version

Summary of AtREG436 (All List)

OrganismArabidopsis thaliana  
IDAtREG436  
SequenceAAACCGGT  
Annotation  
PPDB MotifAACCG(G/A)  overlapping GT1 box  
PLACE Motif 
Total Entry Count518  

Entry Sequences (518 entries)

LocusGene modelSequenceDescription
AT1G02500AT1G02500.1ATAAACCGGTencodes a S-adenosylmethionine synthetase. SAM1 is regulated by protein S-nitrosylation. The covalent binding of nitric oxide (NO) to the Cys114 residue inhibits the enzyme activity. 
AT1G02500.2ATAAACCGGTencodes a S-adenosylmethionine synthetase. SAM1 is regulated by protein S-nitrosylation. The covalent binding of nitric oxide (NO) to the Cys114 residue inhibits the enzyme activity. 
AT1G02870AT1G02870.1GACCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 46; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G04130AT1G04130.1TTAAACCGGTtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase-related (TAIR:AT1G56440.1); Has 3930 Blast hits to 3426 proteins in 259 species: Archae - 8; Bacteria - 133; Metazoa - 1878; Fungi - 572; Plants - 573; Viruses - 0; Other Eukaryotes - 766 (source: NCBI BLink). 
AT1G04690AT1G04690.1CCAAACCGGTPOTASSIUM CHANNEL BETA SUBUNIT (KAB1); FUNCTIONS IN: oxidoreductase activity, potassium channel activity; INVOLVED IN: oxidation reduction, potassium ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Potassium channel, voltage-dependent, beta subunit, KCNAB-related (InterPro:IPR005399); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G60690.1); Has 17446 Blast hits to 17422 proteins in 1383 species: Archae - 314; Bacteria - 9995; Metazoa - 800; Fungi - 1248; Plants - 507; Viruses - 0; Other Eukaryotes - 4582 (source: NCBI BLink). 
AT1G05090AT1G05090.1GTAAACCGGTTTdentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte; EXPRESSED DURING: L mature pollen stage; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT4G20720.1); Has 3317 Blast hits to 1175 proteins in 175 species: Archae - 2; Bacteria - 2415; Metazoa - 347; Fungi - 137; Plants - 84; Viruses - 1; Other Eukaryotes - 331 (source: NCBI BLink). 
AT1G05360AT1G05360.1GAACCGGTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT1G06010AT1G06010.1ACCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G06510AT1G06510.1ACCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 293 Blast hits to 288 proteins in 116 species: Archae - 4; Bacteria - 87; Metazoa - 85; Fungi - 34; Plants - 11; Viruses - 2; Other Eukaryotes - 70 (source: NCBI BLink). 
AT1G06515AT1G06515.1CTAAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30942.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 10; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G07280AT1G07280.1ACCGGTTTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT2G29670.1); Has 381 Blast hits to 218 proteins in 33 species: Archae - 4; Bacteria - 98; Metazoa - 1; Fungi - 2; Plants - 229; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT1G07280.2ACCGGTTTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT2G29670.1); Has 381 Blast hits to 218 proteins in 33 species: Archae - 4; Bacteria - 98; Metazoa - 1; Fungi - 2; Plants - 229; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT1G07280.3ACCGGTTTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT2G29670.1); Has 381 Blast hits to 218 proteins in 33 species: Archae - 4; Bacteria - 98; Metazoa - 1; Fungi - 2; Plants - 229; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT1G07510AT1G07510.1CTAAACCGGTencodes an FtsH protease that is localized to the mitochondrion 
AT1G08110AT1G08110.1AAAACCGGTlactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). 
AT1G08110.2AAAACCGGTlactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). 
AT1G08110.3AAAACCGGTlactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). 
AT1G08110.4AAAACCGGTlactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). 
AT1G08490AT1G08490.1TTTAACCGGTTTGChloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation. 
AT1G08840AT1G08840.1ACCGGTTTTembryo defective 2411 (emb2411); FUNCTIONS IN: ATP-dependent DNA helicase activity, DNA binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, DNA replication; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA replication factor Dna2 (InterPro:IPR014808); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G03270.1); Has 4081 Blast hits to 3639 proteins in 571 species: Archae - 158; Bacteria - 979; Metazoa - 1088; Fungi - 747; Plants - 269; Viruses - 30; Other Eukaryotes - 810 (source: NCBI BLink). 
AT1G08845AT1G08845.1AAAACCGGTstructural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: endomembrane system, ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT3G22450.1). 
AT1G10230AT1G10230.1CAAACCGGTTCARABIDOPSIS SKP1-LIKE 18 (ASK18); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: ASK15 (ARABIDOPSIS SKP1-LIKE 15); protein binding / ubiquitin-protein ligase (TAIR:AT3G25650.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 473; Fungi - 107; Plants - 362; Viruses - 11; Other Eukaryotes - 133 (source: NCBI BLink). 
AT1G10490AT1G10490.1CAAACCGGTCunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1726 (InterPro:IPR013562), Protein of unknown function DUF699, ATPase putative (InterPro:IPR007807); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57940.1); Has 887 Blast hits to 850 proteins in 389 species: Archae - 76; Bacteria - 411; Metazoa - 160; Fungi - 89; Plants - 21; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). 
AT1G10590AT1G10590.1TGAACCGGTTTDNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G10590.2TGAACCGGTTTDNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G10590.3TGAACCGGTTTDNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G11545AT1G11545.1ATAAACCGGTCGGCTTTTAxyloglucan:xyloglucosyl transferase, putative / xyloglucan endotransglycosylase, putative / endo-xyloglucan transferase, putative; FUNCTIONS IN: hydrolase activity, acting on glycosyl bonds, xyloglucan:xyloglucosyl transferase activity, hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process, cellular glucan metabolic process; LOCATED IN: endomembrane system, cell wall, apoplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Xyloglucan endotransglucosylase/hydrolase (InterPro:IPR016455), Beta-glucanase (InterPro:IPR008264), Xyloglucan endo-transglycosylase, C-terminal (InterPro:IPR010713), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Glycoside hydrolase, family 16, active site (InterPro:IPR008263), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Glycoside hydrolase, family 16 (InterPro:IPR000757); BEST Arabidopsis thaliana protein match is: xyloglucan:xyloglucosyl transferase, putative / xyloglucan endotransglycosylase, putative / endo-xyloglucan transferase, putative (TAIR:AT5G65730.1); Has 1331 Blast hits to 1325 proteins in 205 species: Archae - 0; Bacteria - 180; Metazoa - 0; Fungi - 272; Plants - 798; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink). 
AT1G11630AT1G11630.1CTAAACCGGTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PPR336 (pentatricopeptide repeat 336) (TAIR:AT1G61870.1); Has 12390 Blast hits to 3643 proteins in 147 species: Archae - 4; Bacteria - 8; Metazoa - 197; Fungi - 174; Plants - 11635; Viruses - 0; Other Eukaryotes - 372 (source: NCBI BLink). 
AT1G12244AT1G12244.1ACCGGTTTACDNA binding / hydrolase, acting on ester bonds / nuclease/ nucleic acid binding / recombinase; FUNCTIONS IN: hydrolase activity, acting on ester bonds, recombinase activity, DNA binding, nuclease activity, nucleic acid binding; INVOLVED IN: DNA repair, nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, DNA recombination, response to DNA damage stimulus; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Resolvase, RNase H-like fold (InterPro:IPR006641), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Resolvase, holliday junction-type, YqgF-like (InterPro:IPR005227); Has 2009 Blast hits to 2009 proteins in 796 species: Archae - 0; Bacteria - 1622; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 372 (source: NCBI BLink). 
AT1G12450AT1G12450.1ACGACACCGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22850.1); Has 1233 Blast hits to 1230 proteins in 347 species: Archae - 2; Bacteria - 557; Metazoa - 104; Fungi - 72; Plants - 132; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink). 
AT1G12640AT1G12640.1GACCGGTTTATmembrane bound O-acyl transferase (MBOAT) family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane bound O-acyl transferase, MBOAT (InterPro:IPR004299); BEST Arabidopsis thaliana protein match is: membrane bound O-acyl transferase (MBOAT) family protein (TAIR:AT1G63050.1); Has 864 Blast hits to 862 proteins in 168 species: Archae - 0; Bacteria - 109; Metazoa - 536; Fungi - 94; Plants - 27; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). 
AT1G12650AT1G12650.1ATAAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF947 (InterPro:IPR009292); Has 600 Blast hits to 528 proteins in 139 species: Archae - 0; Bacteria - 24; Metazoa - 132; Fungi - 115; Plants - 36; Viruses - 0; Other Eukaryotes - 293 (source: NCBI BLink). 
AT1G12650.2ATAAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF947 (InterPro:IPR009292); Has 600 Blast hits to 528 proteins in 139 species: Archae - 0; Bacteria - 24; Metazoa - 132; Fungi - 115; Plants - 36; Viruses - 0; Other Eukaryotes - 293 (source: NCBI BLink). 
AT1G12650.3ATAAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF947 (InterPro:IPR009292); Has 600 Blast hits to 528 proteins in 139 species: Archae - 0; Bacteria - 24; Metazoa - 132; Fungi - 115; Plants - 36; Viruses - 0; Other Eukaryotes - 293 (source: NCBI BLink). 
AT1G12650.4ATAAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF947 (InterPro:IPR009292); Has 600 Blast hits to 528 proteins in 139 species: Archae - 0; Bacteria - 24; Metazoa - 132; Fungi - 115; Plants - 36; Viruses - 0; Other Eukaryotes - 293 (source: NCBI BLink). 
AT1G12680AT1G12680.1ATAAACCGGTTTPhosphoenolpyruvate carboxylase-related kinase 2 (PEPKR2); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CPK29; ATP binding / calcium ion binding / calmodulin-dependent protein kinase/ kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT1G76040.2); Has 92906 Blast hits to 91377 proteins in 2552 species: Archae - 77; Bacteria - 8548; Metazoa - 39331; Fungi - 8639; Plants - 17815; Viruses - 501; Other Eukaryotes - 17995 (source: NCBI BLink). 
AT1G12770AT1G12770.1ACCGGTTTATembryo defective 1586 (EMB1586); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; INVOLVED IN: embryonic development ending in seed dormancy; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative (TAIR:AT3G19760.1); Has 25549 Blast hits to 25020 proteins in 1695 species: Archae - 449; Bacteria - 9955; Metazoa - 4809; Fungi - 3113; Plants - 1343; Viruses - 12; Other Eukaryotes - 5868 (source: NCBI BLink). 
AT1G12830AT1G12830.1CAAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 39113 Blast hits to 20367 proteins in 821 species: Archae - 97; Bacteria - 5453; Metazoa - 15540; Fungi - 5514; Plants - 1861; Viruses - 608; Other Eukaryotes - 10040 (source: NCBI BLink). 
AT1G12840AT1G12840.1ACCGGTTTGEncodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. 
AT1G13480AT1G13480.1AAAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1262 (InterPro:IPR010683); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13520.1); Has 67 Blast hits to 63 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G13870AT1G13870.1TTAAACCGGTTCEncodes a homolog of the yeast TOT4/KTI12 protein. Yeast TOT4/KTI12 associates with Elongator, a multisubunit complex that binds the RNA polymerase II transcription elongation complex. Ds insertion mutant has enlarged shoot apical region, 4 to 6 long slender leaves followed by spike-like structures, short roots. 
AT1G14230AT1G14230.1GTAAACCGGTCCGGTTCAnucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1089 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 22; Metazoa - 528; Fungi - 214; Plants - 198; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink). 
AT1G14680AT1G14680.1GACCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09060.1); Has 7013 Blast hits to 5372 proteins in 466 species: Archae - 108; Bacteria - 388; Metazoa - 3676; Fungi - 303; Plants - 203; Viruses - 23; Other Eukaryotes - 2312 (source: NCBI BLink). 
AT1G14940AT1G14940.1AAAACCGGTCmajor latex protein-related / MLP-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: major latex protein-related / MLP-related (TAIR:AT1G14930.1); Has 223 Blast hits to 201 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 223; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G16700AT1G16700.1ATAACCGGTTTGNADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY) (TAIR:AT1G79010.1); Has 7775 Blast hits to 7384 proteins in 1556 species: Archae - 918; Bacteria - 3928; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink). 
AT1G17360AT1G17360.1CCAAACCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 8834 Blast hits to 6495 proteins in 406 species: Archae - 8; Bacteria - 626; Metazoa - 3389; Fungi - 793; Plants - 257; Viruses - 52; Other Eukaryotes - 3709 (source: NCBI BLink). 
AT1G17790AT1G17790.1ACCGGTTTGGDNA-binding bromodomain-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: GTE3 (GLOBAL TRANSCRIPTION FACTOR GROUP E 3); DNA binding / histone binding (TAIR:AT1G73150.1); Has 10421 Blast hits to 6039 proteins in 444 species: Archae - 16; Bacteria - 924; Metazoa - 4753; Fungi - 937; Plants - 711; Viruses - 164; Other Eukaryotes - 2916 (source: NCBI BLink). 
AT1G19170AT1G19170.1ACCGGTTTGGglycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT3G42950.1); Has 2514 Blast hits to 2510 proteins in 316 species: Archae - 2; Bacteria - 602; Metazoa - 8; Fungi - 955; Plants - 840; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT1G19170.1CTAAACCGGTglycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT3G42950.1); Has 2514 Blast hits to 2510 proteins in 316 species: Archae - 2; Bacteria - 602; Metazoa - 8; Fungi - 955; Plants - 840; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT1G19330AT1G19330.1AAAACCGGTTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75060.1); Has 85 Blast hits to 85 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 32; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G19330.2AAAACCGGTTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75060.1); Has 85 Blast hits to 85 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 32; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G19990AT1G19990.1TTTAACCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11600.1); Has 10416 Blast hits to 6328 proteins in 368 species: Archae - 4; Bacteria - 381; Metazoa - 4559; Fungi - 839; Plants - 384; Viruses - 34; Other Eukaryotes - 4215 (source: NCBI BLink). 
AT1G20220AT1G20220.1TTTAACCGGTTTAAnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G76010.1); Has 42345 Blast hits to 16680 proteins in 1015 species: Archae - 19; Bacteria - 12355; Metazoa - 15425; Fungi - 3233; Plants - 4676; Viruses - 581; Other Eukaryotes - 6056 (source: NCBI BLink). 
AT1G20770AT1G20770.1ATAACCGGTTTGACCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G20780AT1G20780.1TTCGGGTCAAACCGGTTATEncodes a protein containing a U-box and an ARM domain. 
AT1G21700AT1G21700.1TTAAACCGGTTTAAa member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003). 
AT1G21710AT1G21710.1TTAAACCGGTTTEncodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme. 
AT1G21770AT1G21770.1TTAAACCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: H3/H4 histone acetyltransferase (TAIR:AT1G77540.1); Has 221 Blast hits to 221 proteins in 107 species: Archae - 4; Bacteria - 182; Metazoa - 4; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G21780AT1G21780.1GTAAACCGGTTTAABTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B. 
AT1G21780.2GTAAACCGGTTTAABTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B. 
AT1G21840AT1G21840.1CAAACCGGTCEncodes a urease accessory protein which is essential for the activation of plant urease. 
AT1G22310AT1G22310.1ATAACCGGTTTAAProtein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. 
AT1G22310.2ATAACCGGTTTAAProtein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. 
AT1G22920AT1G22920.1CAAACCGGTTTAAAJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. 
AT1G22920.2CAAACCGGTTTAAAJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. 
AT1G22960AT1G22960.1GTAAACCGGTpentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 24639 Blast hits to 6022 proteins in 188 species: Archae - 4; Bacteria - 28; Metazoa - 847; Fungi - 689; Plants - 21875; Viruses - 0; Other Eukaryotes - 1196 (source: NCBI BLink). 
AT1G27100AT1G27100.1ATAACCGGATACCGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF569 (InterPro:IPR007679), Actin_cross-linking (InterPro:IPR008999); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69900.1); Has 184 Blast hits to 118 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 8; Plants - 166; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G27650AT1G27650.1ATAAACCGGTCU2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions. 
AT1G27650.2ATAAACCGGTCU2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions. 
AT1G27695AT1G27695.1TTAAACCGGTTCGglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 5231 Blast hits to 841 proteins in 144 species: Archae - 32; Bacteria - 309; Metazoa - 3238; Fungi - 61; Plants - 1195; Viruses - 55; Other Eukaryotes - 341 (source: NCBI BLink). 
AT1G27695.2TTAAACCGGTTCGglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 5231 Blast hits to 841 proteins in 144 species: Archae - 32; Bacteria - 309; Metazoa - 3238; Fungi - 61; Plants - 1195; Viruses - 55; Other Eukaryotes - 341 (source: NCBI BLink). 
AT1G27700AT1G27700.1GACCGGTTTATprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: Golgi vesicle transport, vesicle-mediated transport; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: t-SNARE (InterPro:IPR010989), Syntaxin 6, N-terminal (InterPro:IPR015260); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT4G30240.1); Has 64 Blast hits to 63 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G28250AT1G28250.1AAACCGGAATATACCGGTTTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 10 Blast hits to 10 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G30230AT1G30230.1CTTAACCGGTTTATelongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). 
AT1G30230.2CTTAACCGGTTTATelongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). 
AT1G30550AT1G30550.2CCAAACCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: WW domain-containing protein (TAIR:AT1G45231.2); Has 891 Blast hits to 591 proteins in 275 species: Archae - 68; Bacteria - 248; Metazoa - 211; Fungi - 176; Plants - 45; Viruses - 3; Other Eukaryotes - 140 (source: NCBI BLink). 
AT1G30580AT1G30580.1TTAAACCGGTCGTP binding; FUNCTIONS IN: GTP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF933 (InterPro:IPR013029), TGS-like (InterPro:IPR012676), GTP1/OBG (InterPro:IPR006073), Conserved hypothetical protein CHP00092 (InterPro:IPR004396), GTP-binding protein, HSR1-related (InterPro:IPR002917), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G56050.1); Has 12592 Blast hits to 12588 proteins in 1581 species: Archae - 216; Bacteria - 5420; Metazoa - 582; Fungi - 410; Plants - 148; Viruses - 0; Other Eukaryotes - 5816 (source: NCBI BLink). 
AT1G30750AT1G30750.1GAACCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root, pollen tube; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1720 (InterPro:IPR013182); Has 1056 Blast hits to 518 proteins in 153 species: Archae - 0; Bacteria - 268; Metazoa - 168; Fungi - 142; Plants - 17; Viruses - 16; Other Eukaryotes - 445 (source: NCBI BLink). 
AT1G31240AT1G31240.1TGGGCTCAAACCGGTCDNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Bromodomain transcription factor (InterPro:IPR006565); BEST Arabidopsis thaliana protein match is: TAF8 (TBP-ASSOCIATED FACTOR 8); DNA binding (TAIR:AT4G34340.1); Has 104 Blast hits to 104 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G31420AT1G31420.1CAAACCGGTTCAAEncodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. 
AT1G31460AT1G31460.1CCAAACCGGTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23270.1); Has 1177 Blast hits to 701 proteins in 148 species: Archae - 0; Bacteria - 210; Metazoa - 433; Fungi - 158; Plants - 37; Viruses - 17; Other Eukaryotes - 322 (source: NCBI BLink). 
AT1G31580AT1G31580.1AAACCGGTEncodes cell wall protein. ECS1 is not a Xcc750 resistance gene, but the genetic data indicate that ECS1 is linked to a locus influencing resistance to Xcc750. 
AT1G33265AT1G33265.1TAACCGGTTTGGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); Has 119 Blast hits to 119 proteins in 43 species: Archae - 0; Bacteria - 27; Metazoa - 33; Fungi - 2; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G33400AT1G33400.1ACCGGTTTATtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), SET (InterPro:IPR001214), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 5453 Blast hits to 4652 proteins in 333 species: Archae - 109; Bacteria - 690; Metazoa - 2585; Fungi - 539; Plants - 720; Viruses - 0; Other Eukaryotes - 810 (source: NCBI BLink). 
AT1G35516AT1G35516.1ACCGGTTTGCONTAINS InterPro DOMAIN/s: Myb transcription factor (InterPro:IPR015495); Has 12 Blast hits to 12 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G35516.1ACCGGTTTTCONTAINS InterPro DOMAIN/s: Myb transcription factor (InterPro:IPR015495); Has 12 Blast hits to 12 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G35680AT1G35680.1ATAAACCGGTAAACCGAA50S ribosomal protein L21, chloroplast / CL21 (RPL21); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: response to cold, translation; LOCATED IN: ribosome, chloroplast stroma, nucleus, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L21, conserved site (InterPro:IPR018258), Ribosomal protein L21 (InterPro:IPR001787); BEST Arabidopsis thaliana protein match is: NFD1 (NUCLEAR FUSION DEFECTIVE 1); RNA binding / structural constituent of ribosome (TAIR:AT4G30930.1); Has 4670 Blast hits to 4670 proteins in 1425 species: Archae - 0; Bacteria - 2792; Metazoa - 89; Fungi - 4; Plants - 92; Viruses - 0; Other Eukaryotes - 1693 (source: NCBI BLink). 
AT1G45201AT1G45201.1GACCGGTTTTTarget of AtGRP7 regulation. 
AT1G45201.2GACCGGTTTTTarget of AtGRP7 regulation. 
AT1G48430AT1G48430.1TATACCGGTTTTdihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT3G17770.1); Has 2623 Blast hits to 2620 proteins in 533 species: Archae - 8; Bacteria - 1792; Metazoa - 85; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 555 (source: NCBI BLink). 
AT1G48440AT1G48440.1AAAACCGGTATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17780.1); Has 61 Blast hits to 61 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G48460AT1G48460.1TTAAACCGGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63040.2); Has 36 Blast hits to 36 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G48900AT1G48900.1TAACCGGTACCGGTTTsignal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink). 
AT1G48900.2TAACCGGTACCGGTTTsignal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink). 
AT1G49380AT1G49380.1TTGAACCGGTTTAAcytochrome c biogenesis protein family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cytochrome complex assembly; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ResB-like (InterPro:IPR007816); Has 930 Blast hits to 928 proteins in 301 species: Archae - 0; Bacteria - 569; Metazoa - 2; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 335 (source: NCBI BLink). 
AT1G49590AT1G49590.1AAAACCGGTTCformin-binding protein-related; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 340 Blast hits to 336 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 213; Fungi - 38; Plants - 54; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT1G49590.2AAAACCGGTTCformin-binding protein-related; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 340 Blast hits to 336 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 213; Fungi - 38; Plants - 54; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT1G49670AT1G49670.1GACCGGTTTGGmolecular function has not been defined. Was shown involved in oxidative stress tolerance. 
AT1G49970AT1G49970.1AAAACCGGTTTAAEncodes a ClpP-related sequence. Though similar to ClpP proteins, this does not contains the highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). 
AT1G50920AT1G50920.1GACCGGTTTATTCCGGTTTACGTP-binding protein-related; FUNCTIONS IN: GTP binding, nucleotide binding; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674), NOG, C-terminal (InterPro:IPR012973); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G10300.1); Has 6304 Blast hits to 6137 proteins in 1196 species: Archae - 232; Bacteria - 2737; Metazoa - 1044; Fungi - 314; Plants - 177; Viruses - 0; Other Eukaryotes - 1800 (source: NCBI BLink). 
AT1G50970AT1G50970.1AAAACCGGTCmembrane trafficking VPS53 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Vps53-like, N-terminal (InterPro:IPR007234); BEST Arabidopsis thaliana protein match is: HIT1 (HEAT-INTOLERANT 1); transporter (TAIR:AT1G50500.1); Has 433 Blast hits to 308 proteins in 142 species: Archae - 2; Bacteria - 19; Metazoa - 193; Fungi - 111; Plants - 34; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G50970.1CAAACCGGTmembrane trafficking VPS53 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Vps53-like, N-terminal (InterPro:IPR007234); BEST Arabidopsis thaliana protein match is: HIT1 (HEAT-INTOLERANT 1); transporter (TAIR:AT1G50500.1); Has 433 Blast hits to 308 proteins in 142 species: Archae - 2; Bacteria - 19; Metazoa - 193; Fungi - 111; Plants - 34; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G52590AT1G52590.1AAACCGGTTTACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). 
AT1G52590.1GACCGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). 
AT1G52600AT1G52600.1GTAAACCGGTTTsignal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). 
AT1G52600.1TTAAACCGGTCsignal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). 
AT1G53350AT1G53350.1ACCGGTTTATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: defense response, apoptosis; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G35450.1); Has 11361 Blast hits to 10470 proteins in 414 species: Archae - 9; Bacteria - 687; Metazoa - 857; Fungi - 33; Plants - 9637; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). 
AT1G53350.1TTGAACCGGTTTGGATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: defense response, apoptosis; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G35450.1); Has 11361 Blast hits to 10470 proteins in 414 species: Archae - 9; Bacteria - 687; Metazoa - 857; Fungi - 33; Plants - 9637; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). 
AT1G54520AT1G54520.1ATAAACCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1517 (InterPro:IPR010903); Has 198 Blast hits to 197 proteins in 64 species: Archae - 0; Bacteria - 91; Metazoa - 6; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). 
AT1G55590AT1G55590.1TTGAACCGGTTTF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL10) (TAIR:AT2G17020.1); Has 4433 Blast hits to 2197 proteins in 167 species: Archae - 0; Bacteria - 310; Metazoa - 2293; Fungi - 371; Plants - 930; Viruses - 3; Other Eukaryotes - 526 (source: NCBI BLink). 
AT1G55890AT1G55890.1CAAACCGGTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G13160.1); Has 17815 Blast hits to 5592 proteins in 168 species: Archae - 5; Bacteria - 22; Metazoa - 302; Fungi - 235; Plants - 16660; Viruses - 0; Other Eukaryotes - 591 (source: NCBI BLink). 
AT1G55930AT1G55930.1TTAAACCGGTCCBS domain-containing protein / transporter associated domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Transporter-associated region (InterPro:IPR005170), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein / transporter associated domain-containing protein (TAIR:AT3G13070.1); Has 10142 Blast hits to 10142 proteins in 1411 species: Archae - 80; Bacteria - 6182; Metazoa - 215; Fungi - 97; Plants - 96; Viruses - 0; Other Eukaryotes - 3472 (source: NCBI BLink). 
AT1G56440AT1G56440.1ACCGGTTTAAserine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink). 
AT1G56450AT1G56450.1TTAAACCGGT20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds 
AT1G57620AT1G57620.1AAAACCGGTTTAAemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G09580.1); Has 1360 Blast hits to 1358 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 707; Fungi - 343; Plants - 152; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). 
AT1G58030AT1G58030.1CAAACCGGTEncodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Localized to the tonoplast. 
AT1G59835AT1G59835.1GAACCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50610.1); Has 25 Blast hits to 11 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G61150AT1G61150.1CAAACCGGTTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). 
AT1G61150.2CAAACCGGTTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). 
AT1G61150.3CAAACCGGTTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). 
AT1G61150.4CAAACCGGTTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). 
AT1G61150.5CAAACCGGTTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). 
AT1G61150.6CAAACCGGTTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). 
AT1G61150.7CAAACCGGTTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). 
AT1G62150AT1G62150.1ATAAACCGGTTTGGmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G62085.1); Has 429 Blast hits to 366 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 418; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G62600AT1G62600.1CCAAACCGGTTTACflavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960); BEST Arabidopsis thaliana protein match is: flavin-containing monooxygenase family protein / FMO family protein (TAIR:AT1G62620.1); Has 8846 Blast hits to 8478 proteins in 928 species: Archae - 35; Bacteria - 3635; Metazoa - 1030; Fungi - 886; Plants - 455; Viruses - 0; Other Eukaryotes - 2805 (source: NCBI BLink). 
AT1G62600.1GTAAACCGGTflavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960); BEST Arabidopsis thaliana protein match is: flavin-containing monooxygenase family protein / FMO family protein (TAIR:AT1G62620.1); Has 8846 Blast hits to 8478 proteins in 928 species: Archae - 35; Bacteria - 3635; Metazoa - 1030; Fungi - 886; Plants - 455; Viruses - 0; Other Eukaryotes - 2805 (source: NCBI BLink). 
AT1G63690AT1G63690.1CTAAACCGGTprotease-associated (PA) domain-containing protein; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: aspartic-type endopeptidase/ peptidase (TAIR:AT1G01650.1); Has 1356 Blast hits to 1341 proteins in 210 species: Archae - 0; Bacteria - 123; Metazoa - 670; Fungi - 109; Plants - 251; Viruses - 0; Other Eukaryotes - 203 (source: NCBI BLink). 
AT1G63690.2CTAAACCGGTprotease-associated (PA) domain-containing protein; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: aspartic-type endopeptidase/ peptidase (TAIR:AT1G01650.1); Has 1356 Blast hits to 1341 proteins in 210 species: Archae - 0; Bacteria - 123; Metazoa - 670; Fungi - 109; Plants - 251; Viruses - 0; Other Eukaryotes - 203 (source: NCBI BLink). 
AT1G65020AT1G65020.1AAAACCGGTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NERD (InterPro:IPR011528); Has 53 Blast hits to 53 proteins in 19 species: Archae - 0; Bacteria - 18; Metazoa - 9; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G65030AT1G65030.1TAACCGGTTTTThis gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase 
AT1G65220AT1G65220.1CGAACCGGTTTGGeIF4-gamma/eIF5/eIF2-epsilon domain-containing protein; FUNCTIONS IN: binding, translation initiation factor activity; INVOLVED IN: regulation of translational initiation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: eIF4-gamma/eIF5/eIF2-epsilon (InterPro:IPR003307), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: eIF4-gamma/eIF5/eIF2-epsilon domain-containing protein (TAIR:AT5G36230.1); Has 618 Blast hits to 616 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 468; Fungi - 26; Plants - 99; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). 
AT1G67470AT1G67470.1CAAACCGGTprotein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G65250.1); Has 21178 Blast hits to 20996 proteins in 883 species: Archae - 2; Bacteria - 1636; Metazoa - 5632; Fungi - 603; Plants - 11445; Viruses - 32; Other Eukaryotes - 1828 (source: NCBI BLink). 
AT1G67910AT1G67910.1ACCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24577.1); Has 90 Blast hits to 90 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G68720AT1G68720.1CAAACCGGACCGGTTTATTRNA ARGININE ADENOSINE DEAMINASE (TADA); FUNCTIONS IN: hydrolase activity, zinc ion binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CMP/dCMP deaminase, zinc-binding (InterPro:IPR002125), Cytidine deaminase-like (InterPro:IPR016193); BEST Arabidopsis thaliana protein match is: cytidine/deoxycytidylate deaminase family protein (TAIR:AT5G28050.1); Has 19163 Blast hits to 15661 proteins in 1596 species: Archae - 115; Bacteria - 4851; Metazoa - 4895; Fungi - 796; Plants - 406; Viruses - 57; Other Eukaryotes - 8043 (source: NCBI BLink). 
AT1G69230AT1G69230.1ACCGGTTTATSPIRAL1-LIKE2 belongs to a six-member gene family in Arabidopsis; all members share a high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root and organ growth as a result of defective anisotropic cell expansion. 
AT1G69230.2ACCGGTTTATSPIRAL1-LIKE2 belongs to a six-member gene family in Arabidopsis; all members share a high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root and organ growth as a result of defective anisotropic cell expansion. 
AT1G69460AT1G69460.1CCAAACCGGTTTATemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1075 Blast hits to 1073 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 530; Fungi - 308; Plants - 128; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). 
AT1G70490AT1G70490.1GAAACGACGAATAAACCGGTA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. 
AT1G70490.2GAAACGACGAATAAACCGGTA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. 
AT1G70490.3GAAACGACGAATAAACCGGTA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. 
AT1G70700AT1G70700.1TTAACCGGTTTAAJAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. 
AT1G70700.2TTAACCGGTTTAAJAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. 
AT1G71980AT1G71980.1AAAACCGGTprotease-associated zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: peptidase activity, protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: peptidase/ protein binding / zinc ion binding (TAIR:AT4G09560.1); Has 12967 Blast hits to 6609 proteins in 295 species: Archae - 0; Bacteria - 161; Metazoa - 3033; Fungi - 861; Plants - 2686; Viruses - 28; Other Eukaryotes - 6198 (source: NCBI BLink). 
AT1G72160AT1G72160.1AAAACCGGTTCGSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 3452 Blast hits to 2934 proteins in 279 species: Archae - 35; Bacteria - 208; Metazoa - 1309; Fungi - 627; Plants - 480; Viruses - 12; Other Eukaryotes - 781 (source: NCBI BLink). 
AT1G72410AT1G72410.1GTAAACCGGTCOP1-interacting protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G17360.1); Has 12658 Blast hits to 8688 proteins in 500 species: Archae - 14; Bacteria - 773; Metazoa - 6078; Fungi - 1243; Plants - 387; Viruses - 26; Other Eukaryotes - 4137 (source: NCBI BLink). 
AT1G74030AT1G74030.1TGAACCGGTTTAAenolase, putative; FUNCTIONS IN: phosphopyruvate hydratase activity; INVOLVED IN: in 12 processes; LOCATED IN: phosphopyruvate hydratase complex, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Enolase (InterPro:IPR000941); BEST Arabidopsis thaliana protein match is: LOS2; copper ion binding / phosphopyruvate hydratase (TAIR:AT2G36530.1); Has 9513 Blast hits to 9495 proteins in 2259 species: Archae - 189; Bacteria - 3126; Metazoa - 1415; Fungi - 220; Plants - 154; Viruses - 0; Other Eukaryotes - 4409 (source: NCBI BLink). 
AT1G74040AT1G74040.1TTAAACCGGTTCAEncodes an active Arabidopsis isopropylmalate synthase IPMS2. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS2 can be compensated by a second isopropylmalate synthase gene IPMS1 (At1g18500). 
AT1G74380AT1G74380.1ACCGGTTTAGXYLOGLUCAN XYLOSYLTRANSFERASE 5 (XXT5); FUNCTIONS IN: xyloglucan 6-xylosyltransferase activity, transferase activity, transferring glycosyl groups, transferase activity; INVOLVED IN: N-terminal protein myristoylation, root hair elongation; LOCATED IN: Golgi apparatus, Golgi membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Galactosyl transferase (InterPro:IPR008630); BEST Arabidopsis thaliana protein match is: galactosyl transferase GMA12/MNN10 family protein (TAIR:AT5G07720.1); Has 301 Blast hits to 301 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 117; Plants - 172; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT1G74650AT1G74650.1AAAACCGGTTTTMember of the R2R3 factor gene family. 
AT1G74910AT1G74910.1ACCGGTTTADP-glucose pyrophosphorylase family protein; FUNCTIONS IN: transferase activity, nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004), Bacterial transferase hexapeptide repeat (InterPro:IPR001451), Nucleotidyl transferase (InterPro:IPR005835); BEST Arabidopsis thaliana protein match is: ADP-glucose pyrophosphorylase family protein (TAIR:AT2G04650.1); Has 5617 Blast hits to 5611 proteins in 1142 species: Archae - 383; Bacteria - 3084; Metazoa - 330; Fungi - 199; Plants - 216; Viruses - 0; Other Eukaryotes - 1405 (source: NCBI BLink). 
AT1G74910.2ACCGGTTTADP-glucose pyrophosphorylase family protein; FUNCTIONS IN: transferase activity, nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004), Bacterial transferase hexapeptide repeat (InterPro:IPR001451), Nucleotidyl transferase (InterPro:IPR005835); BEST Arabidopsis thaliana protein match is: ADP-glucose pyrophosphorylase family protein (TAIR:AT2G04650.1); Has 5617 Blast hits to 5611 proteins in 1142 species: Archae - 383; Bacteria - 3084; Metazoa - 330; Fungi - 199; Plants - 216; Viruses - 0; Other Eukaryotes - 1405 (source: NCBI BLink). 
AT1G74910.3ACCGGTTTADP-glucose pyrophosphorylase family protein; FUNCTIONS IN: transferase activity, nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004), Bacterial transferase hexapeptide repeat (InterPro:IPR001451), Nucleotidyl transferase (InterPro:IPR005835); BEST Arabidopsis thaliana protein match is: ADP-glucose pyrophosphorylase family protein (TAIR:AT2G04650.1); Has 5617 Blast hits to 5611 proteins in 1142 species: Archae - 383; Bacteria - 3084; Metazoa - 330; Fungi - 199; Plants - 216; Viruses - 0; Other Eukaryotes - 1405 (source: NCBI BLink). 
AT1G76070AT1G76070.1GTAAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20310.1); Has 36 Blast hits to 36 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G77600AT1G77600.1ATAAACCGGTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G47690.3); Has 420 Blast hits to 371 proteins in 114 species: Archae - 0; Bacteria - 2; Metazoa - 153; Fungi - 83; Plants - 153; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT1G80410AT1G80410.1TTGAACCGGTTTGGEMBRYO DEFECTIVE 2753 (EMB2753); FUNCTIONS IN: binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 3255 Blast hits to 2440 proteins in 375 species: Archae - 356; Bacteria - 819; Metazoa - 489; Fungi - 174; Plants - 61; Viruses - 3; Other Eukaryotes - 1353 (source: NCBI BLink). 
AT1G80910AT1G80910.1ATAACCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16020.2); Has 140 Blast hits to 140 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT2G02760AT2G02760.1AAAACCGGTTTAAubiquitin conjugating enzyme UBC2. Homolog of the yeast RAD6 gene. 
AT2G03470AT2G03470.1TTCGGTTTATAAACCGGTTAAmyb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink). 
AT2G03470.2TTCGGTTTATAAACCGGTTAAmyb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink). 
AT2G03680AT2G03680.1ATAAACCGGTTTTThe SPR1 gene encodes a plant-specific 12-kD protein which has a repeated motif at both ends, separated by a predicted rod-like domain, suggesting that it may act as an intermolecular linker. Ubiquitously expressed and belongs to a six-member gene family in Arabidopsis; expressed in transgenic seedlings localized to microtubules within the cortical array, preprophase band, phragmoplast, and mitotic spindle. 
AT2G03680.2ATAAACCGGTTTTThe SPR1 gene encodes a plant-specific 12-kD protein which has a repeated motif at both ends, separated by a predicted rod-like domain, suggesting that it may act as an intermolecular linker. Ubiquitously expressed and belongs to a six-member gene family in Arabidopsis; expressed in transgenic seedlings localized to microtubules within the cortical array, preprophase band, phragmoplast, and mitotic spindle. 
AT2G03730AT2G03730.1AAAACCGGTTCAAMember of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. 
AT2G03730.1AAAACCGGTTTATMember of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. 
AT2G03730.2AAAACCGGTTCAAMember of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. 
AT2G03730.2AAAACCGGTTTATMember of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. 
AT2G04630AT2G04630.1AAAACCGGTCOne of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940. 
AT2G06010AT2G06010.1GTAAACCGGTencodes a novel protein whose expression level is induced in lines overexpressing salicylic-acid (SA)-inducible Arabidopsis DNA binding with one finger (Dof) transcription factor, called OBF-binding protein 3. 
AT2G14750AT2G14750.1ACCGGTTTTEncodes a functional APS kinase 
AT2G17510AT2G17510.1CTAAACCGGTTTTAACCGEMBRYO DEFECTIVE 2763 (EMB2763); FUNCTIONS IN: ribonuclease activity, RNA binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide binding protein, PINc (InterPro:IPR006596), Ribonuclease II and R (InterPro:IPR001900); BEST Arabidopsis thaliana protein match is: ribonuclease II family protein (TAIR:AT1G77680.1); Has 5395 Blast hits to 5320 proteins in 1284 species: Archae - 25; Bacteria - 2941; Metazoa - 370; Fungi - 272; Plants - 61; Viruses - 2; Other Eukaryotes - 1724 (source: NCBI BLink). 
AT2G17840AT2G17840.1AACCGAACCGGTTTATIdentified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. 
AT2G18465AT2G18465.1TTAAACCGGTCCGGTTADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G42080.1); Has 685 Blast hits to 685 proteins in 152 species: Archae - 6; Bacteria - 112; Metazoa - 268; Fungi - 15; Plants - 75; Viruses - 0; Other Eukaryotes - 209 (source: NCBI BLink). 
AT2G18915AT2G18915.1AAACCGGTCencodes a member of F-box proteins that includes two other proteins in Arabidopsis (ZTL and FKF1). These proteins contain a unique structure containing a PAS domain at their N-terminus, an F-box motif, and 6 kelch repeats at their C-terminus. Overexpression results in arrhythmic phenotypes for a number of circadian clock outputs in both constant light and constant darkness, long hypocotyls under multiple fluences of both red and blue light, and a loss of photoperiodic control of flowering time. Although this the expression of this gene itself is not regulated by circadian clock, it physically interacts with Dof transcription factors that are transcriptionally regulated by circadian rhythm. LKP2 interacts with Di19, CO/COL family proteins. 
AT2G18915.1CTAAACCGGTencodes a member of F-box proteins that includes two other proteins in Arabidopsis (ZTL and FKF1). These proteins contain a unique structure containing a PAS domain at their N-terminus, an F-box motif, and 6 kelch repeats at their C-terminus. Overexpression results in arrhythmic phenotypes for a number of circadian clock outputs in both constant light and constant darkness, long hypocotyls under multiple fluences of both red and blue light, and a loss of photoperiodic control of flowering time. Although this the expression of this gene itself is not regulated by circadian clock, it physically interacts with Dof transcription factors that are transcriptionally regulated by circadian rhythm. LKP2 interacts with Di19, CO/COL family proteins. 
AT2G18915.2AAACCGGTCencodes a member of F-box proteins that includes two other proteins in Arabidopsis (ZTL and FKF1). These proteins contain a unique structure containing a PAS domain at their N-terminus, an F-box motif, and 6 kelch repeats at their C-terminus. Overexpression results in arrhythmic phenotypes for a number of circadian clock outputs in both constant light and constant darkness, long hypocotyls under multiple fluences of both red and blue light, and a loss of photoperiodic control of flowering time. Although this the expression of this gene itself is not regulated by circadian clock, it physically interacts with Dof transcription factors that are transcriptionally regulated by circadian rhythm. LKP2 interacts with Di19, CO/COL family proteins. 
AT2G18915.2CTAAACCGGTencodes a member of F-box proteins that includes two other proteins in Arabidopsis (ZTL and FKF1). These proteins contain a unique structure containing a PAS domain at their N-terminus, an F-box motif, and 6 kelch repeats at their C-terminus. Overexpression results in arrhythmic phenotypes for a number of circadian clock outputs in both constant light and constant darkness, long hypocotyls under multiple fluences of both red and blue light, and a loss of photoperiodic control of flowering time. Although this the expression of this gene itself is not regulated by circadian clock, it physically interacts with Dof transcription factors that are transcriptionally regulated by circadian rhythm. LKP2 interacts with Di19, CO/COL family proteins. 
AT2G19270AT2G19270.1CGAACCGGTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitotic checkpoint protein PRCC, C-terminal (InterPro:IPR018800); Has 1029 Blast hits to 488 proteins in 117 species: Archae - 0; Bacteria - 14; Metazoa - 432; Fungi - 124; Plants - 39; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink). 
AT2G19680AT2G19680.1ATAAACCGGTTTGGmitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT2G19680.2ATAAACCGGTTTGGmitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT2G21500AT2G21500.1AAAACCGGTCprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT2G21500.1CAAACCGGTCprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT2G21500.2AAAACCGGTCprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT2G21500.2CAAACCGGTCprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT2G24090AT2G24090.1TATACCGGTTTTribosomal protein L35 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35, conserved site (InterPro:IPR018265), Ribosomal protein L35 (InterPro:IPR001706); Has 3401 Blast hits to 3401 proteins in 1037 species: Archae - 0; Bacteria - 2119; Metazoa - 6; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1232 (source: NCBI BLink). 
AT2G26810AT2G26810.1CAAACCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). 
AT2G26810.2CAAACCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). 
AT2G26810.3CAAACCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). 
AT2G27590AT2G27590.1AAAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 78 Blast hits to 78 proteins in 13 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). 
AT2G27960AT2G27960.1TAACCGGTTTATcatalytic subunit of cyclin dependent kinase 1. physically interact with cyclin-dependent kinases (CDKs) and play an essential, but yet not entirely resolved, role in the regulation of the cell cycle 
AT2G29700AT2G29700.1CTAAACCGGTTTAAEncodes a protein containing one PH (pleckstrin homology) domain with a short N-terminal extension 
AT2G31170AT2G31170.1AAAACCGGTTTACSYCO ARATH; FUNCTIONS IN: cysteine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: cysteinyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cysteinyl-tRNA synthetase, class Ia (InterPro:IPR002308), Cysteinyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015803), Cysteinyl-tRNA synthetase, class Ia, C-terminal (InterPro:IPR015804), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (C) family protein (TAIR:AT5G38830.1); Has 8663 Blast hits to 8413 proteins in 1630 species: Archae - 200; Bacteria - 3464; Metazoa - 434; Fungi - 181; Plants - 82; Viruses - 3; Other Eukaryotes - 4299 (source: NCBI BLink). 
AT2G31340AT2G31340.1ATAAACCGGTembryo defective 1381 (emb1381); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G31340.1ATAAACCGGTTCAembryo defective 1381 (emb1381); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G31725AT2G31725.1TTAACCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05730.1); Has 199 Blast hits to 199 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT2G31970AT2G31970.1ATAAACCGGTCRAD50; FUNCTIONS IN: zinc ion binding, ATP binding, nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: chromosome, Mre11 complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc hook, Rad50 (InterPro:IPR013134), Rad50 zinc hook (InterPro:IPR007517), RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395), Recombination/repair protein Rad50 (InterPro:IPR004584); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27595.1); Has 83241 Blast hits to 43267 proteins in 1813 species: Archae - 1109; Bacteria - 10221; Metazoa - 39962; Fungi - 5795; Plants - 2652; Viruses - 436; Other Eukaryotes - 23066 (source: NCBI BLink). 
AT2G32380AT2G32380.1GCCGTTTAAACCGGTTCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 102 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 9; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT2G32690AT2G32690.1AAAACCGGTTATGlycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. 
AT2G32690.2AAAACCGGTTATGlycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. 
AT2G32690.3AAAACCGGTTATGlycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. 
AT2G32690.4AAAACCGGTTATGlycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. 
AT2G33450AT2G33450.1GACCGGTTTG50S ribosomal protein L28, chloroplast (CL28); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28 (InterPro:IPR001383); Has 2561 Blast hits to 2561 proteins in 799 species: Archae - 0; Bacteria - 1602; Metazoa - 0; Fungi - 4; Plants - 31; Viruses - 0; Other Eukaryotes - 924 (source: NCBI BLink). 
AT2G35190AT2G35190.1ACCGGTTTGplant-specific SNARE located in cell plate of dividing cells. cofractionates with the cytokinesis-specific syntaxin, KNOLLE, which is required for the formation of the cell plate. 
AT2G35795AT2G35795.1AAAACCGGTTTAGDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT3G09700.1); Has 691 Blast hits to 691 proteins in 212 species: Archae - 0; Bacteria - 129; Metazoa - 169; Fungi - 134; Plants - 46; Viruses - 2; Other Eukaryotes - 211 (source: NCBI BLink). 
AT2G35795.1AAAACCGGTTTTGAACCGGTDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT3G09700.1); Has 691 Blast hits to 691 proteins in 212 species: Archae - 0; Bacteria - 129; Metazoa - 169; Fungi - 134; Plants - 46; Viruses - 2; Other Eukaryotes - 211 (source: NCBI BLink). 
AT2G35795.1GACCGGTTTGDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT3G09700.1); Has 691 Blast hits to 691 proteins in 212 species: Archae - 0; Bacteria - 129; Metazoa - 169; Fungi - 134; Plants - 46; Viruses - 2; Other Eukaryotes - 211 (source: NCBI BLink). 
AT2G36000AT2G36000.1ATAAACCGGTTAAAmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT2G36000.2ATAAACCGGTTAAAmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT2G36360AT2G36360.1CTAAACCGGTkelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G74150.1); Has 6904 Blast hits to 2957 proteins in 231 species: Archae - 8; Bacteria - 233; Metazoa - 2896; Fungi - 817; Plants - 1292; Viruses - 0; Other Eukaryotes - 1658 (source: NCBI BLink). 
AT2G36360.2CTAAACCGGTkelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G74150.1); Has 6904 Blast hits to 2957 proteins in 231 species: Archae - 8; Bacteria - 233; Metazoa - 2896; Fungi - 817; Plants - 1292; Viruses - 0; Other Eukaryotes - 1658 (source: NCBI BLink). 
AT2G38670AT2G38670.1AAACCGGTTTTEncodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis. 
AT2G38670.1AAACCGGTTTTGGTTCGGTTTAGEncodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis. 
AT2G38740AT2G38740.1CTAAACCGGThaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), Haloacid dehydrogenase/epoxide hydrolase (InterPro:IPR005833), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT1G56500.1); Has 10291 Blast hits to 10291 proteins in 1397 species: Archae - 137; Bacteria - 7267; Metazoa - 142; Fungi - 274; Plants - 203; Viruses - 3; Other Eukaryotes - 2265 (source: NCBI BLink). 
AT2G40120AT2G40120.1AAAACCGGTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G17750.1); Has 65627 Blast hits to 64489 proteins in 2041 species: Archae - 50; Bacteria - 5400; Metazoa - 28985; Fungi - 7798; Plants - 8456; Viruses - 355; Other Eukaryotes - 14583 (source: NCBI BLink). 
AT2G40600AT2G40600.1CAAACCGGTTCAappr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT1G69340.1); Has 2324 Blast hits to 2216 proteins in 788 species: Archae - 117; Bacteria - 1020; Metazoa - 576; Fungi - 86; Plants - 56; Viruses - 292; Other Eukaryotes - 177 (source: NCBI BLink). 
AT2G40700AT2G40700.1ACCGGTTTAADEAD/DEAH box helicase, putative (RH17); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT5G65900.1); Has 26770 Blast hits to 25070 proteins in 1684 species: Archae - 453; Bacteria - 10406; Metazoa - 5242; Fungi - 3151; Plants - 1377; Viruses - 5; Other Eukaryotes - 6136 (source: NCBI BLink). 
AT2G42070AT2G42070.1TTAAACCGGTARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 23 (ATNUDX23); FUNCTIONS IN: hydrolase activity, FAD diphosphatase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 4344 Blast hits to 4344 proteins in 924 species: Archae - 91; Bacteria - 3112; Metazoa - 94; Fungi - 31; Plants - 36; Viruses - 0; Other Eukaryotes - 980 (source: NCBI BLink). 
AT2G42120AT2G42120.1ACCGGTTTATATCCGGTTCAADNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). 
AT2G42120.2ACCGGTTTATATCCGGTTCAADNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). 
AT2G42130AT2G42130.1TTGAACCGGATATAAACCGGTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G42130.2TTGAACCGGATATAAACCGGTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G42130.3TTGAACCGGATATAAACCGGTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G42130.4TTGAACCGGATATAAACCGGTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G42130.5TTGAACCGGATATAAACCGGTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G42500AT2G42500.1AAACCGGTTCAencodes the fourth isoform of the catalytic subunit of protein phosphatase 2A. 
AT2G42500.1TTAAACCGGTencodes the fourth isoform of the catalytic subunit of protein phosphatase 2A. 
AT2G42500.2AAACCGGTTCAencodes the fourth isoform of the catalytic subunit of protein phosphatase 2A. 
AT2G42500.2TTAAACCGGTencodes the fourth isoform of the catalytic subunit of protein phosphatase 2A. 
AT2G42780AT2G42780.1AAACCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of transcription; LOCATED IN: integral to membrane, nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase II transcription factor SIII, subunit A (InterPro:IPR010684); Has 143 Blast hits to 142 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 19; Plants - 18; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT2G42950AT2G42950.1AAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29820.2); Has 426 Blast hits to 426 proteins in 204 species: Archae - 0; Bacteria - 376; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). 
AT2G44350AT2G44350.1ACCGGTTTAGencodes a mitochrondrion targeted citrate synthase, the first enzyme of the tricarboxylic acid cycle, catalyzing the condensation of acetyl-CoA and oxaloacetate, finally yielding citrate and CoA. 
AT2G44350.2ACCGGTTTAGencodes a mitochrondrion targeted citrate synthase, the first enzyme of the tricarboxylic acid cycle, catalyzing the condensation of acetyl-CoA and oxaloacetate, finally yielding citrate and CoA. 
AT2G44640AT2G44640.1CGGTTAAAACCGGTTTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G45270AT2G45270.1TTAAACCGGTTCglycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT4G22720.2); Has 7895 Blast hits to 7864 proteins in 1652 species: Archae - 179; Bacteria - 3268; Metazoa - 208; Fungi - 197; Plants - 129; Viruses - 0; Other Eukaryotes - 3914 (source: NCBI BLink). 
AT2G46260AT2G46260.1CCAAACCGGTTAAABTB/POZ domain-containing protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: ATPOB1; protein binding (TAIR:AT3G61600.1); Has 3167 Blast hits to 3141 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 3012; Fungi - 0; Plants - 79; Viruses - 9; Other Eukaryotes - 67 (source: NCBI BLink). 
AT2G46330AT2G46330.1AAACCGGTEncodes arabinogalactan protein (AGP16). 
AT2G46330.2AAACCGGTEncodes arabinogalactan protein (AGP16). 
AT2G46800AT2G46800.1ACCGGTTTGEncodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. 
AT2G46800.2ACCGGTTTGEncodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. 
AT2G46900AT2G46900.1ACCGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix, Nulp1-type (InterPro:IPR006994); Has 3014 Blast hits to 2357 proteins in 239 species: Archae - 2; Bacteria - 96; Metazoa - 1166; Fungi - 321; Plants - 100; Viruses - 47; Other Eukaryotes - 1282 (source: NCBI BLink). 
AT2G47610AT2G47610.1ACCGGTTTAA60S ribosomal protein L7A (RPL7aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, plasma membrane, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7A (InterPro:IPR001921), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7A (RPL7aB) (TAIR:AT3G62870.1); Has 1594 Blast hits to 1594 proteins in 293 species: Archae - 217; Bacteria - 0; Metazoa - 627; Fungi - 243; Plants - 175; Viruses - 0; Other Eukaryotes - 332 (source: NCBI BLink). 
AT2G47610.1TTAAACCGGTTTT60S ribosomal protein L7A (RPL7aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, plasma membrane, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7A (InterPro:IPR001921), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7A (RPL7aB) (TAIR:AT3G62870.1); Has 1594 Blast hits to 1594 proteins in 293 species: Archae - 217; Bacteria - 0; Metazoa - 627; Fungi - 243; Plants - 175; Viruses - 0; Other Eukaryotes - 332 (source: NCBI BLink). 
AT3G01060AT3G01060.1TTAAACCGGTCCACGTGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT3G01060.2TTAAACCGGTCCACGTGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT3G01060.3TTAAACCGGTCCACGTGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT3G01090AT3G01090.1CTAAACCGGTTTAAencodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase 
AT3G01090.2CTAAACCGGTTTAAencodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase 
AT3G01090.3CTAAACCGGTTTAAencodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase 
AT3G03120AT3G03120.1CAAACCGGTTATAAACCGGTCA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. 
AT3G03270AT3G03270.1CAAACCGGTTATuniversal stress protein (USP) family protein / early nodulin ENOD18 family protein; INVOLVED IN: response to stress; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G53990.1); Has 331 Blast hits to 331 proteins in 36 species: Archae - 0; Bacteria - 4; Metazoa - 8; Fungi - 10; Plants - 307; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G03270.2CAAACCGGTTATuniversal stress protein (USP) family protein / early nodulin ENOD18 family protein; INVOLVED IN: response to stress; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G53990.1); Has 331 Blast hits to 331 proteins in 36 species: Archae - 0; Bacteria - 4; Metazoa - 8; Fungi - 10; Plants - 307; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G04040AT3G04040.1CTAAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1); Has 32 Blast hits to 32 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G04130AT3G04130.1TAACCGGTTTTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink). 
AT3G04130.2TAACCGGTTTTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink). 
AT3G05230AT3G05230.1ACCGGTTTACsignal peptidase subunit family protein; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endoplasmic reticulum, cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Signal peptidase 22 kDa subunit (InterPro:IPR007653); BEST Arabidopsis thaliana protein match is: signal peptidase subunit family protein (TAIR:AT5G27430.1); Has 300 Blast hits to 300 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). 
AT3G05230.2ACCGGTTTACsignal peptidase subunit family protein; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endoplasmic reticulum, cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Signal peptidase 22 kDa subunit (InterPro:IPR007653); BEST Arabidopsis thaliana protein match is: signal peptidase subunit family protein (TAIR:AT5G27430.1); Has 300 Blast hits to 300 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). 
AT3G06430AT3G06430.1ATAAACCGGTembryo defective 2750 (EMB2750); INVOLVED IN: embryonic development ending in seed dormancy, pollen tube development; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53170.1); Has 13889 Blast hits to 5167 proteins in 165 species: Archae - 3; Bacteria - 14; Metazoa - 269; Fungi - 227; Plants - 12750; Viruses - 0; Other Eukaryotes - 626 (source: NCBI BLink). 
AT3G07170AT3G07170.1CAAACCGGTTATsterile alpha motif (SAM) domain-containing protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: sterile alpha motif (SAM) domain-containing protein (TAIR:AT5G48680.1); Has 396 Blast hits to 395 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 293; Fungi - 2; Plants - 89; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT3G09300AT3G09300.1TTGAACCGGTTTGOSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 3B (ORP3B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein, conserved site (InterPro:IPR018494), Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: UNE18 (UNFERTILIZED EMBRYO SAC 18); oxysterol binding / sterol binding (TAIR:AT5G02100.1); Has 1795 Blast hits to 1772 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 940; Fungi - 458; Plants - 154; Viruses - 0; Other Eukaryotes - 243 (source: NCBI BLink). 
AT3G09410AT3G09410.1TTAAACCGGTpectinacetylesterase family protein; FUNCTIONS IN: carboxylesterase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09405.1); Has 403 Blast hits to 396 proteins in 77 species: Archae - 0; Bacteria - 38; Metazoa - 115; Fungi - 0; Plants - 161; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT3G09410.3TTAAACCGGTpectinacetylesterase family protein; FUNCTIONS IN: carboxylesterase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09405.1); Has 403 Blast hits to 396 proteins in 77 species: Archae - 0; Bacteria - 38; Metazoa - 115; Fungi - 0; Plants - 161; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT3G09690AT3G09690.1AAACCGGThydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT3G09690.2AAACCGGThydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT3G09700AT3G09700.1ATAAACCGGTTCDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G35795.1); Has 701 Blast hits to 701 proteins in 218 species: Archae - 0; Bacteria - 144; Metazoa - 169; Fungi - 136; Plants - 46; Viruses - 2; Other Eukaryotes - 204 (source: NCBI BLink). 
AT3G10050AT3G10050.1CCAAACCGGTCfirst enzyme in the biosynthetic pathway of isoleucine 
AT3G10060AT3G10060.1GACCGGTTTGGimmunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT1G20810.1); Has 5654 Blast hits to 5251 proteins in 998 species: Archae - 30; Bacteria - 2476; Metazoa - 1330; Fungi - 312; Plants - 488; Viruses - 0; Other Eukaryotes - 1018 (source: NCBI BLink). 
AT3G11100AT3G11100.1ATAACCGGTTTTtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT5G05550.1); Has 522 Blast hits to 488 proteins in 92 species: Archae - 2; Bacteria - 29; Metazoa - 76; Fungi - 65; Plants - 221; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). 
AT3G11100.1TTAAACCGGTTTTtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT5G05550.1); Has 522 Blast hits to 488 proteins in 92 species: Archae - 2; Bacteria - 29; Metazoa - 76; Fungi - 65; Plants - 221; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). 
AT3G11710AT3G11710.1CAAACCGGTTCGGTTCGARABIDOPSIS THALIANA LYSYL-TRNA SYNTHETASE 1 (ATKRS-1); FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, lysine-tRNA ligase activity, ATP binding, nucleic acid binding; INVOLVED IN: lysyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Lysyl-tRNA synthetase, class II, C-terminal (InterPro:IPR018149), Lysyl-tRNA synthetase, class II (InterPro:IPR002313), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 15525 Blast hits to 13421 proteins in 1696 species: Archae - 251; Bacteria - 8760; Metazoa - 567; Fungi - 510; Plants - 102; Viruses - 0; Other Eukaryotes - 5335 (source: NCBI BLink). 
AT3G11940AT3G11940.1TTAAACCGGTTCOne of two genes encoding the ribosomal protein S5. Mutants have semi-dominant developmental phenotypes. Most cell-division processes are delayed or disturbed in the heterozygous mutant, and development is completely arrested at an early embryonic stage in the homozygous mutant. 
AT3G11940.2TTAAACCGGTTCOne of two genes encoding the ribosomal protein S5. Mutants have semi-dominant developmental phenotypes. Most cell-division processes are delayed or disturbed in the heterozygous mutant, and development is completely arrested at an early embryonic stage in the homozygous mutant. 
AT3G12070AT3G12070.1GAACCGGATGAACCGGTTTAAgeranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Prenyltransferase/squalene oxidase (InterPro:IPR001330); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative (TAIR:AT5G12210.1); Has 1147 Blast hits to 1009 proteins in 184 species: Archae - 0; Bacteria - 22; Metazoa - 467; Fungi - 295; Plants - 126; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink). 
AT3G12070.2GAACCGGATGAACCGGTTTAAgeranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Prenyltransferase/squalene oxidase (InterPro:IPR001330); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative (TAIR:AT5G12210.1); Has 1147 Blast hits to 1009 proteins in 184 species: Archae - 0; Bacteria - 22; Metazoa - 467; Fungi - 295; Plants - 126; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink). 
AT3G12080AT3G12080.1TTAAACCGGTTCATCCGGTTCembryo defective 2738 (emb2738); FUNCTIONS IN: GTP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), Small GTP-binding protein (InterPro:IPR005225), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT5G39960.1); Has 29827 Blast hits to 16895 proteins in 1667 species: Archae - 139; Bacteria - 20018; Metazoa - 342; Fungi - 286; Plants - 215; Viruses - 0; Other Eukaryotes - 8827 (source: NCBI BLink). 
AT3G12080.2TTAAACCGGTTCATCCGGTTCembryo defective 2738 (emb2738); FUNCTIONS IN: GTP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), Small GTP-binding protein (InterPro:IPR005225), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT5G39960.1); Has 29827 Blast hits to 16895 proteins in 1667 species: Archae - 139; Bacteria - 20018; Metazoa - 342; Fungi - 286; Plants - 215; Viruses - 0; Other Eukaryotes - 8827 (source: NCBI BLink). 
AT3G12560AT3G12560.1CCGGTTTACCGGTTTACEncodes a telomeric DNA-binding protein. 
AT3G12760AT3G12760.1CAAACCGGTTTGGCGAACCGGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defective in cullin neddylation (InterPro:IPR014764), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Protein of unknown function DUF298 (InterPro:IPR005176), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15860.2); Has 628 Blast hits to 626 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 408; Fungi - 99; Plants - 64; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). 
AT3G13410AT3G13410.1AAACCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55546.1); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G13860AT3G13860.1AAAACCGGTTTTHEAT SHOCK PROTEIN 60-3A (HSP60-3A); FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60, conserved site (InterPro:IPR018370), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: HSP60 (HEAT SHOCK PROTEIN 60); ATP binding (TAIR:AT3G23990.1); Has 24236 Blast hits to 24217 proteins in 5120 species: Archae - 378; Bacteria - 14012; Metazoa - 1390; Fungi - 947; Plants - 418; Viruses - 2; Other Eukaryotes - 7089 (source: NCBI BLink). 
AT3G15040AT3G15040.1AAAACCGGTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 2804 Blast hits to 412 proteins in 66 species: Archae - 0; Bacteria - 22; Metazoa - 419; Fungi - 51; Plants - 212; Viruses - 0; Other Eukaryotes - 2100 (source: NCBI BLink). 
AT3G15090AT3G15090.1GTAAACCGGTTAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 20659 Blast hits to 20565 proteins in 1484 species: Archae - 253; Bacteria - 11042; Metazoa - 1064; Fungi - 2188; Plants - 463; Viruses - 0; Other Eukaryotes - 5649 (source: NCBI BLink). 
AT3G16200AT3G16200.1TAACCGGTTTGGGCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 70 Blast hits to 70 proteins in 9 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT3G16840AT3G16840.1TAACCGGTTTAAATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 47629 Blast hits to 37227 proteins in 1876 species: Archae - 406; Bacteria - 10857; Metazoa - 14354; Fungi - 5782; Plants - 2214; Viruses - 278; Other Eukaryotes - 13738 (source: NCBI BLink). 
AT3G17365AT3G17365.1CAAACCGGTGAACCGGTCcatalytic/ methyltransferase; FUNCTIONS IN: methyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: catalytic/ methyltransferase (TAIR:AT3G60910.1); Has 889 Blast hits to 888 proteins in 188 species: Archae - 17; Bacteria - 122; Metazoa - 263; Fungi - 34; Plants - 84; Viruses - 0; Other Eukaryotes - 369 (source: NCBI BLink). 
AT3G17880AT3G17880.1AAAACCGGTEncodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. 
AT3G17880.2AAAACCGGTEncodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. 
AT3G17998AT3G17998.1ACCGGTTTTUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF30 represents a conserved upstream opening reading frame relative to major ORF AT3G18000.1 
AT3G18000AT3G18000.1ACCGGTTTTArabidopsis thaliana N-methyltransferase-like protein mRNA. 
AT3G18100AT3G18100.1TAACCGGTTTATMember of the R2R3 transcription factor gene family. 
AT3G18270AT3G18270.1TTGAACCGAACCGGTTTATa cytochrome P450 pseudogene. the second half of the gene overlaps perfectly with the other gene model. 
AT3G18390AT3G18390.1AAACCGGTTTTembryo defective 1865 (EMB1865); FUNCTIONS IN: RNA binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT3G23070.1); Has 1149 Blast hits to 1011 proteins in 124 species: Archae - 5; Bacteria - 10; Metazoa - 293; Fungi - 119; Plants - 305; Viruses - 46; Other Eukaryotes - 371 (source: NCBI BLink). 
AT3G19190AT3G19190.1GAACCGGTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATG2, C-terminal (InterPro:IPR015412); Has 603 Blast hits to 514 proteins in 156 species: Archae - 0; Bacteria - 19; Metazoa - 326; Fungi - 168; Plants - 38; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). 
AT3G19508AT3G19508.1GACCGGTTTAAunknown protein; LOCATED IN: mitochondrion; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G19508.1TTGAACCGGTTTTunknown protein; LOCATED IN: mitochondrion; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G19640AT3G19640.1AAAACCGGTTTGmagnesium transporter CorA-like family protein (MRS2-3); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-1) (TAIR:AT1G16010.2); Has 603 Blast hits to 521 proteins in 126 species: Archae - 0; Bacteria - 31; Metazoa - 102; Fungi - 198; Plants - 203; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT3G19640.1AAAACCGGTTTGGmagnesium transporter CorA-like family protein (MRS2-3); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-1) (TAIR:AT1G16010.2); Has 603 Blast hits to 521 proteins in 126 species: Archae - 0; Bacteria - 31; Metazoa - 102; Fungi - 198; Plants - 203; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT3G20440AT3G20440.1TTGAACCGGTTTAAEMBRYO DEFECTIVE 2729 (EMB2729); FUNCTIONS IN: cation binding, catalytic activity, alpha-amylase activity; INVOLVED IN: embryonic development ending in seed dormancy, carbohydrate metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl hydrolase, family 13, subfamily, catalytic region (InterPro:IPR006589), Glycosyl hydrolase, family 13, all-beta (InterPro:IPR013780), Immunoglobulin E-set (InterPro:IPR014756), Alpha-amylase, C-terminal all beta (InterPro:IPR006048), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycosyl hydrolase, family 13, catalytic region (InterPro:IPR006047); BEST Arabidopsis thaliana protein match is: SBE2.1 (starch branching enzyme 2.1); 1,4-alpha-glucan branching enzyme (TAIR:AT2G36390.1). 
AT3G20440.2TTGAACCGGTTTAAEMBRYO DEFECTIVE 2729 (EMB2729); FUNCTIONS IN: cation binding, catalytic activity, alpha-amylase activity; INVOLVED IN: embryonic development ending in seed dormancy, carbohydrate metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl hydrolase, family 13, subfamily, catalytic region (InterPro:IPR006589), Glycosyl hydrolase, family 13, all-beta (InterPro:IPR013780), Immunoglobulin E-set (InterPro:IPR014756), Alpha-amylase, C-terminal all beta (InterPro:IPR006048), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycosyl hydrolase, family 13, catalytic region (InterPro:IPR006047); BEST Arabidopsis thaliana protein match is: SBE2.1 (starch branching enzyme 2.1); 1,4-alpha-glucan branching enzyme (TAIR:AT2G36390.1). 
AT3G20920AT3G20920.1ATAAACCGGTtranslocation protein-related; FUNCTIONS IN: protein transporter activity; INVOLVED IN: protein transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocation protein Sec62 (InterPro:IPR004728); Has 185 Blast hits to 185 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 46; Plants - 26; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G20920.2ATAAACCGGTtranslocation protein-related; FUNCTIONS IN: protein transporter activity; INVOLVED IN: protein transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocation protein Sec62 (InterPro:IPR004728); Has 185 Blast hits to 185 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 46; Plants - 26; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G22420AT3G22420.1AAAACCGGTTTAGTAAACCGAEncodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. 
AT3G22420.2AAAACCGGTTTAGTAAACCGAEncodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. 
AT3G22845AT3G22845.1ATAAACCGGTTTTemp24/gp25L/p24 protein-related; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT3G07680.1); Has 1355 Blast hits to 1355 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 771; Fungi - 319; Plants - 146; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). 
AT3G22990AT3G22990.1AACCGGAATAAACCGGTCArmadillo-repeat containing protein. Involved in leaf and flower development. Located in nucleus. Broadly expressed throughout vegetative and floral tissues. 
AT3G23805AT3G23805.1TTAAACCGACCGGTTTAAMember of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. 
AT3G24030AT3G24030.1CTAAACCGGTATAhydroxyethylthiazole kinase family protein; FUNCTIONS IN: catalytic activity, hydroxyethylthiazole kinase activity; INVOLVED IN: thiamin biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hydroxyethylthiazole kinase (InterPro:IPR000417), Hydroxyethylthiazole kinase, monofunctional (InterPro:IPR011144); Has 1376 Blast hits to 1376 proteins in 593 species: Archae - 84; Bacteria - 1080; Metazoa - 1; Fungi - 85; Plants - 22; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). 
AT3G26730AT3G26730.1CAAACCGGTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 5616 Blast hits to 1874 proteins in 214 species: Archae - 3; Bacteria - 108; Metazoa - 2179; Fungi - 373; Plants - 239; Viruses - 6; Other Eukaryotes - 2708 (source: NCBI BLink). 
AT3G28710AT3G28710.1ACCGGTTTAAH+-transporting two-sector ATPase, putative; FUNCTIONS IN: hydrogen ion transmembrane transporter activity, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: vacuolar membrane, plasma membrane, vacuole, plant-type vacuole; EXPRESSED IN: cultured cell, callus; CONTAINS InterPro DOMAIN/s: ATPase, V0/A0 complex, subunit C/D (InterPro:IPR002843), ATPase, V0 complex, subunit D (InterPro:IPR016727); BEST Arabidopsis thaliana protein match is: H+-transporting two-sector ATPase, putative (TAIR:AT3G28715.1); Has 443 Blast hits to 442 proteins in 188 species: Archae - 14; Bacteria - 1; Metazoa - 206; Fungi - 98; Plants - 47; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT3G28715AT3G28715.1GACCGGTTTAGH+-transporting two-sector ATPase, putative; FUNCTIONS IN: hydrogen ion transmembrane transporter activity, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: ATPase, V0/A0 complex, subunit C/D (InterPro:IPR002843), ATPase, V0 complex, subunit D (InterPro:IPR016727); BEST Arabidopsis thaliana protein match is: H+-transporting two-sector ATPase, putative (TAIR:AT3G28710.1); Has 448 Blast hits to 447 proteins in 191 species: Archae - 19; Bacteria - 1; Metazoa - 206; Fungi - 98; Plants - 47; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT3G43520AT3G43520.1AAAACCGGTTTGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26240.1); Has 432 Blast hits to 415 proteins in 105 species: Archae - 4; Bacteria - 70; Metazoa - 210; Fungi - 11; Plants - 99; Viruses - 7; Other Eukaryotes - 31 (source: NCBI BLink). 
AT3G45770AT3G45770.1GACCGGTTTAGoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: zinc ion binding, ATP binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion, chloroplast, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NQR; binding / catalytic/ oxidoreductase/ zinc ion binding (TAIR:AT1G49670.1); Has 15702 Blast hits to 15648 proteins in 1321 species: Archae - 139; Bacteria - 8514; Metazoa - 1237; Fungi - 1345; Plants - 386; Viruses - 0; Other Eukaryotes - 4081 (source: NCBI BLink). 
AT3G45770.2GACCGGTTTAGoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: zinc ion binding, ATP binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion, chloroplast, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NQR; binding / catalytic/ oxidoreductase/ zinc ion binding (TAIR:AT1G49670.1); Has 15702 Blast hits to 15648 proteins in 1321 species: Archae - 139; Bacteria - 8514; Metazoa - 1237; Fungi - 1345; Plants - 386; Viruses - 0; Other Eukaryotes - 4081 (source: NCBI BLink). 
AT3G46100AT3G46100.1CCAAACCGGThistidyl-tRNA synthetase 
AT3G46630AT3G46630.1AAAACCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: defective chloroplasts and leaves protein-related / DCL protein-related (TAIR:AT1G45230.1); Has 102 Blast hits to 102 proteins in 23 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 88; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT3G47650AT3G47650.1AAAACCGGTTAAbundle-sheath defective protein 2 family / bsd2 family; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 47 Blast hits to 47 proteins in 18 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT3G47836AT3G47836.1ACCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G47836.2ACCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G48170AT3G48170.1AAAACCGGTTTAGArabidopsis thaliana putative betaine aldehyde dehydrogenase 
AT3G48880AT3G48880.1GACCGGTTTAAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G11580.1); Has 230 Blast hits to 226 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G48880.2GACCGGTTTAAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G11580.1); Has 230 Blast hits to 226 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G51500AT3G51500.1AAAACCGGTATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G51510AT3G51510.1AAAACCGGTATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G55140AT3G55140.1CCAAACCGGTTTGGpectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G55140.2CCAAACCGGTTTGGpectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G55480AT3G55480.1CAAACCGGTTTAGadaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink). 
AT3G55480.2CAAACCGGTTTAGadaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink). 
AT3G56750AT3G56750.1TCGGTTCGGTTTAATTAAACCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41150.2); Has 71 Blast hits to 71 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT3G57340AT3G57340.1GACCGGTTTGDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink). 
AT3G57340.2GACCGGTTTGDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink). 
AT3G61600AT3G61600.1ATAAACCGGTTCAPOZ/BTB containing-protein AtPOB1 
AT3G61600.2ATAAACCGGTTCAPOZ/BTB containing-protein AtPOB1 
AT4G00180AT4G00180.1ATAAACCGGTTCAAYABBY gene family member, likely has transcription factor activity, involved in specifying abaxial cell fate. Along with FIL, involved in patterning of the fruit. GUS reporter gene expression in seedlings is observed in the young leaves and as the leaf matures, expression is restricted to the abaxial tissues of leaves, expression is also observed on either side of the leaf margin in the younger tissues of leaf blades. 
AT4G00180.2ATAAACCGGTTCAAYABBY gene family member, likely has transcription factor activity, involved in specifying abaxial cell fate. Along with FIL, involved in patterning of the fruit. GUS reporter gene expression in seedlings is observed in the young leaves and as the leaf matures, expression is restricted to the abaxial tissues of leaves, expression is also observed on either side of the leaf margin in the younger tissues of leaf blades. 
AT4G00355AT4G00355.1AAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G00355.2AAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G00355.3AAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G00355.4AAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G00620AT4G00620.1CAAACCGGTTTtetrahydrofolate dehydrogenase/cyclohydrolase, putative; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Tetrahydrofolate dehydrogenase/cyclohydrolase (InterPro:IPR000672), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: tetrahydrofolate dehydrogenase/cyclohydrolase, putative (TAIR:AT4G00600.1); Has 7121 Blast hits to 7116 proteins in 1557 species: Archae - 77; Bacteria - 3120; Metazoa - 345; Fungi - 203; Plants - 87; Viruses - 0; Other Eukaryotes - 3289 (source: NCBI BLink). 
AT4G01900AT4G01900.1CTAAACCGGTTTTencodes a PII protein that may function as part of a signal transduction network involved in perceiving the status of carbon and organic nitrogen. Forms a protein complex with N-acetylglutamate kinase and regulates the kinase activity by relieving the feedback inhibition of the kinase by arginine. 
AT4G03260AT4G03260.1ACCGGTTTGleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). 
AT4G03260.2ACCGGTTTGleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). 
AT4G03410AT4G03410.1CAAACCGGTTTTperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT4G03410.2CAAACCGGTTTTperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT4G05070AT4G05070.1CTAAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G05180AT4G05180.1AAACCGGTTTTEncodes the PsbQ subunit of the oxygen evolving complex of photosystem II. 
AT4G06634AT4G06634.1ATAAACCGGTzinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087), Zinc finger, C2H2-type/integrase, DNA-binding (InterPro:IPR013087); BEST Arabidopsis thaliana protein match is: ELF6 (EARLY FLOWERING 6); transcription factor (TAIR:AT5G04240.1); Has 105509 Blast hits to 34937 proteins in 883 species: Archae - 4; Bacteria - 37; Metazoa - 99278; Fungi - 2690; Plants - 257; Viruses - 38; Other Eukaryotes - 3205 (source: NCBI BLink). 
AT4G06634.1GTAAACCGGTzinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087), Zinc finger, C2H2-type/integrase, DNA-binding (InterPro:IPR013087); BEST Arabidopsis thaliana protein match is: ELF6 (EARLY FLOWERING 6); transcription factor (TAIR:AT5G04240.1); Has 105509 Blast hits to 34937 proteins in 883 species: Archae - 4; Bacteria - 37; Metazoa - 99278; Fungi - 2690; Plants - 257; Viruses - 38; Other Eukaryotes - 3205 (source: NCBI BLink). 
AT4G06634.2ATAAACCGGTzinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087), Zinc finger, C2H2-type/integrase, DNA-binding (InterPro:IPR013087); BEST Arabidopsis thaliana protein match is: ELF6 (EARLY FLOWERING 6); transcription factor (TAIR:AT5G04240.1); Has 105509 Blast hits to 34937 proteins in 883 species: Archae - 4; Bacteria - 37; Metazoa - 99278; Fungi - 2690; Plants - 257; Viruses - 38; Other Eukaryotes - 3205 (source: NCBI BLink). 
AT4G06634.2GTAAACCGGTzinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087), Zinc finger, C2H2-type/integrase, DNA-binding (InterPro:IPR013087); BEST Arabidopsis thaliana protein match is: ELF6 (EARLY FLOWERING 6); transcription factor (TAIR:AT5G04240.1); Has 105509 Blast hits to 34937 proteins in 883 species: Archae - 4; Bacteria - 37; Metazoa - 99278; Fungi - 2690; Plants - 257; Viruses - 38; Other Eukaryotes - 3205 (source: NCBI BLink). 
AT4G08350AT4G08350.1TTAAACCGGTGLOBAL TRANSCRIPTION FACTOR GROUP A2 (GTA2); FUNCTIONS IN: transcription elongation regulator activity, structural constituent of ribosome, transcription factor activity; INVOLVED IN: translation, regulation of transcription from RNA polymerase II promoter, positive regulation of RNA elongation from RNA polymerase II promoter; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Transcription antitermination protein, NusG, N-terminal (InterPro:IPR006645), Transcription elongation factor Spt5 (InterPro:IPR017071), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), KOW (InterPro:IPR005824), Supt5 repeat (InterPro:IPR005100); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome / transcription elongation regulator/ transcription initiation factor (TAIR:AT2G34210.1); Has 14306 Blast hits to 8900 proteins in 471 species: Archae - 78; Bacteria - 505; Metazoa - 6585; Fungi - 2279; Plants - 912; Viruses - 310; Other Eukaryotes - 3637 (source: NCBI BLink). 
AT4G08540AT4G08540.1ACCGGTTTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G77890.1); Has 42 Blast hits to 42 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 6; Plants - 28; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT4G09020AT4G09020.1ATAAACCGGTTTAAEncodes an isoamylase-like protein. Mutant studies show that the gene is strongly involved in starch breakdown. A GUS-protein fusion product was shown to localize to the surface of chloroplastic structures reminiscent of starch granules. In the mutants, the chloroplastic α-amylase AMY3 is upregulated. 
AT4G09300AT4G09300.1AAACCGGTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61150.6); Has 369 Blast hits to 369 proteins in 108 species: Archae - 0; Bacteria - 2; Metazoa - 175; Fungi - 55; Plants - 90; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT4G09620AT4G09620.1CAAACCGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); Has 120 Blast hits to 97 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). 
AT4G11130AT4G11130.1AAAACCGGTCEncodes RNA-dependent RNA polymerase that is required for endogenous siRNA (but not miRNA) formation. Nomenclature according to Xie, et al. (2004). 
AT4G11860AT4G11860.1ACCGGTTTGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF544 (InterPro:IPR007518), Ubiquitin interacting motif (InterPro:IPR003903); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22960.1); Has 761 Blast hits to 466 proteins in 133 species: Archae - 0; Bacteria - 44; Metazoa - 311; Fungi - 246; Plants - 57; Viruses - 0; Other Eukaryotes - 103 (source: NCBI BLink). 
AT4G14210AT4G14210.1ACCGGTTTEncodes phytoene desaturase (phytoene dehydrogenase), an enzyme that catalyzes the desaturation of phytoene to zeta-carotene during carotenoid biosynthesis. Processed protein is localized to the plastid. 
AT4G14210.2ACCGGTTTEncodes phytoene desaturase (phytoene dehydrogenase), an enzyme that catalyzes the desaturation of phytoene to zeta-carotene during carotenoid biosynthesis. Processed protein is localized to the plastid. 
AT4G16650AT4G16650.1AAAACCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76270.1); Has 436 Blast hits to 428 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 436; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G17060AT4G17060.1AAACCGGTTCAEncodes one of the FRI interacting proteins: FRIGIDA INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI (At4G00650) is a major determinant of natural variation in Arabidopsis flowering time. 
AT4G17490AT4G17490.1AAAACCGGTEncodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. 
AT4G18060AT4G18060.1GACCGGTTTGGclathrin binding; FUNCTIONS IN: clathrin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neutrophil cytosol factor 2 (InterPro:IPR000108), Src homology-3 domain (InterPro:IPR001452); BEST Arabidopsis thaliana protein match is: SH3 domain-containing protein 2 (SH3P2) (TAIR:AT4G34660.1); Has 2031 Blast hits to 1692 proteins in 137 species: Archae - 0; Bacteria - 6; Metazoa - 1668; Fungi - 93; Plants - 91; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink). 
AT4G18580AT4G18580.1TTAAACCGAACCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G18580.2TTAAACCGAACCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G18590AT4G18590.1CAAACCGGTTCGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Replication factor A protein 3 (InterPro:IPR013970), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52630.2); Has 58 Blast hits to 58 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT4G20050AT4G20050.1GTAAACCGGTEncodes a polygalacturonase that plays a direct role in degrading the pollen mother cell wall during microspore development. 
AT4G20050.2GTAAACCGGTEncodes a polygalacturonase that plays a direct role in degrading the pollen mother cell wall during microspore development. 
AT4G20280AT4G20280.1AAAACCGGTTCAEncodes TAF11, a putative TBP-associated factor (TBP: TATA binding protein). 
AT4G20720AT4G20720.1GTAAACCGGTTTdentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT1G05090.1); Has 3403 Blast hits to 1139 proteins in 183 species: Archae - 4; Bacteria - 2474; Metazoa - 376; Fungi - 145; Plants - 79; Viruses - 1; Other Eukaryotes - 324 (source: NCBI BLink). 
AT4G21710AT4G21710.1CAAACCGGTTATEncodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. 
AT4G21710.1CAAACCGGTTATEncodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. 
AT4G23910AT4G23910.1TAACCGGTTTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10970.4); Has 29 Blast hits to 29 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G24090AT4G24090.1AAAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 95 Blast hits to 93 proteins in 48 species: Archae - 3; Bacteria - 45; Metazoa - 6; Fungi - 11; Plants - 20; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT4G24140AT4G24140.1CAAACCGGThydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: BDG1 (BODYGUARD1); hydrolase (TAIR:AT1G64670.1); Has 3943 Blast hits to 3942 proteins in 690 species: Archae - 8; Bacteria - 2152; Metazoa - 305; Fungi - 115; Plants - 116; Viruses - 4; Other Eukaryotes - 1243 (source: NCBI BLink). 
AT4G24370AT4G24370.1CTAAACCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT4G24830AT4G24830.1TTTAACCGGTTTarginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink). 
AT4G24830.2TTTAACCGGTTTarginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink). 
AT4G25650AT4G25650.1TTAACCGGTTTAGSimilar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment. 
AT4G25650.2TTAACCGGTTTAGSimilar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment. 
AT4G25660AT4G25660.1CTAAACCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25680.1); Has 499 Blast hits to 499 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 37; Plants - 181; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT4G26750AT4G26750.1GACCGGTTTAGhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF605 (InterPro:IPR006745); BEST Arabidopsis thaliana protein match is: ATGSL11 (glucan synthase-like 11); 1,3-beta-glucan synthase/ transferase, transferring glycosyl groups (TAIR:AT3G59100.1); Has 27093 Blast hits to 16071 proteins in 790 species: Archae - 16; Bacteria - 1458; Metazoa - 10297; Fungi - 5609; Plants - 4452; Viruses - 743; Other Eukaryotes - 4518 (source: NCBI BLink). 
AT4G26965AT4G26965.1TTAAACCGGTNADH:ubiquinone oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: NADH:ubiquinone oxidoreductase 17.2 kD subunit (InterPro:IPR007763); Has 264 Blast hits to 264 proteins in 68 species: Archae - 0; Bacteria - 20; Metazoa - 74; Fungi - 41; Plants - 15; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). 
AT4G26965.1TTAAACCGGTNADH:ubiquinone oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: NADH:ubiquinone oxidoreductase 17.2 kD subunit (InterPro:IPR007763); Has 264 Blast hits to 264 proteins in 68 species: Archae - 0; Bacteria - 20; Metazoa - 74; Fungi - 41; Plants - 15; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). 
AT4G26965.2TTAAACCGGTNADH:ubiquinone oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: NADH:ubiquinone oxidoreductase 17.2 kD subunit (InterPro:IPR007763); Has 264 Blast hits to 264 proteins in 68 species: Archae - 0; Bacteria - 20; Metazoa - 74; Fungi - 41; Plants - 15; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). 
AT4G26965.2TTAAACCGGTNADH:ubiquinone oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: NADH:ubiquinone oxidoreductase 17.2 kD subunit (InterPro:IPR007763); Has 264 Blast hits to 264 proteins in 68 species: Archae - 0; Bacteria - 20; Metazoa - 74; Fungi - 41; Plants - 15; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). 
AT4G27700AT4G27700.1GTAAACCGGTATArhodanese-like domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: aging; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT3G08920.1); Has 465 Blast hits to 463 proteins in 140 species: Archae - 23; Bacteria - 218; Metazoa - 0; Fungi - 0; Plants - 156; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). 
AT4G28630AT4G28630.1AAAACCGGTTAThalf-molecule ABC transporter ATM1 
AT4G29510AT4G29510.1TAACCGGTTTGGHas arginine N-methyltransferase activity. Modifies AtMBD7. 
AT4G29810AT4G29810.1TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. 
AT4G29810.2TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. 
AT4G29810.3TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. 
AT4G32915AT4G32915.1GACCGGTTAAAACCGGTTTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of translational fidelity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glu-tRNAGln amidotransferase, C subunit (InterPro:IPR003837); Has 1227 Blast hits to 1227 proteins in 425 species: Archae - 17; Bacteria - 884; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink). 
AT4G33640AT4G33640.1CAAACCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 141 Blast hits to 141 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT4G34050AT4G34050.1GACCGGTTTTcaffeoyl-CoA 3-O-methyltransferase, putative; FUNCTIONS IN: caffeoyl-CoA O-methyltransferase activity; INVOLVED IN: coumarin biosynthetic process, response to cadmium ion; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: caffeoyl-CoA 3-O-methyltransferase, putative (TAIR:AT4G26220.1); Has 3455 Blast hits to 3452 proteins in 740 species: Archae - 19; Bacteria - 1446; Metazoa - 216; Fungi - 70; Plants - 444; Viruses - 0; Other Eukaryotes - 1260 (source: NCBI BLink). 
AT4G34050.2GACCGGTTTTcaffeoyl-CoA 3-O-methyltransferase, putative; FUNCTIONS IN: caffeoyl-CoA O-methyltransferase activity; INVOLVED IN: coumarin biosynthetic process, response to cadmium ion; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: caffeoyl-CoA 3-O-methyltransferase, putative (TAIR:AT4G26220.1); Has 3455 Blast hits to 3452 proteins in 740 species: Archae - 19; Bacteria - 1446; Metazoa - 216; Fungi - 70; Plants - 444; Viruses - 0; Other Eukaryotes - 1260 (source: NCBI BLink). 
AT4G34090AT4G34090.1GTAAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G34090.2GTAAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G34100AT4G34100.1ACCGGTTTACprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink). 
AT4G34100.2ACCGGTTTACprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink). 
AT4G34430AT4G34430.1CCAAACCGGTMember of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). 
AT4G34430.2CCAAACCGGTMember of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). 
AT4G34430.3CCAAACCGGTMember of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). 
AT4G34430.4CCAAACCGGTMember of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). 
AT4G34730AT4G34730.1GACCGGTTTTribosome-binding factor A family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K homology-like, alpha/beta (InterPro:IPR015946), Ribosome-binding factor A (InterPro:IPR000238); Has 2908 Blast hits to 2907 proteins in 1057 species: Archae - 0; Bacteria - 2230; Metazoa - 5; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 649 (source: NCBI BLink). 
AT4G35700AT4G35700.1ACCGGTTTAGzinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT4G35610.1); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G35850AT4G35850.1CAAACCGGTTAApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G02150.1); Has 6373 Blast hits to 2522 proteins in 127 species: Archae - 1; Bacteria - 4; Metazoa - 104; Fungi - 77; Plants - 5853; Viruses - 0; Other Eukaryotes - 334 (source: NCBI BLink). 
AT4G37190AT4G37190.1ACCGGTTTATINVOLVED IN: protein polymerization; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta tubulin, autoregulation binding site (InterPro:IPR013838), Tubulin/FtsZ, GTPase (InterPro:IPR003008); Has 251 Blast hits to 250 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 89; Plants - 28; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT4G37190.2ACCGGTTTATINVOLVED IN: protein polymerization; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta tubulin, autoregulation binding site (InterPro:IPR013838), Tubulin/FtsZ, GTPase (InterPro:IPR003008); Has 251 Blast hits to 250 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 89; Plants - 28; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT4G38250AT4G38250.1AAAACCGGTamino acid transporter family protein; FUNCTIONS IN: amino acid transmembrane transporter activity; INVOLVED IN: amino acid transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid transporter, transmembrane (InterPro:IPR013057); BEST Arabidopsis thaliana protein match is: amino acid transporter family protein (TAIR:AT2G42005.1); Has 3608 Blast hits to 3534 proteins in 200 species: Archae - 9; Bacteria - 29; Metazoa - 1615; Fungi - 618; Plants - 718; Viruses - 5; Other Eukaryotes - 614 (source: NCBI BLink). 
AT4G38500AT4G38500.1CAAACCGGTCunknown protein; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28240.1); Has 167 Blast hits to 167 proteins in 24 species: Archae - 6; Bacteria - 22; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT4G39050AT4G39050.1CAAACCGGTkinesin-related protein (MKRP2); FUNCTIONS IN: protein binding, microtubule motor activity, zinc ion binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex, chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT2G21380.1); Has 37077 Blast hits to 25676 proteins in 1021 species: Archae - 260; Bacteria - 2097; Metazoa - 19200; Fungi - 3004; Plants - 2225; Viruses - 313; Other Eukaryotes - 9978 (source: NCBI BLink). 
AT5G02480AT5G02480.1CAAACCGGTTTTLOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 60 Blast hits to 60 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G03660AT5G03660.1ACCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09980.1); Has 5235 Blast hits to 3832 proteins in 426 species: Archae - 74; Bacteria - 462; Metazoa - 2482; Fungi - 239; Plants - 192; Viruses - 22; Other Eukaryotes - 1764 (source: NCBI BLink). 
AT5G04140AT5G04140.1CAAACCGGTTAAEncodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. 
AT5G04140.2CAAACCGGTTAAEncodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. 
AT5G04910AT5G04910.1CTAAACCGGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT5G05230AT5G05230.1AAAACCGGTubiquitin-protein ligase; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40640.1); Has 74 Blast hits to 74 proteins in 19 species: Archae - 0; Bacteria - 4; Metazoa - 14; Fungi - 8; Plants - 46; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G05570AT5G05570.1AAACCGGTTTAAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: methyltransferase activity, nucleotide binding, nucleic acid binding; INVOLVED IN: vesicle-mediated transport, methylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052), Synaptobrevin (InterPro:IPR001388); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35560.1); Has 565 Blast hits to 464 proteins in 112 species: Archae - 0; Bacteria - 9; Metazoa - 407; Fungi - 84; Plants - 40; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). 
AT5G05660AT5G05660.1TTAAACCGGTEncodes a homolog of the mammalian zinc finger transcription factor NF-X1. 
AT5G05860AT5G05860.1AAAACCGGTUGT76C2; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT5G05880.1); Has 4858 Blast hits to 4839 proteins in 332 species: Archae - 0; Bacteria - 208; Metazoa - 1867; Fungi - 21; Plants - 2678; Viruses - 62; Other Eukaryotes - 22 (source: NCBI BLink). 
AT5G06750AT5G06750.2GAACCGGTTTAGprotein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: mitochondrion, protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT5G66080.1); Has 3459 Blast hits to 3458 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1097; Fungi - 381; Plants - 1276; Viruses - 5; Other Eukaryotes - 696 (source: NCBI BLink). 
AT5G06755AT5G06755.1GAACCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown. 
AT5G07320AT5G07320.1AAAACCGGTmitochondrial substrate carrier family protein; FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), Mitochondrial substrate carrier (InterPro:IPR001993), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248), Mitochondrial carrier protein (InterPro:IPR002067), EF-HAND 2 (InterPro:IPR018249), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT5G61810.1); Has 25974 Blast hits to 15681 proteins in 989 species: Archae - 0; Bacteria - 9; Metazoa - 12328; Fungi - 6441; Plants - 4249; Viruses - 5; Other Eukaryotes - 2942 (source: NCBI BLink). 
AT5G07360AT5G07360.1GTAAACCGGTTTTamidase family protein; FUNCTIONS IN: amidase activity, carbon-nitrogen ligase activity, with glutamine as amido-N-donor; INVOLVED IN: acrylonitrile catabolic process, aldoxime metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Amidase signature enzyme (InterPro:IPR000120); BEST Arabidopsis thaliana protein match is: glutamyl-tRNA(Gln) amidotransferase, putative (TAIR:AT3G25660.1); Has 13555 Blast hits to 13547 proteins in 1426 species: Archae - 141; Bacteria - 6093; Metazoa - 496; Fungi - 872; Plants - 207; Viruses - 0; Other Eukaryotes - 5746 (source: NCBI BLink). 
AT5G07360.2GTAAACCGGTTTTamidase family protein; FUNCTIONS IN: amidase activity, carbon-nitrogen ligase activity, with glutamine as amido-N-donor; INVOLVED IN: acrylonitrile catabolic process, aldoxime metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Amidase signature enzyme (InterPro:IPR000120); BEST Arabidopsis thaliana protein match is: glutamyl-tRNA(Gln) amidotransferase, putative (TAIR:AT3G25660.1); Has 13555 Blast hits to 13547 proteins in 1426 species: Archae - 141; Bacteria - 6093; Metazoa - 496; Fungi - 872; Plants - 207; Viruses - 0; Other Eukaryotes - 5746 (source: NCBI BLink). 
AT5G07370AT5G07370.1AAAACCGGTTTACEncodes inositol polyphosphate kinase, which phosphorylates inositol 1,4,5-triphosphate and inositol 1,3,4,5-tetrakisphosphate to generate inositol 1,3,4,5,6-pentakisphosphate 
AT5G07370.2AAAACCGGTTTACEncodes inositol polyphosphate kinase, which phosphorylates inositol 1,4,5-triphosphate and inositol 1,3,4,5-tetrakisphosphate to generate inositol 1,3,4,5,6-pentakisphosphate 
AT5G07370.3AAAACCGGTTTACEncodes inositol polyphosphate kinase, which phosphorylates inositol 1,4,5-triphosphate and inositol 1,3,4,5-tetrakisphosphate to generate inositol 1,3,4,5,6-pentakisphosphate 
AT5G07370.4AAAACCGGTTTACEncodes inositol polyphosphate kinase, which phosphorylates inositol 1,4,5-triphosphate and inositol 1,3,4,5-tetrakisphosphate to generate inositol 1,3,4,5,6-pentakisphosphate 
AT5G08400AT5G08400.1TTGAACCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29400.1); Has 258 Blast hits to 258 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). 
AT5G08400.2TTGAACCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29400.1); Has 258 Blast hits to 258 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). 
AT5G09390AT5G09390.1GTAAACCGGTCD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT5G09390.2GTAAACCGGTCD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT5G09770AT5G09770.1AAAACCGGTTTGribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G64650.1); Has 5413 Blast hits to 5398 proteins in 1518 species: Archae - 0; Bacteria - 3032; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT5G10270AT5G10270.1AAAACCGGTCEncodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. 
AT5G10780AT5G10780.1ACCGGTTTGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). 
AT5G10780.2ACCGGTTTGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). 
AT5G11010AT5G11010.1ACCGGTTTTpre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT5G11010.2ACCGGTTTTpre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT5G11010.3ACCGGTTTTpre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT5G13680AT5G13680.1CTAAACCGGTATAA subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. 
AT5G13690AT5G13690.1TATACCGGTTTAGalpha-N-acetylglucosaminidase family / NAGLU family; FUNCTIONS IN: alpha-N-acetylglucosaminidase activity; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-N-acetylglucosaminidase (InterPro:IPR007781); Has 254 Blast hits to 246 proteins in 93 species: Archae - 0; Bacteria - 100; Metazoa - 87; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). 
AT5G13850AT5G13850.1ACCGGTTTGGNASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 3 (NACA3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT3G12390.1); Has 794 Blast hits to 784 proteins in 197 species: Archae - 0; Bacteria - 0; Metazoa - 341; Fungi - 176; Plants - 104; Viruses - 14; Other Eukaryotes - 159 (source: NCBI BLink). 
AT5G13890AT5G13890.1AAAACCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF716 (InterPro:IPR006904); Has 120 Blast hits to 118 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G13890.2AAAACCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF716 (InterPro:IPR006904); Has 120 Blast hits to 118 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G13890.3AAAACCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF716 (InterPro:IPR006904); Has 120 Blast hits to 118 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G17210AT5G17210.1CAAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13380.1); Has 229 Blast hits to 225 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 229; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G17210.2CAAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13380.1); Has 229 Blast hits to 225 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 229; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G17270AT5G17270.1ACCGGTTTtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G37130.1); Has 5379 Blast hits to 3587 proteins in 480 species: Archae - 397; Bacteria - 1752; Metazoa - 604; Fungi - 281; Plants - 148; Viruses - 0; Other Eukaryotes - 2197 (source: NCBI BLink). 
AT5G18440AT5G18440.1TTAACCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). 
AT5G18440.2TTAACCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). 
AT5G19690AT5G19690.1ACCGGTTTGencodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions 
AT5G19830AT5G19830.1AAACCGGTaminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, conserved site (InterPro:IPR018171), Peptidyl-tRNA hydrolase (InterPro:IPR001328); BEST Arabidopsis thaliana protein match is: peptidyl-tRNA hydrolase family protein (TAIR:AT5G16140.2); Has 5409 Blast hits to 5409 proteins in 1418 species: Archae - 0; Bacteria - 2886; Metazoa - 37; Fungi - 46; Plants - 76; Viruses - 0; Other Eukaryotes - 2364 (source: NCBI BLink). 
AT5G19910AT5G19910.1GAACCGGTTTAGGCCSOH1 family protein; FUNCTIONS IN: RNA polymerase II transcription mediator activity; INVOLVED IN: regulation of transcription; LOCATED IN: mediator complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SOH1 (InterPro:IPR008831); Has 313 Blast hits to 313 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 103; Plants - 26; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT5G22100AT5G22100.1ACCGGTTTRNA cyclase family protein; FUNCTIONS IN: RNA-3'-phosphate cyclase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA 3'-terminal phosphate cyclase- like (InterPro:IPR000228), RNA 3'-terminal phosphate cyclase, insert region (InterPro:IPR013796), RNA 3'-terminal phosphate cyclase-like, eukaryotic (InterPro:IPR016443), RNA 3'-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta (InterPro:IPR013792); Has 760 Blast hits to 750 proteins in 310 species: Archae - 113; Bacteria - 208; Metazoa - 233; Fungi - 95; Plants - 22; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT5G23300AT5G23300.1CAAACCGGTTAAdihydroorotate dehydrogenase, catalyses fourth step of pyrimidine biosynthesis 
AT5G23300.1TTAAACCGGTdihydroorotate dehydrogenase, catalyses fourth step of pyrimidine biosynthesis 
AT5G23310AT5G23310.1ACCGGTTTAAFe superoxide dismutase 
AT5G24020AT5G24020.1TTAAACCGGTTAAGEncodes a Ca2+ dependent ATPase required for correct positioning of the chloroplast division apparatus. Its ATPase activity is stimulated by AtMinE1, a topological specificity factor. 
AT5G24750AT5G24750.1TAACCGGTTTGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 976 Blast hits to 975 proteins in 299 species: Archae - 0; Bacteria - 617; Metazoa - 1; Fungi - 251; Plants - 63; Viruses - 14; Other Eukaryotes - 30 (source: NCBI BLink). 
AT5G26110AT5G26110.1AAAACCGGTTCAATP binding / catalytic/ protein kinase; FUNCTIONS IN: protein kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), RIO-like kinase (InterPro:IPR018934), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08120.1); Has 1182 Blast hits to 1178 proteins in 337 species: Archae - 148; Bacteria - 370; Metazoa - 229; Fungi - 137; Plants - 43; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT5G26110.2AAAACCGGTTCAATP binding / catalytic/ protein kinase; FUNCTIONS IN: protein kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), RIO-like kinase (InterPro:IPR018934), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08120.1); Has 1182 Blast hits to 1178 proteins in 337 species: Archae - 148; Bacteria - 370; Metazoa - 229; Fungi - 137; Plants - 43; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT5G28350AT5G28350.1ATAAACCGGTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1339 (InterPro:IPR009771), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61480.1); Has 271 Blast hits to 226 proteins in 106 species: Archae - 0; Bacteria - 9; Metazoa - 133; Fungi - 64; Plants - 30; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT5G28350.2ATAAACCGGTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1339 (InterPro:IPR009771), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61480.1); Has 271 Blast hits to 226 proteins in 106 species: Archae - 0; Bacteria - 9; Metazoa - 133; Fungi - 64; Plants - 30; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT5G28500AT5G28500.1CCAAACCGGTTTAAATCCGGTTCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04550.1); Has 79 Blast hits to 79 proteins in 36 species: Archae - 0; Bacteria - 52; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G35080AT5G35080.1ATAACCGGTTTGprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); Has 480 Blast hits to 361 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 316; Fungi - 98; Plants - 25; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). 
AT5G37850AT5G37850.2CGAACCGGTTTGEncodes a pyridoxal kinase required for root hair development. Mutants are hypersensitive to Na+, K+ and Li+. 
AT5G38660AT5G38660.1AAAACCGGTTCAAmutant has Altered acclimation responses; 
AT5G40150AT5G40150.1ACCGGTTTAAperoxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT3G28200.1); Has 3213 Blast hits to 3199 proteins in 258 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 351; Plants - 2806; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). 
AT5G40155AT5G40155.1TTAAACCGGTEncodes a defensin-like (DEFL) family protein. 
AT5G41150AT5G41150.1AAACCGGTTTConfers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins 
AT5G41150.1CTAAACCGGTTAAGConfers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins 
AT5G41150.2AAACCGGTTTConfers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins 
AT5G41150.2CTAAACCGGTTAAGConfers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins 
AT5G41210AT5G41210.1ACCGGTTTAGEncodes glutathione transferase belonging to the theta class of GSTs. Naming convention according to Wagner et al. (2002). 
AT5G41330AT5G41330.1ACCGGTTTATACCGGTTATpotassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT3G09030.1); Has 474 Blast hits to 473 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 378; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT5G42000AT5G42000.1CGGGTCGGGTCGGAAAACCGGTORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT5G42000.2CGGGTCGGGTCGGAAAACCGGTORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT5G42660AT5G42660.1ATAAACCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02910.1); Has 208 Blast hits to 208 proteins in 27 species: Archae - 6; Bacteria - 28; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). 
AT5G45010AT5G45010.1GACCGGTTTGArabidopsis dss1 homolog on chromosome V (ATDSS1(V)); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DSS1/SEM1 (InterPro:IPR007834); BEST Arabidopsis thaliana protein match is: ATDSS1(I) (ARABIDOPSIS THALIANA DELETION OF SUV3 SUPRESSOR 1(I)) (TAIR:AT1G64750.2); Has 233 Blast hits to 233 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 57; Plants - 43; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT5G45410AT5G45410.1ACCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G45410.2ACCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G45410.3ACCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G45900AT5G45900.1ATAAACCGGTTTTComponent of autophagy conjugation pathway. Required for proper senescence. 
AT5G49510AT5G49510.1ATAAACCGGTTAPREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT5G49510.2ATAAACCGGTTAPREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT5G49930AT5G49930.1TAACCGGTTTTembryo defective 1441 (emb1441); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Fibronectin-binding A, N-terminal (InterPro:IPR008616), Zinc finger, CCHC-type (InterPro:IPR001878), Protein of unknown function DUF814 (InterPro:IPR008532); Has 2906 Blast hits to 2454 proteins in 381 species: Archae - 144; Bacteria - 336; Metazoa - 995; Fungi - 294; Plants - 92; Viruses - 7; Other Eukaryotes - 1038 (source: NCBI BLink). 
AT5G50810AT5G50810.1TTAAACCGGTCGGGTCCGEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. 
AT5G51910AT5G51910.1AAACCGGTTCAATCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 547; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G51910.2AAACCGGTTCAATCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 547; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G52540AT5G52540.1ACCGGTTTAAunknown protein; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF819 (InterPro:IPR008537); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24000.1); Has 519 Blast hits to 519 proteins in 137 species: Archae - 2; Bacteria - 275; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 208 (source: NCBI BLink). 
AT5G54880AT5G54880.1TTAAACCGGTCDTW domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 518 Blast hits to 450 proteins in 183 species: Archae - 0; Bacteria - 364; Metazoa - 76; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT5G54900AT5G54900.1CCAAACCGGTCRNA-binding protein 45A (ATRBP45A); FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 26274 Blast hits to 15473 proteins in 616 species: Archae - 10; Bacteria - 1663; Metazoa - 15334; Fungi - 2743; Plants - 3912; Viruses - 0; Other Eukaryotes - 2612 (source: NCBI BLink). 
AT5G56350AT5G56350.1TTAAACCGGTpyruvate kinase, putative; FUNCTIONS IN: pyruvate kinase activity, potassium ion binding, magnesium ion binding, catalytic activity; INVOLVED IN: glycolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, C-terminal-like (InterPro:IPR015795), Pyruvate kinase, active site (InterPro:IPR018209), Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), Pyruvate kinase, alpha/beta (InterPro:IPR015794), Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate kinase (InterPro:IPR001697), Pyruvate kinase, barrel (InterPro:IPR015793); BEST Arabidopsis thaliana protein match is: pyruvate kinase, putative (TAIR:AT4G26390.1); Has 6880 Blast hits to 6803 proteins in 1521 species: Archae - 99; Bacteria - 3257; Metazoa - 491; Fungi - 169; Plants - 287; Viruses - 0; Other Eukaryotes - 2577 (source: NCBI BLink). 
AT5G57120AT5G57120.1ATAAACCGGTATAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif (InterPro:IPR006594), SRP40, C-terminal (InterPro:IPR007718); Has 90949 Blast hits to 45608 proteins in 1620 species: Archae - 300; Bacteria - 8281; Metazoa - 37603; Fungi - 8095; Plants - 3374; Viruses - 548; Other Eukaryotes - 32748 (source: NCBI BLink). 
AT5G57230AT5G57230.1ACCGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin-like fold (InterPro:IPR012336); Has 18 Blast hits to 18 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G58760AT5G58760.1TTAAACCGGTCdamaged DNA-binding 2 (DDB2); FUNCTIONS IN: nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G80710.1); Has 3318 Blast hits to 3006 proteins in 249 species: Archae - 18; Bacteria - 310; Metazoa - 1331; Fungi - 862; Plants - 258; Viruses - 0; Other Eukaryotes - 539 (source: NCBI BLink). 
AT5G59440AT5G59440.1GTAAACCGGTCEncodes thymidylate kinase which exists in two isoforms in plants. The longer variant of 263 amino acids with a N-terminal extension that is required for localization to the mitochondrion. The second isoform of 224 residues is localized to the cytoplasm and nucleoplasm. Peak of expression occurs during G1/S phase transition. 
AT5G59440.2GTAAACCGGTCEncodes thymidylate kinase which exists in two isoforms in plants. The longer variant of 263 amino acids with a N-terminal extension that is required for localization to the mitochondrion. The second isoform of 224 residues is localized to the cytoplasm and nucleoplasm. Peak of expression occurs during G1/S phase transition. 
AT5G59440.3GTAAACCGGTCEncodes thymidylate kinase which exists in two isoforms in plants. The longer variant of 263 amino acids with a N-terminal extension that is required for localization to the mitochondrion. The second isoform of 224 residues is localized to the cytoplasm and nucleoplasm. Peak of expression occurs during G1/S phase transition. 
AT5G60410AT5G60410.1CAAACCGGTCEncodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. 
AT5G60410.2CAAACCGGTCEncodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. 
AT5G60410.3CAAACCGGTCEncodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. 
AT5G60410.4CAAACCGGTCEncodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. 
AT5G60410.5CAAACCGGTCEncodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. 
AT5G61228AT5G61228.1GAACCGGTTTTUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF15 represents a conserved upstream opening reading frame relative to major ORF AT5G61230.1 
AT5G63870AT5G63870.1CAAACCGGTEncodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. 
AT5G63870.2CAAACCGGTEncodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. 
AT5G63870.3CAAACCGGTEncodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. 
AT5G64380AT5G64380.1CGAACCGGTTTATfructose-1,6-bisphosphatase family protein; FUNCTIONS IN: phosphoric ester hydrolase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase/Fructose-1,6-bisphosphatase (InterPro:IPR017955), Fructose-1,6-bisphosphatase (InterPro:IPR000146); BEST Arabidopsis thaliana protein match is: fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative (TAIR:AT3G54050.1); Has 2310 Blast hits to 2308 proteins in 803 species: Archae - 28; Bacteria - 1223; Metazoa - 325; Fungi - 104; Plants - 207; Viruses - 0; Other Eukaryotes - 423 (source: NCBI BLink). 
AT5G64830AT5G64830.1AAAACCGGTTAGGGCTTTATprogrammed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). 
AT5G64830.2AAAACCGGTTAGGGCTTTATprogrammed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). 
AT5G64960AT5G64960.1ATAACCGGTTTAAEncodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. 
AT5G64960.1TTTAACCGGTTTGEncodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. 
AT5G64960.2ATAACCGGTTTAAEncodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. 
AT5G64960.2TTTAACCGGTTTGEncodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. 
AT5G65310AT5G65310.1GTAAACCGGTEncodes a class I HDZip (homeodomain-leucine zipper) protein that is a positive regulator of ABA-responsiveness, mediating the inhibitory effect of ABA on growth during seedling establishment. 
AT5G65310.2GTAAACCGGTEncodes a class I HDZip (homeodomain-leucine zipper) protein that is a positive regulator of ABA-responsiveness, mediating the inhibitory effect of ABA on growth during seedling establishment. 
AT5G67300AT5G67300.1CTTAACCGGTTTCCGGTTATMember of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.