| Locus | Gene model | Sequence | Description |
| AT1G02816 | AT1G02816.1 | ATGACACGTGTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G03030 | AT1G03030.1 | ATGACACGTGTCT | phosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: kinase activity, phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uridine kinase (InterPro:IPR000764); Has 1794 Blast hits to 1794 proteins in 581 species: Archae - 7; Bacteria - 1124; Metazoa - 151; Fungi - 173; Plants - 39; Viruses - 0; Other Eukaryotes - 300 (source: NCBI BLink). |
| AT1G04920 | AT1G04920.1 | AACACGTGTCAT | Encodes a protein with putative sucrose-phosphate synthase activity. |
| AT1G05360 | AT1G05360.1 | ATGACACGTGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT1G05500 | AT1G05500.1 | ATGACGTGTCAT | NTMC2T2.1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: SYTD (TAIR:AT5G11100.1); Has 9319 Blast hits to 5090 proteins in 209 species: Archae - 0; Bacteria - 0; Metazoa - 6456; Fungi - 877; Plants - 1262; Viruses - 0; Other Eukaryotes - 724 (source: NCBI BLink). |
| AT1G08200 | AT1G08200.1 | ATGACACGTA | Encodes a putative UDP-D-apiose/UPD-D-xylose synthetase. |
| AT1G10590 | AT1G10590.1 | ATGACACGTGTT | DNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G10590.2 | ATGACACGTGTT | DNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G10590.3 | ATGACACGTGTT | DNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G10600 | AT1G10600.1 | AACACGTGTCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink). |
| AT1G10600.2 | AACACGTGTCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink). |
| AT1G10600.3 | AACACGTGTCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink). |
| AT1G11410 | AT1G11410.1 | CGTGTCAT | S-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Apple-like (InterPro:IPR003609), PAN-like, type 2 (InterPro:IPR013227), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), EGF-like, type 3 (InterPro:IPR000742), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus lectin protein kinase family protein (TAIR:AT1G11340.1); Has 88143 Blast hits to 86790 proteins in 3328 species: Archae - 53; Bacteria - 7715; Metazoa - 38620; Fungi - 6632; Plants - 19718; Viruses - 411; Other Eukaryotes - 14994 (source: NCBI BLink). |
| AT1G11840 | AT1G11840.1 | ATGACACG | Encodes a glyoxalase I homolog ATGLX1. |
| AT1G11840.1 | CCGCCACGTGTCAT | Encodes a glyoxalase I homolog ATGLX1. |
| AT1G11840.2 | ATGACACG | Encodes a glyoxalase I homolog ATGLX1. |
| AT1G11840.2 | CCGCCACGTGTCAT | Encodes a glyoxalase I homolog ATGLX1. |
| AT1G11840.3 | ATGACACG | Encodes a glyoxalase I homolog ATGLX1. |
| AT1G11840.3 | CCGCCACGTGTCAT | Encodes a glyoxalase I homolog ATGLX1. |
| AT1G11840.4 | ATGACACG | Encodes a glyoxalase I homolog ATGLX1. |
| AT1G11840.4 | CCGCCACGTGTCAT | Encodes a glyoxalase I homolog ATGLX1. |
| AT1G11840.5 | ATGACACG | Encodes a glyoxalase I homolog ATGLX1. |
| AT1G11840.5 | CCGCCACGTGTCAT | Encodes a glyoxalase I homolog ATGLX1. |
| AT1G15740 | AT1G15740.1 | TACACGTGTCAT | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT4G23840.1); Has 25965 Blast hits to 13594 proteins in 578 species: Archae - 6; Bacteria - 5108; Metazoa - 10615; Fungi - 448; Plants - 7228; Viruses - 79; Other Eukaryotes - 2481 (source: NCBI BLink). |
| AT1G15820 | AT1G15820.1 | TTCCACGTGTCAT | Lhcb6 protein (Lhcb6), light harvesting complex of photosystem II. |
| AT1G18460 | AT1G18460.1 | TACGTGTCAT | lipase family protein; FUNCTIONS IN: lipase activity; INVOLVED IN: glycerol biosynthetic process, lipid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AB-hydrolase associated lipase region (InterPro:IPR006693); BEST Arabidopsis thaliana protein match is: lipase family protein (TAIR:AT1G73920.1); Has 1378 Blast hits to 1358 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 1048; Fungi - 175; Plants - 88; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT1G19000 | AT1G19000.1 | AACACGTGTCAT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT1G19000.2 | AACACGTGTCAT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT1G21410 | AT1G21410.1 | TACACGTGTCAT | AtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. |
| AT1G21440 | AT1G21440.1 | ATGACACGTGGAT | mutase family protein; FUNCTIONS IN: isocitrate lyase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Isocitrate lyase and phosphorylmutase, conserved site (InterPro:IPR018523), Isocitrate lyase and phosphorylmutase (InterPro:IPR000918); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 6447 Blast hits to 6447 proteins in 860 species: Archae - 75; Bacteria - 2907; Metazoa - 29; Fungi - 322; Plants - 109; Viruses - 0; Other Eukaryotes - 3005 (source: NCBI BLink). |
| AT1G22550 | AT1G22550.1 | CGTGTCAT | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT1G22570.1); Has 4470 Blast hits to 4427 proteins in 803 species: Archae - 0; Bacteria - 2095; Metazoa - 435; Fungi - 295; Plants - 1111; Viruses - 0; Other Eukaryotes - 534 (source: NCBI BLink). |
| AT1G22770 | AT1G22770.1 | ATGACACGTA | Together with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering under long days in a circadian clock-controlled flowering pathway. GI acts earlier than CO and FT in the pathway by increasing CO and FT mRNA abundance. Located in the nucleus. Regulates several developmental processes, including photoperiod-mediated flowering, phytochrome B signaling, circadian clock, carbohydrate metabolism, and cold stress response. The gene's transcription is controlled by the circadian clock and it is post-transcriptionally regulated by light and dark. Forms a complex with FKF1 on the CO promoter to regulate CO expression. |
| AT1G24430 | AT1G24430.1 | ATGACACGT | transferase/ transferase, transferring acyl groups other than amino-acyl groups; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, transferase activity; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: transferase family protein (TAIR:AT3G26040.1); Has 920 Blast hits to 920 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 17; Plants - 903; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G25275 | AT1G25275.1 | ATGACACGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G25275.2 | ATGACACGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G25275.3 | ATGACACGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27350 | AT1G27350.1 | ATGACACGTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27330.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT1G27990 | AT1G27990.1 | ATGACACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52420.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G31750 | AT1G31750.1 | ACGTGTCAT | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 28504 Blast hits to 13839 proteins in 758 species: Archae - 8; Bacteria - 3021; Metazoa - 12889; Fungi - 3156; Plants - 5337; Viruses - 840; Other Eukaryotes - 3253 (source: NCBI BLink). |
| AT1G31830 | AT1G31830.1 | ATGACACG | amino acid permease family protein; FUNCTIONS IN: cationic amino acid transmembrane transporter activity; INVOLVED IN: transport, amino acid transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid/polyamine transporter I (InterPro:IPR002293), Amino acid permease-associated region (InterPro:IPR004841); BEST Arabidopsis thaliana protein match is: amino acid permease family protein (TAIR:AT1G31820.1); Has 14358 Blast hits to 14353 proteins in 1181 species: Archae - 249; Bacteria - 11483; Metazoa - 903; Fungi - 728; Plants - 243; Viruses - 0; Other Eukaryotes - 752 (source: NCBI BLink). |
| AT1G31830.2 | ATGACACG | amino acid permease family protein; FUNCTIONS IN: cationic amino acid transmembrane transporter activity; INVOLVED IN: transport, amino acid transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid/polyamine transporter I (InterPro:IPR002293), Amino acid permease-associated region (InterPro:IPR004841); BEST Arabidopsis thaliana protein match is: amino acid permease family protein (TAIR:AT1G31820.1); Has 14358 Blast hits to 14353 proteins in 1181 species: Archae - 249; Bacteria - 11483; Metazoa - 903; Fungi - 728; Plants - 243; Viruses - 0; Other Eukaryotes - 752 (source: NCBI BLink). |
| AT1G32380 | AT1G32380.1 | ATGACACGTA | ribose-phosphate pyrophosphokinase 2 / phosphoribosyl diphosphate synthetase 2 (PRS2); FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 1 / phosphoribosyl diphosphate synthetase 1 (PRSI) (TAIR:AT2G35390.2); Has 8056 Blast hits to 7889 proteins in 1556 species: Archae - 182; Bacteria - 3337; Metazoa - 501; Fungi - 457; Plants - 129; Viruses - 7; Other Eukaryotes - 3443 (source: NCBI BLink). |
| AT1G42990 | AT1G42990.1 | AACACGTGTCAT | AtbZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. GFP fusions containing the first 260 amino acids (AtbZIP60deltaC) are nuclear-localized. AtbZIP60 is upregulated by the addition of tunicamycin (ER stress response inductor), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress the protein is proteolyzed and the soluble part is translocalized into the nucleus. AtbZIP60deltaC can activate the promoters of the ER chaperones BiP1, BiP2 and BiP3 and CNX1 and CNX2 via binding to the ER stress response element (ERSE) and the plant unfolded protein response element(P-UPRE). It can also activate its own transcription. |
| AT1G43160 | AT1G43160.1 | ACGTGTCAT | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT1G43670 | AT1G43670.1 | CTGCCACGTGTCAT | fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative; FUNCTIONS IN: fructose 1,6-bisphosphate 1-phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: carbohydrate metabolic process, fructose metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase/Fructose-1,6-bisphosphatase (InterPro:IPR017955), Fructose-1,6-bisphosphatase (InterPro:IPR000146); BEST Arabidopsis thaliana protein match is: fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative (TAIR:AT3G54050.1); Has 2339 Blast hits to 2334 proteins in 798 species: Archae - 22; Bacteria - 1225; Metazoa - 341; Fungi - 107; Plants - 205; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink). |
| AT1G44446 | AT1G44446.1 | TACACGTGTCAT | Encodes chlorophyllide <i>a</i> oxygenase which converts chlorophyllide <i>a</i> to chlorophyllide <i>b</i> by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide <i>a</i> . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll <i>b</i> and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
| AT1G44446.2 | TACACGTGTCAT | Encodes chlorophyllide <i>a</i> oxygenase which converts chlorophyllide <i>a</i> to chlorophyllide <i>b</i> by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide <i>a</i> . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll <i>b</i> and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
| AT1G44446.3 | TACACGTGTCAT | Encodes chlorophyllide <i>a</i> oxygenase which converts chlorophyllide <i>a</i> to chlorophyllide <i>b</i> by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide <i>a</i> . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll <i>b</i> and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
| AT1G48830 | AT1G48830.1 | TACACGTGTCAT | 40S ribosomal protein S7 (RPS7A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT1G48830.2 | TACACGTGTCAT | 40S ribosomal protein S7 (RPS7A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT1G49340 | AT1G49340.1 | CGTGTCAT | Encodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots. |
| AT1G49340.2 | CGTGTCAT | Encodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots. |
| AT1G50770 | AT1G50770.1 | GAAACGACATCGTGTCAT | unknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G50790.1); Has 864 Blast hits to 735 proteins in 105 species: Archae - 0; Bacteria - 129; Metazoa - 142; Fungi - 42; Plants - 412; Viruses - 1; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT1G55080 | AT1G55080.1 | ATGACACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29580.1); Has 64498 Blast hits to 23302 proteins in 980 species: Archae - 12; Bacteria - 3118; Metazoa - 24455; Fungi - 7046; Plants - 5363; Viruses - 296; Other Eukaryotes - 24208 (source: NCBI BLink). |
| AT1G55480 | AT1G55480.1 | ATGACACGTGGCGA | binding / protein binding; FUNCTIONS IN: protein binding, binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), PDZ/DHR/GLGF (InterPro:IPR001478), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: LPA1 (LOW PSII ACCUMULATION1); binding (TAIR:AT1G02910.1); Has 203 Blast hits to 203 proteins in 54 species: Archae - 0; Bacteria - 65; Metazoa - 7; Fungi - 2; Plants - 97; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT1G56340 | AT1G56340.1 | ATGACACG | Encodes calreticulin CRT1. |
| AT1G56340.2 | ATGACACG | Encodes calreticulin CRT1. |
| AT1G62730 | AT1G62730.1 | ACGTCGTCGTGTCAT | transferase; FUNCTIONS IN: transferase activity; INVOLVED IN: biosynthetic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid synthase (InterPro:IPR008949), Squalene/phytoene synthase (InterPro:IPR002060); Has 671 Blast hits to 669 proteins in 308 species: Archae - 0; Bacteria - 381; Metazoa - 94; Fungi - 65; Plants - 24; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT1G62740 | AT1G62740.1 | ATGACACGACGACGT | stress-inducible protein, putative; FUNCTIONS IN: binding; INVOLVED IN: response to stress; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G12270.1); Has 34012 Blast hits to 14045 proteins in 887 species: Archae - 1292; Bacteria - 9292; Metazoa - 8243; Fungi - 1967; Plants - 2227; Viruses - 4; Other Eukaryotes - 10987 (source: NCBI BLink). |
| AT1G69010 | AT1G69010.1 | CCCACGTGTCAT | BES1-interacting Myc-like protein 2 (BIM2); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: dTDP-rhamnose biosynthetic process, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM1; DNA binding / protein binding / transcription factor (TAIR:AT5G08130.3); Has 1614 Blast hits to 1609 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 38; Plants - 1371; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G70760 | AT1G70760.1 | ATGACACGTGGAA | a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity. |
| AT1G72040 | AT1G72040.1 | CGCACGTGTCAT | deoxynucleoside kinase family; FUNCTIONS IN: phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Deoxynucleoside kinase (InterPro:IPR002624); Has 1720 Blast hits to 1716 proteins in 345 species: Archae - 0; Bacteria - 621; Metazoa - 410; Fungi - 0; Plants - 41; Viruses - 60; Other Eukaryotes - 588 (source: NCBI BLink). |
| AT1G73060 | AT1G73060.1 | AGCCACGTGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48790.1); Has 45 Blast hits to 45 proteins in 18 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G74780 | AT1G74780.1 | TCCACGTGTCAT | nodulin family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT1G18940.1); Has 1801 Blast hits to 1756 proteins in 510 species: Archae - 9; Bacteria - 869; Metazoa - 40; Fungi - 217; Plants - 319; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink). |
| AT1G74840 | AT1G74840.1 | AACACGTGTCAT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 9 processes; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G19000.2); Has 742 Blast hits to 741 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 677; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT1G77370 | AT1G77370.1 | TTGCCACGTGTCAT | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G20500.1); Has 4324 Blast hits to 4321 proteins in 856 species: Archae - 10; Bacteria - 1999; Metazoa - 364; Fungi - 233; Plants - 336; Viruses - 107; Other Eukaryotes - 1275 (source: NCBI BLink). |
| AT1G78510 | AT1G78510.1 | ATGACACGTGGT | Encodes a protein with solanesyl diphosphate synthase activity. |
| AT1G78510.2 | ATGACACGTGGT | Encodes a protein with solanesyl diphosphate synthase activity. |
| AT1G79040 | AT1G79040.1 | AGCCACGTGTCAT | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ. |
| AT1G79350 | AT1G79350.1 | GTCACGTGATGACACGTGA | embryo defective 1135 (EMB1135); FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: embryonic development ending in seed dormancy, regulation of transcription, DNA-dependent; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, LSD1-type (InterPro:IPR005735), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: ATXR6; DNA binding / protein binding (TAIR:AT5G24330.1); Has 3516 Blast hits to 3129 proteins in 248 species: Archae - 2; Bacteria - 434; Metazoa - 2253; Fungi - 273; Plants - 285; Viruses - 34; Other Eukaryotes - 235 (source: NCBI BLink). |
| AT2G03820 | AT2G03820.1 | ATGACACGTGGAT | nonsense-mediated mRNA decay NMD3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: nuclear-transcribed mRNA catabolic process, nonsense-mediated decay; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NMD3 (InterPro:IPR007064); Has 355 Blast hits to 345 proteins in 156 species: Archae - 8; Bacteria - 0; Metazoa - 129; Fungi - 90; Plants - 42; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G03890 | AT2G03890.1 | GATGACGTGTCAT | phosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT1G13640.1); Has 415 Blast hits to 408 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 52; Plants - 137; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT2G03890.2 | GATGACGTGTCAT | phosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT1G13640.1); Has 415 Blast hits to 408 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 52; Plants - 137; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT2G20260 | AT2G20260.1 | TCACACGTGTCAT | Encodes subunit E of photosystem I. |
| AT2G21280 | AT2G21280.1 | CGTGTCAT | A nuclear-encoded, plastid-targeted protein (AtSulA) whose overexpression causes severe yet stochastic plastid (shown in chloroplasts and leucoplasts) division defects. The protein does not appear to interact with either AtFtsZ proteins when studied in a yeast two-hybrid system. |
| AT2G24790 | AT2G24790.1 | ACGTGTCAT | Positive regulator of photomorphogenesis that acts downstream of COP1 but can promote lateral root development independently of COP1 and also function as a daylength-sensitive regulator of shoot branching. |
| AT2G24790.2 | ACGTGTCAT | Positive regulator of photomorphogenesis that acts downstream of COP1 but can promote lateral root development independently of COP1 and also function as a daylength-sensitive regulator of shoot branching. |
| AT2G25110 | AT2G25110.1 | ATGACACGTGTT | STROMAL CELL-DERIVED FACTOR 2-LIKE PROTEIN PRECURSOR (SDF2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MIR (InterPro:IPR003608), MIR motif (InterPro:IPR016093); Has 774 Blast hits to 744 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 337; Fungi - 338; Plants - 41; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT2G25900 | AT2G25900.1 | TACACGTGTCAT | putative Cys3His zinc finger protein (ATCTH) mRNA, complete |
| AT2G30570 | AT2G30570.1 | ATGACACGTGGA | Encodes a protein similar to photosystem II reaction center subunit W. |
| AT2G34650 | AT2G34650.1 | TCACACGTGTCAT | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
| AT2G39270 | AT2G39270.1 | ATGACACGTGTT | adenylate kinase family protein; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; CONTAINS InterPro DOMAIN/s: Adenylate kinase, subfamily (InterPro:IPR006259), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: ADK (ADENOSINE KINASE); adenylate kinase/ nucleotide kinase (TAIR:AT2G37250.1); Has 8604 Blast hits to 8484 proteins in 1852 species: Archae - 61; Bacteria - 4479; Metazoa - 995; Fungi - 287; Plants - 246; Viruses - 0; Other Eukaryotes - 2536 (source: NCBI BLink). |
| AT2G40880 | AT2G40880.1 | AGACACGTGTCAT | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmitic, cold stress). |
| AT2G43240 | AT2G43240.1 | ATGACACGTCAGC | nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G43240.2 | ATGACACGTCAGC | nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G44610 | AT2G44610.1 | ATGACACGTG | Encodes a GTP-binding protein with similarity to yeast YPT6 . RAB6 can complement the yeast YTP mutant. |
| AT2G45300 | AT2G45300.1 | AACACGTGTCAT | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis |
| AT2G46790 | AT2G46790.1 | ATGACACGTGTT | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. |
| AT2G46790.1 | CCCACGTGTCAT | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. |
| AT2G46790.2 | ATGACACGTGTT | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. |
| AT2G46790.2 | CCCACGTGTCAT | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. |
| AT2G47460 | AT2G47460.1 | CACACGTGTCAT | "MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. " The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. |
| AT3G01570 | AT3G01570.1 | TACGTGTCAT | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO2 (OLEOSIN 2) (TAIR:AT5G40420.1); Has 384 Blast hits to 384 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 384; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G05630 | AT3G05630.1 | TACGTGTCAT | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. |
| AT3G07140 | AT3G07140.1 | ACGTGTCAT | GPI transamidase component Gpi16 subunit family protein; FUNCTIONS IN: GPI-anchor transamidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gpi16 subunit, GPI transamidase component (InterPro:IPR007245); Has 252 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 88; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G07140.2 | ACGTGTCAT | GPI transamidase component Gpi16 subunit family protein; FUNCTIONS IN: GPI-anchor transamidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gpi16 subunit, GPI transamidase component (InterPro:IPR007245); Has 252 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 88; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G08630 | AT3G08630.1 | ATGACACGTGGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: alphavirus core protein family (TAIR:AT3G08640.1); Has 3471 Blast hits to 1913 proteins in 226 species: Archae - 0; Bacteria - 450; Metazoa - 1700; Fungi - 130; Plants - 787; Viruses - 19; Other Eukaryotes - 385 (source: NCBI BLink). |
| AT3G09640 | AT3G09640.1 | ATGACACGTGGT | Encodes a cytosolic ascorbate peroxidase APX2. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT3G09640.2 | ATGACACGTGGT | Encodes a cytosolic ascorbate peroxidase APX2. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT3G11770 | AT3G11770.1 | AGACACGTGTCAT | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT5G06450.1); Has 77 Blast hits to 77 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 30; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G12410 | AT3G12410.1 | ATGACACG | 3'-5' exonuclease/ nucleic acid binding; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease/ nucleic acid binding (TAIR:AT3G12460.1); Has 117 Blast hits to 109 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 2; Plants - 108; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G14730 | AT3G14730.1 | CGTGTCAT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 14433 Blast hits to 4909 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 53; Fungi - 48; Plants - 14121; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT3G15460 | AT3G15460.1 | CGTGTCATTAAGGCCCATG | brix domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: brix domain-containing protein (TAIR:AT1G52930.1); Has 299 Blast hits to 299 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 88; Plants - 33; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT3G15500 | AT3G15500.1 | ATCCACGTGTCAT | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. |
| AT3G15660 | AT3G15660.1 | ATGACACGACGTCGTT | GLUTAREDOXIN 4 (GRX4); FUNCTIONS IN: metal ion binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336), Glutaredoxin-related protein (InterPro:IPR004480); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT4G04950.1); Has 4103 Blast hits to 3965 proteins in 839 species: Archae - 12; Bacteria - 1387; Metazoa - 395; Fungi - 212; Plants - 231; Viruses - 0; Other Eukaryotes - 1866 (source: NCBI BLink). |
| AT3G15660.2 | ATGACACGACGTCGTT | GLUTAREDOXIN 4 (GRX4); FUNCTIONS IN: metal ion binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336), Glutaredoxin-related protein (InterPro:IPR004480); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT4G04950.1); Has 4103 Blast hits to 3965 proteins in 839 species: Archae - 12; Bacteria - 1387; Metazoa - 395; Fungi - 212; Plants - 231; Viruses - 0; Other Eukaryotes - 1866 (source: NCBI BLink). |
| AT3G16175 | AT3G16175.1 | ATGACACGTA | thioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52191.1); Has 207 Blast hits to 207 proteins in 44 species: Archae - 0; Bacteria - 4; Metazoa - 96; Fungi - 4; Plants - 99; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G18950 | AT3G18950.1 | TAAAACGCCACGTGTCAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G49450.1); Has 22480 Blast hits to 12151 proteins in 451 species: Archae - 14; Bacteria - 3107; Metazoa - 9780; Fungi - 4621; Plants - 1980; Viruses - 0; Other Eukaryotes - 2978 (source: NCBI BLink). |
| AT3G19390 | AT3G19390.1 | ATGACACGT | cysteine proteinase, putative / thiol protease, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Granulin (InterPro:IPR000118), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: cysteine proteinase, putative / thiol protease, putative (TAIR:AT5G43060.1); Has 7156 Blast hits to 6383 proteins in 610 species: Archae - 31; Bacteria - 127; Metazoa - 3743; Fungi - 6; Plants - 1232; Viruses - 124; Other Eukaryotes - 1893 (source: NCBI BLink). |
| AT3G20550 | AT3G20550.1 | ATGACACGTGTCA | Encodes a nuclear localized FHA (forhkead) domain containing protein.Mutant plants have shortened roots, delayed flowering time, altered floral organ number, defective floral organs and reduced fertility.Ddl mutants also show reduced levels of pri-miRNAs as well as mature miRNAs suggesting involvement in biogenesis of miRNAs. DDL does not affect transcription of miRNAs directly but may act through other proteins such as DCL. |
| AT3G21055 | AT3G21055.1 | ATGACACGTGGC | Encodes photosystem II 5 kD protein subunit PSII-T. This is a nuclear-encoded gene (PsbTn) which also has a plastid-encoded paralog (PsbTc). |
| AT3G21060 | AT3G21060.1 | GCCACGTGTCAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 4301 Blast hits to 3013 proteins in 248 species: Archae - 10; Bacteria - 960; Metazoa - 1315; Fungi - 1005; Plants - 275; Viruses - 0; Other Eukaryotes - 736 (source: NCBI BLink). |
| AT3G22200 | AT3G22200.1 | ATGACACGTCAC | Genetically redundant with POP3;mediates pollen tube guidance. Double mutants are self sterile; gamma-aminobutyrate transaminase subunit precursor; nuclear gene for mitochondrial product. Encodes gamma-aminobutyrate transaminase that uses pyruvate instead of alpha-ketoglutarate as cosubstrate. Mutations in POP2/HER1 render roots resistant to the inhibitory growth effects of the volatile organic compound E-2-hexenal implicated in plant defense. |
| AT3G22370 | AT3G22370.1 | TACACGTGTCAT | Encodes an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. |
| AT3G23050 | AT3G23050.1 | CAAGCCCACGTGTCAT | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. |
| AT3G23050.2 | CAAGCCCACGTGTCAT | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. |
| AT3G24440 | AT3G24440.1 | ATGACACGTGTACCCTAGA | Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM. |
| AT3G24500 | AT3G24500.1 | ATGACACGTCGTC | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses. |
| AT3G49530 | AT3G49530.1 | TTCCACGTGTCAT | Arabidopsis NAC domain containing protein 62 (anac062); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: TIP (TCV-INTERACTING PROTEIN); transcription coactivator/ transcription factor (TAIR:AT5G24590.2); Has 1568 Blast hits to 1566 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1568; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G51890 | AT3G51890.1 | ATGACACGTA | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: clathrin coat of trans-Golgi network vesicle, clathrin coat of coated pit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT2G40060.1); Has 258 Blast hits to 256 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 126; Fungi - 42; Plants - 56; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G53000 | AT3G53000.1 | CCGCCACGTGTCAT | Phloem protein 2-A15 (AtPP2-A15); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 289 Blast hits to 286 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 289; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G54050 | AT3G54050.1 | AAGCCACGTGTCAT | fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative; FUNCTIONS IN: fructose 1,6-bisphosphate 1-phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: response to cold, fructose metabolic process; LOCATED IN: apoplast, stromule, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase/Fructose-1,6-bisphosphatase (InterPro:IPR017955), Fructose-1,6-bisphosphatase (InterPro:IPR000146); BEST Arabidopsis thaliana protein match is: fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative (TAIR:AT1G43670.1); Has 2353 Blast hits to 2350 proteins in 800 species: Archae - 24; Bacteria - 1225; Metazoa - 332; Fungi - 108; Plants - 224; Viruses - 0; Other Eukaryotes - 440 (source: NCBI BLink). |
| AT3G54680 | AT3G54680.1 | TACGTGTCAT | proteophosphoglycan-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; Has 4087 Blast hits to 405 proteins in 103 species: Archae - 2; Bacteria - 51; Metazoa - 124; Fungi - 85; Plants - 81; Viruses - 11; Other Eukaryotes - 3733 (source: NCBI BLink). |
| AT3G57520 | AT3G57520.1 | ATGACACGTGGCAA | Arabidopsis thaliana seed imbibition 2 (AtSIP2); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Raffinose synthase (InterPro:IPR008811); BEST Arabidopsis thaliana protein match is: AtSIP1 (Arabidopsis thaliana seed imbibition 1); hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G55740.1); Has 272 Blast hits to 257 proteins in 79 species: Archae - 9; Bacteria - 35; Metazoa - 0; Fungi - 51; Plants - 171; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G57520.2 | ATGACACGTGGCAA | Arabidopsis thaliana seed imbibition 2 (AtSIP2); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Raffinose synthase (InterPro:IPR008811); BEST Arabidopsis thaliana protein match is: AtSIP1 (Arabidopsis thaliana seed imbibition 1); hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G55740.1); Has 272 Blast hits to 257 proteins in 79 species: Archae - 9; Bacteria - 35; Metazoa - 0; Fungi - 51; Plants - 171; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G57520.3 | ATGACACGTGGCAA | Arabidopsis thaliana seed imbibition 2 (AtSIP2); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Raffinose synthase (InterPro:IPR008811); BEST Arabidopsis thaliana protein match is: AtSIP1 (Arabidopsis thaliana seed imbibition 1); hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G55740.1); Has 272 Blast hits to 257 proteins in 79 species: Archae - 9; Bacteria - 35; Metazoa - 0; Fungi - 51; Plants - 171; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G57890 | AT3G57890.1 | CTGACGTGTCAT | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT2G42230.2); Has 286 Blast hits to 286 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT3G60640 | AT3G60640.1 | GCTGACGTGTCAT | AUTOPHAGY 8G (ATG8G); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: ATG8F (autophagy 8f); microtubule binding (TAIR:AT4G16520.2); Has 1156 Blast hits to 1154 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 574; Fungi - 125; Plants - 171; Viruses - 3; Other Eukaryotes - 283 (source: NCBI BLink). |
| AT3G62140 | AT3G62140.1 | ACCACGTGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; Has 331 Blast hits to 328 proteins in 104 species: Archae - 0; Bacteria - 6; Metazoa - 181; Fungi - 52; Plants - 23; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT3G62260 | AT3G62260.1 | ATGACACGTGTCAT | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink). |
| AT3G62260.2 | ATGACACGTGTCAT | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink). |
| AT3G62980 | AT3G62980.1 | AGACACGTGTCAT | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. |
| AT3G63460 | AT3G63460.1 | TGACGTGTCAT | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). |
| AT3G63460.2 | TGACGTGTCAT | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). |
| AT4G01120 | AT4G01120.1 | ATGACACGTGTAC | bZIP (basic leucine zipper) transcription factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light |
| AT4G05320 | AT4G05320.1 | TACACGTGTCAT | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. |
| AT4G05320.2 | TACACGTGTCAT | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. |
| AT4G05320.3 | TACACGTGTCAT | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. |
| AT4G05320.4 | TACACGTGTCAT | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. |
| AT4G05320.5 | TACACGTGTCAT | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. |
| AT4G05320.6 | TACACGTGTCAT | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. |
| AT4G13250 | AT4G13250.1 | ATGACACGTGTCA | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT5G04900.1); Has 51597 Blast hits to 51519 proteins in 2076 species: Archae - 367; Bacteria - 30349; Metazoa - 4261; Fungi - 2633; Plants - 1242; Viruses - 3; Other Eukaryotes - 12742 (source: NCBI BLink). |
| AT4G14900 | AT4G14900.1 | TACACGTGTCAT | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT3G22440.1); Has 1960 Blast hits to 1334 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 248; Fungi - 80; Plants - 1600; Viruses - 2; Other Eukaryotes - 22 (source: NCBI BLink). |
| AT4G15110 | AT4G15110.1 | ATGACACGTGTCAC | member of CYP97B |
| AT4G18140 | AT4G18140.1 | TACGTGTCAT | phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18140.2 | TACGTGTCAT | phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G21280 | AT4G21280.1 | ATGACACGTGGT | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G21280.2 | ATGACACGTGGT | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G25580 | AT4G25580.1 | TACGTGGCATGACACGTGGT | stress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT4G27840 | AT4G27840.1 | TTCCACGTGTCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: vesicle-associated membrane protein-related (TAIR:AT5G52990.1); Has 165 Blast hits to 165 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G28250 | AT4G28250.1 | ATGACACG | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G28250.2 | ATGACACG | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G29420 | AT4G29420.1 | ATGACACGT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 44 Blast hits to 42 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G29430 | AT4G29430.1 | ACGTGTCAT | ribosomal protein S15A E (rps15ae); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, mitochondrion, cytosolic ribosome, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: rps15ab (ribosomal protein S15A B); structural constituent of ribosome (TAIR:AT2G19720.1); Has 2257 Blast hits to 2257 proteins in 736 species: Archae - 184; Bacteria - 865; Metazoa - 322; Fungi - 130; Plants - 184; Viruses - 0; Other Eukaryotes - 572 (source: NCBI BLink). |
| AT4G31115 | AT4G31115.1 | ATGACACGTGGAA | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04440.1); Has 127 Blast hits to 127 proteins in 28 species: Archae - 0; Bacteria - 38; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT4G31115.2 | ATGACACGTGGAA | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04440.1); Has 127 Blast hits to 127 proteins in 28 species: Archae - 0; Bacteria - 38; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT4G31340 | AT4G31340.1 | CGTGTCAT | myosin heavy chain-related; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: DNA repair ATPase-related (TAIR:AT2G24420.2); Has 34880 Blast hits to 19753 proteins in 1289 species: Archae - 456; Bacteria - 3905; Metazoa - 16892; Fungi - 2497; Plants - 1119; Viruses - 175; Other Eukaryotes - 9836 (source: NCBI BLink). |
| AT4G31340.2 | CGTGTCAT | myosin heavy chain-related; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: DNA repair ATPase-related (TAIR:AT2G24420.2); Has 34880 Blast hits to 19753 proteins in 1289 species: Archae - 456; Bacteria - 3905; Metazoa - 16892; Fungi - 2497; Plants - 1119; Viruses - 175; Other Eukaryotes - 9836 (source: NCBI BLink). |
| AT4G33666 | AT4G33666.1 | TACGTGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 6 Blast hits to 6 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G34490 | AT4G34490.1 | GCCACGTGTCAT | CYCLASE ASSOCIATED PROTEIN |
| AT4G34870 | AT4G34870.1 | TACACGTGTCAT | belongs to cyclophilin family |
| AT4G34880 | AT4G34880.1 | TACACGTGTCAT | amidase family protein; FUNCTIONS IN: amidase activity, carbon-nitrogen ligase activity, with glutamine as amido-N-donor; INVOLVED IN: acrylonitrile catabolic process, aldoxime metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Amidase signature enzyme (InterPro:IPR000120); BEST Arabidopsis thaliana protein match is: amidase family protein (TAIR:AT5G07360.2); Has 10946 Blast hits to 10880 proteins in 1379 species: Archae - 132; Bacteria - 5130; Metazoa - 366; Fungi - 337; Plants - 155; Viruses - 0; Other Eukaryotes - 4826 (source: NCBI BLink). |
| AT4G39990 | AT4G39990.1 | TTCCACGTGTCAT | GTP-binding protein ATGB3 |
| AT5G03120 | AT5G03120.1 | ATGACACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G03240 | AT5G03240.1 | ATGACACGTA | encodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. |
| AT5G03240.2 | ATGACACGTA | encodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. |
| AT5G03240.3 | ATGACACGTA | encodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. |
| AT5G04120 | AT5G04120.1 | ATGACACGTGGT | phosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078), Phosphoglycerate/bisphosphoglycerate mutase (InterPro:IPR001345); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT3G50520.1); Has 8851 Blast hits to 8694 proteins in 1334 species: Archae - 50; Bacteria - 5552; Metazoa - 723; Fungi - 290; Plants - 143; Viruses - 0; Other Eukaryotes - 2093 (source: NCBI BLink). |
| AT5G04590 | AT5G04590.1 | CGCACGTGTCAT | A.thaliana gene encoding sulfite reductase. |
| AT5G05530 | AT5G05530.1 | ATGACACG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT4G18110.1); Has 3566 Blast hits to 3558 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 887; Fungi - 270; Plants - 1714; Viruses - 46; Other Eukaryotes - 649 (source: NCBI BLink). |
| AT5G05540 | AT5G05540.1 | ATGACACG | SMALL RNA DEGRADING NUCLEASE 2 (SDN2); FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: SDN3 (SMALL RNA DEGRADING NUCLEASE 3); exonuclease/ nucleic acid binding (TAIR:AT5G67240.1); Has 1287 Blast hits to 1276 proteins in 177 species: Archae - 0; Bacteria - 12; Metazoa - 608; Fungi - 388; Plants - 159; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). |
| AT5G05540.2 | ATGACACG | SMALL RNA DEGRADING NUCLEASE 2 (SDN2); FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: SDN3 (SMALL RNA DEGRADING NUCLEASE 3); exonuclease/ nucleic acid binding (TAIR:AT5G67240.1); Has 1287 Blast hits to 1276 proteins in 177 species: Archae - 0; Bacteria - 12; Metazoa - 608; Fungi - 388; Plants - 159; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). |
| AT5G05870 | AT5G05870.1 | CGTGTCAT | UDP-glucosyl transferase 76C1 (UGT76C1); FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT5G05880.1); Has 4917 Blast hits to 4898 proteins in 368 species: Archae - 0; Bacteria - 241; Metazoa - 1848; Fungi - 23; Plants - 2679; Viruses - 100; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT5G06730 | AT5G06730.1 | ATGACACG | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: plasma membrane; EXPRESSED IN: root, cultured cell; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT5G06720.1); Has 2943 Blast hits to 2927 proteins in 230 species: Archae - 0; Bacteria - 5; Metazoa - 2; Fungi - 106; Plants - 2785; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). |
| AT5G06760 | AT5G06760.1 | ATGACACGTC | late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); Has 477 Blast hits to 328 proteins in 98 species: Archae - 0; Bacteria - 70; Metazoa - 102; Fungi - 37; Plants - 214; Viruses - 1; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G07010 | AT5G07010.1 | ATGACACG | Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). |
| AT5G07380 | AT5G07380.1 | CGTGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 50 Blast hits to 48 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 34; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G07380.2 | CGTGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 50 Blast hits to 48 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 34; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G07380.3 | CGTGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 50 Blast hits to 48 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 34; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G07920 | AT5G07920.1 | CGTGTCAT | diacylglycerol kinase |
| AT5G08790 | AT5G08790.1 | CGTGTCAT | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
| AT5G10190 | AT5G10190.1 | GTCCACGTGTCAT | transporter-related; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: UNE2 (unfertilized embryo sac 2); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G78130.1); Has 8728 Blast hits to 8693 proteins in 1166 species: Archae - 209; Bacteria - 6596; Metazoa - 315; Fungi - 290; Plants - 194; Viruses - 2; Other Eukaryotes - 1122 (source: NCBI BLink). |
| AT5G10390 | AT5G10390.1 | ATGACACG | histone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, chloroplast, nucleosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G65360.1); Has 10280 Blast hits to 10277 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7396; Fungi - 1309; Plants - 999; Viruses - 0; Other Eukaryotes - 576 (source: NCBI BLink). |
| AT5G13820 | AT5G13820.1 | TCCACGTGTCAT | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding domain in C-terminus that prefers the sequence TTTAGGG. |
| AT5G14620 | AT5G14620.1 | ACGTGTCAT | A putative DNA methyltransferase with rearranged catalytic domains; similar to mammalian DNMT3 methyltransferases; contains UBA domains. The 3'-end proximal part of the gene coding region is highly methylated at both adenine and cytosine residues. |
| AT5G15160 | AT5G15160.1 | TCACGTGTCAT | bHLH family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: vacuole; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092); BEST Arabidopsis thaliana protein match is: PRE1 (PACLOBUTRAZOL RESISTANCE1); DNA binding / transcription factor (TAIR:AT5G39860.1); Has 72 Blast hits to 72 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G15910 | AT5G15910.1 | ATGACACGTGGAT | dehydrogenase-related; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 4174 Blast hits to 4174 proteins in 940 species: Archae - 63; Bacteria - 2510; Metazoa - 105; Fungi - 172; Plants - 313; Viruses - 2; Other Eukaryotes - 1009 (source: NCBI BLink). |
| AT5G16390 | AT5G16390.1 | ATGACACGTGGCGA | Encodes for the biotin carboxyl-carrier subunit of the multi-enzyme plastidial acetyl-coenzyme A carboxylase complex. |
| AT5G16390.2 | ATGACACGTGGCGA | Encodes for the biotin carboxyl-carrier subunit of the multi-enzyme plastidial acetyl-coenzyme A carboxylase complex. |
| AT5G19050 | AT5G19050.1 | ATGACACG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1749 (InterPro:IPR013744); Has 423 Blast hits to 292 proteins in 96 species: Archae - 0; Bacteria - 91; Metazoa - 43; Fungi - 150; Plants - 25; Viruses - 6; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT5G21920 | AT5G21920.1 | ATGCCACGTGTCAT | YGGT family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function YGGT (InterPro:IPR003425); BEST Arabidopsis thaliana protein match is: YGGT family protein (TAIR:AT4G27990.1); Has 1060 Blast hits to 1060 proteins in 353 species: Archae - 0; Bacteria - 642; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 348 (source: NCBI BLink). |
| AT5G21930 | AT5G21930.1 | ATGACACGTGGCAT | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport |
| AT5G21930.2 | ATGACACGTGGCAT | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport |
| AT5G22470 | AT5G22470.1 | ATGACACG | NAD+ ADP-ribosyltransferase; FUNCTIONS IN: NAD+ ADP-ribosyltransferase activity; INVOLVED IN: protein amino acid ADP-ribosylation; LOCATED IN: intracellular, nucleus; CONTAINS InterPro DOMAIN/s: WGR (InterPro:IPR008893), Poly(ADP-ribose) polymerase, regulatory region (InterPro:IPR004102), PADR1 (InterPro:IPR012982), Poly(ADP-ribose) polymerase, catalytic region (InterPro:IPR012317), BRCT (InterPro:IPR001357); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 515 Blast hits to 506 proteins in 104 species: Archae - 0; Bacteria - 9; Metazoa - 313; Fungi - 39; Plants - 59; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink). |
| AT5G24970 | AT5G24970.1 | TTGCCACGTGTCAT | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7448 Blast hits to 7430 proteins in 1103 species: Archae - 69; Bacteria - 2644; Metazoa - 345; Fungi - 303; Plants - 352; Viruses - 14; Other Eukaryotes - 3721 (source: NCBI BLink). |
| AT5G24980 | AT5G24980.1 | ATGACACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10745.1); Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G25390 | AT5G25390.1 | ATGACACG | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G25390.2 | ATGACACG | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G27770 | AT5G27770.1 | ATGACACG | 60S ribosomal protein L22 (RPL22C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22e (InterPro:IPR002671); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L22-2 (RPL22B) (TAIR:AT3G05560.3); Has 492 Blast hits to 492 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 89; Plants - 73; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT5G37260 | AT5G37260.1 | TCCACGTGTCAT | Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. |
| AT5G39530 | AT5G39530.1 | CGTGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39520.1); Has 172 Blast hits to 172 proteins in 54 species: Archae - 0; Bacteria - 88; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G40670 | AT5G40670.1 | ATGACACGTCATC | PQ-loop repeat family protein / transmembrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Lysosomal cystine transporter (InterPro:IPR005282); Has 261 Blast hits to 261 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 89; Plants - 21; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT5G42570 | AT5G42570.1 | GATGACGTGTCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B-cell receptor-associated 31-like (InterPro:IPR008417); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11905.1); Has 311 Blast hits to 268 proteins in 81 species: Archae - 2; Bacteria - 2; Metazoa - 134; Fungi - 41; Plants - 73; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT5G44760 | AT5G44760.1 | ATGACACG | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Phosphoribosyltransferase C-terminal, plant (InterPro:IPR013583), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT4G20080.1); Has 354 Blast hits to 204 proteins in 14 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 353; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G45300 | AT5G45300.1 | CGTGTCAT | BETA-AMYLASE 2 (BMY2); FUNCTIONS IN: cation binding, beta-amylase activity, catalytic activity; INVOLVED IN: cellulose biosynthetic process, carbohydrate metabolic process, polysaccharide catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 14 (InterPro:IPR001554), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: BAM7 (BETA-AMYLASE 7); beta-amylase/ catalytic/ cation binding (TAIR:AT2G45880.1); Has 843 Blast hits to 824 proteins in 149 species: Archae - 0; Bacteria - 74; Metazoa - 196; Fungi - 10; Plants - 492; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT5G45300.2 | CGTGTCAT | BETA-AMYLASE 2 (BMY2); FUNCTIONS IN: cation binding, beta-amylase activity, catalytic activity; INVOLVED IN: cellulose biosynthetic process, carbohydrate metabolic process, polysaccharide catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 14 (InterPro:IPR001554), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: BAM7 (BETA-AMYLASE 7); beta-amylase/ catalytic/ cation binding (TAIR:AT2G45880.1); Has 843 Blast hits to 824 proteins in 149 species: Archae - 0; Bacteria - 74; Metazoa - 196; Fungi - 10; Plants - 492; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT5G47200 | AT5G47200.1 | CTTAACCGTGTCAT | ATRAB1A; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1C; GTP binding (TAIR:AT4G17530.1); Has 23714 Blast hits to 23664 proteins in 649 species: Archae - 17; Bacteria - 107; Metazoa - 13262; Fungi - 2840; Plants - 2236; Viruses - 19; Other Eukaryotes - 5233 (source: NCBI BLink). |
| AT5G47910 | AT5G47910.1 | ATGACACG | NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT5G49270 | AT5G49270.1 | CGTGTCAT | Involved in successfully establishing tip growth in root hairs. |
| AT5G50460 | AT5G50460.1 | GACGTGTCAT | protein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT4G24920.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G51070 | AT5G51070.1 | TGACGTGTCAT | ATP-dependent Clp protease regulatory subunit |
| AT5G51150 | AT5G51150.1 | AAATGACGTGTCAT | unknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34630.1); Has 381 Blast hits to 298 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 87; Plants - 35; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). |
| AT5G52670 | AT5G52670.1 | ATGACACG | heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: metal ion binding (TAIR:AT5G52720.1); Has 117 Blast hits to 113 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G53570 | AT5G53570.1 | AACACGTGTCAT | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1). |
| AT5G53570.2 | AACACGTGTCAT | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1). |
| AT5G55670 | AT5G55670.1 | AACACGTGTCAT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT1G13190.1); Has 39714 Blast hits to 21553 proteins in 936 species: Archae - 21; Bacteria - 7210; Metazoa - 18978; Fungi - 3959; Plants - 3841; Viruses - 192; Other Eukaryotes - 5513 (source: NCBI BLink). |
| AT5G56540 | AT5G56540.1 | ACGTGTCAT | Encodes arabinogalactan protein (AGP14). |
| AT5G56750 | AT5G56750.1 | CGTGTCAT | Ndr family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell differentiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pollen specific protein SF21 (InterPro:IPR015511), Ndr (InterPro:IPR004142); BEST Arabidopsis thaliana protein match is: Ndr family protein (TAIR:AT2G19620.1); Has 620 Blast hits to 620 proteins in 81 species: Archae - 0; Bacteria - 31; Metazoa - 480; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G57660 | AT5G57660.1 | TACACGTGTCAT | zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc finger (B-box type) family protein (TAIR:AT5G24930.1); Has 1656 Blast hits to 1357 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1583; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT5G58090 | AT5G58090.1 | TACGTGTCAT | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT4G31140.1); Has 1739 Blast hits to 1690 proteins in 137 species: Archae - 0; Bacteria - 12; Metazoa - 0; Fungi - 53; Plants - 1666; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G60220 | AT5G60220.1 | AACACGTGTCATAATGGG | Member of TETRASPANIN family |
| AT5G60940 | AT5G60940.1 | CGCACGTGTCAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). |
| AT5G60940.2 | CGCACGTGTCAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). |
| AT5G65205 | AT5G65205.1 | ATGACACG | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT5G10050.1); Has 80678 Blast hits to 80522 proteins in 2307 species: Archae - 457; Bacteria - 44708; Metazoa - 6289; Fungi - 4215; Plants - 1677; Viruses - 2; Other Eukaryotes - 23330 (source: NCBI BLink). |
| AT5G65207 | AT5G65207.1 | ATGACACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10040.1); Has 8 Blast hits to 8 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G65940 | AT5G65940.1 | CCCACGTGTCAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G65940.2 | CCCACGTGTCAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G65940.3 | CCCACGTGTCAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G67250 | AT5G67250.1 | ATGACACGTGTT | Encodes an SKP1 interacting partner (SKIP2).Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,2, and 3. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| ATCG00770 | ATCG00770.1 | ATGACACG | chloroplast 30S ribosomal protein S8 |
| ATCG00780 | ATCG00780.1 | ATGACACG | encodes a chloroplast ribosomal protein L14, a constituent of the large subunit of the ribosomal complex |