| Locus | Gene model | Sequence | Description |
| AT1G02870 | AT1G02870.1 | AACGACGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 46; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G03780 | AT1G03780.1 | GAAACGACGTCGTT | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase. |
| AT1G03780.2 | GAAACGACGTCGTT | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase. |
| AT1G03910 | AT1G03910.1 | AACGACGTCGT | EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cactin, central region (InterPro:IPR018816); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36815.2); Has 11516 Blast hits to 6722 proteins in 356 species: Archae - 23; Bacteria - 259; Metazoa - 6122; Fungi - 1009; Plants - 493; Viruses - 33; Other Eukaryotes - 3577 (source: NCBI BLink). |
| AT1G04680 | AT1G04680.1 | GACGACGTCGT | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT4G13710.1); Has 926 Blast hits to 921 proteins in 162 species: Archae - 0; Bacteria - 377; Metazoa - 0; Fungi - 139; Plants - 402; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G04710 | AT1G04710.1 | ACGACGTCGTTTA | EC2.3.1.16 thiolase. |
| AT1G08110 | AT1G08110.1 | AACGACGTCGTTTA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.2 | AACGACGTCGTTTA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.3 | AACGACGTCGTTTA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.4 | AACGACGTCGTTTA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08360 | AT1G08360.1 | GACGACGTCGT | 60S ribosomal protein L10A (RPL10aA); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: PGY1 (PIGGYBACK1); RNA binding / structural constituent of ribosome (TAIR:AT2G27530.2); Has 2469 Blast hits to 2469 proteins in 759 species: Archae - 186; Bacteria - 980; Metazoa - 354; Fungi - 122; Plants - 236; Viruses - 0; Other Eukaryotes - 591 (source: NCBI BLink). |
| AT1G08400 | AT1G08400.1 | AACGACGTC | chromosome structural maintenance protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RINT-1/TIP-1 (InterPro:IPR007528); BEST Arabidopsis thaliana protein match is: MAG2 (maigo2) (TAIR:AT3G47700.1); Has 98 Blast hits to 96 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 53; Fungi - 18; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G10240 | AT1G10240.1 | AACGACGTCGT | FAR1-related sequence 11 (FRS11); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS10 (FAR1-related sequence 10); zinc ion binding (TAIR:AT5G28530.1); Has 770 Blast hits to 690 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 74; Plants - 691; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G11475 | AT1G11475.1 | ACGACGTCGTTTA | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB10. |
| AT1G11680 | AT1G11680.1 | ACGACGTCGTT | putative obtusifoliol 14-alpha demethylase involved in sterol biosynthesis. |
| AT1G11940 | AT1G11940.1 | ACGTGTACGTGGCTTACGACGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62305.1); Has 329 Blast hits to 329 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 304; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT1G14140 | AT1G14140.1 | GAAACGACGTCGTC | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink). |
| AT1G14260 | AT1G14260.1 | GACGTCGTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G02960.4); Has 1265 Blast hits to 1265 proteins in 158 species: Archae - 0; Bacteria - 0; Metazoa - 607; Fungi - 81; Plants - 327; Viruses - 49; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G14260.2 | GACGTCGTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G02960.4); Has 1265 Blast hits to 1265 proteins in 158 species: Archae - 0; Bacteria - 0; Metazoa - 607; Fungi - 81; Plants - 327; Viruses - 49; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G14380 | AT1G14380.1 | AAACGACGTC | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G14380.2 | AAACGACGTC | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G14380.3 | AAACGACGTC | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G16905 | AT1G16905.1 | GACGTCGT | sugar binding; FUNCTIONS IN: sugar binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480); BEST Arabidopsis thaliana protein match is: curculin-like (mannose-binding) lectin family protein (TAIR:AT1G78860.1); Has 1413 Blast hits to 1382 proteins in 73 species: Archae - 0; Bacteria - 26; Metazoa - 0; Fungi - 0; Plants - 1385; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G17270 | AT1G17270.1 | AAAACGACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G50420.1); Has 68 Blast hits to 68 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G17860 | AT1G17860.1 | GACGTCGTC | trypsin and protease inhibitor family protein / Kunitz family protein; FUNCTIONS IN: endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: apoplast, cell wall; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I3, Kunitz legume (InterPro:IPR002160), Kunitz inhibitor ST1-like (InterPro:IPR011065); BEST Arabidopsis thaliana protein match is: trypsin and protease inhibitor family protein / Kunitz family protein (TAIR:AT1G73260.1); Has 508 Blast hits to 508 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 507; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G18070 | AT1G18070.1 | GACGTCGT | EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink). |
| AT1G18070.2 | GACGTCGT | EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink). |
| AT1G20370 | AT1G20370.1 | ACGACGTCGT | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G76120.1); Has 2413 Blast hits to 2196 proteins in 790 species: Archae - 88; Bacteria - 1223; Metazoa - 281; Fungi - 214; Plants - 87; Viruses - 0; Other Eukaryotes - 520 (source: NCBI BLink). |
| AT1G22200 | AT1G22200.1 | ACGACGTCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink). |
| AT1G22200.2 | ACGACGTCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink). |
| AT1G22970 | AT1G22970.1 | AAACGACGTCGTT | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G71150.1); Has 102 Blast hits to 102 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 62; Fungi - 9; Plants - 27; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G24150 | AT1G24150.1 | GACGACGTC | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. |
| AT1G26340 | AT1G26340.1 | TAAACGACGTCGTT | encodes a member of the cytochromes b5 family of proteins that localizes to the outer envelope of the chloroplast. The C-terminal portion of the protein appears to be capable of inserting into a plant microsomal membrane in vitro. |
| AT1G27000 | AT1G27000.1 | GACGACGTCGTTTC | bZIP family transcription factor; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02730.2); Has 122 Blast hits to 113 proteins in 16 species: Archae - 0; Bacteria - 8; Metazoa - 2; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT1G27540 | AT1G27540.1 | GACGTCGTATATTGGGCCATA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27540.2 | GACGTCGTATATTGGGCCATA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G29890 | AT1G29890.2 | AAAACGACGTC | acetyltransferase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Cas1p-like (InterPro:IPR012419); BEST Arabidopsis thaliana protein match is: O-acetyltransferase family protein (TAIR:AT2G34410.2); Has 188 Blast hits to 184 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 99; Fungi - 25; Plants - 57; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G31160 | AT1G31160.1 | AAATGACGTCGTTT | zinc-binding protein, putative / protein kinase C inhibitor, putative; FUNCTIONS IN: protein kinase C binding, zinc ion binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histidine triad-like motif (InterPro:IPR011146), Histidine triad (HIT) protein (InterPro:IPR001310), Histidine triad motif (InterPro:IPR011151); BEST Arabidopsis thaliana protein match is: zinc-binding protein, putative / protein kinase C inhibitor, putative (TAIR:AT3G56490.1); Has 5594 Blast hits to 5592 proteins in 1456 species: Archae - 103; Bacteria - 2673; Metazoa - 341; Fungi - 103; Plants - 63; Viruses - 0; Other Eukaryotes - 2311 (source: NCBI BLink). |
| AT1G32220 | AT1G32220.1 | GATGACGTCGTTTA | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT1G32870 | AT1G32870.1 | CCGACCCGAAAAAACGACGTC | Arabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT1G32870.2 | CCGACCCGAAAAAACGACGTC | Arabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT1G43245 | AT1G43245.1 | AACGACGTCGTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214); Has 432 Blast hits to 430 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 212; Fungi - 80; Plants - 47; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT1G50660 | AT1G50660.1 | ACGACGTCGTC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G20350.1); Has 17678 Blast hits to 12063 proteins in 820 species: Archae - 279; Bacteria - 1267; Metazoa - 9769; Fungi - 1256; Plants - 599; Viruses - 41; Other Eukaryotes - 4467 (source: NCBI BLink). |
| AT1G53590 | AT1G53590.1 | GACGACGTCGTC | NTMC2T6.1; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14590.2); Has 4658 Blast hits to 3860 proteins in 257 species: Archae - 0; Bacteria - 64; Metazoa - 2751; Fungi - 514; Plants - 693; Viruses - 7; Other Eukaryotes - 629 (source: NCBI BLink). |
| AT1G62730 | AT1G62730.1 | GACGTCGT | transferase; FUNCTIONS IN: transferase activity; INVOLVED IN: biosynthetic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid synthase (InterPro:IPR008949), Squalene/phytoene synthase (InterPro:IPR002060); Has 671 Blast hits to 669 proteins in 308 species: Archae - 0; Bacteria - 381; Metazoa - 94; Fungi - 65; Plants - 24; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT1G62740 | AT1G62740.1 | ACGACGTC | stress-inducible protein, putative; FUNCTIONS IN: binding; INVOLVED IN: response to stress; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G12270.1); Has 34012 Blast hits to 14045 proteins in 887 species: Archae - 1292; Bacteria - 9292; Metazoa - 8243; Fungi - 1967; Plants - 2227; Viruses - 4; Other Eukaryotes - 10987 (source: NCBI BLink). |
| AT1G64090 | AT1G64090.1 | ACGACGTCGT | reticulon family protein (RTNLB3); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: BTI3 (VIRB2-INTERACTING PROTEIN 3) (TAIR:AT5G41600.1); Has 970 Blast hits to 970 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 664; Fungi - 15; Plants - 274; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G65290 | AT1G65290.1 | AACGACGTCGTTTT | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. As part of the mitochondrial matrix, it is likely to be involved in fatty acid or lipoic acid biogenesis. |
| AT1G65445 | AT1G65445.1 | AAAACGACGTC | transferase-related; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: HCT (HYDROXYCINNAMOYL-COA SHIKIMATE/QUINATE HYDROXYCINNAMOYL TRANSFERASE); quinate O-hydroxycinnamoyltransferase/ shikimate O-hydroxycinnamoyltransferase/ transferase (TAIR:AT5G48930.1); Has 438 Blast hits to 437 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 435; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G71780 | AT1G71780.1 | GACGTCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G71840 | AT1G71840.1 | AAACGACGTCGTTTA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 67893 Blast hits to 26212 proteins in 696 species: Archae - 58; Bacteria - 6808; Metazoa - 32655; Fungi - 12563; Plants - 6168; Viruses - 0; Other Eukaryotes - 9641 (source: NCBI BLink). |
| AT1G72160 | AT1G72160.1 | GACGACGTC | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 3452 Blast hits to 2934 proteins in 279 species: Archae - 35; Bacteria - 208; Metazoa - 1309; Fungi - 627; Plants - 480; Viruses - 12; Other Eukaryotes - 781 (source: NCBI BLink). |
| AT1G72175 | AT1G72175.1 | AACGACGTCGTTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1232 (InterPro:IPR010652), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G22510.1); Has 591 Blast hits to 591 proteins in 84 species: Archae - 0; Bacteria - 8; Metazoa - 474; Fungi - 32; Plants - 29; Viruses - 2; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT1G79990 | AT1G79990.3 | AAAACGACGTC | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat, endomembrane system, COPI vesicle coat; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Coatomer, WD associated region (InterPro:IPR006692), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: coatomer protein complex, subunit beta 2 (beta prime), putative (TAIR:AT1G52360.1); Has 55918 Blast hits to 24188 proteins in 622 species: Archae - 40; Bacteria - 5752; Metazoa - 25846; Fungi - 10921; Plants - 5304; Viruses - 8; Other Eukaryotes - 8047 (source: NCBI BLink). |
| AT1G79990.5 | AAAACGACGTC | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat, endomembrane system, COPI vesicle coat; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Coatomer, WD associated region (InterPro:IPR006692), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: coatomer protein complex, subunit beta 2 (beta prime), putative (TAIR:AT1G52360.1); Has 55918 Blast hits to 24188 proteins in 622 species: Archae - 40; Bacteria - 5752; Metazoa - 25846; Fungi - 10921; Plants - 5304; Viruses - 8; Other Eukaryotes - 8047 (source: NCBI BLink). |
| AT2G01110 | AT2G01110.1 | AACGACGTCGTTTA | mutant is Albino and pale green; Chloroplast Protein Translocation (tatC). Core subunit of the chloroplast Tat translocase. Integral chloroplast thylakoid membrane protein. |
| AT2G01120 | AT2G01120.1 | TAAACGACGTCGTT | Origin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
| AT2G01270 | AT2G01270.1 | GACGTCGTT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT2G04850 | AT2G04850.1 | GAAACGACGTCGTTTA | auxin-responsive protein-related; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive family protein (TAIR:AT3G25290.2); Has 374 Blast hits to 374 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 72; Fungi - 47; Plants - 246; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT2G04880 | AT2G04880.1 | AACGACGTC | Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1. |
| AT2G04880.2 | AACGACGTC | Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1. |
| AT2G04890 | AT2G04890.1 | AAAACGACGTCGT | Encodes a scarecrow-like protein (SCL21). Member of GRAS gene family. |
| AT2G05830 | AT2G05830.1 | AAAACGACGTC | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: cellular biosynthetic process, translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative translation initiation factor, aIF-2BI/5-methylthioribose-1-phosphate isomerase (InterPro:IPR005251), Initiation factor 2B related (InterPro:IPR000649), Initiation factor 2B alpha/beta/delta (InterPro:IPR011559); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 2B family protein / eIF-2B family protein (TAIR:AT3G07300.3); Has 3649 Blast hits to 3647 proteins in 608 species: Archae - 219; Bacteria - 965; Metazoa - 445; Fungi - 250; Plants - 116; Viruses - 0; Other Eukaryotes - 1654 (source: NCBI BLink). |
| AT2G05830.2 | AAAACGACGTC | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: cellular biosynthetic process, translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative translation initiation factor, aIF-2BI/5-methylthioribose-1-phosphate isomerase (InterPro:IPR005251), Initiation factor 2B related (InterPro:IPR000649), Initiation factor 2B alpha/beta/delta (InterPro:IPR011559); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 2B family protein / eIF-2B family protein (TAIR:AT3G07300.3); Has 3649 Blast hits to 3647 proteins in 608 species: Archae - 219; Bacteria - 965; Metazoa - 445; Fungi - 250; Plants - 116; Viruses - 0; Other Eukaryotes - 1654 (source: NCBI BLink). |
| AT2G05830.3 | AAAACGACGTC | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: cellular biosynthetic process, translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative translation initiation factor, aIF-2BI/5-methylthioribose-1-phosphate isomerase (InterPro:IPR005251), Initiation factor 2B related (InterPro:IPR000649), Initiation factor 2B alpha/beta/delta (InterPro:IPR011559); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 2B family protein / eIF-2B family protein (TAIR:AT3G07300.3); Has 3649 Blast hits to 3647 proteins in 608 species: Archae - 219; Bacteria - 965; Metazoa - 445; Fungi - 250; Plants - 116; Viruses - 0; Other Eukaryotes - 1654 (source: NCBI BLink). |
| AT2G05830.4 | AAAACGACGTC | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: cellular biosynthetic process, translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative translation initiation factor, aIF-2BI/5-methylthioribose-1-phosphate isomerase (InterPro:IPR005251), Initiation factor 2B related (InterPro:IPR000649), Initiation factor 2B alpha/beta/delta (InterPro:IPR011559); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 2B family protein / eIF-2B family protein (TAIR:AT3G07300.3); Has 3649 Blast hits to 3647 proteins in 608 species: Archae - 219; Bacteria - 965; Metazoa - 445; Fungi - 250; Plants - 116; Viruses - 0; Other Eukaryotes - 1654 (source: NCBI BLink). |
| AT2G20450 | AT2G20450.1 | TAAACGACGTC | 60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT2G21640 | AT2G21640.1 | GACGTCGTC | Encodes a protein of unknown function that is a marker for oxidative stress response. |
| AT2G24250 | AT2G24250.1 | AAAACGACGTCATC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G64840.1); Has 60 Blast hits to 58 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G24250.2 | AAAACGACGTCATC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G64840.1); Has 60 Blast hits to 58 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G26780 | AT2G26780.1 | ACGACGTCGTTTA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 325 Blast hits to 275 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 149; Fungi - 125; Plants - 34; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT2G27500 | AT2G27500.3 | AAAACGACGTCGT | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to plasma membrane, nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT1G32860.1); Has 1391 Blast hits to 1379 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 1379; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G31200 | AT2G31200.1 | AACGACGTCGTTTC | Encodes actin depolymerizing factor 6 (ADF6). |
| AT2G33040 | AT2G33040.1 | GAAACGACGTCGT | ATP synthase gamma chain, mitochondrial (ATPC); FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, gamma subunit (InterPro:IPR000131); BEST Arabidopsis thaliana protein match is: ATPC1; enzyme regulator (TAIR:AT4G04640.1); Has 6854 Blast hits to 6853 proteins in 1574 species: Archae - 5; Bacteria - 3135; Metazoa - 212; Fungi - 103; Plants - 101; Viruses - 0; Other Eukaryotes - 3298 (source: NCBI BLink). |
| AT2G38080 | AT2G38080.1 | AAAACGACGTC | Encodes a protein with similarity to putative laccase, a member of laccase family (17 members in Arabidopsis). Might be involved in cell wall biosynthesis. Mutants have a mild irregular xylem phenotype. |
| AT2G40140 | AT2G40140.1 | AACGACGTC | CZF1; FUNCTIONS IN: transcription factor activity; INVOLVED IN: defense response to fungus, response to cold, response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: SZF1 (SALT-INDUCIBLE ZINC FINGER 1); transcription factor (TAIR:AT3G55980.1); Has 847 Blast hits to 803 proteins in 134 species: Archae - 2; Bacteria - 35; Metazoa - 340; Fungi - 36; Plants - 230; Viruses - 2; Other Eukaryotes - 202 (source: NCBI BLink). |
| AT2G40140.2 | AACGACGTC | CZF1; FUNCTIONS IN: transcription factor activity; INVOLVED IN: defense response to fungus, response to cold, response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: SZF1 (SALT-INDUCIBLE ZINC FINGER 1); transcription factor (TAIR:AT3G55980.1); Has 847 Blast hits to 803 proteins in 134 species: Archae - 2; Bacteria - 35; Metazoa - 340; Fungi - 36; Plants - 230; Viruses - 2; Other Eukaryotes - 202 (source: NCBI BLink). |
| AT2G40420 | AT2G40420.1 | GACGTCGTT | Encodes a putative amino acid transporter. |
| AT2G42280 | AT2G42280.1 | AAAACGACGTC | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G51140.1); Has 932 Blast hits to 932 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 924; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G42280.2 | AAAACGACGTC | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G51140.1); Has 932 Blast hits to 932 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 924; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G43360 | AT2G43360.1 | ACGACGTC | Catalyzes the conversion of dethiobiotin to biotin. |
| AT2G43750 | AT2G43750.1 | GACGTCGTTTT | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasB, the key enzyme for fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. |
| AT2G43760 | AT2G43760.1 | AAAACGACGTC | molybdopterin biosynthesis MoaE family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: Mo-molybdopterin cofactor biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molybdopterin biosynthesis MoaE (InterPro:IPR003448); Has 3000 Blast hits to 3000 proteins in 933 species: Archae - 109; Bacteria - 1683; Metazoa - 112; Fungi - 47; Plants - 25; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink). |
| AT2G43760.2 | AAAACGACGTC | molybdopterin biosynthesis MoaE family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: Mo-molybdopterin cofactor biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molybdopterin biosynthesis MoaE (InterPro:IPR003448); Has 3000 Blast hits to 3000 proteins in 933 species: Archae - 109; Bacteria - 1683; Metazoa - 112; Fungi - 47; Plants - 25; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink). |
| AT2G43760.3 | AAAACGACGTC | molybdopterin biosynthesis MoaE family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: Mo-molybdopterin cofactor biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molybdopterin biosynthesis MoaE (InterPro:IPR003448); Has 3000 Blast hits to 3000 proteins in 933 species: Archae - 109; Bacteria - 1683; Metazoa - 112; Fungi - 47; Plants - 25; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink). |
| AT2G46900 | AT2G46900.1 | AAAACGACGTCGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix, Nulp1-type (InterPro:IPR006994); Has 3014 Blast hits to 2357 proteins in 239 species: Archae - 2; Bacteria - 96; Metazoa - 1166; Fungi - 321; Plants - 100; Viruses - 47; Other Eukaryotes - 1282 (source: NCBI BLink). |
| AT3G01450 | AT3G01450.1 | AAAACGACGTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G14790.1); Has 188 Blast hits to 188 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 97; Fungi - 6; Plants - 61; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT3G02080 | AT3G02080.1 | AAAACGACGTCATTT | 40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae - 134; Bacteria - 4; Metazoa - 345; Fungi - 96; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT3G02090 | AT3G02090.1 | AAATGACGTCGTTTT | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT3G02090.2 | AAATGACGTCGTTTT | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT3G03740 | AT3G03740.1 | AAACGACGTCGTT | BTB-POZ and MATH domain 4 (ATBPM4); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083), BTB/POZ fold (InterPro:IPR011333), BTB/POZ (InterPro:IPR013069), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: ATBPM5 (BTB-POZ and MATH domain 5); protein binding (TAIR:AT5G21010.1); Has 4765 Blast hits to 4690 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 3585; Fungi - 73; Plants - 877; Viruses - 41; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT3G05020 | AT3G05020.1 | AACGACGTC | encodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light. |
| AT3G06300 | AT3G06300.1 | AACGACGTCGTTTT | Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins. |
| AT3G07090 | AT3G07090.1 | TAAACGACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25170.1); Has 596 Blast hits to 596 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 84; Plants - 173; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT3G07320 | AT3G07320.1 | GACGTCGT | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT3G23770.1); Has 1745 Blast hits to 1692 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 1739; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G07330 | AT3G07330.1 | GACGACGTC | encodes a gene similar to cellulose synthase |
| AT3G07680 | AT3G07680.1 | GACGTCGTTTA | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 protein-related (TAIR:AT3G22845.1); Has 672 Blast hits to 672 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 151; Plants - 95; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). |
| AT3G09690 | AT3G09690.1 | AACGACGTC | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). |
| AT3G09690.2 | AACGACGTC | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). |
| AT3G11620 | AT3G11620.1 | AAAACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11620.2 | AAAACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11620.3 | AAAACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11620.4 | AAAACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT3G11630 | AT3G11630.1 | GACGTCGTTTT | Encodes a 2-Cys peroxiredoxin (2-Cys PrxA) that contains two catalytic Cys residues. |
| AT3G12260 | AT3G12260.1 | GAAACGACGTCGTC | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G13940 | AT3G13940.1 | GACGTCGTT | DNA binding / DNA-directed RNA polymerase; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase I associated factor, A49-like (InterPro:IPR009668); Has 150 Blast hits to 150 proteins in 69 species: Archae - 0; Bacteria - 1; Metazoa - 57; Fungi - 66; Plants - 15; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT3G15660 | AT3G15660.1 | ATGACACGACGTCGTT | GLUTAREDOXIN 4 (GRX4); FUNCTIONS IN: metal ion binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336), Glutaredoxin-related protein (InterPro:IPR004480); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT4G04950.1); Has 4103 Blast hits to 3965 proteins in 839 species: Archae - 12; Bacteria - 1387; Metazoa - 395; Fungi - 212; Plants - 231; Viruses - 0; Other Eukaryotes - 1866 (source: NCBI BLink). |
| AT3G15660.2 | ATGACACGACGTCGTT | GLUTAREDOXIN 4 (GRX4); FUNCTIONS IN: metal ion binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336), Glutaredoxin-related protein (InterPro:IPR004480); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT4G04950.1); Has 4103 Blast hits to 3965 proteins in 839 species: Archae - 12; Bacteria - 1387; Metazoa - 395; Fungi - 212; Plants - 231; Viruses - 0; Other Eukaryotes - 1866 (source: NCBI BLink). |
| AT3G17205 | AT3G17205.1 | AAAACGACGTC | UBIQUITIN PROTEIN LIGASE 6 (UPL6); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein modification process, protein ubiquitination; LOCATED IN: ubiquitin ligase complex, intracellular; CONTAINS InterPro DOMAIN/s: HECT (InterPro:IPR000569), IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: UPL7; ubiquitin-protein ligase (TAIR:AT3G53090.2); Has 3380 Blast hits to 3333 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 2123; Fungi - 505; Plants - 160; Viruses - 0; Other Eukaryotes - 592 (source: NCBI BLink). |
| AT3G17205.2 | AAAACGACGTC | UBIQUITIN PROTEIN LIGASE 6 (UPL6); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein modification process, protein ubiquitination; LOCATED IN: ubiquitin ligase complex, intracellular; CONTAINS InterPro DOMAIN/s: HECT (InterPro:IPR000569), IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: UPL7; ubiquitin-protein ligase (TAIR:AT3G53090.2); Has 3380 Blast hits to 3333 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 2123; Fungi - 505; Plants - 160; Viruses - 0; Other Eukaryotes - 592 (source: NCBI BLink). |
| AT3G20270 | AT3G20270.1 | GAAACGACGTCGTC | lipid-binding serum glycoprotein family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Bactericidal permeability-increasing protein, alpha/beta domain (InterPro:IPR017943), Lipid-binding serum glycoprotein, N-terminal (InterPro:IPR017942), Lipid-binding serum glycoprotein, C-terminal (InterPro:IPR001124); BEST Arabidopsis thaliana protein match is: lipid-binding serum glycoprotein family protein (TAIR:AT1G04970.1); Has 353 Blast hits to 347 proteins in 49 species: Archae - 2; Bacteria - 0; Metazoa - 298; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT3G25500 | AT3G25500.1 | GACGTCGTC | Poly-L-proline-containing (PLP) protein that form part of the signal-transduction cascade that leads to rearrangement of the actin cytoskeleton. AFH1 is a nonprocessive formin that moves from the barbered end to the side of an actin filament after the nucleation event. |
| AT3G25805 | AT3G25805.1 | AAAACGACGTCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 32 species: Archae - 0; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G27110 | AT3G27110.1 | GACGTCGT | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink). |
| AT3G27110.2 | GACGTCGT | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink). |
| AT3G27770 | AT3G27770.1 | GACGTCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G27770.2 | GACGTCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G32930 | AT3G32930.1 | AACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 50 Blast hits to 50 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G44750 | AT3G44750.1 | AACGACGTCGTT | Encodes a histone deacetylase. Controls the development of adaxial/abaxial leaf polarity. Two lines with RNAi-directed against this gene show reduced Agrobacterium-mediated DNA transformation of the roots. |
| AT3G46830 | AT3G46830.1 | GACGTCGTTTC | ARABIDOPSIS RAB GTPASE HOMOLOG A2C (ATRABA2C); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: endosome, plasma membrane, cell plate; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: ATRABA2D (HOARABIDOPSIS RAB GTPASE HOMOLOG A2D); GTP binding (TAIR:AT5G59150.1); Has 23118 Blast hits to 23078 proteins in 640 species: Archae - 19; Bacteria - 105; Metazoa - 12740; Fungi - 3037; Plants - 2133; Viruses - 19; Other Eukaryotes - 5065 (source: NCBI BLink). |
| AT3G47340 | AT3G47340.1 | GACGTCGT | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G47340.2 | GACGTCGT | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G47340.3 | GACGTCGT | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G49540 | AT3G49540.1 | GACGTCGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 8326 Blast hits to 4596 proteins in 687 species: Archae - 16; Bacteria - 1991; Metazoa - 1984; Fungi - 842; Plants - 266; Viruses - 74; Other Eukaryotes - 3153 (source: NCBI BLink). |
| AT3G52090 | AT3G52090.1 | AAAACGACGTCGT | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB11 and the E. oli RNA polymerase alpha subunit. |
| AT3G61670 | AT3G61670.1 | AAAACGACGTCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46380.1); Has 197 Blast hits to 162 proteins in 30 species: Archae - 0; Bacteria - 2; Metazoa - 13; Fungi - 15; Plants - 161; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G62260 | AT3G62260.1 | GACGTCGTT | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink). |
| AT3G62260.2 | GACGTCGTT | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink). |
| AT3G62600 | AT3G62600.1 | AACGACGTCGT | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. |
| AT4G00290 | AT4G00290.1 | AAAACGACGTC | mechanosensitive ion channel domain-containing protein / MS ion channel domain-containing protein; LOCATED IN: chloroplast, membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Mechanosensitive ion channel MscS, transmembrane-2 (InterPro:IPR011014), Mechanosensitive ion channel MscS (InterPro:IPR006685), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00234.1); Has 8044 Blast hits to 8044 proteins in 1230 species: Archae - 282; Bacteria - 5483; Metazoa - 2; Fungi - 2; Plants - 99; Viruses - 0; Other Eukaryotes - 2176 (source: NCBI BLink). |
| AT4G00335 | AT4G00335.1 | CTTAACCGACGTCGT | RHB1A; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G41350.1); Has 3768 Blast hits to 3762 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1338; Fungi - 286; Plants - 1392; Viruses - 4; Other Eukaryotes - 748 (source: NCBI BLink). |
| AT4G00335.2 | CTTAACCGACGTCGT | RHB1A; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G41350.1); Has 3768 Blast hits to 3762 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1338; Fungi - 286; Plants - 1392; Viruses - 4; Other Eukaryotes - 748 (source: NCBI BLink). |
| AT4G00335.3 | CTTAACCGACGTCGT | RHB1A; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G41350.1); Has 3768 Blast hits to 3762 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1338; Fungi - 286; Plants - 1392; Viruses - 4; Other Eukaryotes - 748 (source: NCBI BLink). |
| AT4G01810 | AT4G01810.1 | AACGACGTCGTTTC | protein transport protein-related; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular protein transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895); BEST Arabidopsis thaliana protein match is: transport protein, putative (TAIR:AT2G21630.1); Has 7526 Blast hits to 4938 proteins in 507 species: Archae - 16; Bacteria - 861; Metazoa - 2084; Fungi - 961; Plants - 2123; Viruses - 449; Other Eukaryotes - 1032 (source: NCBI BLink). |
| AT4G03120 | AT4G03120.1 | GAAACGACGTC | proline-rich family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, U1-C type (InterPro:IPR013085), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 34224 Blast hits to 17252 proteins in 759 species: Archae - 8; Bacteria - 3549; Metazoa - 17424; Fungi - 3540; Plants - 5278; Viruses - 776; Other Eukaryotes - 3649 (source: NCBI BLink). |
| AT4G03200 | AT4G03200.2 | AACGACGTCGTTTT | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF255 (InterPro:IPR004879), Thioredoxin fold (InterPro:IPR012335), Six-hairpin glycosidase-like (InterPro:IPR008928), Thioredoxin-like fold (InterPro:IPR012336); Has 2027 Blast hits to 2020 proteins in 379 species: Archae - 84; Bacteria - 613; Metazoa - 108; Fungi - 47; Plants - 17; Viruses - 0; Other Eukaryotes - 1158 (source: NCBI BLink). |
| AT4G03430 | AT4G03430.1 | AAACGACGTCGTTTA | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT4G04190 | AT4G04190.1 | TAAACGACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G04190.2 | TAAACGACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G04620 | AT4G04620.1 | ATCCAACGACGTCGT | autophagy 8b (ATG8B); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: APG8A (AUTOPHAGY 8A); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase (TAIR:AT4G21980.2); Has 1162 Blast hits to 1160 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 581; Fungi - 125; Plants - 172; Viruses - 3; Other Eukaryotes - 281 (source: NCBI BLink). |
| AT4G04620.2 | ATCCAACGACGTCGT | autophagy 8b (ATG8B); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: APG8A (AUTOPHAGY 8A); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase (TAIR:AT4G21980.2); Has 1162 Blast hits to 1160 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 581; Fungi - 125; Plants - 172; Viruses - 3; Other Eukaryotes - 281 (source: NCBI BLink). |
| AT4G05400 | AT4G05400.1 | AAAACGACGTCGTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21140.1); Has 31 Blast hits to 31 proteins in 12 species: Archae - 5; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G05400.2 | AAAACGACGTCGTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21140.1); Has 31 Blast hits to 31 proteins in 12 species: Archae - 5; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G09040 | AT4G09040.1 | AACGACGTCGTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). |
| AT4G09040.1 | AACGACGTCGTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). |
| AT4G09040.1 | TAAACGACGTC | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). |
| AT4G09040.2 | AACGACGTCGTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). |
| AT4G09040.2 | AACGACGTCGTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). |
| AT4G09040.2 | TAAACGACGTC | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). |
| AT4G10790 | AT4G10790.1 | AAAACGACGTCGT | UBX domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UAS (InterPro:IPR006577), UBX (InterPro:IPR001012); BEST Arabidopsis thaliana protein match is: SAY1 (TAIR:AT4G11740.1); Has 16384 Blast hits to 7928 proteins in 781 species: Archae - 7; Bacteria - 2234; Metazoa - 5947; Fungi - 1696; Plants - 733; Viruses - 184; Other Eukaryotes - 5583 (source: NCBI BLink). |
| AT4G10800 | AT4G10800.1 | ACGACGTCGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT3G05675.2); Has 114 Blast hits to 114 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G12700 | AT4G12700.1 | GACGTCGTTTTAGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G04280.1); Has 77 Blast hits to 77 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G13350 | AT4G13350.1 | GACGTCGTC | Encodes a GTPase that interacts with nuclear shuttle proteins (NSPs) from a number of different plant viruses. The gene is widely expressed and NIG transcript levels do not rise in response to viral infection. This cytoplasmic protein does not directly interact with a viral movement protein (MP), but, it does promote the movement of NSP from the nucleus to the cytoplasm. Overexpression of NIG in Arabidopsis plants renders them more sensitive to geminivirus infection. |
| AT4G13350.2 | GACGTCGTC | Encodes a GTPase that interacts with nuclear shuttle proteins (NSPs) from a number of different plant viruses. The gene is widely expressed and NIG transcript levels do not rise in response to viral infection. This cytoplasmic protein does not directly interact with a viral movement protein (MP), but, it does promote the movement of NSP from the nucleus to the cytoplasm. Overexpression of NIG in Arabidopsis plants renders them more sensitive to geminivirus infection. |
| AT4G14870 | AT4G14870.1 | GACGTCGTC | P-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecE subunit of protein translocation complex (InterPro:IPR005807); Has 24 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G14910 | AT4G14910.1 | ACGACGTCGTT | imidazoleglycerol-phosphate dehydratase, putative; FUNCTIONS IN: imidazoleglycerol-phosphate dehydratase activity; INVOLVED IN: histidine biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Imidazole glycerol-phosphate dehydratase (InterPro:IPR000807); BEST Arabidopsis thaliana protein match is: IGPD; imidazoleglycerol-phosphate dehydratase (TAIR:AT3G22425.2); Has 4921 Blast hits to 4919 proteins in 1283 species: Archae - 135; Bacteria - 2311; Metazoa - 2; Fungi - 152; Plants - 61; Viruses - 0; Other Eukaryotes - 2260 (source: NCBI BLink). |
| AT4G14910.2 | ACGACGTCGTT | imidazoleglycerol-phosphate dehydratase, putative; FUNCTIONS IN: imidazoleglycerol-phosphate dehydratase activity; INVOLVED IN: histidine biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Imidazole glycerol-phosphate dehydratase (InterPro:IPR000807); BEST Arabidopsis thaliana protein match is: IGPD; imidazoleglycerol-phosphate dehydratase (TAIR:AT3G22425.2); Has 4921 Blast hits to 4919 proteins in 1283 species: Archae - 135; Bacteria - 2311; Metazoa - 2; Fungi - 152; Plants - 61; Viruses - 0; Other Eukaryotes - 2260 (source: NCBI BLink). |
| AT4G15010 | AT4G15010.1 | AAAACGACGTCATTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT4G15010.2 | AAAACGACGTCATTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT4G15010.3 | AAAACGACGTCATTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). |
| AT4G15830 | AT4G15830.1 | GAAACGACGTCGT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT3G01450.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 5; Plants - 61; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT4G15840 | AT4G15840.1 | ACGACGTCGTTTC | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); Has 305 Blast hits to 303 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 12; Plants - 22; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT4G18040 | AT4G18040.1 | AAAACGACGTCGT | eIF4E protein. The cum1 mutation affects the local spreading of CMV within the inoculated leaf, delaying accumulation of cucumber mosaic virus coat protein. |
| AT4G23620 | AT4G23620.1 | GAAACGACGACGTCGTTTT | 50S ribosomal protein-related; FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L25 (InterPro:IPR001021), Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G66860.1); Has 2862 Blast hits to 2862 proteins in 613 species: Archae - 0; Bacteria - 1307; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1515 (source: NCBI BLink). |
| AT4G24644 | AT4G24644.1 | ACGACGTC | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT4G25290 | AT4G25290.1 | ACGACGTCGTTTTGA | DNA photolyase; FUNCTIONS IN: DNA photolyase activity; INVOLVED IN: DNA repair; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), DNA photolyase, N-terminal (InterPro:IPR006050), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G36530.2); Has 4147 Blast hits to 4144 proteins in 685 species: Archae - 35; Bacteria - 2248; Metazoa - 244; Fungi - 30; Plants - 260; Viruses - 0; Other Eukaryotes - 1330 (source: NCBI BLink). |
| AT4G25300 | AT4G25300.1 | TCAAAACGACGTCGT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G25310.1); Has 5835 Blast hits to 5806 proteins in 680 species: Archae - 0; Bacteria - 700; Metazoa - 111; Fungi - 623; Plants - 3093; Viruses - 0; Other Eukaryotes - 1308 (source: NCBI BLink). |
| AT4G25300.2 | TCAAAACGACGTCGT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G25310.1); Has 5835 Blast hits to 5806 proteins in 680 species: Archae - 0; Bacteria - 700; Metazoa - 111; Fungi - 623; Plants - 3093; Viruses - 0; Other Eukaryotes - 1308 (source: NCBI BLink). |
| AT4G26000 | AT4G26000.1 | AAAACGACGTCGT | Encodes a novel Arabidopsis gene encoding a polypeptide with K-homology (KH) RNA-binding modules, which acts on vegetative growth and pistil development. Genetic studies suggest that PEP interacts with element(s) of the CLAVATA signaling pathway. |
| AT4G26750 | AT4G26750.1 | GACGTCGTTTC | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF605 (InterPro:IPR006745); BEST Arabidopsis thaliana protein match is: ATGSL11 (glucan synthase-like 11); 1,3-beta-glucan synthase/ transferase, transferring glycosyl groups (TAIR:AT3G59100.1); Has 27093 Blast hits to 16071 proteins in 790 species: Archae - 16; Bacteria - 1458; Metazoa - 10297; Fungi - 5609; Plants - 4452; Viruses - 743; Other Eukaryotes - 4518 (source: NCBI BLink). |
| AT4G26900 | AT4G26900.1 | GAAACGACGTCGTT | encodes a glutamine amidotransferase and cyclase, catalyzes the fifth and sixth steps of the histidine biosynthetic pathway |
| AT4G27340 | AT4G27340.1 | GAAACGACGTCGTTTA | Met-10+ like family protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function Met10 (InterPro:IPR003402); BEST Arabidopsis thaliana protein match is: Met-10+ like family protein (TAIR:AT3G56120.1); Has 1006 Blast hits to 996 proteins in 336 species: Archae - 244; Bacteria - 250; Metazoa - 158; Fungi - 92; Plants - 67; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT4G28300 | AT4G28300.1 | AACGACGTCGTT | Encodes a protein with 13.6% proline amino acids that is predicted to localize to the cell wall. |
| AT4G28300.2 | AACGACGTCGTT | Encodes a protein with 13.6% proline amino acids that is predicted to localize to the cell wall. |
| AT4G29120 | AT4G29120.1 | AACCCGACGTCGTT | 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, phosphogluconate dehydrogenase (decarboxylating) activity, binding, catalytic activity; INVOLVED IN: pentose-phosphate shunt, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71180.1); Has 12459 Blast hits to 12442 proteins in 1308 species: Archae - 93; Bacteria - 6200; Metazoa - 393; Fungi - 342; Plants - 184; Viruses - 2; Other Eukaryotes - 5245 (source: NCBI BLink). |
| AT4G29480 | AT4G29480.1 | ACGACGTCGTT | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT2G19680.2); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G29490 | AT4G29490.1 | AACGACGTCGT | aminopeptidase/ manganese ion binding; FUNCTIONS IN: manganese ion binding, aminopeptidase activity; INVOLVED IN: cellular process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (InterPro:IPR007865), Peptidase M24, structural domain (InterPro:IPR000994); BEST Arabidopsis thaliana protein match is: metallopeptidase M24 family protein (TAIR:AT1G09300.2); Has 7096 Blast hits to 7089 proteins in 1383 species: Archae - 160; Bacteria - 3987; Metazoa - 333; Fungi - 234; Plants - 49; Viruses - 0; Other Eukaryotes - 2333 (source: NCBI BLink). |
| AT4G30260 | AT4G30260.1 | GAAACGACGTCGTTTA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT2G18840.1); Has 733 Blast hits to 718 proteins in 145 species: Archae - 0; Bacteria - 8; Metazoa - 377; Fungi - 147; Plants - 99; Viruses - 4; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT4G31450 | AT4G31450.1 | GACGTCGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G24870.2); Has 5333 Blast hits to 5244 proteins in 197 species: Archae - 0; Bacteria - 4; Metazoa - 1900; Fungi - 309; Plants - 2274; Viruses - 6; Other Eukaryotes - 840 (source: NCBI BLink). |
| AT4G32520 | AT4G32520.1 | GACGACGTCGTTTC | SERINE HYDROXYMETHYLTRANSFERASE 3 (SHM3); FUNCTIONS IN: pyridoxal phosphate binding, glycine hydroxymethyltransferase activity, catalytic activity; INVOLVED IN: glycine metabolic process, L-serine metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Glycine hydroxymethyltransferase (InterPro:IPR001085); BEST Arabidopsis thaliana protein match is: SHM1 (SERINE TRANSHYDROXYMETHYLTRANSFERASE 1); glycine hydroxymethyltransferase/ poly(U) binding (TAIR:AT4G37930.1); Has 8367 Blast hits to 8354 proteins in 1625 species: Archae - 143; Bacteria - 3516; Metazoa - 292; Fungi - 187; Plants - 212; Viruses - 6; Other Eukaryotes - 4011 (source: NCBI BLink). |
| AT4G32520.2 | GACGACGTCGTTTC | SERINE HYDROXYMETHYLTRANSFERASE 3 (SHM3); FUNCTIONS IN: pyridoxal phosphate binding, glycine hydroxymethyltransferase activity, catalytic activity; INVOLVED IN: glycine metabolic process, L-serine metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421), Glycine hydroxymethyltransferase (InterPro:IPR001085); BEST Arabidopsis thaliana protein match is: SHM1 (SERINE TRANSHYDROXYMETHYLTRANSFERASE 1); glycine hydroxymethyltransferase/ poly(U) binding (TAIR:AT4G37930.1); Has 8367 Blast hits to 8354 proteins in 1625 species: Archae - 143; Bacteria - 3516; Metazoa - 292; Fungi - 187; Plants - 212; Viruses - 6; Other Eukaryotes - 4011 (source: NCBI BLink). |
| AT4G32840 | AT4G32840.1 | AAAACGACGTC | PHOSPHOFRUCTOKINASE 6 (PFK6); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: cytosol, 6-phosphofructokinase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK1 (PHOSPHOFRUCTOKINASE 1); 6-phosphofructokinase (TAIR:AT4G29220.1); Has 4932 Blast hits to 4525 proteins in 1180 species: Archae - 20; Bacteria - 2587; Metazoa - 575; Fungi - 273; Plants - 227; Viruses - 2; Other Eukaryotes - 1248 (source: NCBI BLink). |
| AT4G32960 | AT4G32960.1 | TAAACGACGACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32970.1); Has 78 Blast hits to 78 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G33100 | AT4G33100.1 | GAAACGACGTCGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial distribution and morphology family 35/apoptosis (InterPro:IPR007918); Has 160 Blast hits to 160 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 46; Plants - 13; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT4G34135 | AT4G34135.1 | AACGACGTC | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position. |
| AT4G34135.2 | AACGACGTC | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position. |
| AT4G34412 | AT4G34412.1 | GACGTCGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Kinase binding protein CGI-121 (InterPro:IPR013926); Has 194 Blast hits to 194 proteins in 96 species: Archae - 0; Bacteria - 4; Metazoa - 78; Fungi - 77; Plants - 19; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT4G37820 | AT4G37820.1 | AAATGACGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G22795.1); Has 363989 Blast hits to 137148 proteins in 2858 species: Archae - 1191; Bacteria - 38325; Metazoa - 151130; Fungi - 38393; Plants - 14217; Viruses - 2059; Other Eukaryotes - 118674 (source: NCBI BLink). |
| AT5G02270 | AT5G02270.1 | AACGACGTCGTC | member of NAP subfamily |
| AT5G02280 | AT5G02280.1 | GACGACGTCGTT | synbindin, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: cis-Golgi network; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sybindin-like protein (InterPro:IPR007233), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: synbindin, putative (TAIR:AT1G51160.2); Has 419 Blast hits to 413 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 194; Fungi - 100; Plants - 56; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT5G02502 | AT5G02502.1 | AAAACGACGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12587.1); Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G06600 | AT5G06600.1 | ACGACGTC | Encodes a ubiquitin-specific protease. |
| AT5G06600.2 | ACGACGTC | Encodes a ubiquitin-specific protease. |
| AT5G06600.3 | ACGACGTC | Encodes a ubiquitin-specific protease. |
| AT5G06660 | AT5G06660.1 | TCAAAACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF841, eukaryotic (InterPro:IPR008559); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12030.1); Has 193 Blast hits to 193 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT5G07000 | AT5G07000.1 | GACGTCGTTTT | Encodes a member of the sulfotransferase family of proteins. Although it has 85% amino acid identity with ST2A (At5g07010), this protein is not able to transfer a sulfate group to 11- or 12-hydroxyjasmonic acid in vitro. It may be able to act on structurally related jasmonates. |
| AT5G08139 | AT5G08139.1 | GACGTCGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G60820.1); Has 6373 Blast hits to 6323 proteins in 223 species: Archae - 2; Bacteria - 19; Metazoa - 2188; Fungi - 476; Plants - 2447; Viruses - 45; Other Eukaryotes - 1196 (source: NCBI BLink). |
| AT5G09230 | AT5G09230.1 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.2 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.3 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.4 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.5 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.6 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09230.7 | AACGACGTCGTTT | Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230). |
| AT5G09310 | AT5G09310.1 | ACGTGGAAACGACGTCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 124 Blast hits to 124 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G09370 | AT5G09370.1 | GACGTCGTC | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: anchored to membrane; EXPRESSED IN: embryo, sepal, pedicel, pollen tube; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein/Par allergen (InterPro:IPR000528), Plant lipid transfer protein and hydrophobic protein, helical (InterPro:IPR013770); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G64080.2); Has 583 Blast hits to 579 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 583; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G09370.2 | GACGTCGTC | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: anchored to membrane; EXPRESSED IN: embryo, sepal, pedicel, pollen tube; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein/Par allergen (InterPro:IPR000528), Plant lipid transfer protein and hydrophobic protein, helical (InterPro:IPR013770); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G64080.2); Has 583 Blast hits to 579 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 583; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G09590 | AT5G09590.1 | TAAACGACGTCGTTTC | heat shock protein 70 (Hsc70-5); nuclear |
| AT5G10350 | AT5G10350.1 | GACGACGTCGTT | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). |
| AT5G10350.2 | GACGACGTCGTT | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). |
| AT5G10650 | AT5G10650.1 | GACGACGTC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G24870.2); Has 8469 Blast hits to 6498 proteins in 243 species: Archae - 0; Bacteria - 110; Metazoa - 2635; Fungi - 536; Plants - 2504; Viruses - 44; Other Eukaryotes - 2640 (source: NCBI BLink). |
| AT5G10650.2 | GACGACGTC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G24870.2); Has 8469 Blast hits to 6498 proteins in 243 species: Archae - 0; Bacteria - 110; Metazoa - 2635; Fungi - 536; Plants - 2504; Viruses - 44; Other Eukaryotes - 2640 (source: NCBI BLink). |
| AT5G11270 | AT5G11270.1 | TAAACGACGTCGTTTA | Encodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance. |
| AT5G11280 | AT5G11280.1 | TAAACGACGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80200.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G11630 | AT5G11630.1 | GACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.1); Has 60 Blast hits to 60 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G11630.2 | GACGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.1); Has 60 Blast hits to 60 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G13300 | AT5G13300.1 | GAAACGACGTCGT | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. |
| AT5G15400 | AT5G15400.1 | TAAACGACGTCGTT | U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 761 Blast hits to 744 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 440; Fungi - 133; Plants - 86; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT5G17270 | AT5G17270.1 | AAACGACGTCGTT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G37130.1); Has 5379 Blast hits to 3587 proteins in 480 species: Archae - 397; Bacteria - 1752; Metazoa - 604; Fungi - 281; Plants - 148; Viruses - 0; Other Eukaryotes - 2197 (source: NCBI BLink). |
| AT5G18540 | AT5G18540.1 | GACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; Has 2276 Blast hits to 850 proteins in 109 species: Archae - 2; Bacteria - 9; Metazoa - 1490; Fungi - 256; Plants - 238; Viruses - 0; Other Eukaryotes - 281 (source: NCBI BLink). |
| AT5G18540.2 | GACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; Has 2276 Blast hits to 850 proteins in 109 species: Archae - 2; Bacteria - 9; Metazoa - 1490; Fungi - 256; Plants - 238; Viruses - 0; Other Eukaryotes - 281 (source: NCBI BLink). |
| AT5G20120 | AT5G20120.1 | AAAACGACGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 36 Blast hits to 36 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT5G22070 | AT5G22070.1 | GACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52060.2); Has 333 Blast hits to 332 proteins in 16 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT5G27120 | AT5G27120.1 | ACGACGTCGTTTA | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein |
| AT5G27460 | AT5G27460.1 | ACGACGTC | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02150.1); Has 3781 Blast hits to 2103 proteins in 60 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 13; Plants - 3697; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G27470 | AT5G27470.1 | GACGTCGT | seryl-tRNA synthetase / serine--tRNA ligase; FUNCTIONS IN: serine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, seryl-tRNA aminoacylation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: tRNA-binding arm (InterPro:IPR010978), Seryl-tRNA synthetase, class IIa, N-terminal (InterPro:IPR015866), Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Seryl-tRNA synthetase, class IIa (InterPro:IPR002317), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Seryl-tRNA synthetase, class IIa, C-terminal (InterPro:IPR018156); BEST Arabidopsis thaliana protein match is: SRS (SERYL-TRNA SYNTHETASE); serine-tRNA ligase (TAIR:AT1G11870.2); Has 7169 Blast hits to 7168 proteins in 1635 species: Archae - 140; Bacteria - 3036; Metazoa - 295; Fungi - 180; Plants - 68; Viruses - 0; Other Eukaryotes - 3450 (source: NCBI BLink). |
| AT5G27640 | AT5G27640.1 | GACGTCGT | encodes a member of eukaryotic translation initiation factor 3B family. |
| AT5G27640.2 | GACGTCGT | encodes a member of eukaryotic translation initiation factor 3B family. |
| AT5G27650 | AT5G27650.1 | ACGACGTC | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G05430.1); Has 6970 Blast hits to 4442 proteins in 299 species: Archae - 10; Bacteria - 363; Metazoa - 3592; Fungi - 627; Plants - 302; Viruses - 141; Other Eukaryotes - 1935 (source: NCBI BLink). |
| AT5G39570 | AT5G39570.1 | AACGACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G41190 | AT5G41190.1 | GACGTCGTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nin one binding (NOB1) Zn-ribbon like (InterPro:IPR014881), D-site 20S pre-rRNA nuclease (InterPro:IPR017117); Has 855 Blast hits to 653 proteins in 196 species: Archae - 53; Bacteria - 16; Metazoa - 335; Fungi - 168; Plants - 29; Viruses - 10; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT5G42765 | AT5G42765.1 | GACGTCGTTTT | INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Twin-arginine translocation pathway signal (InterPro:IPR006311); Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G47690 | AT5G47690.1 | TCAAAACGACGTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47690.2 | TCAAAACGACGTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47690.3 | TCAAAACGACGTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G51720 | AT5G51720.1 | ACGACGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 215 Blast hits to 215 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G55300 | AT5G55300.1 | ACGACGTCGT | Encodes a type-I DNA topoisomerase I. Disruptions in this gene affect phyllotaxis and plant architecture suggesting that the gene plays a critical role in the maintenance of a regular pattern of organ initiation. Isolated as a protein oxidized during seed germination; proteomics approach revealed differences in de novo synthesis levels of this protein in condition with vs. without salicylic acid in the period from 0 to 40 hrs. following seed imbibition. |
| AT5G55310 | AT5G55310.1 | TAAACGACGTC | Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality. |
| AT5G56160 | AT5G56160.1 | AAAACGACGTC | transporter; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G55690.2); Has 1407 Blast hits to 1405 proteins in 173 species: Archae - 3; Bacteria - 0; Metazoa - 460; Fungi - 292; Plants - 404; Viruses - 0; Other Eukaryotes - 248 (source: NCBI BLink). |
| AT5G56160.1 | AAAACGACGTC | transporter; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G55690.2); Has 1407 Blast hits to 1405 proteins in 173 species: Archae - 3; Bacteria - 0; Metazoa - 460; Fungi - 292; Plants - 404; Viruses - 0; Other Eukaryotes - 248 (source: NCBI BLink). |
| AT5G57460 | AT5G57460.1 | AAACGACGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to 121 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G58340 | AT5G58340.1 | GACGTCGTTTT | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: TRFL5 (TRF-LIKE 5); DNA binding / transcription factor (TAIR:AT1G15720.1); Has 281 Blast hits to 279 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 51; Fungi - 13; Plants - 202; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT5G58570 | AT5G58570.1 | AAAACGACGTC | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G59920 | AT5G59920.1 | ACGACGTC | Isolated in a screen for UV-B insensitive mutants using a hypocotyl growth inhibition assay. Mutants are defective in a number of UV-B responses. |
| AT5G62770 | AT5G62770.1 | GACGTCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G27880.1); Has 113 Blast hits to 113 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 2; Plants - 101; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G63200 | AT5G63200.1 | GACGACGTC | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: SEC (secret agent); transferase, transferring glycosyl groups (TAIR:AT3G04240.1); Has 14546 Blast hits to 7662 proteins in 724 species: Archae - 553; Bacteria - 5441; Metazoa - 2275; Fungi - 367; Plants - 302; Viruses - 0; Other Eukaryotes - 5608 (source: NCBI BLink). |
| AT5G63870 | AT5G63870.1 | GACGTCGTTT | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G63870.2 | GACGTCGTTT | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G63870.3 | GACGTCGTTT | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G64050 | AT5G64050.1 | GACGACGTCGTT | Glutamate-tRNA ligase. Targeted to mitochondria and chloroplast. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
| AT5G65005 | AT5G65005.1 | GACGTCGTTTT | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT1G52990.1). |
| AT5G65430 | AT5G65430.1 | AACGACGTCGTTTA | member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT5G65430.2 | AACGACGTCGTTTA | member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT5G67210 | AT5G67210.1 | GACGTCGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF579, plant (InterPro:IPR006514); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50220.1); Has 161 Blast hits to 161 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 152; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| ATCG00330 | ATCG00330.1 | AACGACGTC | 30S chloroplast ribosomal protein S14 |
| ATMG01370 | ATMG01370.1 | GACGACGTC | hypothetical protein |