Organism | Arabidopsis thaliana | |
ID | AtREG440 | |
Sequence | CACGTCAG | |
Annotation | ABA | |
PPDB Motif | ACGT | bZIP-binding motif, environmental responses |
PLACE Motif | ACGT | ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis; | ACGTG | ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis; |
Total Entry Count | 196 |
Locus | Gene model | Sequence | Description |
AT1G01630 | AT1G01630.1 | CTGACGTGGGCTCA | SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G14820.3); Has 2114 Blast hits to 2114 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 944; Fungi - 440; Plants - 452; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink).  |
AT1G01720 | AT1G01720.1 | TCGCCACGTCAGC | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA.  |
AT1G03905 | AT1G03905.1 | CTGACGTGGCGA | ABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink).  |
AT1G03905.1 | CTGACGTGGCGA | ABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink).  | |
AT1G06680 | AT1G06680.1 | CTGACGTGGAA | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution.  |
AT1G06680.2 | CTGACGTGGAA | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution.  | |
AT1G07030 | AT1G07030.1 | GCTGACGTGTCA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G30160.1); Has 19774 Blast hits to 10070 proteins in 353 species: Archae - 0; Bacteria - 0; Metazoa - 9836; Fungi - 5154; Plants - 2928; Viruses - 0; Other Eukaryotes - 1856 (source: NCBI BLink).  |
AT1G08830 | AT1G08830.1 | CTGACGTGGCTTTTT | Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress.  |
AT1G08830.2 | CTGACGTGGCTTTTT | Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress.  | |
AT1G09210 | AT1G09210.1 | CTGACGTGTCG | calreticulin 2 (CRT2); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: response to oxidative stress, response to salt stress; LOCATED IN: mitochondrion, endoplasmic reticulum, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Calreticulin (InterPro:IPR009169), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein binding (TAIR:AT1G56340.2); Has 6897 Blast hits to 3331 proteins in 371 species: Archae - 6; Bacteria - 265; Metazoa - 3811; Fungi - 490; Plants - 317; Viruses - 187; Other Eukaryotes - 1821 (source: NCBI BLink).  |
AT1G14900 | AT1G14900.1 | GTCCACGTCAG | Encodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA.  |
AT1G17440 | AT1G17440.1 | CTGACGTGTAC | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression.  |
AT1G17440.2 | CTGACGTGTAC | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression.  | |
AT1G17680 | AT1G17680.1 | CTGACGTG | transcription factor-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 5115 Blast hits to 2913 proteins in 387 species: Archae - 48; Bacteria - 954; Metazoa - 1578; Fungi - 711; Plants - 242; Viruses - 52; Other Eukaryotes - 1530 (source: NCBI BLink).  |
AT1G17680.2 | CTGACGTG | transcription factor-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 5115 Blast hits to 2913 proteins in 387 species: Archae - 48; Bacteria - 954; Metazoa - 1578; Fungi - 711; Plants - 242; Viruses - 52; Other Eukaryotes - 1530 (source: NCBI BLink).  | |
AT1G18330 | AT1G18330.1 | CTGACGTGGCAC | EARLY-PHYTOCHROME-RESPONSIVE1  |
AT1G18330.2 | CTGACGTGGCAC | EARLY-PHYTOCHROME-RESPONSIVE1  | |
AT1G19190 | AT1G19190.1 | CACGTCAGC | hydrolase; FUNCTIONS IN: hydrolase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Lipase, GDXG, active site (InterPro:IPR002168), Alpha/beta hydrolase fold-3 (InterPro:IPR013094); BEST Arabidopsis thaliana protein match is: hydrolase (TAIR:AT2G03550.1); Has 5587 Blast hits to 5577 proteins in 861 species: Archae - 47; Bacteria - 2876; Metazoa - 576; Fungi - 522; Plants - 655; Viruses - 3; Other Eukaryotes - 908 (source: NCBI BLink).  |
AT1G19890 | AT1G19890.1 | CCACGTCAGC | histone 3.3, male-gamete-specific expression  |
AT1G23280 | AT1G23280.1 | GCTGACGTG | MAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink).  |
AT1G26665 | AT1G26665.1 | TTCCACGTCAGC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: RNA polymerase II mediator complex protein-related (TAIR:AT5G41910.1); Has 223 Blast hits to 223 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 83; Plants - 24; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G26665.2 | TTCCACGTCAGC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: RNA polymerase II mediator complex protein-related (TAIR:AT5G41910.1); Has 223 Blast hits to 223 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 83; Plants - 24; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT1G26799 | AT1G26799.1 | CACGTCAGC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26796.1); Has 67 Blast hits to 63 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G29390 | AT1G29390.1 | GCTGACGTGGAA | encodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.  |
AT1G29390.2 | GCTGACGTGGAA | encodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.  | |
AT1G29395 | AT1G29395.1 | GCTGACGTGG | encodes a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. Possibly targeted to thylakoid membrane.  |
AT1G44000 | AT1G44000.1 | GCTGACGTGGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G11911.1); Has 133 Blast hits to 131 proteins in 47 species: Archae - 0; Bacteria - 53; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G54740 | AT1G54740.1 | CTGACGTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G22110.1); Has 479 Blast hits to 317 proteins in 60 species: Archae - 0; Bacteria - 25; Metazoa - 81; Fungi - 16; Plants - 88; Viruses - 0; Other Eukaryotes - 269 (source: NCBI BLink).  |
AT1G55810 | AT1G55810.1 | CTGACGTGGAT | uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink).  |
AT1G55810.2 | CTGACGTGGAT | uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink).  | |
AT1G55810.3 | CTGACGTGGAT | uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink).  | |
AT1G56340 | AT1G56340.1 | CCACGTCAGC | Encodes calreticulin CRT1.  |
AT1G56340.2 | CCACGTCAGC | Encodes calreticulin CRT1.  | |
AT1G57850 | AT1G57850.1 | CTGACGTGTCA | Toll-Interleukin-Resistance (TIR) domain-containing protein; FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: signal transduction, defense response, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: leaf lamina base, leaf whorl, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.10 ten leaves visible, LP.02 two leaves visible, LP.12 twelve leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: Toll-Interleukin-Resistance (TIR) domain-containing protein (TAIR:AT2G03300.1); Has 846 Blast hits to 806 proteins in 40 species: Archae - 0; Bacteria - 3; Metazoa - 2; Fungi - 0; Plants - 841; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G68010 | AT1G68010.1 | GCCACGTCAGC | Encodes hydroxypyruvate reductase.  |
AT1G72510 | AT1G72510.1 | CTGACGTGGCTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G72510.2 | CTGACGTGGCTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G72650 | AT1G72650.1 | CTGACGTGGCAAT | Arabidopsis thaliana myb family transcription factor (At1g72650)  |
AT1G72650.2 | CTGACGTGGCAAT | Arabidopsis thaliana myb family transcription factor (At1g72650)  | |
AT1G73170 | AT1G73170.1 | GCTGACGTGTCT | ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).  |
AT1G73170.2 | GCTGACGTGTCT | ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).  | |
AT1G74730 | AT1G74730.1 | CTGACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1118 (InterPro:IPR009500); Has 41 Blast hits to 41 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G79340 | AT1G79340.1 | ATGCCACGTCAG | metacaspase 4 (AtMC4); FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600); BEST Arabidopsis thaliana protein match is: ATMC5 (ARABIDOPSIS THALIANA METACASPASE 5); cysteine-type endopeptidase (TAIR:AT1G79330.1); Has 835 Blast hits to 815 proteins in 210 species: Archae - 5; Bacteria - 241; Metazoa - 2; Fungi - 193; Plants - 189; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).  |
AT1G79790 | AT1G79790.1 | CTGACGTGGAC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).  |
AT1G79790.2 | CTGACGTGGAC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).  | |
AT1G80060 | AT1G80060.1 | CTGACGTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32270.1); Has 97 Blast hits to 97 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT2G01590 | AT2G01590.1 | GCTGACGTGGC | Likely a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located in the membrane fraction of chloroplast. Mutant has impaired NAD(P)H dehydrogenase activity.  |
AT2G01900 | AT2G01900.1 | GTCCACGTCAG | endonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: hydrolase activity, inositol or phosphatidylinositol phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: sepal, hypocotyl, root; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Inositol polyphosphate related phosphatase (InterPro:IPR000300), Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: endonuclease/exonuclease/phosphatase family protein (TAIR:AT2G37440.1); Has 1513 Blast hits to 1357 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 597; Fungi - 340; Plants - 368; Viruses - 0; Other Eukaryotes - 208 (source: NCBI BLink).  |
AT2G03850 | AT2G03850.1 | CACGTCAGC | late embryogenesis abundant domain-containing protein / LEA domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT2G03740.1); Has 393 Blast hits to 214 proteins in 69 species: Archae - 1; Bacteria - 67; Metazoa - 15; Fungi - 12; Plants - 269; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT2G05070 | AT2G05070.1 | CTGACGTGTAC | Encodes Lhcb2.2. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus.  |
AT2G16640 | AT2G16640.1 | GTCCACGTCAGC | MULTIMERIC TRANSLOCON COMPLEX IN THE OUTER ENVELOPE MEMBRANE 132 (TOC132); FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: protein targeting to chloroplast; LOCATED IN: chloroplast outer membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloroplast protein import component Toc86/159 (InterPro:IPR005690), AIG1 (InterPro:IPR006703); BEST Arabidopsis thaliana protein match is: ATTOC120; GTP binding (TAIR:AT3G16620.1); Has 6352 Blast hits to 4186 proteins in 415 species: Archae - 14; Bacteria - 449; Metazoa - 2396; Fungi - 635; Plants - 342; Viruses - 83; Other Eukaryotes - 2433 (source: NCBI BLink).  |
AT2G17870 | AT2G17870.1 | GCTGACGTGGCGA | cold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink).  |
AT2G18193 | AT2G18193.1 | CTGACGTGTAC | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: endomembrane system; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT2G18190.1); Has 15970 Blast hits to 14789 proteins in 1627 species: Archae - 790; Bacteria - 4301; Metazoa - 3207; Fungi - 2071; Plants - 1436; Viruses - 30; Other Eukaryotes - 4135 (source: NCBI BLink).  |
AT2G24550 | AT2G24550.1 | CCACGTCAGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G31510.1); Has 115 Blast hits to 115 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 2; Plants - 108; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT2G29630 | AT2G29630.1 | GGACACGTCAGC | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene.  |
AT2G29630.2 | GGACACGTCAGC | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene.  | |
AT2G31810 | AT2G31810.1 | GCTGACGTGT | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink).  |
AT2G31810.2 | GCTGACGTGT | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink).  | |
AT2G31810.3 | GCTGACGTGT | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink).  | |
AT2G33540 | AT2G33540.1 | GCTGACGTGTAC | C-TERMINAL DOMAIN PHOSPHATASE-LIKE 3 (CPL3); FUNCTIONS IN: phosphoprotein phosphatase activity, CTD phosphatase activity; INVOLVED IN: response to salt stress; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: FCP1-like phosphatase, phosphatase domain (InterPro:IPR011947), NLI interacting factor (InterPro:IPR004274), BRCT (InterPro:IPR001357); BEST Arabidopsis thaliana protein match is: CPL4 (C-TERMINAL DOMAIN PHOSPHATASE-LIKE 4); phosphoprotein phosphatase (TAIR:AT5G58003.1); Has 1270 Blast hits to 886 proteins in 180 species: Archae - 0; Bacteria - 80; Metazoa - 438; Fungi - 191; Plants - 138; Viruses - 2; Other Eukaryotes - 421 (source: NCBI BLink).  |
AT2G34430 | AT2G34430.1 | ACACGTCAG | Photosystem II type I chlorophyll a/b-binding protein  |
AT2G34740 | AT2G34740.1 | GCTGACGTGTCG | catalytic/ protein serine/threonine phosphatase; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 5333 Blast hits to 5320 proteins in 675 species: Archae - 7; Bacteria - 1029; Metazoa - 1363; Fungi - 524; Plants - 1327; Viruses - 11; Other Eukaryotes - 1072 (source: NCBI BLink).  |
AT2G37250 | AT2G37250.1 | ATGCCACGTCAG | encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth  |
AT2G40490 | AT2G40490.1 | ATCCACGTCAGC | HEME2; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME1; uroporphyrinogen decarboxylase (TAIR:AT3G14930.2); Has 5539 Blast hits to 5539 proteins in 1187 species: Archae - 101; Bacteria - 2315; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2763 (source: NCBI BLink).  |
AT2G42750 | AT2G42750.1 | TTGCCACGTCAGC | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G23240.1); Has 11990 Blast hits to 11989 proteins in 1806 species: Archae - 113; Bacteria - 4757; Metazoa - 2272; Fungi - 965; Plants - 810; Viruses - 15; Other Eukaryotes - 3058 (source: NCBI BLink).  |
AT2G43240 | AT2G43240.1 | ATGACACGTCAGC | nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  |
AT2G43240.2 | ATGACACGTCAGC | nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  | |
AT2G44360 | AT2G44360.1 | CCACGTCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G45170 | AT2G45170.1 | ACACGTCAGC | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes.  |
AT2G45170.1 | GCTGACGTGTCT | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes.  | |
AT2G45170.2 | ACACGTCAGC | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes.  | |
AT2G45170.2 | GCTGACGTGTCT | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes.  | |
AT2G46790 | AT2G46790.1 | AAGCCACGTCAGC | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.  |
AT2G46790.2 | AAGCCACGTCAGC | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.  | |
AT2G46820 | AT2G46820.1 | CCGCCACGTCAGC | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits.  |
AT2G46820.2 | CCGCCACGTCAGC | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits.  | |
AT2G46850 | AT2G46850.1 | CGACACGTCAG | ATP binding / protein kinase/ protein tyrosine kinase; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G23450.2); Has 14254 Blast hits to 14061 proteins in 404 species: Archae - 0; Bacteria - 73; Metazoa - 2017; Fungi - 136; Plants - 11571; Viruses - 17; Other Eukaryotes - 440 (source: NCBI BLink).  |
AT2G47860 | AT2G47860.1 | CTGACGTGT | phototropic-responsive NPH3 family protein; FUNCTIONS IN: protein binding, signal transducer activity; INVOLVED IN: response to light stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ fold (InterPro:IPR011333); BEST Arabidopsis thaliana protein match is: phototropic-responsive NPH3 family protein (TAIR:AT1G03010.1); Has 432 Blast hits to 418 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 432; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G47860.2 | CTGACGTGT | phototropic-responsive NPH3 family protein; FUNCTIONS IN: protein binding, signal transducer activity; INVOLVED IN: response to light stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ fold (InterPro:IPR011333); BEST Arabidopsis thaliana protein match is: phototropic-responsive NPH3 family protein (TAIR:AT1G03010.1); Has 432 Blast hits to 418 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 432; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G02380 | AT3G02380.1 | ATCCACGTCAGC | homologous to the flowering-time gene CONSTANS (CO) encoding zinc-finger proteins  |
AT3G02830 | AT3G02830.1 | CTGACGTGT | Encodes a zinc finger protein.  |
AT3G02940 | AT3G02940.1 | GGACACGTCAG | Encodes a putative transcription factor (MYB107).  |
AT3G07680 | AT3G07680.1 | ACACGTCAG | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 protein-related (TAIR:AT3G22845.1); Has 672 Blast hits to 672 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 151; Plants - 95; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink).  |
AT3G08890 | AT3G08890.1 | GTCCACGTCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37070.1); Has 268 Blast hits to 266 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 268; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G08890.2 | GTCCACGTCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37070.1); Has 268 Blast hits to 266 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 268; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G09690 | AT3G09690.1 | CCGCCACGTCAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
AT3G09690.2 | CCGCCACGTCAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  | |
AT3G10620 | AT3G10620.1 | CACGTCAG | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26 (ATNUDX26); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX27 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT5G06340.1); Has 3528 Blast hits to 3526 proteins in 752 species: Archae - 0; Bacteria - 1779; Metazoa - 13; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 1695 (source: NCBI BLink).  |
AT3G13445 | AT3G13445.1 | GCTGACGTGGC | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex  |
AT3G13445.2 | GCTGACGTGGC | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex  | |
AT3G13450 | AT3G13450.1 | CTGACGTGGCT | branched chain alpha-keto acid dehydrogenase E1 beta  |
AT3G13550 | AT3G13550.1 | CCACGTCAGC | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark.  |
AT3G13550.2 | CCACGTCAGC | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark.  | |
AT3G13670 | AT3G13670.1 | CTGACGTGGCAT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G25760.1); Has 12090 Blast hits to 12038 proteins in 826 species: Archae - 10; Bacteria - 3127; Metazoa - 4213; Fungi - 955; Plants - 1425; Viruses - 207; Other Eukaryotes - 2153 (source: NCBI BLink).  |
AT3G18350 | AT3G18350.1 | GCTGACGTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF639 (InterPro:IPR006927); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48840.1); Has 84 Blast hits to 81 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G18930 | AT3G18930.1 | CTGACGTGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G40250.1); Has 5776 Blast hits to 5756 proteins in 221 species: Archae - 0; Bacteria - 0; Metazoa - 1856; Fungi - 419; Plants - 2604; Viruses - 59; Other Eukaryotes - 838 (source: NCBI BLink).  |
AT3G18930.2 | CTGACGTGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G40250.1); Has 5776 Blast hits to 5756 proteins in 221 species: Archae - 0; Bacteria - 0; Metazoa - 1856; Fungi - 419; Plants - 2604; Viruses - 59; Other Eukaryotes - 838 (source: NCBI BLink).  | |
AT3G18980 | AT3G18980.1 | ACACGTCAGC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G18910.1); Has 525 Blast hits to 500 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 525; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G18980.1 | ACACGTCAGC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G18910.1); Has 525 Blast hits to 500 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 525; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G18980.2 | ACACGTCAGC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G18910.1); Has 525 Blast hits to 500 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 525; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G18980.2 | ACACGTCAGC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G18910.1); Has 525 Blast hits to 500 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 525; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G24503 | AT3G24503.1 | GCTGACGTGTGA | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively  |
AT3G26935 | AT3G26935.1 | AGACACGTCAGC | zinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT5G41060.1); Has 3999 Blast hits to 3989 proteins in 185 species: Archae - 0; Bacteria - 0; Metazoa - 1952; Fungi - 537; Plants - 411; Viruses - 0; Other Eukaryotes - 1099 (source: NCBI BLink).  |
AT3G27690 | AT3G27690.1 | GCTGACGTGTCT | Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus.  |
AT3G45310 | AT3G45310.1 | ACACGTCAG | cysteine proteinase, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: AALP (Arabidopsis aleurain-like protease); cysteine-type peptidase (TAIR:AT5G60360.1); Has 6209 Blast hits to 6164 proteins in 602 species: Archae - 25; Bacteria - 133; Metazoa - 2840; Fungi - 4; Plants - 1213; Viruses - 129; Other Eukaryotes - 1865 (source: NCBI BLink).  |
AT3G45310.2 | ACACGTCAG | cysteine proteinase, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: AALP (Arabidopsis aleurain-like protease); cysteine-type peptidase (TAIR:AT5G60360.1); Has 6209 Blast hits to 6164 proteins in 602 species: Archae - 25; Bacteria - 133; Metazoa - 2840; Fungi - 4; Plants - 1213; Viruses - 129; Other Eukaryotes - 1865 (source: NCBI BLink).  | |
AT3G47500 | AT3G47500.1 | GCTGACGTGT | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions.  |
AT3G54500 | AT3G54500.1 | CTGACGTGGCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT3G54500.2 | CTGACGTGGCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT3G55660 | AT3G55660.1 | CTGACGTGGCAG | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.  |
AT3G56800 | AT3G56800.1 | GCTGACGTGACA | encodes a calmodulin  |
AT3G57890 | AT3G57890.1 | CTGACGTGTCAT | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT2G42230.2); Has 286 Blast hits to 286 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  |
AT3G60640 | AT3G60640.1 | GCTGACGTGTCAT | AUTOPHAGY 8G (ATG8G); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: ATG8F (autophagy 8f); microtubule binding (TAIR:AT4G16520.2); Has 1156 Blast hits to 1154 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 574; Fungi - 125; Plants - 171; Viruses - 3; Other Eukaryotes - 283 (source: NCBI BLink).  |
AT4G00490 | AT4G00490.1 | CTGACGTGTCA | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. Mutant of BAM2 has no visible phenotype.  |
AT4G01050 | AT4G01050.1 | GTCCACGTCAGC | hydroxyproline-rich glycoprotein family protein, contains a rhodanese homology domain.  |
AT4G01100 | AT4G01100.1 | GCTGACGTG | ADENINE NUCLEOTIDE TRANSPORTER 1 (ADNT1); FUNCTIONS IN: binding, ADP transmembrane transporter activity, AMP transmembrane transporter activity, ATP transmembrane transporter activity; INVOLVED IN: in 6 processes; LOCATED IN: mitochondrion, mitochondrial inner membrane, plasma membrane, plastid, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT5G51050.1); Has 20204 Blast hits to 10344 proteins in 365 species: Archae - 0; Bacteria - 0; Metazoa - 10389; Fungi - 5277; Plants - 2571; Viruses - 0; Other Eukaryotes - 1967 (source: NCBI BLink).  |
AT4G02940 | AT4G02940.1 | AGCCACGTCAGC | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G48080.1); Has 143 Blast hits to 141 proteins in 42 species: Archae - 0; Bacteria - 8; Metazoa - 22; Fungi - 12; Plants - 70; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  |
AT4G08180 | AT4G08180.1 | TCGCCACGTCAGC | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1C (ORP1C); FUNCTIONS IN: phosphoinositide binding, oxysterol binding; INVOLVED IN: steroid metabolic process, signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Oxysterol-binding protein (InterPro:IPR000648), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: ORP1D (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1D); oxysterol binding (TAIR:AT1G13170.1); Has 2131 Blast hits to 1984 proteins in 165 species: Archae - 0; Bacteria - 4; Metazoa - 1234; Fungi - 475; Plants - 169; Viruses - 0; Other Eukaryotes - 249 (source: NCBI BLink).  |
AT4G08180.2 | TCGCCACGTCAGC | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1C (ORP1C); FUNCTIONS IN: phosphoinositide binding, oxysterol binding; INVOLVED IN: steroid metabolic process, signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Oxysterol-binding protein (InterPro:IPR000648), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: ORP1D (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1D); oxysterol binding (TAIR:AT1G13170.1); Has 2131 Blast hits to 1984 proteins in 165 species: Archae - 0; Bacteria - 4; Metazoa - 1234; Fungi - 475; Plants - 169; Viruses - 0; Other Eukaryotes - 249 (source: NCBI BLink).  | |
AT4G08180.3 | TCGCCACGTCAGC | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1C (ORP1C); FUNCTIONS IN: phosphoinositide binding, oxysterol binding; INVOLVED IN: steroid metabolic process, signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Oxysterol-binding protein (InterPro:IPR000648), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: ORP1D (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1D); oxysterol binding (TAIR:AT1G13170.1); Has 2131 Blast hits to 1984 proteins in 165 species: Archae - 0; Bacteria - 4; Metazoa - 1234; Fungi - 475; Plants - 169; Viruses - 0; Other Eukaryotes - 249 (source: NCBI BLink).  | |
AT4G08330 | AT4G08330.1 | ATCCACGTCAGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G17705.1); Has 48 Blast hits to 48 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G11980 | AT4G11980.1 | CTGACGTG | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 14 (ATNUDX14); FUNCTIONS IN: hydrolase activity, ADP-sugar diphosphatase activity, ADP-ribose pyrophosphohydrolase activity, ADP-glucose pyrophosphohydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 845 Blast hits to 845 proteins in 388 species: Archae - 4; Bacteria - 636; Metazoa - 8; Fungi - 51; Plants - 17; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink).  |
AT4G14030 | AT4G14030.1 | ACACGTCAG | selenium-binding protein 1 (SBP1); FUNCTIONS IN: selenium binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cellular_component unknown; EXPRESSED IN: guard cell, cultured cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), Selenium-binding protein (InterPro:IPR008826); BEST Arabidopsis thaliana protein match is: SBP2 (SELENIUM-BINDING PROTEIN 2); selenium binding (TAIR:AT4G14040.1); Has 766 Blast hits to 759 proteins in 154 species: Archae - 15; Bacteria - 128; Metazoa - 187; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 381 (source: NCBI BLink).  |
AT4G15955 | AT4G15955.1 | CTGACGTG | epoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1).  |
AT4G15955.2 | CTGACGTG | epoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1).  | |
AT4G15955.3 | CTGACGTG | epoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1).  | |
AT4G16330 | AT4G16330.1 | GTGCCACGTCAGC | oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G38240.1); Has 5424 Blast hits to 5410 proteins in 662 species: Archae - 0; Bacteria - 677; Metazoa - 111; Fungi - 490; Plants - 3015; Viruses - 0; Other Eukaryotes - 1131 (source: NCBI BLink).  |
AT4G16640 | AT4G16640.1 | CACGTCAG | matrix metalloproteinase, putative; FUNCTIONS IN: metallopeptidase activity, metalloendopeptidase activity; INVOLVED IN: proteolysis, metabolic process; LOCATED IN: anchored to membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Peptidase M10A and M12B, matrixin and adamalysin (InterPro:IPR001818), Peptidoglycan binding-like (InterPro:IPR002477), Peptidase, metallopeptidases (InterPro:IPR006026); BEST Arabidopsis thaliana protein match is: matrix metalloproteinase (TAIR:AT2G45040.1); Has 2200 Blast hits to 2021 proteins in 162 species: Archae - 2; Bacteria - 79; Metazoa - 1899; Fungi - 3; Plants - 83; Viruses - 39; Other Eukaryotes - 95 (source: NCBI BLink).  |
AT4G16660 | AT4G16660.1 | TTCCACGTCAG | heat shock protein 70, putative / HSP70, putative; FUNCTIONS IN: ATP binding; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: heat shock protein, putative (TAIR:AT1G11660.1); Has 18930 Blast hits to 18189 proteins in 2776 species: Archae - 119; Bacteria - 6307; Metazoa - 3629; Fungi - 1186; Plants - 638; Viruses - 97; Other Eukaryotes - 6954 (source: NCBI BLink).  |
AT4G16745 | AT4G16745.1 | ACACGTCAGC | exostosin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT5G19670.1); Has 870 Blast hits to 866 proteins in 88 species: Archae - 0; Bacteria - 10; Metazoa - 274; Fungi - 4; Plants - 491; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink).  |
AT4G17530 | AT4G17530.1 | AGACACGTCAGC | ATRAB1C; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1A; GTP binding (TAIR:AT5G47200.1); Has 23593 Blast hits to 23542 proteins in 647 species: Archae - 17; Bacteria - 111; Metazoa - 13220; Fungi - 2827; Plants - 2160; Viruses - 19; Other Eukaryotes - 5239 (source: NCBI BLink).  |
AT4G17540 | AT4G17540.1 | GCTGACGTGTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 80 Blast hits to 67 proteins in 31 species: Archae - 4; Bacteria - 22; Metazoa - 9; Fungi - 3; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT4G18580 | AT4G18580.1 | AGACACGTCAGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G18580.2 | AGACACGTCAGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G18590 | AT4G18590.1 | GCTGACGTGTCT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Replication factor A protein 3 (InterPro:IPR013970), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52630.2); Has 58 Blast hits to 58 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT4G22820 | AT4G22820.1 | ACACGTCAGC | zinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT1G12440.2); Has 766 Blast hits to 761 proteins in 109 species: Archae - 2; Bacteria - 0; Metazoa - 378; Fungi - 2; Plants - 273; Viruses - 6; Other Eukaryotes - 105 (source: NCBI BLink).  |
AT4G22820.2 | ACACGTCAGC | zinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT1G12440.2); Has 766 Blast hits to 761 proteins in 109 species: Archae - 2; Bacteria - 0; Metazoa - 378; Fungi - 2; Plants - 273; Viruses - 6; Other Eukaryotes - 105 (source: NCBI BLink).  | |
AT4G22890 | AT4G22890.1 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I).  |
AT4G22890.2 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I).  | |
AT4G22890.3 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I).  | |
AT4G22890.4 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I).  | |
AT4G22890.5 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I).  | |
AT4G24100 | AT4G24100.1 | CCACGTCAGC | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G10730.1); Has 91504 Blast hits to 90179 proteins in 3094 species: Archae - 51; Bacteria - 7936; Metazoa - 40188; Fungi - 8002; Plants - 18055; Viruses - 587; Other Eukaryotes - 16685 (source: NCBI BLink).  |
AT4G24110 | AT4G24110.1 | GTCCACGTCAGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; Has 49 Blast hits to 49 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G26450 | AT4G26450.1 | GCTGACGTGGCGTTTT | unknown protein; Has 2630 Blast hits to 1931 proteins in 274 species: Archae - 42; Bacteria - 240; Metazoa - 1048; Fungi - 174; Plants - 110; Viruses - 15; Other Eukaryotes - 1001 (source: NCBI BLink).  |
AT4G26630 | AT4G26630.1 | CTGACGTGGCAT | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink).  |
AT4G26630.2 | CTGACGTGGCAT | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink).  | |
AT4G26970 | AT4G26970.1 | CTGACGTGGCCTTGGGCCAT | aconitate hydratase/ copper ion binding; FUNCTIONS IN: aconitate hydratase activity, copper ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aconitase family, 4Fe-4S cluster binding site (InterPro:IPR018136), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (InterPro:IPR001030), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (InterPro:IPR015932), Aconitase/Iron regulatory protein 2/2-methylisocitrate dehydratase (InterPro:IPR015934), Aconitase-like core (InterPro:IPR015937), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase/iron regulatory protein 2 (InterPro:IPR006249), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomains 1 and 3 (InterPro:IPR015931); BEST Arabidopsis thaliana protein match is: aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, putative (TAIR:AT2G05710.1); Has 15496 Blast hits to 15351 proteins in 1535 species: Archae - 312; Bacteria - 6112; Metazoa - 484; Fungi - 449; Plants - 132; Viruses - 0; Other Eukaryotes - 8007 (source: NCBI BLink).  |
AT4G27150 | AT4G27150.1 | TGTCACGTCAG | 2S seed storage protein 2 / 2S albumin storage protein / NWMU2-2S albumin 2; FUNCTIONS IN: lipid binding, nutrient reservoir activity; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Bifunctional trypsin/alpha-amylase inhibitor (InterPro:IPR013771), Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Napin/ Bra allergen (InterPro:IPR000617), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: AT2S3; lipid binding / nutrient reservoir (TAIR:AT4G27160.1); Has 152 Blast hits to 147 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT4G29390 | AT4G29390.1 | GCTGACGTGGCT | 40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT4G29400 | AT4G29400.1 | AGCCACGTCAGC | unknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink).  |
AT4G32285 | AT4G32285.1 | CCACGTCAGC | epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein (TAIR:AT2G25430.1); Has 1251 Blast hits to 1096 proteins in 211 species: Archae - 8; Bacteria - 172; Metazoa - 457; Fungi - 134; Plants - 334; Viruses - 22; Other Eukaryotes - 124 (source: NCBI BLink).  |
AT4G32285.2 | CCACGTCAGC | epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein (TAIR:AT2G25430.1); Has 1251 Blast hits to 1096 proteins in 211 species: Archae - 8; Bacteria - 172; Metazoa - 457; Fungi - 134; Plants - 334; Viruses - 22; Other Eukaryotes - 124 (source: NCBI BLink).  | |
AT4G35770 | AT4G35770.1 | GCTGACGTGACA | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant.  |
AT4G35770.2 | GCTGACGTGACA | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant.  | |
AT4G35770.3 | GCTGACGTGACA | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant.  | |
AT4G37390 | AT4G37390.1 | GCTGACGTGGAA | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity.  |
AT4G39050 | AT4G39050.1 | CCACGTCAGC | kinesin-related protein (MKRP2); FUNCTIONS IN: protein binding, microtubule motor activity, zinc ion binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex, chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT2G21380.1); Has 37077 Blast hits to 25676 proteins in 1021 species: Archae - 260; Bacteria - 2097; Metazoa - 19200; Fungi - 3004; Plants - 2225; Viruses - 313; Other Eukaryotes - 9978 (source: NCBI BLink).  |
AT4G39100 | AT4G39100.1 | GCTGACGTGG | Putative transcription factor containing a PHD finger and BAH motif, required for normal development  |
AT4G39800 | AT4G39800.1 | CTGACGTGTCA | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.  |
AT5G02440 | AT5G02440.1 | CACGTCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G02810 | AT5G02810.1 | CTGACGTGGAA | PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels.  |
AT5G06760 | AT5G06760.1 | CTGACGTGTCGT | late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); Has 477 Blast hits to 328 proteins in 98 species: Archae - 0; Bacteria - 70; Metazoa - 102; Fungi - 37; Plants - 214; Viruses - 1; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT5G07090 | AT5G07090.1 | ACGCCACGTCAGC | 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).  |
AT5G07090.2 | ACGCCACGTCAGC | 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).  | |
AT5G09650 | AT5G09650.1 | CTGACGTG | Encodes a protein with inorganic pyrophosphatase activity.  |
AT5G10490 | AT5G10490.1 | CTGACGTGTCG | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE.  |
AT5G10490.2 | CTGACGTGTCG | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE.  | |
AT5G15500 | AT5G15500.1 | CTGACGTGTCCACGT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink).  |
AT5G15500.2 | CTGACGTGTCCACGT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink).  | |
AT5G19390 | AT5G19390.1 | GCTGACGTGGAA | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.  |
AT5G19390.2 | GCTGACGTGGAA | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.  | |
AT5G19390.3 | GCTGACGTGGAA | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.  | |
AT5G19390.4 | GCTGACGTGGAA | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.  | |
AT5G22880 | AT5G22880.1 | CCACGTCAGC | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases.  |
AT5G23890 | AT5G23890.1 | GCTGACGTGGCAT | LOCATED IN: mitochondrion, chloroplast thylakoid membrane, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: S-layer homology region (InterPro:IPR001119); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52410.2); Has 47782 Blast hits to 27307 proteins in 1672 species: Archae - 444; Bacteria - 6951; Metazoa - 22630; Fungi - 3561; Plants - 1682; Viruses - 252; Other Eukaryotes - 12262 (source: NCBI BLink).  |
AT5G25540 | AT5G25540.1 | AGACACGTCAGC | Expressed protein contains PAM2 PABC interacting domain.  |
AT5G27740 | AT5G27740.1 | CTGACGTGG | EMBRYO DEFECTIVE 2775 (EMB2775); FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding; INVOLVED IN: DNA replication; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA polymerase III clamp loader subunit, C-terminal (InterPro:IPR008921); BEST Arabidopsis thaliana protein match is: emb1968 (embryo defective 1968); ATP binding / ATPase/ DNA binding / DNA clamp loader/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT1G21690.1); Has 8053 Blast hits to 8003 proteins in 1440 species: Archae - 377; Bacteria - 2705; Metazoa - 463; Fungi - 373; Plants - 162; Viruses - 67; Other Eukaryotes - 3906 (source: NCBI BLink).  |
AT5G36120 | AT5G36120.1 | TTCCACGTCAGC | COFACTOR ASSEMBLY, COMPLEX C (B6F), (CCB3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cytochrome b6f complex assembly; LOCATED IN: chloroplast thylakoid membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function YGGT (InterPro:IPR003425); Has 552 Blast hits to 552 proteins in 118 species: Archae - 0; Bacteria - 273; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 238 (source: NCBI BLink).  |
AT5G39040 | AT5G39040.1 | CTGACGTGT | member of TAP subfamily  |
AT5G40950 | AT5G40950.1 | GCTGACGTGTAC | RIBOSOMAL PROTEIN LARGE SUBUNIT 27 (RPL27); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: thylakoid, ribosome, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT5G15220.1); Has 5099 Blast hits to 5099 proteins in 1536 species: Archae - 0; Bacteria - 2975; Metazoa - 83; Fungi - 94; Plants - 70; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).  |
AT5G41080 | AT5G41080.1 | GCTGACGTGGAA | glycerophosphoryl diester phosphodiesterase family protein; FUNCTIONS IN: phosphoric diester hydrolase activity, glycerophosphodiester phosphodiesterase activity; INVOLVED IN: glycerol metabolic process, lipid metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), Glycerophosphoryl diester phosphodiesterase (InterPro:IPR004129); BEST Arabidopsis thaliana protein match is: SRG3 (senescence-related gene 3); glycerophosphodiester phosphodiesterase/ phosphoric diester hydrolase (TAIR:AT3G02040.1); Has 1314 Blast hits to 1286 proteins in 350 species: Archae - 22; Bacteria - 625; Metazoa - 237; Fungi - 103; Plants - 54; Viruses - 2; Other Eukaryotes - 271 (source: NCBI BLink).  |
AT5G41080.2 | GCTGACGTGGAA | glycerophosphoryl diester phosphodiesterase family protein; FUNCTIONS IN: phosphoric diester hydrolase activity, glycerophosphodiester phosphodiesterase activity; INVOLVED IN: glycerol metabolic process, lipid metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), Glycerophosphoryl diester phosphodiesterase (InterPro:IPR004129); BEST Arabidopsis thaliana protein match is: SRG3 (senescence-related gene 3); glycerophosphodiester phosphodiesterase/ phosphoric diester hydrolase (TAIR:AT3G02040.1); Has 1314 Blast hits to 1286 proteins in 350 species: Archae - 22; Bacteria - 625; Metazoa - 237; Fungi - 103; Plants - 54; Viruses - 2; Other Eukaryotes - 271 (source: NCBI BLink).  | |
AT5G47200 | AT5G47200.1 | GCCACGTCAGC | ATRAB1A; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1C; GTP binding (TAIR:AT4G17530.1); Has 23714 Blast hits to 23664 proteins in 649 species: Archae - 17; Bacteria - 107; Metazoa - 13262; Fungi - 2840; Plants - 2236; Viruses - 19; Other Eukaryotes - 5233 (source: NCBI BLink).  |
AT5G50375 | AT5G50375.1 | CTGCCACGTCAGC | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2  |
AT5G50460 | AT5G50460.1 | GCTGACGTGT | protein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT4G24920.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT5G54770 | AT5G54770.1 | CTGACGTGGC | Encodes a thiamine biosynthetic gene that has a dual function in thiamine biosynthesis and mitochondrial DNA damage tolerance. It appears to be involved in producing the thiazole portion of thiamine (vitamin B1). A crystal structure of the protein reveals that it forms a 2-ring homo-octamer.  |
AT5G59750 | AT5G59750.1 | TATAGGCCACGTCAGC | riboflavin biosynthesis protein, putative; FUNCTIONS IN: 3,4-dihydroxy-2-butanone-4-phosphate synthase activity, GTP cyclohydrolase II activity; INVOLVED IN: riboflavin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP cyclohydrolase II (InterPro:IPR000926), DHBP synthase RibB (InterPro:IPR000422), DHBP synthase RibB-like alpha/beta domain (InterPro:IPR017945); BEST Arabidopsis thaliana protein match is: ATGCH; 3,4-dihydroxy-2-butanone-4-phosphate synthase/ GTP cyclohydrolase II (TAIR:AT5G64300.1); Has 8351 Blast hits to 8350 proteins in 1311 species: Archae - 133; Bacteria - 4029; Metazoa - 0; Fungi - 273; Plants - 55; Viruses - 0; Other Eukaryotes - 3861 (source: NCBI BLink).  |
AT5G59950 | AT5G59950.1 | CTGACGTG | RNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT5G02530.1); Has 9001 Blast hits to 7949 proteins in 569 species: Archae - 14; Bacteria - 859; Metazoa - 4521; Fungi - 1273; Plants - 1384; Viruses - 32; Other Eukaryotes - 918 (source: NCBI BLink).  |
AT5G59950.2 | CTGACGTG | RNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT5G02530.1); Has 9001 Blast hits to 7949 proteins in 569 species: Archae - 14; Bacteria - 859; Metazoa - 4521; Fungi - 1273; Plants - 1384; Viruses - 32; Other Eukaryotes - 918 (source: NCBI BLink).  | |
AT5G59950.3 | CTGACGTG | RNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT5G02530.1); Has 9001 Blast hits to 7949 proteins in 569 species: Archae - 14; Bacteria - 859; Metazoa - 4521; Fungi - 1273; Plants - 1384; Viruses - 32; Other Eukaryotes - 918 (source: NCBI BLink).  | |
AT5G59950.4 | CTGACGTG | RNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT5G02530.1); Has 9001 Blast hits to 7949 proteins in 569 species: Archae - 14; Bacteria - 859; Metazoa - 4521; Fungi - 1273; Plants - 1384; Viruses - 32; Other Eukaryotes - 918 (source: NCBI BLink).  | |
AT5G61840 | AT5G61840.1 | GCTGACGTGGAA | GUT1; FUNCTIONS IN: glucuronoxylan glucuronosyltransferase activity, catalytic activity; INVOLVED IN: secondary cell wall biogenesis, glucuronoxylan biosynthetic process; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 30 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: GUT2; catalytic/ glucuronoxylan glucuronosyltransferase (TAIR:AT1G27440.1); Has 853 Blast hits to 845 proteins in 89 species: Archae - 0; Bacteria - 12; Metazoa - 227; Fungi - 4; Plants - 512; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |
AT5G65700 | AT5G65700.1 | CTGACGTGGCAC | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs.  |
AT5G65730 | AT5G65730.1 | GTCCACGTCAGC | xyloglucan:xyloglucosyl transferase, putative / xyloglucan endotransglycosylase, putative / endo-xyloglucan transferase, putative; FUNCTIONS IN: hydrolase activity, acting on glycosyl bonds, hydrolase activity, hydrolyzing O-glycosyl compounds, xyloglucan:xyloglucosyl transferase activity; INVOLVED IN: response to water deprivation; LOCATED IN: endomembrane system, cell wall, apoplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Xyloglucan endotransglucosylase/hydrolase (InterPro:IPR016455), Xyloglucan endo-transglycosylase, C-terminal (InterPro:IPR010713), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Glycoside hydrolase, family 16 (InterPro:IPR000757), Glycoside hydrolase, family 16, active site (InterPro:IPR008263); BEST Arabidopsis thaliana protein match is: xyloglucan:xyloglucosyl transferase, putative / xyloglucan endotransglycosylase, putative / endo-xyloglucan transferase, putative (TAIR:AT4G37800.1); Has 1348 Blast hits to 1342 proteins in 196 species: Archae - 0; Bacteria - 152; Metazoa - 0; Fungi - 301; Plants - 805; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT5G67330 | AT5G67330.1 | CTGACGTGGCGT | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp3, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination.  |