| Locus | Gene model | Sequence | Description |
| AT1G01260 | AT1G01260.1 | GACCCGGTTTAA | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ATAIB (ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR); DNA binding / transcription factor (TAIR:AT2G46510.1); Has 2098 Blast hits to 1892 proteins in 178 species: Archae - 0; Bacteria - 2; Metazoa - 163; Fungi - 52; Plants - 1843; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT1G01260.2 | GACCCGGTTTAA | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ATAIB (ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR); DNA binding / transcription factor (TAIR:AT2G46510.1); Has 2098 Blast hits to 1892 proteins in 178 species: Archae - 0; Bacteria - 2; Metazoa - 163; Fungi - 52; Plants - 1843; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT1G04950 | AT1G04950.1 | AACCGGGT | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G04950.2 | AACCGGGT | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G04950.3 | AACCGGGT | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G06010 | AT1G06010.1 | AACCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G06220 | AT1G06220.1 | AACCCGGTTTAC | Encodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS. |
| AT1G06220.2 | AACCCGGTTTAC | Encodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS. |
| AT1G06730 | AT1G06730.1 | AACCCGGTTCGGT | pfkB-type carbohydrate kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: D-ribose catabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate/purine kinase (InterPro:IPR011611); BEST Arabidopsis thaliana protein match is: pfkB-type carbohydrate kinase family protein (TAIR:AT3G59480.1); Has 8525 Blast hits to 8520 proteins in 1199 species: Archae - 160; Bacteria - 6264; Metazoa - 85; Fungi - 26; Plants - 192; Viruses - 0; Other Eukaryotes - 1798 (source: NCBI BLink). |
| AT1G08470 | AT1G08470.1 | ATCCGGTTCACCCGGTTTT | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: strictosidine synthase family protein (TAIR:AT5G22020.1); Has 898 Blast hits to 891 proteins in 185 species: Archae - 1; Bacteria - 239; Metazoa - 198; Fungi - 13; Plants - 301; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT1G08480 | AT1G08480.1 | AAAACCGGGTGAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, plastid, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; Has 22 Blast hits to 22 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G10430 | AT1G10430.1 | AAACCGAACCTTAACCGGGTC | Encodes one of two isoforms of the catalytic subunit of protein phosphatase 2A. |
| AT1G10865 | AT1G10865.1 | ACCCGGTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G10865.2 | ACCCGGTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G12440 | AT1G12440.1 | AACCCGGTTCA | zinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G12040.2); Has 773 Blast hits to 766 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 388; Fungi - 2; Plants - 269; Viruses - 6; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G12440.2 | AACCCGGTTCA | zinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G12040.2); Has 773 Blast hits to 766 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 388; Fungi - 2; Plants - 269; Viruses - 6; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G12620 | AT1G12620.1 | AACCCGGTTTT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: shoot apex, leaf whorl, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G12300.1); Has 27983 Blast hits to 6205 proteins in 194 species: Archae - 4; Bacteria - 17; Metazoa - 1072; Fungi - 778; Plants - 24632; Viruses - 0; Other Eukaryotes - 1480 (source: NCBI BLink). |
| AT1G12770 | AT1G12770.1 | GACCCGGTT | embryo defective 1586 (EMB1586); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; INVOLVED IN: embryonic development ending in seed dormancy; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative (TAIR:AT3G19760.1); Has 25549 Blast hits to 25020 proteins in 1695 species: Archae - 449; Bacteria - 9955; Metazoa - 4809; Fungi - 3113; Plants - 1343; Viruses - 12; Other Eukaryotes - 5868 (source: NCBI BLink). |
| AT1G16020 | AT1G16020.1 | AACCCGACCCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G16020.2 | AACCCGACCCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G16850 | AT1G16850.1 | AACCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, leaf apex, male gametophyte, flower, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; Has 9 Blast hits to 9 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G17130 | AT1G17130.1 | CGACCCGGTTAA | cell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink). |
| AT1G17130.2 | CGACCCGGTTAA | cell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink). |
| AT1G17360 | AT1G17360.1 | AACCCGGTTTAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 8834 Blast hits to 6495 proteins in 406 species: Archae - 8; Bacteria - 626; Metazoa - 3389; Fungi - 793; Plants - 257; Viruses - 52; Other Eukaryotes - 3709 (source: NCBI BLink). |
| AT1G18150 | AT1G18150.1 | CAAACCGGGTCG | ATMPK8, |
| AT1G18150.2 | CAAACCGGGTCG | ATMPK8, |
| AT1G18680 | AT1G18680.1 | ACCCGGTTCGGT | HNH endonuclease domain-containing protein; FUNCTIONS IN: endonuclease activity, nucleic acid binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: HNH nuclease (InterPro:IPR003615), HNH endonuclease (InterPro:IPR002711); BEST Arabidopsis thaliana protein match is: HNH endonuclease domain-containing protein (TAIR:AT3G47490.1); Has 51 Blast hits to 51 proteins in 15 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G21010 | AT1G21010.1 | ACCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76600.1); Has 113 Blast hits to 113 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 113; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G22040 | AT1G22040.1 | GACCCGGTTTAC | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G55270.1); Has 8530 Blast hits to 4244 proteins in 221 species: Archae - 18; Bacteria - 386; Metazoa - 6931; Fungi - 33; Plants - 777; Viruses - 68; Other Eukaryotes - 317 (source: NCBI BLink). |
| AT1G22180 | AT1G22180.1 | AAAACCGGGTT | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G08690.2); Has 1880 Blast hits to 1880 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 814; Fungi - 399; Plants - 444; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). |
| AT1G22180.2 | AAAACCGGGTT | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G08690.2); Has 1880 Blast hits to 1880 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 814; Fungi - 399; Plants - 444; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). |
| AT1G22180.3 | AAAACCGGGTT | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G08690.2); Has 1880 Blast hits to 1880 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 814; Fungi - 399; Plants - 444; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). |
| AT1G24706 | AT1G24706.1 | CTTAACCGGACCCGGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 25479 Blast hits to 15950 proteins in 654 species: Archae - 12; Bacteria - 897; Metazoa - 14432; Fungi - 3233; Plants - 1262; Viruses - 124; Other Eukaryotes - 5519 (source: NCBI BLink). |
| AT1G26640 | AT1G26640.1 | AACCCGGTTTG | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/glutamate/uridylate kinase (InterPro:IPR001048); Has 393 Blast hits to 393 proteins in 151 species: Archae - 114; Bacteria - 162; Metazoa - 4; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT1G26650 | AT1G26650.1 | CAAACCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69430.1); Has 108 Blast hits to 107 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G26740 | AT1G26740.1 | TTAAACCGGGT | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L32p (InterPro:IPR002677); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G69485.1); Has 76 Blast hits to 76 proteins in 26 species: Archae - 0; Bacteria - 21; Metazoa - 0; Fungi - 12; Plants - 31; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G26750 | AT1G26750.1 | ACCCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G28281 | AT1G28281.1 | AAAACCGGGTT | unknown protein; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT1G28281.1 | TTAACCGGGTT | unknown protein; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT1G29700 | AT1G29700.1 | GTAAACCGGGTCCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 321 Blast hits to 321 proteins in 85 species: Archae - 0; Bacteria - 142; Metazoa - 0; Fungi - 2; Plants - 20; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT1G33490 | AT1G33490.1 | AACCCGGTTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G33490.1 | ACCGGGTCGACCCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G33500 | AT1G33500.1 | CCGAACCGGGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink). |
| AT1G33500.1 | CTAAACCGGGTCGACCCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink). |
| AT1G33520 | AT1G33520.1 | GACCCGGTTTGG | Has single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4; |
| AT1G35516 | AT1G35516.1 | TTAAACCGGGT | CONTAINS InterPro DOMAIN/s: Myb transcription factor (InterPro:IPR015495); Has 12 Blast hits to 12 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G49670 | AT1G49670.1 | AACCGGGTT | molecular function has not been defined. Was shown involved in oxidative stress tolerance. |
| AT1G50500 | AT1G50500.1 | ATAAACCGGGTT | encodes a member of VPS53 family protein involved in the retrograde trafficking of vesicles to the late Golgi. Mutants in this gene are more sensitive to heat and osmotic stress. |
| AT1G52290 | AT1G52290.1 | ATAAACCGGGT | protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATPERK1 (PROLINE EXTENSIN-LIKE RECEPTOR KINASE 1); ATP binding / protein kinase (TAIR:AT3G24550.1); Has 84708 Blast hits to 83704 proteins in 3065 species: Archae - 46; Bacteria - 7953; Metazoa - 37310; Fungi - 6457; Plants - 18280; Viruses - 385; Other Eukaryotes - 14277 (source: NCBI BLink). |
| AT1G54100 | AT1G54100.1 | AACCCGGTTTG | Aldehyde dehydrogenase |
| AT1G54100.2 | AACCCGGTTTG | Aldehyde dehydrogenase |
| AT1G56440 | AT1G56440.1 | AACCCGGTT | serine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink). |
| AT1G56450 | AT1G56450.1 | AACCGGGTT | 20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds |
| AT1G61900 | AT1G61900.1 | AACCCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30700.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G61900.2 | AACCCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30700.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G63520 | AT1G63520.1 | AGGGCCCAACCGGGTTCGAACCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G11450.1); Has 63 Blast hits to 63 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G69010 | AT1G69010.1 | GGCCTAACCGGGT | BES1-interacting Myc-like protein 2 (BIM2); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: dTDP-rhamnose biosynthetic process, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM1; DNA binding / protein binding / transcription factor (TAIR:AT5G08130.3); Has 1614 Blast hits to 1609 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 38; Plants - 1371; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G71430 | AT1G71430.1 | AACCGGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G71430.1 | GTAAACCGGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G73020 | AT1G73020.1 | ACCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF590 (InterPro:IPR007632); Has 925 Blast hits to 873 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 662; Fungi - 104; Plants - 12; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). |
| AT1G73030 | AT1G73030.1 | CAAACCGGGT | VPS46.2; INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS46.1 (VACUOLAR PROTEIN SORTING 46.1) (TAIR:AT1G17730.1); Has 975 Blast hits to 974 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 421; Fungi - 187; Plants - 221; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT1G74230 | AT1G74230.1 | TTTAACCGGGTC | encodes a glycine-rich RNA binding protein. |
| AT1G75670 | AT1G75670.1 | CGAACCGGGTTATTGGG | DNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G75670.2 | CGAACCGGGTTATTGGG | DNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G76630 | AT1G76630.1 | CAAACCGGGTC | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: SEC (secret agent); transferase, transferring glycosyl groups (TAIR:AT3G04240.1); Has 5924 Blast hits to 3836 proteins in 536 species: Archae - 384; Bacteria - 2298; Metazoa - 901; Fungi - 281; Plants - 131; Viruses - 0; Other Eukaryotes - 1929 (source: NCBI BLink). |
| AT2G01470 | AT2G01470.1 | TGAACCGGGTC | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER. |
| AT2G06925 | AT2G06925.1 | AACCCGGTTAAG | Encodes a secretory phospholipase A2 enzyme, which specifically hydrolyzes the sn-2 position of phospholipids. The enzyme has a preference towards linoleoyl acyl chain over palmitoyl acyl chain. It also has a slight preference for phosphatidylcholine over phosphatidylethanolamine. |
| AT2G17200 | AT2G17200.1 | CGAACCGGGTT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17190.1); Has 11842 Blast hits to 6071 proteins in 720 species: Archae - 6; Bacteria - 2895; Metazoa - 3957; Fungi - 1228; Plants - 1619; Viruses - 162; Other Eukaryotes - 1975 (source: NCBI BLink). |
| AT2G17880 | AT2G17880.1 | AACCCGGTTCG | DNAJ heat shock protein, putative; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (J11) (TAIR:AT4G36040.1); Has 13518 Blast hits to 13518 proteins in 1859 species: Archae - 87; Bacteria - 4830; Metazoa - 2737; Fungi - 1089; Plants - 967; Viruses - 5; Other Eukaryotes - 3803 (source: NCBI BLink). |
| AT2G22425 | AT2G22425.1 | GCCGGTTCACCCGGTTAT | peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, signal peptidase complex, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT4G40042.1); Has 209 Blast hits to 209 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT2G22425.2 | GCCGGTTCACCCGGTTAT | peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, signal peptidase complex, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT4G40042.1); Has 209 Blast hits to 209 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT2G22660 | AT2G22660.1 | AACCCGGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1399 (InterPro:IPR009836); BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT4G37900.1); Has 14843 Blast hits to 4550 proteins in 469 species: Archae - 40; Bacteria - 5555; Metazoa - 4422; Fungi - 897; Plants - 1977; Viruses - 191; Other Eukaryotes - 1761 (source: NCBI BLink). |
| AT2G22660.2 | AACCCGGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1399 (InterPro:IPR009836); BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT4G37900.1); Has 14843 Blast hits to 4550 proteins in 469 species: Archae - 40; Bacteria - 5555; Metazoa - 4422; Fungi - 897; Plants - 1977; Viruses - 191; Other Eukaryotes - 1761 (source: NCBI BLink). |
| AT2G22990 | AT2G22990.2 | AACCGGGTT | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT2G22990.6 | AACCGGGTT | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT2G27900 | AT2G27900.1 | ACCCGGTTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 244 Blast hits to 190 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT2G27900.2 | ACCCGGTTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 244 Blast hits to 190 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT2G30530 | AT2G30530.1 | AACCCGGTTTAA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G01970.1); Has 5828 Blast hits to 755 proteins in 128 species: Archae - 0; Bacteria - 29; Metazoa - 881; Fungi - 129; Plants - 81; Viruses - 12; Other Eukaryotes - 4696 (source: NCBI BLink). |
| AT2G32235 | AT2G32235.1 | AACCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 4; Metazoa - 10; Fungi - 9; Plants - 3; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G32630 | AT2G32630.1 | CTAAACCGGGTT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05670.2); Has 24903 Blast hits to 6117 proteins in 190 species: Archae - 4; Bacteria - 30; Metazoa - 789; Fungi - 688; Plants - 22202; Viruses - 0; Other Eukaryotes - 1190 (source: NCBI BLink). |
| AT2G35410 | AT2G35410.1 | GACCCGGTTCA | 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT4G09040.2); Has 19540 Blast hits to 13531 proteins in 594 species: Archae - 12; Bacteria - 1397; Metazoa - 10397; Fungi - 2454; Plants - 3010; Viruses - 0; Other Eukaryotes - 2270 (source: NCBI BLink). |
| AT2G37680 | AT2G37680.1 | AAACCGAACCGGGT | CONTAINS InterPro DOMAIN/s: Vacuolar import and degradation protein Vid24 (InterPro:IPR018618); Has 214 Blast hits to 214 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 124; Plants - 31; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G38000 | AT2G38000.1 | GACCCGGTT | chaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT2G42120 | AT2G42120.1 | TTAACCGGGTT | DNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). |
| AT2G42120.2 | TTAACCGGGTT | DNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). |
| AT2G42130 | AT2G42130.1 | AACCCGGTTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G42130.2 | AACCCGGTTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G42130.3 | AACCCGGTTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G42130.4 | AACCCGGTTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G42130.5 | AACCCGGTTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G48100 | AT2G48100.1 | AACCCGGTTTT | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT2G48100.2 | AACCCGGTTTT | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT2G48100.3 | AACCCGGTTTT | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT2G48100.4 | AACCCGGTTTT | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT3G02820 | AT3G02820.1 | ATAAACCGGGTCAAA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: cell cycle, replication fork protection, response to DNA damage stimulus; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Replication fork protection component Swi3 (InterPro:IPR012923), Zinc finger, CCHC-type (InterPro:IPR001878); Has 310 Blast hits to 310 proteins in 102 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 74; Plants - 50; Viruses - 2; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT3G03580 | AT3G03580.1 | TCGGTTTAAACCGGGTT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DOT4 (DEFECTIVELY ORGANIZED TRIBUTARIES 4) (TAIR:AT4G18750.1); Has 19378 Blast hits to 5309 proteins in 162 species: Archae - 0; Bacteria - 2; Metazoa - 56; Fungi - 84; Plants - 18779; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink). |
| AT3G03600 | AT3G03600.1 | CGACCCGGTTTG | Structural component of the mitochondrial ribosome small subunit |
| AT3G03610 | AT3G03610.1 | CAAACCGGGTCG | phagocytosis and cell motility protein ELMO1-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: phagocytosis; LOCATED IN: cytoskeleton; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Engulfment and cell motility, ELMO (InterPro:IPR006816); BEST Arabidopsis thaliana protein match is: phagocytosis and cell motility protein ELMO1-related (TAIR:AT1G03620.1); Has 636 Blast hits to 636 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 422; Fungi - 25; Plants - 106; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT3G03810 | AT3G03810.1 | ACCCGGTT | embryo sac development arrest 30 (EDA30); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation, polar nucleus fusion, pollen tube development; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G30300.1); Has 433 Blast hits to 418 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 433; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03810.1 | CTAAACCGGGTT | embryo sac development arrest 30 (EDA30); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation, polar nucleus fusion, pollen tube development; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G30300.1); Has 433 Blast hits to 418 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 433; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03890 | AT3G03890.1 | CCAAACCGGGTT | FMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT3G03890.2 | CCAAACCGGGTT | FMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT3G04830 | AT3G04830.1 | GACCCGGTTAT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT3G04830.2 | GACCCGGTTAT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT3G05625 | AT3G05625.1 | ACCCGGTTCA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 209 Blast hits to 207 proteins in 91 species: Archae - 14; Bacteria - 152; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT3G06240 | AT3G06240.1 | GACCCGGTTTG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G23880.1); Has 1173 Blast hits to 1161 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1171; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G09210 | AT3G09210.1 | ATAAACCGGGTT | PLASTID TRANSCRIPTIONALLY ACTIVE13 (PTAC13); FUNCTIONS IN: transcription elongation regulator activity; INVOLVED IN: positive regulation of RNA elongation from RNA polymerase II promoter; LOCATED IN: plastid chromosome, nucleoid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Transcription antitermination protein, NusG, N-terminal (InterPro:IPR006645), Translation protein SH3-like, subgroup (InterPro:IPR014722), KOW (InterPro:IPR005824); Has 2507 Blast hits to 2507 proteins in 692 species: Archae - 0; Bacteria - 1288; Metazoa - 0; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 1201 (source: NCBI BLink). |
| AT3G11945 | AT3G11945.1 | TTAACCGGGTT | Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. |
| AT3G11945.2 | TTAACCGGGTT | Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. |
| AT3G13070 | AT3G13070.1 | CAAACCGGGTT | CBS domain-containing protein / transporter associated domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Transporter-associated region (InterPro:IPR005170), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein / transporter associated domain-containing protein (TAIR:AT1G55930.1); Has 10211 Blast hits to 10209 proteins in 1421 species: Archae - 94; Bacteria - 6198; Metazoa - 215; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 3506 (source: NCBI BLink). |
| AT3G15580 | AT3G15580.1 | TGAACCGGGTT | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. |
| AT3G18165 | AT3G18165.1 | TAGGGCCCTAGAAGCCCAAGGCCCAATAAAACCGGGTCGG | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
| AT3G18250 | AT3G18250.1 | ATAAACCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, LP.02 two leaves visible, petal differentiation and expansion stage; Has 20 Blast hits to 20 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G19640 | AT3G19640.1 | AACCCGGTTTG | magnesium transporter CorA-like family protein (MRS2-3); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-1) (TAIR:AT1G16010.2); Has 603 Blast hits to 521 proteins in 126 species: Archae - 0; Bacteria - 31; Metazoa - 102; Fungi - 198; Plants - 203; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT3G19770 | AT3G19770.1 | AAAACCGGGTT | Guanine nucleotide exchange factor VPS9a. Can ctivate all Rab5 members to GTP-bound forms in vitro. Required for embryogenesis. Regulates the localization of ARA7 and ARA6. Involved in postembryonic root development. |
| AT3G19770.2 | AAAACCGGGTT | Guanine nucleotide exchange factor VPS9a. Can ctivate all Rab5 members to GTP-bound forms in vitro. Required for embryogenesis. Regulates the localization of ARA7 and ARA6. Involved in postembryonic root development. |
| AT3G20870 | AT3G20870.1 | AACCCGGTT | metal transporter family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc/iron permease (InterPro:IPR003689); BEST Arabidopsis thaliana protein match is: metal transporter family protein (TAIR:AT3G08650.2); Has 2198 Blast hits to 2183 proteins in 642 species: Archae - 78; Bacteria - 1120; Metazoa - 489; Fungi - 73; Plants - 72; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink). |
| AT3G21290 | AT3G21290.1 | CCGAACCGGGT | dentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Occludin and RNA polymerase II elongation factor ELL domain (InterPro:IPR010844); Has 15416 Blast hits to 7392 proteins in 559 species: Archae - 48; Bacteria - 5567; Metazoa - 4037; Fungi - 1335; Plants - 339; Viruses - 108; Other Eukaryotes - 3982 (source: NCBI BLink). |
| AT3G22480 | AT3G22480.1 | AACCCGGTTCAA | PREFOLDIN 2 (PDF2); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin beta-like (InterPro:IPR002777), Prefoldin (InterPro:IPR009053); Has 303 Blast hits to 303 proteins in 148 species: Archae - 11; Bacteria - 0; Metazoa - 113; Fungi - 80; Plants - 37; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G22480.2 | AACCCGGTTCAA | PREFOLDIN 2 (PDF2); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin beta-like (InterPro:IPR002777), Prefoldin (InterPro:IPR009053); Has 303 Blast hits to 303 proteins in 148 species: Archae - 11; Bacteria - 0; Metazoa - 113; Fungi - 80; Plants - 37; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G24150 | AT3G24150.1 | AACCCGGTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32295.1); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G24160 | AT3G24160.1 | ATAACCGGGTT | Encodes a putative Type 1 membrane protein (PMP). |
| AT3G24200 | AT3G24200.1 | AAAACCGGGTT | FAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink). |
| AT3G24200.2 | AAAACCGGGTT | FAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink). |
| AT3G24315 | AT3G24315.1 | ATAACCGGGTT | AtSec20; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sec20 (InterPro:IPR005606); Has 205 Blast hits to 205 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 64; Plants - 27; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G27160 | AT3G27160.1 | TTAAACCGGGTT | GHS1 encodes plastid ribosomal protein S21 |
| AT3G28715 | AT3G28715.1 | TTTAACCGGGT | H+-transporting two-sector ATPase, putative; FUNCTIONS IN: hydrogen ion transmembrane transporter activity, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: ATPase, V0/A0 complex, subunit C/D (InterPro:IPR002843), ATPase, V0 complex, subunit D (InterPro:IPR016727); BEST Arabidopsis thaliana protein match is: H+-transporting two-sector ATPase, putative (TAIR:AT3G28710.1); Has 448 Blast hits to 447 proteins in 191 species: Archae - 19; Bacteria - 1; Metazoa - 206; Fungi - 98; Plants - 47; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT3G51840 | AT3G51840.1 | CCGACTTAACCGGGTCGG | Encodes a short-chain acyl-CoA oxidase, which catalyzes the first step of peroxisomal fatty acid beta-oxidation during early, post-germinative growth in oilseed species. Null mutants virtually lack short-chain acyl-CoA and are resistant to 2,4-dichlorophenoxybutyric acid, which is converted to the herbicide and auxin analogue 2,4-dichlorophenoxyacetic acid by beta-oxidation. Despite the almost complete loss of short-chain activity, lipid catabolism and seedling growth and establishment was unaltered in the acx4 mutant. However, double mutants in acx3acx4 (acx3 encodes medium chain acyl CoA oxidase) were not viable and arrested during embryogenesis. |
| AT3G52400 | AT3G52400.1 | AACCCGGTT | syntaxin protein, involved in the negative regulation of defense pathways such as programmed cell death, salicylic acid signalling pathway, jasmonic acid signalling pathway |
| AT3G57330 | AT3G57330.1 | GTAAACCGGGTT | autoinhibited Ca2+-ATPase 11 (ACA11); FUNCTIONS IN: calmodulin binding, calcium-transporting ATPase activity; INVOLVED IN: cation transport, calcium ion transport, metabolic process, ATP biosynthetic process; LOCATED IN: chloroplast, plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, ATPase-associated region (InterPro:IPR008250), ATPase, P-type, calcium-transporting, PMCA-type (InterPro:IPR006408), ATPase, P-type, H+ transporting proton pump (InterPro:IPR000695), ATPase, P-type cation-transporter, N-terminal (InterPro:IPR004014), Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type cation-transporter, C-terminal (InterPro:IPR006068), ATPase, P-type phosphorylation site (InterPro:IPR018303); BEST Arabidopsis thaliana protein match is: ACA4 (AUTO-INHIBITED CA(2+)-ATPASE, ISOFORM 4); calcium-transporting ATPase/ calmodulin binding (TAIR:AT2G41560.1); Has 25242 Blast hits to 19809 proteins in 1858 species: Archae - 502; Bacteria - 15238; Metazoa - 3407; Fungi - 1728; Plants - 1099; Viruses - 3; Other Eukaryotes - 3265 (source: NCBI BLink). |
| AT3G58460 | AT3G58460.1 | CCGACCCGGTT | ARABIDOPSIS RHOMBOID-LIKE PROTEIN 15 (ATRBL15); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Peptidase S54, rhomboid (InterPro:IPR002610), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ATRBL14 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 14); zinc ion binding (TAIR:AT3G17611.1); Has 1918 Blast hits to 1918 proteins in 675 species: Archae - 50; Bacteria - 1104; Metazoa - 148; Fungi - 104; Plants - 162; Viruses - 3; Other Eukaryotes - 347 (source: NCBI BLink). |
| AT3G62000 | AT3G62000.1 | TTTGACCCGACCCGGTT | O-methyltransferase family 3 protein; FUNCTIONS IN: O-methyltransferase activity; LOCATED IN: cytosol; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: O-methyltransferase family 3 protein (TAIR:AT3G61990.1); Has 3642 Blast hits to 3640 proteins in 775 species: Archae - 31; Bacteria - 1513; Metazoa - 236; Fungi - 112; Plants - 446; Viruses - 0; Other Eukaryotes - 1304 (source: NCBI BLink). |
| AT3G63150 | AT3G63150.1 | TCACGTGTCGGGTCAACCCGGTT | Encodes a calcium binding GTPases that is localized to the mitochondrion and is involved in salt stress response. |
| AT4G00090 | AT4G00090.1 | AACCCGACCCGACCCGGTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink). |
| AT4G00355 | AT4G00355.1 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.2 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.3 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.4 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G01370 | AT4G01370.1 | AACCCGGTTTAA | Encodes a nuclear and cytoplasmically localized MAP kinase involved in mediating responses to pathogens. Its substrates include MKS1. |
| AT4G02890 | AT4G02890.1 | AACCCGGTTTT | Polyubiquitin gene containing 4 ubiquitin repeats. |
| AT4G02890.2 | AACCCGGTTTT | Polyubiquitin gene containing 4 ubiquitin repeats. |
| AT4G02890.3 | AACCCGGTTTT | Polyubiquitin gene containing 4 ubiquitin repeats. |
| AT4G02890.4 | AACCCGGTTTT | Polyubiquitin gene containing 4 ubiquitin repeats. |
| AT4G03390 | AT4G03390.1 | CGGTTTAGACCCGGTTAA | STRUBBELIG-RECEPTOR FAMILY 3 (SRF3); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: SRF1 (strubbelig receptor family 1); kinase (TAIR:AT2G20850.1); Has 104562 Blast hits to 78934 proteins in 2893 species: Archae - 52; Bacteria - 7276; Metazoa - 35203; Fungi - 5374; Plants - 43078; Viruses - 296; Other Eukaryotes - 13283 (source: NCBI BLink). |
| AT4G12005 | AT4G12005.1 | GACCCGGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G19400 | AT4G19400.1 | TTAAACCGGGTT | actin binding; FUNCTIONS IN: actin binding; INVOLVED IN: cytoskeleton organization; LOCATED IN: actin cytoskeleton; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Profilin/allergen (InterPro:IPR002097); Has 17 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G23930 | AT4G23930.1 | AACCCGGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G64450.1); Has 183 Blast hits to 177 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G23930.2 | AACCCGGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G64450.1); Has 183 Blast hits to 177 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G24490 | AT4G24490.1 | AAAACCGGGTT | protein prenyltransferase; FUNCTIONS IN: protein prenyltransferase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein prenyltransferase (InterPro:IPR008940), Protein prenyltransferase, alpha subunit (InterPro:IPR002088); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase alpha subunit-related / RAB geranylgeranyltransferase alpha subunit-related (TAIR:AT5G41820.1); Has 2932 Blast hits to 2359 proteins in 263 species: Archae - 17; Bacteria - 285; Metazoa - 1694; Fungi - 296; Plants - 206; Viruses - 2; Other Eukaryotes - 432 (source: NCBI BLink). |
| AT4G24490.1 | AACCCGGTTTAC | protein prenyltransferase; FUNCTIONS IN: protein prenyltransferase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein prenyltransferase (InterPro:IPR008940), Protein prenyltransferase, alpha subunit (InterPro:IPR002088); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase alpha subunit-related / RAB geranylgeranyltransferase alpha subunit-related (TAIR:AT5G41820.1); Has 2932 Blast hits to 2359 proteins in 263 species: Archae - 17; Bacteria - 285; Metazoa - 1694; Fungi - 296; Plants - 206; Viruses - 2; Other Eukaryotes - 432 (source: NCBI BLink). |
| AT4G24490.2 | AAAACCGGGTT | protein prenyltransferase; FUNCTIONS IN: protein prenyltransferase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein prenyltransferase (InterPro:IPR008940), Protein prenyltransferase, alpha subunit (InterPro:IPR002088); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase alpha subunit-related / RAB geranylgeranyltransferase alpha subunit-related (TAIR:AT5G41820.1); Has 2932 Blast hits to 2359 proteins in 263 species: Archae - 17; Bacteria - 285; Metazoa - 1694; Fungi - 296; Plants - 206; Viruses - 2; Other Eukaryotes - 432 (source: NCBI BLink). |
| AT4G24490.2 | AACCCGGTTTAC | protein prenyltransferase; FUNCTIONS IN: protein prenyltransferase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein prenyltransferase (InterPro:IPR008940), Protein prenyltransferase, alpha subunit (InterPro:IPR002088); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase alpha subunit-related / RAB geranylgeranyltransferase alpha subunit-related (TAIR:AT5G41820.1); Has 2932 Blast hits to 2359 proteins in 263 species: Archae - 17; Bacteria - 285; Metazoa - 1694; Fungi - 296; Plants - 206; Viruses - 2; Other Eukaryotes - 432 (source: NCBI BLink). |
| AT4G24500 | AT4G24500.1 | AACCCGGTTTT | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT4G24500.1 | GTAAACCGGGTT | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT4G24500.2 | AACCCGGTTTT | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT4G24500.2 | GTAAACCGGGTT | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT4G25390 | AT4G25390.1 | AACCCGGTTCCGGTTT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G51770.1); Has 62019 Blast hits to 52421 proteins in 1538 species: Archae - 19; Bacteria - 4146; Metazoa - 22140; Fungi - 3414; Plants - 25096; Viruses - 163; Other Eukaryotes - 7041 (source: NCBI BLink). |
| AT4G25390.2 | AACCCGGTTCCGGTTT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G51770.1); Has 62019 Blast hits to 52421 proteins in 1538 species: Archae - 19; Bacteria - 4146; Metazoa - 22140; Fungi - 3414; Plants - 25096; Viruses - 163; Other Eukaryotes - 7041 (source: NCBI BLink). |
| AT4G27000 | AT4G27000.1 | CTTAACCGGGTT | ATRBP45C; FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45A (RNA-binding protein 45A); RNA binding (TAIR:AT5G54900.1); Has 24066 Blast hits to 14859 proteins in 588 species: Archae - 10; Bacteria - 1237; Metazoa - 14401; Fungi - 2729; Plants - 3582; Viruses - 5; Other Eukaryotes - 2102 (source: NCBI BLink). |
| AT4G33530 | AT4G33530.1 | AACCCGGTTTT | potassium transporter |
| AT4G33540 | AT4G33540.1 | AAAACCGGGTT | metallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: response to arsenic, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 1070 Blast hits to 1070 proteins in 241 species: Archae - 64; Bacteria - 439; Metazoa - 27; Fungi - 6; Plants - 47; Viruses - 0; Other Eukaryotes - 487 (source: NCBI BLink). |
| AT4G34090 | AT4G34090.1 | GGCCTAACCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G34090.2 | GGCCTAACCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G34100 | AT4G34100.1 | GACCCGGTTAGGCC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT4G34100.2 | GACCCGGTTAGGCC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT4G37190 | AT4G37190.1 | ACCCGGTTAT | INVOLVED IN: protein polymerization; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta tubulin, autoregulation binding site (InterPro:IPR013838), Tubulin/FtsZ, GTPase (InterPro:IPR003008); Has 251 Blast hits to 250 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 89; Plants - 28; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT4G37190.2 | ACCCGGTTAT | INVOLVED IN: protein polymerization; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta tubulin, autoregulation binding site (InterPro:IPR013838), Tubulin/FtsZ, GTPase (InterPro:IPR003008); Has 251 Blast hits to 250 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 89; Plants - 28; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT4G39070 | AT4G39070.1 | CAAACCGGGT | zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: STH2 (SALT TOLERANCE HOMOLOG2); transcription factor/ zinc ion binding (TAIR:AT1G75540.1); Has 1235 Blast hits to 854 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 1150; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT5G01510 | AT5G01510.1 | ATAAACCGAATTTAACCGGGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: RUS1 (ROOT UVB SENSITIVE 1) (TAIR:AT3G45890.1); Has 266 Blast hits to 266 proteins in 86 species: Archae - 0; Bacteria - 2; Metazoa - 95; Fungi - 39; Plants - 94; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). |
| AT5G02870 | AT5G02870.1 | AACCCGGTTAA | 60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT5G02870.2 | AACCCGGTTAA | 60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT5G03970 | AT5G03970.1 | AACCCGGTTCAA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G03970.2 | AACCCGGTTCAA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G04910 | AT5G04910.1 | CAAACCGGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G06410 | AT5G06410.1 | GACCCGGTTGACCCGGT | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: protein binding, heat shock protein binding, chaperone binding; INVOLVED IN: protein folding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock cognate protein B, C-terminal oligomerisation (InterPro:IPR009073), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Co-chaperone Hsc20 (InterPro:IPR004640); Has 1232 Blast hits to 1232 proteins in 576 species: Archae - 0; Bacteria - 899; Metazoa - 98; Fungi - 66; Plants - 20; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). |
| AT5G06760 | AT5G06760.1 | AAAACCGGGTT | late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); Has 477 Blast hits to 328 proteins in 98 species: Archae - 0; Bacteria - 70; Metazoa - 102; Fungi - 37; Plants - 214; Viruses - 1; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G08360 | AT5G08360.1 | ATAACCGGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF789 (InterPro:IPR008507); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23380.1); Has 132 Blast hits to 132 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 131; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G10330 | AT5G10330.1 | AACCGGGTT | Encodes histidinol-phosphate aminotransferase that catalyzes the eighth step in histidine biosynthesis. Loss of function mutations are embryo lethal. |
| AT5G10330.2 | AACCGGGTT | Encodes histidinol-phosphate aminotransferase that catalyzes the eighth step in histidine biosynthesis. Loss of function mutations are embryo lethal. |
| AT5G10330.3 | AACCGGGTT | Encodes histidinol-phosphate aminotransferase that catalyzes the eighth step in histidine biosynthesis. Loss of function mutations are embryo lethal. |
| AT5G11440 | AT5G11440.1 | ATAACCGGGT | Interacts with PAB (poly A binding protein) in yeast two hybrid experiments. Contains PAM2 motif, a PABC interacting domain. |
| AT5G11450 | AT5G11450.1 | ACCCGGTTAT | oxygen-evolving complex-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 81 Blast hits to 81 proteins in 22 species: Archae - 0; Bacteria - 22; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G13680 | AT5G13680.1 | ATAAACCGGGTC | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. |
| AT5G13690 | AT5G13690.1 | GACCCGGTTTAT | alpha-N-acetylglucosaminidase family / NAGLU family; FUNCTIONS IN: alpha-N-acetylglucosaminidase activity; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-N-acetylglucosaminidase (InterPro:IPR007781); Has 254 Blast hits to 246 proteins in 93 species: Archae - 0; Bacteria - 100; Metazoa - 87; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT5G15120 | AT5G15120.1 | AACCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1637 (InterPro:IPR012864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39890.1); Has 239 Blast hits to 239 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT5G15600 | AT5G15600.1 | AAAACCGGGT | SPIRAL1-LIKE4 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT5G15920 | AT5G15920.1 | GTAAACCGGGTT | structural maintenance of chromosomes (SMC) family protein (MSS2); FUNCTIONS IN: ATP binding; INVOLVED IN: chromosome segregation; LOCATED IN: chromosome, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395); BEST Arabidopsis thaliana protein match is: MIM (hypersensitive to MMS, irradiation and MMC); ATP binding (TAIR:AT5G61460.1); Has 53696 Blast hits to 28151 proteins in 1680 species: Archae - 715; Bacteria - 7485; Metazoa - 25639; Fungi - 3625; Plants - 1389; Viruses - 117; Other Eukaryotes - 14726 (source: NCBI BLink). |
| AT5G16220 | AT5G16220.1 | ACCCGACCCGGTT | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT2G01190.1); Has 247 Blast hits to 246 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 12; Plants - 175; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G16640 | AT5G16640.1 | AACCGGGTT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: F mature embryo stage, 4 leaf senescence stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62680.1); Has 27324 Blast hits to 6063 proteins in 188 species: Archae - 4; Bacteria - 18; Metazoa - 819; Fungi - 570; Plants - 24583; Viruses - 0; Other Eukaryotes - 1330 (source: NCBI BLink). |
| AT5G18400 | AT5G18400.1 | AACCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G18400.2 | AACCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G18400.3 | AACCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G20720 | AT5G20720.1 | ACCCGGTT | Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES. |
| AT5G20720.2 | ACCCGGTT | Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES. |
| AT5G27950 | AT5G27950.1 | ACCCGGTTATTCGGTTT | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT1G55550.1); Has 7669 Blast hits to 7281 proteins in 238 species: Archae - 0; Bacteria - 8; Metazoa - 3877; Fungi - 919; Plants - 883; Viruses - 0; Other Eukaryotes - 1982 (source: NCBI BLink). |
| AT5G38880 | AT5G38880.1 | TCGACCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 379 Blast hits to 327 proteins in 103 species: Archae - 4; Bacteria - 53; Metazoa - 188; Fungi - 37; Plants - 26; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT5G40170 | AT5G40170.1 | ACCCGGTT | Receptor Like Protein 54 (AtRLP54); FUNCTIONS IN: protein binding, kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP27 (Receptor Like Protein 27); kinase/ protein binding (TAIR:AT2G33060.1); Has 59534 Blast hits to 17883 proteins in 780 species: Archae - 51; Bacteria - 3089; Metazoa - 16109; Fungi - 738; Plants - 35078; Viruses - 17; Other Eukaryotes - 4452 (source: NCBI BLink). |
| AT5G54960 | AT5G54960.1 | CGAACCGGGTCGG | pyruvate decarboxylase-2 |
| AT5G55940 | AT5G55940.1 | TGACCCGAACCCGGTTTAG | embryo defective 2731 (emb2731); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51620.3); Has 220 Blast hits to 219 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 10; Plants - 30; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT5G66760 | AT5G66760.1 | AACCCGGTTTAG | One of two genes in Arabidopsis that encode a flavoprotein subunit of the mitochondrial succinate dehydrogenase complex. |