| Locus | Gene model | Sequence | Description |
| AT1G01510 | AT1G01510.1 | ACGGCGTCGTTTA | Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. |
| AT1G01730 | AT1G01730.1 | ACGGCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 4; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G12310 | AT1G12310.1 | AAAACGACGCC | calmodulin, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT1G62820.1); Has 12140 Blast hits to 10293 proteins in 1212 species: Archae - 0; Bacteria - 26; Metazoa - 5264; Fungi - 3120; Plants - 2025; Viruses - 0; Other Eukaryotes - 1705 (source: NCBI BLink). |
| AT1G16250 | AT1G16250.1 | AAAACGACGCGGTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G63220.2); Has 7013 Blast hits to 3858 proteins in 178 species: Archae - 4; Bacteria - 338; Metazoa - 5746; Fungi - 21; Plants - 596; Viruses - 32; Other Eukaryotes - 276 (source: NCBI BLink). |
| AT1G19990 | AT1G19990.1 | TAAACGACGCCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11600.1); Has 10416 Blast hits to 6328 proteins in 368 species: Archae - 4; Bacteria - 381; Metazoa - 4559; Fungi - 839; Plants - 384; Viruses - 34; Other Eukaryotes - 4215 (source: NCBI BLink). |
| AT1G20300 | AT1G20300.1 | TAAACGACGCC | pentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G77360.1); Has 19529 Blast hits to 6019 proteins in 192 species: Archae - 5; Bacteria - 22; Metazoa - 563; Fungi - 464; Plants - 17637; Viruses - 0; Other Eukaryotes - 838 (source: NCBI BLink). |
| AT1G22300 | AT1G22300.1 | GCGTCGTT | Encodes a 14-3-3 protein. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT1G22300.2 | GCGTCGTT | Encodes a 14-3-3 protein. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT1G22300.3 | GCGTCGTT | Encodes a 14-3-3 protein. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT1G24180 | AT1G24180.1 | TAAACGACGC | Arabidopsis thaliana pyruvate dehydrogenase E1a-like subunit. 81% identical to a previously characterized Arabidopsis mitochondrial PDH E1a-subunit, At1g59900 |
| AT1G29470 | AT1G29470.1 | AAAACGACGCCGTTT | dehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT2G34300.2); Has 60693 Blast hits to 25760 proteins in 1331 species: Archae - 209; Bacteria - 12823; Metazoa - 19500; Fungi - 5083; Plants - 2714; Viruses - 653; Other Eukaryotes - 19711 (source: NCBI BLink). |
| AT1G29470.2 | AAAACGACGCCGTTT | dehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT2G34300.2); Has 60693 Blast hits to 25760 proteins in 1331 species: Archae - 209; Bacteria - 12823; Metazoa - 19500; Fungi - 5083; Plants - 2714; Viruses - 653; Other Eukaryotes - 19711 (source: NCBI BLink). |
| AT1G30810 | AT1G30810.1 | AAAACGACGCGTTTTG | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), FY-rich, C-terminal (InterPro:IPR003889), FY-rich, N-terminal (InterPro:IPR003888), Transcription factor jumonji, JmjN (InterPro:IPR003349), Zinc finger, C5HC2-type (InterPro:IPR004198), FY-rich, C-terminal subgroup (InterPro:IPR018516), Transcription factor jumonji (InterPro:IPR013129), FY-rich, N-terminal subgroup (InterPro:IPR018518); BEST Arabidopsis thaliana protein match is: MEE27 (maternal effect embryo arrest 27); transcription factor (TAIR:AT2G34880.1); Has 1543 Blast hits to 1140 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 960; Fungi - 297; Plants - 152; Viruses - 0; Other Eukaryotes - 134 (source: NCBI BLink). |
| AT1G30825 | AT1G30825.1 | AAACGGCGTCGTT | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT1G31170 | AT1G31170.1 | GAAACGACGCCGT | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT1G31170.2 | GAAACGACGCCGT | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT1G31170.3 | GAAACGACGCCGT | encodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress |
| AT1G32210 | AT1G32210.1 | AAAACGACGCCGTT | Encodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation. |
| AT1G32220 | AT1G32220.1 | AACGGCGTCGTTTT | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT1G32490 | AT1G32490.1 | AAAACGACGC | Encodes a homolog of the yeast PRP2 protein, one of four related DEAH RNA helicases identified as essential cofactors for RNA splicing. |
| AT1G60380 | AT1G60380.1 | ACGGCGTCGTTTT | apical meristem formation protein-related; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac024 (Arabidopsis NAC domain containing protein 24); transcription factor (TAIR:AT1G60350.1); Has 227 Blast hits to 222 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 227; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G63180 | AT1G63180.1 | GGCGTCGTT | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development. |
| AT1G65280 | AT1G65280.1 | TAAACGACGC | heat shock protein binding; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G22080.1); Has 22647 Blast hits to 16088 proteins in 1412 species: Archae - 102; Bacteria - 2761; Metazoa - 9875; Fungi - 2142; Plants - 1453; Viruses - 33; Other Eukaryotes - 6281 (source: NCBI BLink). |
| AT1G69640 | AT1G69640.1 | ACGGCGTCGTTTC | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT1G70530 | AT1G70530.1 | ACGGCGTCGTTTT | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF26 (InterPro:IPR002902), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G40380.1); Has 86025 Blast hits to 84934 proteins in 3436 species: Archae - 55; Bacteria - 7756; Metazoa - 37741; Fungi - 6539; Plants - 18862; Viruses - 424; Other Eukaryotes - 14648 (source: NCBI BLink). |
| AT1G70610 | AT1G70610.1 | GAAACGACGCGTTTTA | member of TAP subfamily |
| AT1G71840 | AT1G71840.1 | GCGTCGTTTA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 67893 Blast hits to 26212 proteins in 696 species: Archae - 58; Bacteria - 6808; Metazoa - 32655; Fungi - 12563; Plants - 6168; Viruses - 0; Other Eukaryotes - 9641 (source: NCBI BLink). |
| AT1G75020 | AT1G75020.1 | AACGACGCC | LYSOPHOSPHATIDYL ACYLTRANSFERASE 4 (LPAT4); FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT5; acyltransferase (TAIR:AT3G18850.4); Has 1540 Blast hits to 1538 proteins in 412 species: Archae - 0; Bacteria - 617; Metazoa - 462; Fungi - 118; Plants - 77; Viruses - 4; Other Eukaryotes - 262 (source: NCBI BLink). |
| AT1G75020.2 | AACGACGCC | LYSOPHOSPHATIDYL ACYLTRANSFERASE 4 (LPAT4); FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT5; acyltransferase (TAIR:AT3G18850.4); Has 1540 Blast hits to 1538 proteins in 412 species: Archae - 0; Bacteria - 617; Metazoa - 462; Fungi - 118; Plants - 77; Viruses - 4; Other Eukaryotes - 262 (source: NCBI BLink). |
| AT1G75180 | AT1G75180.1 | GCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75180.2 | GCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75180.3 | GCGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G79830 | AT1G79830.1 | GAAACGACGCCGTTT | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). |
| AT1G79830.2 | GAAACGACGCCGTTT | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). |
| AT2G20820 | AT2G20820.1 | ACGGCGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 28 Blast hits to 28 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G20820.2 | ACGGCGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 28 Blast hits to 28 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G34040 | AT2G34040.1 | TGAACCGGCGTCGTTTT | apoptosis inhibitory 5 (API5) family protein; FUNCTIONS IN: binding; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Apoptosis inhibitory 5 (InterPro:IPR008383), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: apoptosis inhibitory 5 (API5) family protein (TAIR:AT1G29030.1); Has 245 Blast hits to 233 proteins in 69 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 14; Plants - 56; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT2G34040.2 | TGAACCGGCGTCGTTTT | apoptosis inhibitory 5 (API5) family protein; FUNCTIONS IN: binding; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Apoptosis inhibitory 5 (InterPro:IPR008383), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: apoptosis inhibitory 5 (API5) family protein (TAIR:AT1G29030.1); Has 245 Blast hits to 233 proteins in 69 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 14; Plants - 56; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT2G35320 | AT2G35320.1 | TAAACGACGCC | homologue of the animal Eyes Absent genes. encodes a tyrosine-specific phosphatase. the protein sequence lacks the cys-containing signature of the classical tyrosine phosphatases. belongs to the aspartate-based phosphatases. The enzyme activity is strictly metal-dependent. |
| AT2G37400 | AT2G37400.1 | AAAACGACGCCGT | chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast thylakoid lumen, plastid, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT3G53560.1); Has 1554 Blast hits to 1284 proteins in 289 species: Archae - 132; Bacteria - 762; Metazoa - 103; Fungi - 19; Plants - 70; Viruses - 0; Other Eukaryotes - 468 (source: NCBI BLink). |
| AT2G38550 | AT2G38550.1 | ACGGCGTCGTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57280.1); Has 94 Blast hits to 92 proteins in 26 species: Archae - 0; Bacteria - 4; Metazoa - 3; Fungi - 4; Plants - 69; Viruses - 7; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT2G40620 | AT2G40620.1 | AAACGACGC | bZIP transcription factor family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: AtbZIP52 (Arabidopsis thaliana basic leucine zipper 52); DNA binding / transcription factor (TAIR:AT1G06850.1); Has 1256 Blast hits to 1226 proteins in 140 species: Archae - 0; Bacteria - 14; Metazoa - 289; Fungi - 48; Plants - 766; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT2G46490 | AT2G46490.1 | AACGGCGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35110.1); Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G01280 | AT3G01280.1 | TAAACGACGCCGTTTA | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
| AT3G01910 | AT3G01910.1 | AAAACGACGCCGTT | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT3G01910.2 | AAAACGACGCCGTT | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT3G01910.3 | AAAACGACGCCGTT | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT3G02460 | AT3G02460.1 | ACGGCGTCGTTTC | plant adhesion molecule, putative; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: PAM1 (plant adhesion molecule 1); RAB GTPase activator (TAIR:AT5G15930.1); Has 4072 Blast hits to 4066 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 2318; Fungi - 725; Plants - 269; Viruses - 0; Other Eukaryotes - 760 (source: NCBI BLink). |
| AT3G02460.2 | ACGGCGTCGTTTC | plant adhesion molecule, putative; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: PAM1 (plant adhesion molecule 1); RAB GTPase activator (TAIR:AT5G15930.1); Has 4072 Blast hits to 4066 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 2318; Fungi - 725; Plants - 269; Viruses - 0; Other Eukaryotes - 760 (source: NCBI BLink). |
| AT3G06590 | AT3G06590.1 | AAAACGACGCC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT3G17100.2); Has 141 Blast hits to 141 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G06590.2 | AAAACGACGCC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT3G17100.2); Has 141 Blast hits to 141 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G09570 | AT3G09570.1 | ACGGCGTCGTTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18520.1); Has 385 Blast hits to 385 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 216; Fungi - 12; Plants - 132; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT3G13410 | AT3G13410.1 | AAAACGACGCCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55546.1); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13845 | AT3G13845.1 | GAAACGACGCCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 11 Blast hits to 11 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15990 | AT3G15990.1 | GAAACGACGC | Encodes sulfate transporter Sultr3;4. |
| AT3G16750 | AT3G16750.1 | ACGGCGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4694 Blast hits to 1384 proteins in 164 species: Archae - 36; Bacteria - 1175; Metazoa - 1347; Fungi - 379; Plants - 64; Viruses - 23; Other Eukaryotes - 1670 (source: NCBI BLink). |
| AT3G22430 | AT3G22430.1 | AACGACGCCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 493 Blast hits to 438 proteins in 88 species: Archae - 2; Bacteria - 43; Metazoa - 185; Fungi - 27; Plants - 37; Viruses - 4; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT3G24200 | AT3G24200.1 | AAACGGCGTCGTTT | FAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink). |
| AT3G24200.2 | AAACGGCGTCGTTT | FAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink). |
| AT3G26410 | AT3G26410.1 | AAACGACGC | methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT3G55070 | AT3G55070.1 | AACGACGCCGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT3G55070.2 | AACGACGCCGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT3G59190 | AT3G59190.1 | AAACGGCGTCGTTTC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, embryo, seed; EXPRESSED DURING: D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G59200.1); Has 1274 Blast hits to 1236 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1274; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G60240 | AT3G60240.2 | GCGTCGTTTC | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
| AT3G60240.3 | GCGTCGTTTC | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
| AT3G60240.4 | GCGTCGTTTC | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
| AT4G01560 | AT4G01560.1 | ACGGCGTCGTTTA | maternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 218; Fungi - 225; Plants - 59; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT4G04350 | AT4G04350.1 | AACGGCGTCGTTTC | EMBRYO DEFECTIVE 2369 (EMB2369); FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, leucine-tRNA ligase activity, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Leucyl-tRNA synthetase, class Ia, bacterial/mitochondrial (InterPro:IPR002302), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Aminoacyl-tRNA synthetase, class Ia (InterPro:IPR002300), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: OVA2 (ovule abortion 2); ATP binding / aminoacyl-tRNA ligase/ isoleucine-tRNA ligase/ nucleotide binding (TAIR:AT5G49030.2); Has 28364 Blast hits to 26241 proteins in 1865 species: Archae - 900; Bacteria - 12390; Metazoa - 742; Fungi - 524; Plants - 168; Viruses - 3; Other Eukaryotes - 13637 (source: NCBI BLink). |
| AT4G21930 | AT4G21930.1 | GCGTCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61930.1); Has 196 Blast hits to 196 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G22720 | AT4G22720.1 | TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). |
| AT4G22720.2 | TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). |
| AT4G26310 | AT4G26310.1 | AAACGACGCCGT | elongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT3G08740.1); Has 6706 Blast hits to 6706 proteins in 1428 species: Archae - 6; Bacteria - 4287; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 2373 (source: NCBI BLink). |
| AT4G26550 | AT4G26550.1 | GAAACGACGCCGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SFT2-like (InterPro:IPR011691); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56020.1); Has 452 Blast hits to 452 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 198; Fungi - 89; Plants - 61; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). |
| AT4G27090 | AT4G27090.1 | AAAACGACGCCGTTTT | 60S ribosomal protein L14 (RPL14B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14A) (TAIR:AT2G20450.1); Has 520 Blast hits to 520 proteins in 229 species: Archae - 47; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT4G27390 | AT4G27390.1 | TAAACGACGCGTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 63 Blast hits to 63 proteins in 30 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G28590 | AT4G28590.1 | AAACGACGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31840.1); Has 81 Blast hits to 81 proteins in 33 species: Archae - 2; Bacteria - 0; Metazoa - 16; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT4G29820 | AT4G29820.1 | GCGTCGTTTT | Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit. |
| AT4G29830 | AT4G29830.1 | AAAACGACGC | The protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin. |
| AT4G29850 | AT4G29850.1 | AAACGACGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0414 (InterPro:IPR008590); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19350.1); Has 188 Blast hits to 188 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31290 | AT4G31290.1 | CGAACCGAAACGACGCCGTT | ChaC-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ChaC-like protein (InterPro:IPR006840); BEST Arabidopsis thaliana protein match is: ChaC-like family protein (TAIR:AT5G26220.1); Has 1092 Blast hits to 1086 proteins in 379 species: Archae - 0; Bacteria - 540; Metazoa - 194; Fungi - 85; Plants - 75; Viruses - 0; Other Eukaryotes - 198 (source: NCBI BLink). |
| AT4G32060 | AT4G32060.1 | TAAACGACGCCGT | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); Has 902 Blast hits to 878 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 729; Fungi - 55; Plants - 46; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT4G32060.2 | TAAACGACGCCGT | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); Has 902 Blast hits to 878 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 729; Fungi - 55; Plants - 46; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT4G32710 | AT4G32710.1 | AACGACGCC | ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATPERK1 (PROLINE EXTENSIN-LIKE RECEPTOR KINASE 1); ATP binding / protein kinase (TAIR:AT3G24550.1); Has 87667 Blast hits to 86649 proteins in 3166 species: Archae - 53; Bacteria - 7959; Metazoa - 38002; Fungi - 7110; Plants - 19079; Viruses - 374; Other Eukaryotes - 15090 (source: NCBI BLink). |
| AT4G32900 | AT4G32900.1 | GCGTCGTTTT | aminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 486 Blast hits to 486 proteins in 195 species: Archae - 103; Bacteria - 0; Metazoa - 148; Fungi - 84; Plants - 38; Viruses - 6; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT4G32900.2 | GCGTCGTTTT | aminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 486 Blast hits to 486 proteins in 195 species: Archae - 103; Bacteria - 0; Metazoa - 148; Fungi - 84; Plants - 38; Viruses - 6; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT4G32910 | AT4G32910.1 | AAAACGACGC | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoporin, Nup85-like (InterPro:IPR011502); Has 161 Blast hits to 158 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 128; Fungi - 10; Plants - 21; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G33690 | AT4G33690.1 | AAAACGACGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: pollen tube; Has 499 Blast hits to 464 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 283; Fungi - 48; Plants - 38; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). |
| AT4G33920 | AT4G33920.1 | AAAACGACGC | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: mitochondrion, protein serine/threonine phosphatase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51370.1); Has 3521 Blast hits to 3519 proteins in 216 species: Archae - 0; Bacteria - 7; Metazoa - 1157; Fungi - 386; Plants - 1254; Viruses - 3; Other Eukaryotes - 714 (source: NCBI BLink). |
| AT4G35740 | AT4G35740.1 | AAACGGCGTCGTTTC | RecQl3; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA recombination; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DNA helicase, ATP-dependent, RecQ type (InterPro:IPR004589), DNA helicase, ATP-dependent, RecQ type, N-terminal region (InterPro:IPR018329), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RECQL2 (ARABIDOPSIS RECQ HELICASE L2); 3'-5' DNA helicase/ ATP-dependent helicase/ four-way junction helicase/ protein binding (TAIR:AT1G31360.1); Has 20515 Blast hits to 20463 proteins in 1611 species: Archae - 344; Bacteria - 10151; Metazoa - 3213; Fungi - 2195; Plants - 965; Viruses - 10; Other Eukaryotes - 3637 (source: NCBI BLink). |
| AT4G35740.2 | AAACGGCGTCGTTTC | RecQl3; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA recombination; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DNA helicase, ATP-dependent, RecQ type (InterPro:IPR004589), DNA helicase, ATP-dependent, RecQ type, N-terminal region (InterPro:IPR018329), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RECQL2 (ARABIDOPSIS RECQ HELICASE L2); 3'-5' DNA helicase/ ATP-dependent helicase/ four-way junction helicase/ protein binding (TAIR:AT1G31360.1); Has 20515 Blast hits to 20463 proteins in 1611 species: Archae - 344; Bacteria - 10151; Metazoa - 3213; Fungi - 2195; Plants - 965; Viruses - 10; Other Eukaryotes - 3637 (source: NCBI BLink). |
| AT4G37390 | AT4G37390.1 | AACGACGCC | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
| AT4G39350 | AT4G39350.1 | GCGTCGTTTT | Encodes a cellulose synthase isomer, related to CESA6. |
| AT4G39680 | AT4G39680.1 | GAAACGACGCCGT | SAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26630.2); Has 10132 Blast hits to 6217 proteins in 537 species: Archae - 24; Bacteria - 931; Metazoa - 3852; Fungi - 1124; Plants - 2077; Viruses - 539; Other Eukaryotes - 1585 (source: NCBI BLink). |
| AT4G39680.2 | GAAACGACGCCGT | SAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26630.2); Has 10132 Blast hits to 6217 proteins in 537 species: Archae - 24; Bacteria - 931; Metazoa - 3852; Fungi - 1124; Plants - 2077; Viruses - 539; Other Eukaryotes - 1585 (source: NCBI BLink). |
| AT4G39690 | AT4G39690.1 | ACGGCGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; Has 6265 Blast hits to 4855 proteins in 651 species: Archae - 26; Bacteria - 1226; Metazoa - 2506; Fungi - 658; Plants - 238; Viruses - 35; Other Eukaryotes - 1576 (source: NCBI BLink). |
| AT5G02270 | AT5G02270.1 | TCAAAACGGCGTCGTT | member of NAP subfamily |
| AT5G02280 | AT5G02280.1 | AACGACGCCGTTTTGA | synbindin, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: cis-Golgi network; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sybindin-like protein (InterPro:IPR007233), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: synbindin, putative (TAIR:AT1G51160.2); Has 419 Blast hits to 413 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 194; Fungi - 100; Plants - 56; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT5G04885 | AT5G04885.1 | AAAACGACGCC | glycosyl hydrolase family 3 protein; FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 7 plant structures; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 3 protein (TAIR:AT5G20950.2); Has 5829 Blast hits to 5471 proteins in 844 species: Archae - 20; Bacteria - 2907; Metazoa - 6; Fungi - 873; Plants - 279; Viruses - 0; Other Eukaryotes - 1744 (source: NCBI BLink). |
| AT5G10240 | AT5G10240.1 | TCAAAACGCGTCGTTTT | Encodes asparagine synthetase (ASN3). |
| AT5G10240.2 | TCAAAACGCGTCGTTTT | Encodes asparagine synthetase (ASN3). |
| AT5G15450 | AT5G15450.1 | GGCGTCGTTTA | Encodes a chloroplast-targeted Hsp101 homologue. Functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. APG6 expression is upregulated in response to heat shock in various organs, but not in response to other abiotic stresses. Apg6 mutants have a pale-green phenotype. |
| AT5G17700 | AT5G17700.1 | AAAACGACGC | MATE efflux family protein; FUNCTIONS IN: drug transporter activity, antiporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT3G03620.1); Has 5190 Blast hits to 5101 proteins in 1067 species: Archae - 107; Bacteria - 3403; Metazoa - 117; Fungi - 210; Plants - 710; Viruses - 0; Other Eukaryotes - 643 (source: NCBI BLink). |
| AT5G18540 | AT5G18540.1 | AACGACGCCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; Has 2276 Blast hits to 850 proteins in 109 species: Archae - 2; Bacteria - 9; Metazoa - 1490; Fungi - 256; Plants - 238; Viruses - 0; Other Eukaryotes - 281 (source: NCBI BLink). |
| AT5G18540.2 | AACGACGCCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; Has 2276 Blast hits to 850 proteins in 109 species: Archae - 2; Bacteria - 9; Metazoa - 1490; Fungi - 256; Plants - 238; Viruses - 0; Other Eukaryotes - 281 (source: NCBI BLink). |
| AT5G22650 | AT5G22650.1 | AAAACGACGCCGT | Encodes a member of a plant-specific class of histone deacetylases. Controls the development of adaxial/abaxial leaf polarity. Its mRNA is widely expressed in stems, leaves, flowers and young siliques. Plant lines expressing RNAi constructs directed against this gene showed a marked reduction in agrobacterium-mediated root transformation. |
| AT5G22650.2 | AAAACGACGCCGT | Encodes a member of a plant-specific class of histone deacetylases. Controls the development of adaxial/abaxial leaf polarity. Its mRNA is widely expressed in stems, leaves, flowers and young siliques. Plant lines expressing RNAi constructs directed against this gene showed a marked reduction in agrobacterium-mediated root transformation. |
| AT5G25440 | AT5G25440.1 | GAAACGACGCC | protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G11410.1); Has 37433 Blast hits to 37026 proteins in 1128 species: Archae - 24; Bacteria - 1745; Metazoa - 15094; Fungi - 1709; Plants - 13857; Viruses - 129; Other Eukaryotes - 4875 (source: NCBI BLink). |
| AT5G41150 | AT5G41150.1 | TAAACGACGCCGTTTTGA | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G41150.2 | TAAACGACGCCGTTTTGA | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G45930 | AT5G45930.1 | GGCGTCGTT | encodes a second Chl I gene (CHLI2), a subunit of magnesium chelatase which is required for chlorophyll biosynthesis. Has ATPase activity, regulated by TRX-f. Involved in the assembly of the Mg chelatase complex. |
| AT5G48657 | AT5G48657.1 | AAGCGCGTCGTT | defense protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT3G07195.1); Has 49 Blast hits to 47 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G48657.2 | AAGCGCGTCGTT | defense protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT3G07195.1); Has 49 Blast hits to 47 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G53300 | AT5G53300.1 | GCGTCGTTTC | Encodes a ubiquitin conjugating enzyme. |
| AT5G53300.2 | GCGTCGTTTC | Encodes a ubiquitin conjugating enzyme. |
| AT5G53300.3 | GCGTCGTTTC | Encodes a ubiquitin conjugating enzyme. |
| AT5G53310 | AT5G53310.1 | GAAACGACGC | myosin heavy chain-related; FUNCTIONS IN: motor activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Myosin tail 2 (InterPro:IPR010926); Has 312 Blast hits to 312 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 37; Plants - 16; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G53570 | AT5G53570.1 | GAAACGACGC | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1). |
| AT5G53570.2 | GAAACGACGC | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1). |
| AT5G54500 | AT5G54500.1 | AACGGCGTCGTTTT | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
| AT5G65350 | AT5G65350.1 | AACGACGC | histone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G65360.1); Has 10270 Blast hits to 10267 proteins in 5328 species: Archae - 0; Bacteria - 0; Metazoa - 7395; Fungi - 1305; Plants - 999; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink). |
| AT5G65840 | AT5G65840.1 | AAAACGACGCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37240.1); Has 167 Blast hits to 165 proteins in 51 species: Archae - 0; Bacteria - 28; Metazoa - 51; Fungi - 13; Plants - 59; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G66650 | AT5G66650.1 | GCGTCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23790.1); Has 272 Blast hits to 270 proteins in 89 species: Archae - 2; Bacteria - 0; Metazoa - 132; Fungi - 36; Plants - 70; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |