Organism | Arabidopsis thaliana | |
ID | AtREG448 | |
Sequence | ATGCCACG | |
Annotation | ABA, DREB1Aox | |
PPDB Motif | ||
PLACE Motif | GCCAC | one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; SORLIP 1 is most over-represented, and most statistically singnificant; See also S000483, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs); Over-represented in light-induced cotyledon and root common genes and root-specific genes (Jiao et al. 2005; see S000486); |
Total Entry Count | 175 |
Locus | Gene model | Sequence | Description |
AT1G01140 | AT1G01140.1 | TACGTGGCAT | Encodes a CBL-interacting protein kinase with similarity to SOS2  |
AT1G01140.2 | TACGTGGCAT | Encodes a CBL-interacting protein kinase with similarity to SOS2  | |
AT1G01140.3 | TACGTGGCAT | Encodes a CBL-interacting protein kinase with similarity to SOS2  | |
AT1G03090 | AT1G03090.1 | ATGCCACGTCAC | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.  |
AT1G03090.2 | ATGCCACGTCAC | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.  | |
AT1G07590 | AT1G07590.1 | ATGCCACGTGTA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 6623 Blast hits to 3122 proteins in 84 species: Archae - 0; Bacteria - 4; Metazoa - 30; Fungi - 22; Plants - 6377; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).  |
AT1G07600 | AT1G07600.1 | ATGCCACGTGTA | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage.  |
AT1G09350 | AT1G09350.1 | TTTAGGCCACGTGGCAT | Arabidopsis thaliana galactinol synthase 3 (AtGolS3); FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, hypocotyl; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: AtGolS2 (Arabidopsis thaliana galactinol synthase 2); transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G56600.1); Has 871 Blast hits to 870 proteins in 198 species: Archae - 0; Bacteria - 55; Metazoa - 224; Fungi - 186; Plants - 285; Viruses - 70; Other Eukaryotes - 51 (source: NCBI BLink).  |
AT1G10090 | AT1G10090.1 | ATGCCACGTCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
AT1G10350 | AT1G10350.1 | ATGCCACGTGGCTCCATTAAG | DNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT1G59725.1); Has 19690 Blast hits to 19405 proteins in 2073 species: Archae - 113; Bacteria - 5759; Metazoa - 3795; Fungi - 1695; Plants - 1434; Viruses - 18; Other Eukaryotes - 6876 (source: NCBI BLink).  |
AT1G13670 | AT1G13670.1 | ACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: petal, inflorescence meristem, hypocotyl, flower, root; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G15330 | AT1G15330.1 | ATGCCACGTGTT | CBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT1G80090.1); Has 364 Blast hits to 364 proteins in 90 species: Archae - 2; Bacteria - 4; Metazoa - 214; Fungi - 57; Plants - 56; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  |
AT1G16850 | AT1G16850.1 | CGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, leaf apex, male gametophyte, flower, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; Has 9 Blast hits to 9 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G18360 | AT1G18360.1 | ACGTGGCAT | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G73480.1); Has 3797 Blast hits to 3785 proteins in 942 species: Archae - 19; Bacteria - 2420; Metazoa - 132; Fungi - 101; Plants - 246; Viruses - 60; Other Eukaryotes - 819 (source: NCBI BLink).  |
AT1G19000 | AT1G19000.1 | ATGCCACGTGGCTT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  |
AT1G19000.2 | ATGCCACGTGGCTT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G27470 | AT1G27470.1 | CTACGTGGCAT | transducin-related / WD-40 repeat protein-related; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G07410.1); Has 6753 Blast hits to 4580 proteins in 346 species: Archae - 8; Bacteria - 2018; Metazoa - 1907; Fungi - 1463; Plants - 459; Viruses - 0; Other Eukaryotes - 898 (source: NCBI BLink).  |
AT1G27480 | AT1G27480.1 | ATGCCACGTAG | lecithin:cholesterol acyltransferase family protein / LACT family protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); Has 852 Blast hits to 847 proteins in 171 species: Archae - 0; Bacteria - 22; Metazoa - 582; Fungi - 0; Plants - 127; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).  |
AT1G28540 | AT1G28540.1 | CTGCCACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G29050 | AT1G29050.1 | CGTGGCAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G34070.1); Has 710 Blast hits to 699 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 709; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G30755 | AT1G30755.1 | ATGCCACG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF668 (InterPro:IPR007700); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34320.1); Has 262 Blast hits to 228 proteins in 50 species: Archae - 0; Bacteria - 7; Metazoa - 53; Fungi - 15; Plants - 160; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).  |
AT1G30757 | AT1G30757.1 | CGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G52220 | AT1G52220.1 | ATGCCACGTGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G52220.2 | ATGCCACGTGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G52220.3 | ATGCCACGTGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G52230 | AT1G52230.1 | ATCCACGTGGCAT | PHOTOSYSTEM I SUBUNIT H2 (PSAH2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem I reaction centre subunit VI (InterPro:IPR004928); BEST Arabidopsis thaliana protein match is: PSAH-1 (photosystem I subunit H-1) (TAIR:AT3G16140.1); Has 72 Blast hits to 72 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G52590 | AT1G52590.1 | ATGACGTGGCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink).  |
AT1G52600 | AT1G52600.1 | ATGCCACGTCAT | signal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  |
AT1G59950 | AT1G59950.1 | TACACGTGGCAT | aldo/keto reductase, putative; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: oxidation reduction; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase, putative (TAIR:AT1G59960.1); Has 11553 Blast hits to 11538 proteins in 1272 species: Archae - 159; Bacteria - 6414; Metazoa - 1616; Fungi - 1065; Plants - 853; Viruses - 0; Other Eukaryotes - 1446 (source: NCBI BLink).  |
AT1G61780 | AT1G61780.1 | CGTGGCAT | postsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G61790 | AT1G61790.1 | ATGCCACG | OST3/OST6 family protein; FUNCTIONS IN: oligosaccharide transmembrane transporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: OST3/OST6 (InterPro:IPR006844); BEST Arabidopsis thaliana protein match is: OST3/OST6 family protein (TAIR:AT1G11560.1); Has 268 Blast hits to 268 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 171; Fungi - 49; Plants - 34; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT1G67090 | AT1G67090.1 | TTCCACGTGGCAT | RIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN 1A (RBCS1A); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity, copper ion binding; INVOLVED IN: response to blue light, response to cold, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 10 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, seedling growth; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1759 Blast hits to 1738 proteins in 405 species: Archae - 0; Bacteria - 340; Metazoa - 0; Fungi - 0; Plants - 872; Viruses - 0; Other Eukaryotes - 547 (source: NCBI BLink).  |
AT1G67090.2 | TTCCACGTGGCAT | RIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN 1A (RBCS1A); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity, copper ion binding; INVOLVED IN: response to blue light, response to cold, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 10 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, seedling growth; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1759 Blast hits to 1738 proteins in 405 species: Archae - 0; Bacteria - 340; Metazoa - 0; Fungi - 0; Plants - 872; Viruses - 0; Other Eukaryotes - 547 (source: NCBI BLink).  | |
AT1G67785 | AT1G67785.1 | CGACACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G73120 | AT1G73120.1 | ATGCCACGTGGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; EXPRESSED IN: root, cultured cell; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G74880 | AT1G74880.1 | TACGTGGCAT | Encodes subunit NDH-O of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly.  |
AT1G75440 | AT1G75440.1 | GTACACGTGGCAT | ubiquitin-conjugating enzyme 16 (UBC16); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC18 (ubiquitin-conjugating enzyme 18); small conjugating protein ligase/ ubiquitin-protein ligase (TAIR:AT5G42990.1); Has 6497 Blast hits to 6496 proteins in 295 species: Archae - 0; Bacteria - 2; Metazoa - 3150; Fungi - 1284; Plants - 976; Viruses - 16; Other Eukaryotes - 1069 (source: NCBI BLink).  |
AT1G75460 | AT1G75460.1 | CACGTGGCAT | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); BEST Arabidopsis thaliana protein match is: ATP-dependent protease La (LON) domain-containing protein (TAIR:AT1G19740.1); Has 2926 Blast hits to 2926 proteins in 561 species: Archae - 0; Bacteria - 1066; Metazoa - 150; Fungi - 29; Plants - 57; Viruses - 0; Other Eukaryotes - 1624 (source: NCBI BLink).  |
AT1G76100 | AT1G76100.1 | ATGCCACGTCAC | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions.  |
AT1G77120 | AT1G77120.1 | ATGCCACGTGGAC | Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.  |
AT1G77810 | AT1G77810.1 | ATGACGTGGCAT | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT1G77810.2 | ATGACGTGGCAT | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  | |
AT1G78040 | AT1G78040.1 | ATGCCACGT | pollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G78040.2 | ATGCCACGT | pollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G78700 | AT1G78700.1 | CGTGGCAT | brassinosteroid signalling positive regulator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: brassinosteroid signalling positive regulator-related (TAIR:AT4G18890.1); Has 3132 Blast hits to 468 proteins in 84 species: Archae - 0; Bacteria - 18; Metazoa - 271; Fungi - 99; Plants - 190; Viruses - 0; Other Eukaryotes - 2554 (source: NCBI BLink).  |
AT1G79040 | AT1G79040.1 | CTACGTGGCAT | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ.  |
AT1G79040.1 | CTACGTGGCAT | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ.  | |
AT1G79340 | AT1G79340.1 | ATGCCACGTCAG | metacaspase 4 (AtMC4); FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600); BEST Arabidopsis thaliana protein match is: ATMC5 (ARABIDOPSIS THALIANA METACASPASE 5); cysteine-type endopeptidase (TAIR:AT1G79330.1); Has 835 Blast hits to 815 proteins in 210 species: Archae - 5; Bacteria - 241; Metazoa - 2; Fungi - 193; Plants - 189; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).  |
AT1G80480 | AT1G80480.1 | ATGCCACGTG | PLASTID TRANSCRIPTIONALLY ACTIVE17 (PTAC17); LOCATED IN: plastid chromosome, chloroplast stroma, chloroplast, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cobalamin (vitamin B12) biosynthesis CobW-like (InterPro:IPR003495), Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal (InterPro:IPR011629); BEST Arabidopsis thaliana protein match is: PRLI-interacting factor L, putative (TAIR:AT1G15730.1); Has 18597 Blast hits to 10859 proteins in 1179 species: Archae - 146; Bacteria - 6676; Metazoa - 2747; Fungi - 687; Plants - 516; Viruses - 15; Other Eukaryotes - 7810 (source: NCBI BLink).  |
AT1G80610 | AT1G80610.1 | ATGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15800.1); Has 41 Blast hits to 39 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT2G20770 | AT2G20770.1 | ATGCCACGT | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase.  |
AT2G27590 | AT2G27590.1 | GGGCCTACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 78 Blast hits to 78 proteins in 13 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT2G29300 | AT2G29300.1 | ATGCCACGTA | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29320.1); Has 77732 Blast hits to 77581 proteins in 2156 species: Archae - 464; Bacteria - 43191; Metazoa - 4073; Fungi - 3687; Plants - 1470; Viruses - 5; Other Eukaryotes - 24842 (source: NCBI BLink).  |
AT2G29550 | AT2G29550.1 | TACGTGGCAT | Encodes a beta-tubulin that is expressed in leaves, roots and flowers.  |
AT2G32080 | AT2G32080.1 | TACGTGGCAT | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication  |
AT2G32080.2 | TACGTGGCAT | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication  | |
AT2G37250 | AT2G37250.1 | ATGCCACGTCAG | encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth  |
AT2G40420 | AT2G40420.1 | ATGCCACGTA | Encodes a putative amino acid transporter.  |
AT2G43570 | AT2G43570.1 | CGTGGCAT | chitinase, putative; FUNCTIONS IN: chitin binding, chitinase activity; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: apoplast, plant-type cell wall; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Chitin-binding, type 1, conserved site (InterPro:IPR018371), Glycoside hydrolase, family 19 (InterPro:IPR016283), Chitin-binding, type 1 (InterPro:IPR001002), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: chitinase, putative (TAIR:AT2G43590.1); Has 1931 Blast hits to 1721 proteins in 374 species: Archae - 0; Bacteria - 368; Metazoa - 33; Fungi - 172; Plants - 1246; Viruses - 9; Other Eukaryotes - 103 (source: NCBI BLink).  |
AT2G45820 | AT2G45820.1 | GTGACGTGGCAT | DNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / remorin family protein (TAIR:AT3G61260.1); Has 2170 Blast hits to 1469 proteins in 249 species: Archae - 2; Bacteria - 278; Metazoa - 371; Fungi - 179; Plants - 300; Viruses - 4; Other Eukaryotes - 1036 (source: NCBI BLink).  |
AT2G47780 | AT2G47780.1 | ATGCCACGTGGCT | rubber elongation factor (REF) protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) family protein (TAIR:AT3G05500.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G01090 | AT3G01090.1 | ATGCCACGTC | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase  |
AT3G01090.2 | ATGCCACGTC | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase  | |
AT3G01090.3 | ATGCCACGTC | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase  | |
AT3G01850 | AT3G01850.1 | ATGCCACGTCATC | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink).  |
AT3G01850.2 | ATGCCACGTCATC | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink).  | |
AT3G02020 | AT3G02020.1 | ATGCCACGTA | encodes a monofunctional aspartate kinase  |
AT3G02540 | AT3G02540.1 | ACCACGTGGCAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink).  |
AT3G02540.2 | ACCACGTGGCAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink).  | |
AT3G09350 | AT3G09350.1 | CGTGGCAT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT3G09350.2 | CGTGGCAT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  | |
AT3G09350.3 | CGTGGCAT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  | |
AT3G11670 | AT3G11670.1 | ATGCCACGT | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE).  |
AT3G11670.2 | ATGCCACGT | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE).  | |
AT3G12150 | AT3G12150.1 | CGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 276 Blast hits to 200 proteins in 88 species: Archae - 0; Bacteria - 59; Metazoa - 189; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT3G12300 | AT3G12300.1 | AGACACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF667 (InterPro:IPR007714); Has 280 Blast hits to 278 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 2; Plants - 29; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  |
AT3G13670 | AT3G13670.1 | CTGACGTGGCAT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G25760.1); Has 12090 Blast hits to 12038 proteins in 826 species: Archae - 10; Bacteria - 3127; Metazoa - 4213; Fungi - 955; Plants - 1425; Viruses - 207; Other Eukaryotes - 2153 (source: NCBI BLink).  |
AT3G14067 | AT3G14067.1 | GACGTGGCAT | subtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: apoplast, plasma membrane, vacuole, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4847 Blast hits to 4214 proteins in 722 species: Archae - 147; Bacteria - 2629; Metazoa - 66; Fungi - 489; Plants - 902; Viruses - 0; Other Eukaryotes - 614 (source: NCBI BLink).  |
AT3G14070 | AT3G14070.1 | ATGCCACGTC | Involved in cation (K, Na and Mn) homeostasis and transport  |
AT3G14930 | AT3G14930.1 | TACGTGGCAT | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink).  |
AT3G14930.2 | TACGTGGCAT | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink).  | |
AT3G14930.3 | TACGTGGCAT | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink).  | |
AT3G16140 | AT3G16140.1 | TTCCACGTGGCAT | Encodes subunit H of photosystem I reaction center subunit VI.  |
AT3G17810 | AT3G17810.1 | CACGTGGCAT | dihydroorotate dehydrogenase family protein / dihydroorotate oxidase family protein; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, catalytic activity, dihydroorotate oxidase activity, dihydroorotate dehydrogenase activity; INVOLVED IN: 'de novo' pyrimidine base biosynthetic process, UMP biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Dihydroorotate dehydrogenase, classes 1 and 2 (InterPro:IPR012135), Dihydroorotate dehydrogenase, class 1, core (InterPro:IPR005720); Has 3539 Blast hits to 3539 proteins in 1009 species: Archae - 112; Bacteria - 2115; Metazoa - 241; Fungi - 79; Plants - 25; Viruses - 0; Other Eukaryotes - 967 (source: NCBI BLink).  |
AT3G18750 | AT3G18750.1 | ATGCCACGTGTA | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.  |
AT3G18750.2 | ATGCCACGTGTA | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.  | |
AT3G19000 | AT3G19000.1 | TACGTGGCAT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G19010.1); Has 6199 Blast hits to 6163 proteins in 694 species: Archae - 0; Bacteria - 740; Metazoa - 132; Fungi - 658; Plants - 3109; Viruses - 0; Other Eukaryotes - 1560 (source: NCBI BLink).  |
AT3G19000.2 | TACGTGGCAT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G19010.1); Has 6199 Blast hits to 6163 proteins in 694 species: Archae - 0; Bacteria - 740; Metazoa - 132; Fungi - 658; Plants - 3109; Viruses - 0; Other Eukaryotes - 1560 (source: NCBI BLink).  | |
AT3G22880 | AT3G22880.1 | ATGACGTGGCAT | Expression of the AtDMC1 is restricted to pollen mother cells in anthers and to megaspore mother cells in ovules. Similar to meiosis-specific yeast DMC gene.  |
AT3G22968 | AT3G22968.1 | CGACGTGGCAT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF59 represents a conserved upstream opening reading frame relative to major ORF AT3G22970.1  |
AT3G22970 | AT3G22970.1 | CGACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G22970.2 | CGACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT3G23700 | AT3G23700.1 | ATGCCACGTCAC | S1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: response to cold; LOCATED IN: chloroplast stroma, nucleus, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: RPS1 (RIBOSOMAL PROTEIN S1); RNA binding / structural constituent of ribosome (TAIR:AT5G30510.1); Has 19049 Blast hits to 12627 proteins in 1560 species: Archae - 136; Bacteria - 11493; Metazoa - 155; Fungi - 150; Plants - 198; Viruses - 0; Other Eukaryotes - 6917 (source: NCBI BLink).  |
AT3G25840 | AT3G25840.1 | ATGCCACGT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G13350.1); Has 132242 Blast hits to 94068 proteins in 2209 species: Archae - 141; Bacteria - 10146; Metazoa - 64521; Fungi - 15048; Plants - 10889; Viruses - 745; Other Eukaryotes - 30752 (source: NCBI BLink).  |
AT3G46780 | AT3G46780.1 | ATGACGTGGCAT | PLASTID TRANSCRIPTIONALLY ACTIVE 16 (PTAC16); FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT3G18890.1); Has 939 Blast hits to 790 proteins in 244 species: Archae - 1; Bacteria - 344; Metazoa - 68; Fungi - 66; Plants - 99; Viruses - 22; Other Eukaryotes - 339 (source: NCBI BLink).  |
AT3G47520 | AT3G47520.1 | CGTGGCAT | Encodes a protein with NAD-dependent malate dehydrogenase activity, located in chloroplasts.  |
AT3G48990 | AT3G48990.1 | AACACGTGGCAT | AMP-dependent synthetase and ligase family protein; FUNCTIONS IN: catalytic activity, AMP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: apoplast, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate--CoA ligase, putative / 4-coumaroyl-CoA synthase, putative (TAIR:AT4G05160.1); Has 56117 Blast hits to 51778 proteins in 2278 species: Archae - 561; Bacteria - 29860; Metazoa - 2967; Fungi - 3087; Plants - 1292; Viruses - 1; Other Eukaryotes - 18349 (source: NCBI BLink).  |
AT3G50920 | AT3G50920.1 | ATGCCACGTGGAA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
AT3G50920.2 | ATGCCACGTGGAA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  | |
AT3G54440 | AT3G54440.1 | ACGACACCACGTGGCAT | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).  |
AT3G54440.2 | ACGACACCACGTGGCAT | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).  | |
AT3G61260 | AT3G61260.1 | TACGTGGCAT | DNA-binding family protein / remorin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G45820.1); Has 7363 Blast hits to 4653 proteins in 692 species: Archae - 12; Bacteria - 1846; Metazoa - 1409; Fungi - 602; Plants - 495; Viruses - 172; Other Eukaryotes - 2827 (source: NCBI BLink).  |
AT4G00020 | AT4G00020.1 | AAAAGGCCGTGGCAT | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development.  |
AT4G00020.2 | AAAAGGCCGTGGCAT | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development.  | |
AT4G00170 | AT4G00170.1 | TACGTGGCAT | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 758 Blast hits to 742 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 363; Fungi - 101; Plants - 232; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT4G00970 | AT4G00970.1 | TGACACGTGGCAT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF26 (InterPro:IPR002902), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G21410.1); Has 85932 Blast hits to 84886 proteins in 3199 species: Archae - 45; Bacteria - 7229; Metazoa - 37779; Fungi - 6763; Plants - 18977; Viruses - 382; Other Eukaryotes - 14757 (source: NCBI BLink).  |
AT4G01590 | AT4G01590.1 | ATGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae - 0; Bacteria - 99; Metazoa - 666; Fungi - 320; Plants - 99; Viruses - 74; Other Eukaryotes - 776 (source: NCBI BLink).  |
AT4G01590.2 | ATGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae - 0; Bacteria - 99; Metazoa - 666; Fungi - 320; Plants - 99; Viruses - 74; Other Eukaryotes - 776 (source: NCBI BLink).  | |
AT4G01810 | AT4G01810.1 | ATGCCACG | protein transport protein-related; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular protein transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895); BEST Arabidopsis thaliana protein match is: transport protein, putative (TAIR:AT2G21630.1); Has 7526 Blast hits to 4938 proteins in 507 species: Archae - 16; Bacteria - 861; Metazoa - 2084; Fungi - 961; Plants - 2123; Viruses - 449; Other Eukaryotes - 1032 (source: NCBI BLink).  |
AT4G02550 | AT4G02550.1 | ATGCCACGTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G02550.2 | ATGCCACGTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G02550.3 | ATGCCACGTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G03210 | AT4G03210.1 | CTACGTGGCAT | encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers.  |
AT4G03210.2 | CTACGTGGCAT | encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers.  | |
AT4G05020 | AT4G05020.1 | ATGCCACGTGGT | NAD(P)H dehydrogenase B2 (NDB2); FUNCTIONS IN: disulfide oxidoreductase activity, oxidoreductase activity, FAD binding; LOCATED IN: extrinsic to mitochondrial inner membrane, mitochondrion; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), EF-HAND 1 (InterPro:IPR018247), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327), EF-HAND 2 (InterPro:IPR018249), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: NDB3; NADH dehydrogenase (TAIR:AT4G21490.1); Has 9447 Blast hits to 9170 proteins in 1455 species: Archae - 245; Bacteria - 6823; Metazoa - 105; Fungi - 514; Plants - 280; Viruses - 0; Other Eukaryotes - 1480 (source: NCBI BLink).  |
AT4G08230 | AT4G08230.1 | ATGCCACGTGACA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; Has 13979 Blast hits to 5534 proteins in 565 species: Archae - 19; Bacteria - 2070; Metazoa - 5921; Fungi - 772; Plants - 3540; Viruses - 122; Other Eukaryotes - 1535 (source: NCBI BLink).  |
AT4G10960 | AT4G10960.1 | ACCACGTGGCAT | Encodes a protein with UDP-D-glucose 4-epimerase activity.  |
AT4G14620 | AT4G14620.1 | AAATGACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 217 Blast hits to 217 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT4G14622 | AT4G14622.1 | AAATGACGTGGCAT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF60 represents a conserved upstream opening reading frame relative to major ORF AT4G14620.1  |
AT4G16190 | AT4G16190.1 | ATGCCACGTGTT | cysteine proteinase, putative; FUNCTIONS IN: cysteine-type peptidase activity, cysteine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: RD19 (RESPONSIVE TO DEHYDRATION 19); cysteine-type endopeptidase/ cysteine-type peptidase (TAIR:AT4G39090.1); Has 6049 Blast hits to 6013 proteins in 589 species: Archae - 27; Bacteria - 106; Metazoa - 2786; Fungi - 4; Plants - 1188; Viruses - 126; Other Eukaryotes - 1812 (source: NCBI BLink).  |
AT4G17560 | AT4G17560.1 | ATGCCACG | ribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857), Ribosomal protein L19, conserved site (InterPro:IPR018257); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT5G47190.1); Has 5332 Blast hits to 5332 proteins in 1492 species: Archae - 0; Bacteria - 2922; Metazoa - 96; Fungi - 46; Plants - 97; Viruses - 0; Other Eukaryotes - 2171 (source: NCBI BLink).  |
AT4G21320 | AT4G21320.1 | ATGACGTGGCAT | Encodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment.  |
AT4G22756 | AT4G22756.1 | ATGCCACGTCAC | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha- methyl oxidase.  |
AT4G24280 | AT4G24280.1 | CGTGGCAT | chloroplast heat shock protein 70-1 (cpHsc70-1); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cadmium ion, response to cold, response to heat; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Chaperone DnaK (InterPro:IPR012725), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: CPHSC70-2EAT SHOCK PROTEIN 70-2 (CHLOROPLAST HEAT SHOCK PROTEIN 70-2); ATP binding / unfolded protein binding (TAIR:AT5G49910.1); Has 26366 Blast hits to 26267 proteins in 3135 species: Archae - 103; Bacteria - 10457; Metazoa - 2944; Fungi - 1164; Plants - 700; Viruses - 286; Other Eukaryotes - 10712 (source: NCBI BLink).  |
AT4G25470 | AT4G25470.1 | ATCCACGTGGCAT | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway.  |
AT4G25580 | AT4G25580.1 | TACGTGGCATGACACGTGGT | stress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink).  |
AT4G26630 | AT4G26630.1 | CTGACGTGGCAT | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink).  |
AT4G26630.2 | CTGACGTGGCAT | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink).  | |
AT4G27720 | AT4G27720.1 | ATGCCACGTA | LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64650.1); Has 496 Blast hits to 491 proteins in 183 species: Archae - 5; Bacteria - 234; Metazoa - 75; Fungi - 33; Plants - 96; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT4G28140 | AT4G28140.1 | ATGCCACGTA | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.  |
AT4G31290 | AT4G31290.1 | CGTGGCAT | ChaC-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ChaC-like protein (InterPro:IPR006840); BEST Arabidopsis thaliana protein match is: ChaC-like family protein (TAIR:AT5G26220.1); Has 1092 Blast hits to 1086 proteins in 379 species: Archae - 0; Bacteria - 540; Metazoa - 194; Fungi - 85; Plants - 75; Viruses - 0; Other Eukaryotes - 198 (source: NCBI BLink).  |
AT4G31330 | AT4G31330.1 | ATGCCACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10580.1); Has 252 Blast hits to 252 proteins in 85 species: Archae - 0; Bacteria - 139; Metazoa - 0; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
AT4G34830 | AT4G34830.1 | GCCGTTTATGCCACGTA | LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 19818 Blast hits to 5849 proteins in 171 species: Archae - 3; Bacteria - 16; Metazoa - 570; Fungi - 397; Plants - 17732; Viruses - 0; Other Eukaryotes - 1100 (source: NCBI BLink).  |
AT4G34840 | AT4G34840.1 | TACGTGGCATAAACGGC | ATMTN2; FUNCTIONS IN: methylthioadenosine nucleosidase activity; INVOLVED IN: nucleoside metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphorylase (InterPro:IPR000845), Nucleoside phosphorylase, family 1 (InterPro:IPR018017); BEST Arabidopsis thaliana protein match is: ATMTN1; catalytic/ methylthioadenosine nucleosidase (TAIR:AT4G38800.1); Has 1301 Blast hits to 1301 proteins in 595 species: Archae - 0; Bacteria - 1215; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  |
AT4G37240 | AT4G37240.1 | CTACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23690.1); Has 130 Blast hits to 130 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G37390 | AT4G37390.1 | ATGCCACGTA | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity.  |
AT5G05200 | AT5G05200.1 | TTCCACGTGGCAT | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink).  |
AT5G05210 | AT5G05210.1 | ATGCCACGTGGAA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).  |
AT5G05210.2 | ATGCCACGTGGAA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).  | |
AT5G05290 | AT5G05290.1 | GTCCACGTGGCAT | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)  |
AT5G06370 | AT5G06370.1 | ATGCCACGCGTTT | NC domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein (TAIR:AT3G02700.1); Has 102 Blast hits to 101 proteins in 29 species: Archae - 0; Bacteria - 28; Metazoa - 4; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT5G09440 | AT5G09440.1 | ATCCACGTGGCAT | EXORDIUM LIKE 4 (EXL4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphate-induced protein 1 conserved region (InterPro:IPR006766); BEST Arabidopsis thaliana protein match is: EXL2 (EXORDIUM LIKE 2) (TAIR:AT5G64260.1); Has 233 Blast hits to 233 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 231; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G11560 | AT5G11560.1 | TACGTGGCAT | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1620 (InterPro:IPR011678), Quinonprotein alcohol dehydrogenase-like (InterPro:IPR011047); Has 361 Blast hits to 325 proteins in 153 species: Archae - 4; Bacteria - 34; Metazoa - 139; Fungi - 102; Plants - 18; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT5G13440 | AT5G13440.1 | ATGCCACG | ubiquinol-cytochrome C reductase iron-sulfur subunit, mitochondrial, putative / Rieske iron-sulfur protein, putative; FUNCTIONS IN: metal ion binding; INVOLVED IN: oxidation reduction; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome c reductase, iron-sulphur subunit (InterPro:IPR006317), Rieske [2Fe-2S] iron-sulphur domain (InterPro:IPR017941), Rieske [2Fe-2S] region (InterPro:IPR005806), Rieske iron-sulphur protein (InterPro:IPR014349), Ubiquinol cytochrome reductase transmembrane region (InterPro:IPR004192); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase iron-sulfur subunit, mitochondrial, putative / Rieske iron-sulfur protein, putative (TAIR:AT5G13430.1); Has 3953 Blast hits to 3953 proteins in 832 species: Archae - 4; Bacteria - 1423; Metazoa - 206; Fungi - 100; Plants - 334; Viruses - 0; Other Eukaryotes - 1886 (source: NCBI BLink).  |
AT5G16820 | AT5G16820.1 | ATGCCACGTA | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes.  |
AT5G16820.2 | ATGCCACGTA | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes.  | |
AT5G20700 | AT5G20700.1 | CGTGGCAT | senescence-associated protein-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT1G74940.1); Has 265 Blast hits to 265 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 265; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G21920 | AT5G21920.1 | ATGCCACGTGTCAT | YGGT family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function YGGT (InterPro:IPR003425); BEST Arabidopsis thaliana protein match is: YGGT family protein (TAIR:AT4G27990.1); Has 1060 Blast hits to 1060 proteins in 353 species: Archae - 0; Bacteria - 642; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 348 (source: NCBI BLink).  |
AT5G21930 | AT5G21930.1 | ATGACACGTGGCAT | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport  |
AT5G21930.2 | ATGACACGTGGCAT | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport  | |
AT5G22290 | AT5G22290.1 | GTGACGTGGCAT | Arabidopsis NAC domain containing protein 89 (anac089); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac060 (Arabidopsis NAC domain containing protein 60); transcription factor (TAIR:AT3G44290.1); Has 1506 Blast hits to 1504 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1506; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G23060 | AT5G23060.1 | ATGCCACGTAG | Calcium sensing receptor (CaS); LOCATED IN: thylakoid, mitochondrion, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59780.1); Has 141 Blast hits to 132 proteins in 46 species: Archae - 0; Bacteria - 51; Metazoa - 8; Fungi - 10; Plants - 56; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT5G23200 | AT5G23200.1 | GACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08270.1); Has 52 Blast hits to 52 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT5G23890 | AT5G23890.1 | GCTGACGTGGCAT | LOCATED IN: mitochondrion, chloroplast thylakoid membrane, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: S-layer homology region (InterPro:IPR001119); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52410.2); Has 47782 Blast hits to 27307 proteins in 1672 species: Archae - 444; Bacteria - 6951; Metazoa - 22630; Fungi - 3561; Plants - 1682; Viruses - 252; Other Eukaryotes - 12262 (source: NCBI BLink).  |
AT5G27420 | AT5G27420.1 | GTCCACGTGGCAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin, response to abscisic acid stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ATL6; protein binding / zinc ion binding (TAIR:AT3G05200.1); Has 6369 Blast hits to 6350 proteins in 217 species: Archae - 0; Bacteria - 0; Metazoa - 2077; Fungi - 469; Plants - 2661; Viruses - 39; Other Eukaryotes - 1123 (source: NCBI BLink).  |
AT5G38560 | AT5G38560.1 | AACCGCGTGGCAT | protein kinase family protein; FUNCTIONS IN: structural constituent of cell wall, protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Pistil-specific extensin-like protein (InterPro:IPR003882), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G68690.1); Has 405816 Blast hits to 189864 proteins in 4487 species: Archae - 1066; Bacteria - 69258; Metazoa - 168923; Fungi - 53404; Plants - 46895; Viruses - 9870; Other Eukaryotes - 56400 (source: NCBI BLink).  |
AT5G39530 | AT5G39530.1 | ATGCCACGTGGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39520.1); Has 172 Blast hits to 172 proteins in 54 species: Archae - 0; Bacteria - 88; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT5G39570 | AT5G39570.1 | CCCACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G41080 | AT5G41080.1 | ATGCCACGTA | glycerophosphoryl diester phosphodiesterase family protein; FUNCTIONS IN: phosphoric diester hydrolase activity, glycerophosphodiester phosphodiesterase activity; INVOLVED IN: glycerol metabolic process, lipid metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), Glycerophosphoryl diester phosphodiesterase (InterPro:IPR004129); BEST Arabidopsis thaliana protein match is: SRG3 (senescence-related gene 3); glycerophosphodiester phosphodiesterase/ phosphoric diester hydrolase (TAIR:AT3G02040.1); Has 1314 Blast hits to 1286 proteins in 350 species: Archae - 22; Bacteria - 625; Metazoa - 237; Fungi - 103; Plants - 54; Viruses - 2; Other Eukaryotes - 271 (source: NCBI BLink).  |
AT5G41080.2 | ATGCCACGTA | glycerophosphoryl diester phosphodiesterase family protein; FUNCTIONS IN: phosphoric diester hydrolase activity, glycerophosphodiester phosphodiesterase activity; INVOLVED IN: glycerol metabolic process, lipid metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), Glycerophosphoryl diester phosphodiesterase (InterPro:IPR004129); BEST Arabidopsis thaliana protein match is: SRG3 (senescence-related gene 3); glycerophosphodiester phosphodiesterase/ phosphoric diester hydrolase (TAIR:AT3G02040.1); Has 1314 Blast hits to 1286 proteins in 350 species: Archae - 22; Bacteria - 625; Metazoa - 237; Fungi - 103; Plants - 54; Viruses - 2; Other Eukaryotes - 271 (source: NCBI BLink).  | |
AT5G47550 | AT5G47550.1 | ACACGTCATGCCACGTGGCGG | cysteine protease inhibitor, putative / cystatin, putative; FUNCTIONS IN: cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor family protein / cystatin family protein (TAIR:AT4G16500.1); Has 507 Blast hits to 483 proteins in 88 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 0; Plants - 482; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT5G52990 | AT5G52990.1 | TACGTGGCAT | vesicle-associated membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27840.1); Has 89 Blast hits to 89 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G53490 | AT5G53490.1 | ATGCCACGTCAT | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein.  |
AT5G53490.2 | ATGCCACGTCAT | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein.  | |
AT5G54080 | AT5G54080.1 | ATGCCACGTCATC | homogentisate 1,2-dioxygenase  |
AT5G54080.2 | ATGCCACGTCATC | homogentisate 1,2-dioxygenase  | |
AT5G58070 | AT5G58070.1 | TTCCACGTGGCAT | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane.  |
AT5G60680 | AT5G60680.1 | CGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45210.1); Has 210 Blast hits to 210 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 207; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G62090 | AT5G62090.1 | ATGCCACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: SLK1 (SEUSS-LIKE 1); transcription regulator (TAIR:AT4G25520.1); Has 38202 Blast hits to 15459 proteins in 742 species: Archae - 6; Bacteria - 1392; Metazoa - 14682; Fungi - 3752; Plants - 2341; Viruses - 407; Other Eukaryotes - 15622 (source: NCBI BLink).  |
AT5G62090.2 | ATGCCACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: SLK1 (SEUSS-LIKE 1); transcription regulator (TAIR:AT4G25520.1); Has 38202 Blast hits to 15459 proteins in 742 species: Archae - 6; Bacteria - 1392; Metazoa - 14682; Fungi - 3752; Plants - 2341; Viruses - 407; Other Eukaryotes - 15622 (source: NCBI BLink).  | |
AT5G63160 | AT5G63160.1 | ATGCCACGT | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development.  |
AT5G64930 | AT5G64930.1 | GGACACGTGGCAT | Regulator of expression of pathogenesis-related (PR) genes. Participates in signal transduction pathways involved in plant defense (systemic acquired resistance -SAR).  |
AT5G64940 | AT5G64940.1 | ATGCCACGTGTCC | Encodes a member of ATH subfamily of ATP-binding cassette (ABC) proteins.  |
AT5G64940.2 | ATGCCACGTGTCC | Encodes a member of ATH subfamily of ATP-binding cassette (ABC) proteins.  | |
AT5G66580 | AT5G66580.1 | CTGCCACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50800.1); Has 132 Blast hits to 132 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 132; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |