has 19936 Blast hits to 19933 proteins in 1515 species: Archae - 283; Bacteria - 9447; Metazoa - 662; Fungi - 752; Plants - 323; Viruses - 5; Other Eukaryotes - 8464 (source: NCBI BLink).  |
AT1G80550 | AT1G80550.1 | GGGCTTTGGGCCCATAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink).  |
AT2G01270 | AT2G01270.1 | AGCCCAATTGGGCCCAAAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.  |
AT2G01870 | AT2G01870.1 | AAATGGGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G20530 | AT2G20530.1 | TTTTGGGCCCAAA | PROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink).  |
AT2G20530.2 | TTTTGGGCCCAAA | PROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink).  | |
AT2G20580 | AT2G20580.1 | TGTGGGCCCATG | encoding the RPN subunits of the 26S proteasome  |
AT2G23130 | AT2G23130.1 | ATATTGGGCCCAATG | AGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers.  |
AT2G23130.2 | ATATTGGGCCCAATG | AGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers.  | |
AT2G24860 | AT2G24860.1 | TTAATGGGCCCAG | chaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 65 Blast hits to 65 proteins in 20 species: Archae - 0; Bacteria - 8; Metazoa - 8; Fungi - 2; Plants - 40; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT2G29510 | AT2G29510.1 | ACTGGGCCCATCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59020.1); Has 3816 Blast hits to 613 proteins in 107 species: Archae - 0; Bacteria - 39; Metazoa - 471; Fungi - 67; Plants - 91; Viruses - 10; Other Eukaryotes - 3138 (source: NCBI BLink).  |
AT2G29510.1 | CTATTGGGCCCATCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59020.1); Has 3816 Blast hits to 613 proteins in 107 species: Archae - 0; Bacteria - 39; Metazoa - 471; Fungi - 67; Plants - 91; Viruses - 10; Other Eukaryotes - 3138 (source: NCBI BLink).  | |
AT2G35520 | AT2G35520.1 | CTTGGGCCCAAAGGCCC | DEFENDER AGAINST CELL DEATH 2 (DAD2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defender against death DAD protein (InterPro:IPR003038); BEST Arabidopsis thaliana protein match is: ATDAD1 (DEFENDER AGAINST APOPTOTIC DEATH 1) (TAIR:AT1G32210.1); Has 338 Blast hits to 338 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 77; Plants - 74; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
AT2G35520.2 | CTTGGGCCCAAAGGCCC | DEFENDER AGAINST CELL DEATH 2 (DAD2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defender against death DAD protein (InterPro:IPR003038); BEST Arabidopsis thaliana protein match is: ATDAD1 (DEFENDER AGAINST APOPTOTIC DEATH 1) (TAIR:AT1G32210.1); Has 338 Blast hits to 338 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 77; Plants - 74; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  | |
AT2G39805 | AT2G39805.1 | TCTGGGCCCAAG | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
AT2G39805.1 | TCTGGGCCCAAG | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT2G39805.2 | TCTGGGCCCAAG | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT2G39805.2 | TCTGGGCCCAAG | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT2G43720 | AT2G43720.1 | TAAATGGGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31725.1); Has 203 Blast hits to 203 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 158; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT2G44180 | AT2G44180.1 | ATATTGGGCCCAATAAG | Encodes a MAP2 like methionine aminopeptidase. In MAP1A mutant background plants show an increased sensitivity to fumagillin resulting in defects in development. Phenotype is similar to RNAi lines which knock out all MAP2/MAP1 loci.  |
AT2G44970 | AT2G44970.1 | TAATTGGGCCCAGTAGTGGCCCATAT | lipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT2G44970.2 | TAATTGGGCCCAGTAGTGGCCCATAT | lipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT2G46540 | AT2G46540.1 | ATTTGGGCCCAGTAACCCGACCCGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G46890 | AT2G46890.1 | TGGGCCAACATGGGCCCATA | oxidoreductase, acting on the CH-CH group of donors; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system, integral to membrane, cytoplasm; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104), Protein of unknown function DUF1295 (InterPro:IPR010721); BEST Arabidopsis thaliana protein match is: oxidoreductase, acting on the CH-CH group of donors (TAIR:AT1G18180.1); Has 1542 Blast hits to 1542 proteins in 207 species: Archae - 2; Bacteria - 258; Metazoa - 69; Fungi - 95; Plants - 57; Viruses - 0; Other Eukaryotes - 1061 (source: NCBI BLink).  |
AT3G01390 | AT3G01390.1 | TGGGCCCA | Subunit G of the vacuolar membrane ATPAse complex  |
AT3G01390.2 | TGGGCCCA | Subunit G of the vacuolar membrane ATPAse complex  | |
AT3G01400 | AT3G01400.1 | TGGGCCCA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT5G58680.1); Has 3812 Blast hits to 2325 proteins in 207 species: Archae - 0; Bacteria - 2; Metazoa - 1580; Fungi - 356; Plants - 1453; Viruses - 0; Other Eukaryotes - 421 (source: NCBI BLink).  |
AT3G02555 | AT3G02555.1 | CAATGGGCCCAATG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16110.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G02560 | AT3G02560.1 | CATTGGGCCCATTG | 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
AT3G02560.2 | CATTGGGCCCATTG | 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  | |
AT3G05510 | AT3G05510.1 | TATGGGCCCATG | phospholipid/glycerol acyltransferase family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123), Tafazzin (InterPro:IPR000872); BEST Arabidopsis thaliana protein match is: phospholipid/glycerol acyltransferase family protein (TAIR:AT1G78690.1); Has 1693 Blast hits to 1691 proteins in 471 species: Archae - 0; Bacteria - 947; Metazoa - 220; Fungi - 76; Plants - 60; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink).  |
AT3G05510.2 | TATGGGCCCATG | phospholipid/glycerol acyltransferase family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123), Tafazzin (InterPro:IPR000872); BEST Arabidopsis thaliana protein match is: phospholipid/glycerol acyltransferase family protein (TAIR:AT1G78690.1); Has 1693 Blast hits to 1691 proteins in 471 species: Archae - 0; Bacteria - 947; Metazoa - 220; Fungi - 76; Plants - 60; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink).  | |
AT3G06420 | AT3G06420.1 | TGATGGGCCCAAAA | autophagy 8h (ATG8H); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: APG8H (AUTOPHAGY 8H); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase/ microtubule binding (TAIR:AT3G15580.1); Has 1119 Blast hits to 1117 proteins in 200 species: Archae - 0; Bacteria - 0; Metazoa - 577; Fungi - 124; Plants - 171; Viruses - 3; Other Eukaryotes - 244 (source: NCBI BLink).  |
AT3G07590 | AT3G07590.1 | TTTTGGGCCCAATAT | small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative (TAIR:AT4G02840.1); Has 828 Blast hits to 827 proteins in 166 species: Archae - 0; Bacteria - 2; Metazoa - 337; Fungi - 221; Plants - 121; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink).  |
AT3G07630 | AT3G07630.1 | TAGGGCTTTTATTGGGCCCAGT | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].  |
AT3G07630.2 | TAGGGCTTTTATTGGGCCCAGT | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].  | |
AT3G07690 | AT3G07690.1 | AGTTGGGCCCA | NAD or NADH binding / binding / catalytic/ coenzyme binding / glycerol-3-phosphate dehydrogenase (NAD+)/ oxidoreductase/ oxidoreductase, acting on CH-OH group of donors / oxidoreductase, acting on the CH-OH group of donors, NAD or NADP as acceptor; FUNCTIONS IN: in 8 functions; INVOLVED IN: glycerol-3-phosphate catabolic process, glycerol-3-phosphate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: glycerol-3-phosphate dehydrogenase complex, cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), NAD-dependent glycerol-3-phosphate dehydrogenase, C-terminal (InterPro:IPR006109), NAD-dependent glycerol-3-phosphate dehydrogenase, N-terminal (InterPro:IPR011128), NAD-dependent glycerol-3-phosphate dehydrogenase (InterPro:IPR006168); BEST Arabidopsis thaliana protein match is: GPDHC1; NAD or NADH binding / glycerol-3-phosphate dehydrogenase (NAD+) (TAIR:AT2G41540.3); Has 2182 Blast hits to 2182 proteins in 581 species: Archae - 10; Bacteria - 1021; Metazoa - 281; Fungi - 47; Plants - 70; Viruses - 0; Other Eukaryotes - 753 (source: NCBI BLink).  |
AT3G09080 | AT3G09080.1 | TTATGGGCCCATTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 11046 Blast hits to 7089 proteins in 331 species: Archae - 36; Bacteria - 2713; Metazoa - 3924; Fungi - 1952; Plants - 817; Viruses - 0; Other Eukaryotes - 1604 (source: NCBI BLink).  |
AT3G09085 | AT3G09085.1 | AAATGGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2253, membrane (InterPro:IPR018722); Has 550 Blast hits to 550 proteins in 186 species: Archae - 0; Bacteria - 294; Metazoa - 0; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 233 (source: NCBI BLink).  |
AT3G12280 | AT3G12280.1 | TGGGCCCAAT | Encodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA.  |
AT3G12290 | AT3G12290.1 | ATTGGGCCCA | tetrahydrofolate dehydrogenase/cyclohydrolase, putative; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetrahydrofolate dehydrogenase/cyclohydrolase (InterPro:IPR000672), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: tetrahydrofolate dehydrogenase/cyclohydrolase, putative (TAIR:AT4G00620.1); Has 7113 Blast hits to 7108 proteins in 1554 species: Archae - 77; Bacteria - 3117; Metazoa - 345; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 3287 (source: NCBI BLink).  |
AT3G12600 | AT3G12600.1 | GAATGGGCCCAATAAG | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
AT3G12600.1 | TGGGCCCATTAAACCGAA | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  | |
AT3G12600.2 | GAATGGGCCCAATAAG | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  | |
AT3G12600.2 | TGGGCCCATTAAACCGAA | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  | |
AT3G15420 | AT3G15420.1 | TAATGGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80745.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G15430 | AT3G15430.1 | TTTTGGGCCCATTA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink).  |
AT3G15430.2 | TTTTGGGCCCATTA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink).  | |
AT3G17020 | AT3G17020.1 | TGGGCCCAGA | universal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cold, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein / early nodulin ENOD18 family protein (TAIR:AT3G03270.2); Has 1714 Blast hits to 1682 proteins in 394 species: Archae - 203; Bacteria - 983; Metazoa - 43; Fungi - 48; Plants - 391; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).  |
AT3G20280 | AT3G20280.1 | ATATGGGCCCAACT | PHD finger family protein; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT1G50620.1); Has 9770 Blast hits to 5029 proteins in 476 species: Archae - 22; Bacteria - 1974; Metazoa - 3487; Fungi - 1858; Plants - 150; Viruses - 195; Other Eukaryotes - 2084 (source: NCBI BLink).  |
AT3G22460 | AT3G22460.1 | ATATGGGCCCAGA | Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity.  |
AT3G23390 | AT3G23390.1 | AGATGGGCCCATTG | 60S ribosomal protein L36a/L44 (RPL36aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aB) (TAIR:AT4G14320.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  |
AT3G24515 | AT3G24515.1 | TTTTGGGCCCATAA | ubiquitin-conjugating enzyme 37 (UBC37); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC11 (UBIQUITIN-CONJUGATING ENZYME 11); ubiquitin-protein ligase (TAIR:AT3G08690.1); Has 7488 Blast hits to 7480 proteins in 304 species: Archae - 0; Bacteria - 0; Metazoa - 3738; Fungi - 1409; Plants - 1069; Viruses - 22; Other Eukaryotes - 1250 (source: NCBI BLink).  |
AT3G24860 | AT3G24860.1 | TGTTGGGCCCAAAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT2G44730.1); Has 700 Blast hits to 557 proteins in 131 species: Archae - 0; Bacteria - 29; Metazoa - 100; Fungi - 40; Plants - 346; Viruses - 61; Other Eukaryotes - 124 (source: NCBI BLink).  |
AT3G26410 | AT3G26410.1 | TAAATGGGCTTTATTGGGCCCATG | methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
AT3G26420 | AT3G26420.1 | CATGGGCCCAATAAAGCCCATTTA | Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance.  |
AT3G27530 | AT3G27530.1 | TAAATGGGCCCATAT | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC6 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (225 aa) portion of the protein.  |
AT3G45030 | AT3G45030.1 | GTTGGGCCCAACAAGCCCATATA | 40S ribosomal protein S20 (RPS20A); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20C) (TAIR:AT5G62300.2); Has 5001 Blast hits to 5001 proteins in 1494 species: Archae - 173; Bacteria - 2599; Metazoa - 280; Fungi - 90; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).  |
AT3G46580 | AT3G46580.1 | CTTAATGGGCCCAAAAGCCCAAAA | Protein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.  |
AT3G51260 | AT3G51260.1 | CTTGGGCCCAGTA | 20S proteosomal alpha subunits. Interacts with SnRK, SKP1/ASK1 during proteasomal binding of an SCF ubiquitin ligase.  |
AT3G51260.2 | CTTGGGCCCAGTA | 20S proteosomal alpha subunits. Interacts with SnRK, SKP1/ASK1 during proteasomal binding of an SCF ubiquitin ligase.  | |
AT3G51820 | AT3G51820.1 | ACTGGGCCCATTC | Encodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP.  |
AT3G52040 | AT3G52040.1 | AATTGGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G52050 | AT3G52050.1 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink).  |
AT3G52050.2 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink).  | |
AT3G52050.3 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink).  | |
AT3G52050.4 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink).  | |
AT3G52050.5 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink).  | |
AT3G62790 | AT3G62790.1 | AGTTGGGCCCATG | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT2G47690.1); Has 85 Blast hits to 85 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 43; Plants - 36; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT3G63140 | AT3G63140.1 | TAAATGGGCCCATTT | Encodes a protein with ribonuclease activity that is involved in plastid rRNA maturation.  |
AT3G63460 | AT3G63460.1 | TTATTGGGCCCAATTG | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink).  |
AT3G63460.2 | TTATTGGGCCCAATTG | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink).  | |
AT4G00530 | AT4G00530.1 | AGATGGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G00860 | AT4G00860.1 | AAATGGGCCCATAATGGCCCAATAT | putative pathogenesis-related protein whose transcript level is induced in response to ozone and pathogenic Pseudomonas strains.  |
AT4G01560 | AT4G01560.1 | AGATGGGCCCAAG | maternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 218; Fungi - 225; Plants - 59; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  |
AT4G01570 | AT4G01570.1 | CTTGGGCCCATCT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62910.1); Has 25223 Blast hits to 5430 proteins in 165 species: Archae - 8; Bacteria - 10; Metazoa - 231; Fungi - 283; Plants - 23698; Viruses - 0; Other Eukaryotes - 993 (source: NCBI BLink).  |
AT4G01590 | AT4G01590.1 | ACTGGGCCCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae - 0; Bacteria - 99; Metazoa - 666; Fungi - 320; Plants - 99; Viruses - 74; Other Eukaryotes - 776 (source: NCBI BLink).  |
AT4G01590.2 | ACTGGGCCCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae - 0; Bacteria - 99; Metazoa - 666; Fungi - 320; Plants - 99; Viruses - 74; Other Eukaryotes - 776 (source: NCBI BLink).  | |
AT4G14145 | AT4G14145.1 | TACTGGGCTGGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G15410 | AT4G15410.1 | TTTGGGCCCATTAA | Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma (PUX5); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBX (InterPro:IPR001012), SEP (InterPro:IPR012989), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: PUX4; protein binding (TAIR:AT4G04210.1); Has 2169 Blast hits to 897 proteins in 184 species: Archae - 0; Bacteria - 87; Metazoa - 456; Fungi - 202; Plants - 88; Viruses - 16; Other Eukaryotes - 1320 (source: NCBI BLink).  |
AT4G16500 | AT4G16500.1 | TATATGGGCCCATTTA | cysteine protease inhibitor family protein / cystatin family protein; FUNCTIONS IN: enzyme regulator activity, cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT5G47550.1); Has 461 Blast hits to 440 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 452; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT4G17560 | AT4G17560.1 | TGGGCCCAAAT | ribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857), Ribosomal protein L19, conserved site (InterPro:IPR018257); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT5G47190.1); Has 5332 Blast hits to 5332 proteins in 1492 species: Archae - 0; Bacteria - 2922; Metazoa - 96; Fungi - 46; Plants - 97; Viruses - 0; Other Eukaryotes - 2171 (source: NCBI BLink).  |
AT4G17650 | AT4G17650.1 | ATAAAGCCCATTGGGCCCAACA | aromatic-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); Has 1885 Blast hits to 1881 proteins in 667 species: Archae - 0; Bacteria - 1017; Metazoa - 157; Fungi - 73; Plants - 26; Viruses - 1; Other Eukaryotes - 611 (source: NCBI BLink).  |
AT4G20440 | AT4G20440.1 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  |
AT4G20440.2 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G20440.3 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G20440.4 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G24290 | AT4G24290.1 | CAATGGGCCCACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin/complement C9 (InterPro:IPR001862); BEST Arabidopsis thaliana protein match is: NSL1 (necrotic spotted lesions 1) (TAIR:AT1G28380.1); Has 150 Blast hits to 149 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT4G24290.2 | CAATGGGCCCACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Membrane attack complex component/perforin/complement C9 (InterPro:IPR001862); BEST Arabidopsis thaliana protein match is: NSL1 (necrotic spotted lesions 1) (TAIR:AT1G28380.1); Has 150 Blast hits to 149 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  | |
AT4G26720 | AT4G26720.1 | TCTGGGCCCATTAT | Encodes catalytic subunit of protein phosphatase X. Expressed at very low levels in A. thaliana flowers, leaves, stems and roots.  |
AT4G27370 | AT4G27370.1 | CTTATTGGGCCCATA | member of Myosin-like proteins  |
AT4G27380 | AT4G27380.1 | TATGGGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G27740 | AT4G27740.1 | GATGGGCCCATCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27745.1); Has 684 Blast hits to 682 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 132; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT4G28030 | AT4G28030.1 | TATGGGCTCATATTGGGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G06025.1); Has 235 Blast hits to 234 proteins in 78 species: Archae - 4; Bacteria - 115; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).  |
AT4G28030.2 | TATGGGCTCATATTGGGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G06025.1); Has 235 Blast hits to 234 proteins in 78 species: Archae - 4; Bacteria - 115; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).  | |
AT4G28390 | AT4G28390.1 | AATTGGGCCCAGA | Encodes a mitochondrial ADP/ATP carrier protein. Shown in heterologous systems to be located in the plasma membrane. Has comparable affinity for ADP and ATP (in E.coli).  |
AT4G28910 | AT4G28910.1 | AATTGGGCCCATG | LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT4G28910.2 | AATTGGGCCCATG | LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink).  | |
AT4G28910.3 | AATTGGGCCCATG | LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink).  | |
AT4G29840 | AT4G29840.1 | TTAATGGGCCCAAAA | threonine synthase  |
AT4G30750 | AT4G30750.1 | CTTGGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30730.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G30760 | AT4G30760.1 | TTTTGGGCCCAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G30760.2 | TTTTGGGCCCAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G36480 | AT4G36480.1 | TCTGGGCCCAG | Encodes the LCB1 subunit of serine palmitoyltransferase. Together with the LCB2 subunit, forms a functional serine palmitoyltransferase complex, which catalyzes the first reaction of sphingolipid biosynthesis. Knockout of LCB1 was embryo lethal. Partial suppression of LCB1 expression led to smaller plants due to reduced cell expansion.  |
AT4G36480.2 | TCTGGGCCCAG | Encodes the LCB1 subunit of serine palmitoyltransferase. Together with the LCB2 subunit, forms a functional serine palmitoyltransferase complex, which catalyzes the first reaction of sphingolipid biosynthesis. Knockout of LCB1 was embryo lethal. Partial suppression of LCB1 expression led to smaller plants due to reduced cell expansion.  | |
AT5G01780 | AT5G01780.1 | GAGGCCCATGGGCCCATG | oxidoreductase; FUNCTIONS IN: oxidoreductase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase (TAIR:AT3G14160.1); Has 755 Blast hits to 755 proteins in 354 species: Archae - 0; Bacteria - 517; Metazoa - 77; Fungi - 32; Plants - 43; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  |
AT5G02240 | AT5G02240.1 | GGCTGGGCCCAAAA | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.  |
AT5G02370 | AT5G02370.1 | TAAATGGGCCCAAAAAAGGCC | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, sequence-specific DNA binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT5G23910.1); Has 7488 Blast hits to 7156 proteins in 245 species: Archae - 0; Bacteria - 21; Metazoa - 3823; Fungi - 875; Plants - 885; Viruses - 0; Other Eukaryotes - 1884 (source: NCBI BLink).  |
AT5G02450 | AT5G02450.1 | GTTTGGGCCCAACA | 60S ribosomal protein L36 (RPL36C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
AT5G03160 | AT5G03160.1 | TTTTGGGCCCATCA | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast.  |
AT5G03380 | AT5G03380.1 | TAAATGGGCCCATTTA | heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink).  |
AT5G03380.2 | TAAATGGGCCCATTTA | heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink).  | |
AT5G04280 | AT5G04280.1 | CTTGGGCCCATA | glycine-rich RNA-binding protein; FUNCTIONS IN: RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: glycine-rich RNA-binding protein, putative (TAIR:AT1G60650.2); Has 24420 Blast hits to 18586 proteins in 789 species: Archae - 10; Bacteria - 1605; Metazoa - 14101; Fungi - 2458; Plants - 3834; Viruses - 39; Other Eukaryotes - 2373 (source: NCBI BLink).  |
AT5G04710 | AT5G04710.1 | CATGGGCCCAAAGCCCATA | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G60160.1); Has 1276 Blast hits to 1273 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 40; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink).  |
AT5G05320 | AT5G05320.1 | CATTGGGCCCATG | monooxygenase, putative (MO3); FUNCTIONS IN: monooxygenase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938); BEST Arabidopsis thaliana protein match is: monooxygenase, putative (MO2) (TAIR:AT4G38540.1); Has 3563 Blast hits to 3548 proteins in 650 species: Archae - 42; Bacteria - 1804; Metazoa - 7; Fungi - 839; Plants - 277; Viruses - 0; Other Eukaryotes - 594 (source: NCBI BLink).  |
AT5G06340 | AT5G06340.1 | AAATGGGCCCAATA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27 (ATNUDX27); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 3191 Blast hits to 3191 proteins in 724 species: Archae - 2; Bacteria - 1483; Metazoa - 9; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1660 (source: NCBI BLink).  |
AT5G07340 | AT5G07340.1 | TAATTGGGCCCAG | calnexin, putative; FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: protein folding; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: calnexin 1 (CNX1) (TAIR:AT5G61790.1); Has 1287 Blast hits to 1216 proteins in 289 species: Archae - 0; Bacteria - 58; Metazoa - 600; Fungi - 146; Plants - 196; Viruses - 11; Other Eukaryotes - 276 (source: NCBI BLink).  |
AT5G09450 | AT5G09450.1 | CATGGGCCCATTAG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 2335 Blast hits to 1588 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 6; Plants - 2224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |
AT5G09770 | AT5G09770.1 | TATATGGGCCCAAAGCCCAAAC | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G64650.1); Has 5413 Blast hits to 5398 proteins in 1518 species: Archae - 0; Bacteria - 3032; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink).  |
AT5G09880 | AT5G09880.1 | CTATTGGGCCCATCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Splicing factor, CC1-like (InterPro:IPR006509), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G16940.1); Has 75114 Blast hits to 36610 proteins in 1254 species: Archae - 65; Bacteria - 4369; Metazoa - 40620; Fungi - 8054; Plants - 5837; Viruses - 419; Other Eukaryotes - 15750 (source: NCBI BLink).  |
AT5G10360 | AT5G10360.1 | TTATGGGCCCATAA | embryo defective 3010 (EMB3010); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S6e (InterPro:IPR001377), Ribosomal protein S6, eukaryotic (InterPro:IPR014401), Ribosomal protein S6e, conserved site (InterPro:IPR018282); BEST Arabidopsis thaliana protein match is: RPS6 (RIBOSOMAL PROTEIN S6); structural constituent of ribosome (TAIR:AT4G31700.1); Has 832 Blast hits to 830 proteins in 304 species: Archae - 152; Bacteria - 0; Metazoa - 342; Fungi - 112; Plants - 80; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
AT5G10870 | AT5G10870.1 | AGTTGGGCCCAAAT | Encodes chorismate mutase AtCM2.  |
AT5G12290 | AT5G12290.1 | TACTGGGCCCATTAAAAGCCCAATAAG | Encodes a mitochondrial outer membrane protein, involved in galactoglycerolipid biosynthesis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background.  |
AT5G14030 | AT5G14030.1 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT5G14030.2 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT5G14030.3 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT5G14030.4 | CAATTGGGCCCATCATTGACTTT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT5G14610 | AT5G14610.1 | CATGGGCCCAAAT | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding / protein binding; FUNCTIONS IN: protein binding, helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), WW/Rsp5/WWP (InterPro:IPR001202), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DRH1 (DEAD BOX RNA HELICASE 1); ATP-dependent RNA helicase/ ATPase (TAIR:AT3G01540.4); Has 52477 Blast hits to 39251 proteins in 1971 species: Archae - 612; Bacteria - 22224; Metazoa - 10881; Fungi - 4675; Plants - 4189; Viruses - 260; Other Eukaryotes - 9636 (source: NCBI BLink).  |
AT5G15550 | AT5G15550.1 | TTTGGGCCCAAAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 24919 Blast hits to 14751 proteins in 514 species: Archae - 36; Bacteria - 3358; Metazoa - 10677; Fungi - 5278; Plants - 2324; Viruses - 0; Other Eukaryotes - 3246 (source: NCBI BLink).  |
AT5G15550.2 | TTTGGGCCCAAAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 24919 Blast hits to 14751 proteins in 514 species: Archae - 36; Bacteria - 3358; Metazoa - 10677; Fungi - 5278; Plants - 2324; Viruses - 0; Other Eukaryotes - 3246 (source: NCBI BLink).  | |
AT5G15860 | AT5G15860.1 | TTTGGGCCCA | Encodes a protein with prenylcysteine methylesterase activity.  |
AT5G15860.2 | TTTGGGCCCA | Encodes a protein with prenylcysteine methylesterase activity.  | |
AT5G16220 | AT5G16220.1 | CATGGGCCCAAAT | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT2G01190.1); Has 247 Blast hits to 246 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 12; Plants - 175; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT5G16250 | AT5G16250.1 | CATTGGGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G02640.1); Has 56 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G16260 | AT5G16260.1 | TGGGCCCAATG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), GYF (InterPro:IPR003169); Has 1767 Blast hits to 1758 proteins in 207 species: Archae - 0; Bacteria - 82; Metazoa - 1049; Fungi - 296; Plants - 184; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink).  |
AT5G16940 | AT5G16940.1 | ATATTGGGCCCAATAA | carbon-sulfur lyase; FUNCTIONS IN: carbon-sulfur lyase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione-dependent formaldehyde-activating, GFA (InterPro:IPR006913); Has 1933 Blast hits to 1931 proteins in 352 species: Archae - 0; Bacteria - 664; Metazoa - 60; Fungi - 38; Plants - 18; Viruses - 0; Other Eukaryotes - 1153 (source: NCBI BLink).  |
AT5G16940.2 | ATATTGGGCCCAATAA | carbon-sulfur lyase; FUNCTIONS IN: carbon-sulfur lyase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione-dependent formaldehyde-activating, GFA (InterPro:IPR006913); Has 1933 Blast hits to 1931 proteins in 352 species: Archae - 0; Bacteria - 664; Metazoa - 60; Fungi - 38; Plants - 18; Viruses - 0; Other Eukaryotes - 1153 (source: NCBI BLink).  | |
AT5G16950 | AT5G16950.1 | TTATTGGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G23200 | AT5G23200.1 | AAATGGGCCCAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08270.1); Has 52 Blast hits to 52 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT5G24810 | AT5G24810.1 | TTGGGCTTATTGGGCCCATAA | ABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae - 93; Bacteria - 6015; Metazoa - 395; Fungi - 388; Plants - 356; Viruses - 16; Other Eukaryotes - 4320 (source: NCBI BLink).  |
AT5G26610 | AT5G26610.1 | TTTTGGGCCCAAT | D111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink).  |
AT5G26610.2 | TTTTGGGCCCAAT | D111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink).  | |
AT5G28370 | AT5G28370.1 | AAATGGGCCCAACT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G28460.1); Has 22506 Blast hits to 6026 proteins in 190 species: Archae - 7; Bacteria - 27; Metazoa - 841; Fungi - 534; Plants - 20012; Viruses - 0; Other Eukaryotes - 1085 (source: NCBI BLink).  |
AT5G28540 | AT5G28540.1 | ACTGGGCCCAACA | Encodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. BiP is composed of an N-terminal ATP binding domain and a C-terminal domain that binds to hydrophobic patches on improperly/incompletely folded proteins in an ATP-dependent manner.  |
AT5G38480 | AT5G38480.1 | GTTGGGCCCAGTGGCCCATTTA | general regulatory factor, a 14-3-3 gene  |
AT5G38480.2 | GTTGGGCCCAGTGGCCCATTTA | general regulatory factor, a 14-3-3 gene  | |
AT5G41560 | AT5G41560.1 | GTAGGCCCAATGGGCCCATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 59 Blast hits to 59 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 46; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G41600 | AT5G41600.1 | TAAATGGGCCCAATG | VIRB2-INTERACTING PROTEIN 3 (BTI3); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB3) (TAIR:AT1G64090.1); Has 939 Blast hits to 939 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 648; Fungi - 2; Plants - 271; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
AT5G41940 | AT5G41940.1 | TGGGCCCAATT | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1); Has 3483 Blast hits to 2868 proteins in 186 species: Archae - 2; Bacteria - 83; Metazoa - 1894; Fungi - 490; Plants - 337; Viruses - 5; Other Eukaryotes - 672 (source: NCBI BLink).  |
AT5G47010 | AT5G47010.1 | TAATTGGGCCCAATAT | Required for nonsense-mediated mRNA decay. Involved in RNA interference. lba1 mutants has reduced sugar-induced expression of Atb- amylase, is hypersensitive to glucose and abscisic acid and resistant to mannose, and shows early flowering, short day-sensitive growth, and seed germination phenotypes.  |
AT5G47320 | AT5G47320.1 | CATTGGGCCCATTAT | Nuclear encoded mitochondrial ribosome subunit.  |
AT5G47430 | AT5G47430.1 | TGGGCCCATAA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DWNN domain (InterPro:IPR014891), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G17410.1); Has 12501 Blast hits to 8536 proteins in 350 species: Archae - 0; Bacteria - 308; Metazoa - 7733; Fungi - 1802; Plants - 953; Viruses - 24; Other Eukaryotes - 1681 (source: NCBI BLink).  |
AT5G47435 | AT5G47435.1 | CTTATTGGGCCCATTT | encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle.  |
AT5G47435.2 | CTTATTGGGCCCATTT | encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle.  | |
AT5G48730 | AT5G48730.1 | TTTTGGGCCCAAAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53170.1); Has 13431 Blast hits to 4993 proteins in 158 species: Archae - 3; Bacteria - 10; Metazoa - 241; Fungi - 171; Plants - 12464; Viruses - 0; Other Eukaryotes - 542 (source: NCBI BLink).  |
AT5G50080 | AT5G50080.1 | ATTTGGGCCCAAAT | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.  |
AT5G51620 | AT5G51620.1 | AAATGGGCCCAGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: emb2731 (embryo defective 2731) (TAIR:AT5G55940.1); Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G51620.2 | AAATGGGCCCAGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: emb2731 (embryo defective 2731) (TAIR:AT5G55940.1); Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G51620.3 | AAATGGGCCCAGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: emb2731 (embryo defective 2731) (TAIR:AT5G55940.1); Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G53940 | AT5G53940.1 | AAATGGGCCCAGTTAAGGCCCAACA | yippee family protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: yippee family protein (TAIR:AT2G40110.1); Has 696 Blast hits to 696 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 132; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT5G55140 | AT5G55140.1 | TAATTGGGCCCAGATAAAGCCCAAAT | ribosomal protein L30 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L30, bacterial-type (InterPro:IPR005996), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); Has 388 Blast hits to 388 proteins in 155 species: Archae - 0; Bacteria - 328; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT5G56030 | AT5G56030.1 | AGTTGGGCCCAAAA | a member of heat shock protein 90 (HSP90) gene family. Expressed in all tissues and abundant in root apical meristem, pollen and tapetum. Expression is NOT heat-induced but induced by IAA and NaCl.  |
AT5G56670 | AT5G56670.1 | TATGGGCCCATAAAGCCCAATAT | 40S ribosomal protein S30 (RPS30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30B) (TAIR:AT4G29390.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT5G57815 | AT5G57815.1 | TTTTGGGCCCATTAAAGCCCAATAAAATGGGCTA | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT5G62300 | AT5G62300.1 | GTTTGGGCCCAACA | 40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).  |
AT5G62300.2 | GTTTGGGCCCAACA | 40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).  | |
AT5G62700 | AT5G62700.1 | ATGGGCCCAAA | encodes tubulin beta-2/beta-3 chain  |
AT5G66240 | AT5G66240.1 | ATTTGGGCCCATAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink).  |
AT5G66240.2 | ATTTGGGCCCATAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink).  | |
AT5G66290 | AT5G66290.1 | TGGGCCCAATAAAATGGGCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G66910 | AT5G66910.1 | TTATGGGCCCATATA | disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance, plant (InterPro:IPR014011), Leucine-rich repeat (InterPro:IPR001611), Mildew-resistance, broad-spectrum (InterPro:IPR008808); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G66900.1); Has 19423 Blast hits to 11897 proteins in 451 species: Archae - 22; Bacteria - 1182; Metazoa - 2936; Fungi - 103; Plants - 14487; Viruses - 0; Other Eukaryotes - 693 (source: NCBI BLink).  |