| Locus | Gene model | Sequence | Description |
| AT1G01080 | AT1G01080.1 | TTTGGGCCTTTT | 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink). |
| AT1G01080.2 | TTTGGGCCTTTT | 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink). |
| AT1G01970 | AT1G01970.1 | AAAAGGCCCATA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: NFD5 (NUCLEAR FUSION DEFECTIVE 5) (TAIR:AT1G19520.1); Has 7256 Blast hits to 3017 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 83; Fungi - 5; Plants - 6997; Viruses - 0; Other Eukaryotes - 171 (source: NCBI BLink). |
| AT1G01990 | AT1G01990.1 | ATAATGGGCTTTAAAAGGCCTAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02160 | AT1G02160.1 | AAAAGGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02160.2 | AAAAGGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G03030 | AT1G03030.1 | GGCCTTTT | phosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: kinase activity, phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uridine kinase (InterPro:IPR000764); Has 1794 Blast hits to 1794 proteins in 581 species: Archae - 7; Bacteria - 1124; Metazoa - 151; Fungi - 173; Plants - 39; Viruses - 0; Other Eukaryotes - 300 (source: NCBI BLink). |
| AT1G03600 | AT1G03600.1 | AAAAGGCC | photosystem II family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 218 Blast hits to 218 proteins in 63 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT1G04510 | AT1G04510.1 | AAAAGGCCCATTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). |
| AT1G04510.2 | AAAAGGCCCATTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). |
| AT1G04790 | AT1G04790.1 | AAAAGGCCCATTAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6374 Blast hits to 6356 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2257; Fungi - 483; Plants - 2544; Viruses - 68; Other Eukaryotes - 1022 (source: NCBI BLink). |
| AT1G05430 | AT1G05430.1 | GGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G06670 | AT1G06670.1 | TGGCCCAAAAGGCCCAAAAAGCCCAAAA | nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins |
| AT1G06690 | AT1G06690.1 | AAAAGGCCCAACT | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity, ATPase activity, ATP binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT5G53580.1); Has 18029 Blast hits to 18016 proteins in 1454 species: Archae - 258; Bacteria - 9842; Metazoa - 1647; Fungi - 1390; Plants - 743; Viruses - 0; Other Eukaryotes - 4149 (source: NCBI BLink). |
| AT1G07350 | AT1G07350.2 | CAATTGGGCCTTTT | transformer serine/arginine-rich ribonucleoprotein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT4G35785.2); Has 25544 Blast hits to 16897 proteins in 693 species: Archae - 12; Bacteria - 1110; Metazoa - 16477; Fungi - 2700; Plants - 2768; Viruses - 163; Other Eukaryotes - 2314 (source: NCBI BLink). |
| AT1G07420 | AT1G07420.1 | AAAAGGCCC | Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA |
| AT1G08490 | AT1G08490.1 | AAAAGGCCTAATTCGGCCCATAT | Chloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation. |
| AT1G08570 | AT1G08570.1 | GGCCTTTT | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
| AT1G08570.2 | GGCCTTTT | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
| AT1G08570.3 | GGCCTTTT | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
| AT1G08570.4 | GGCCTTTT | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
| AT1G08580 | AT1G08580.1 | AAAAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G08580.1 | AAAAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G09620 | AT1G09620.1 | TCTGGGCCTTTT | ATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding; FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, leucine-tRNA ligase activity, ATP binding; INVOLVED IN: leucyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Leucyl-tRNA synthetase, class Ia, archaeal/eukaryotic cytosolic (InterPro:IPR004493), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: EMB2369 (EMBRYO DEFECTIVE 2369); ATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding (TAIR:AT4G04350.1); Has 10914 Blast hits to 10382 proteins in 1644 species: Archae - 486; Bacteria - 5815; Metazoa - 490; Fungi - 313; Plants - 129; Viruses - 0; Other Eukaryotes - 3681 (source: NCBI BLink). |
| AT1G10840 | AT1G10840.1 | GGCCTTTT | Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1). |
| AT1G10840.2 | GGCCTTTT | Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1). |
| AT1G11240 | AT1G11240.1 | TTAAAGCCTAAAGCCCAATTAAAAGGCC | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 2452 Blast hits to 1845 proteins in 201 species: Archae - 0; Bacteria - 81; Metazoa - 1026; Fungi - 315; Plants - 107; Viruses - 18; Other Eukaryotes - 905 (source: NCBI BLink). |
| AT1G11860 | AT1G11860.1 | GGCCTTTT | aminomethyltransferase, putative; FUNCTIONS IN: aminomethyltransferase activity; INVOLVED IN: response to cadmium ion; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycine cleavage system T protein (InterPro:IPR006223), Glycine cleavage T-protein, N-terminal (InterPro:IPR006222), Glycine cleavage T-protein, C-terminal barrel (InterPro:IPR013977); BEST Arabidopsis thaliana protein match is: aminomethyltransferase (TAIR:AT1G60990.3); Has 16017 Blast hits to 16014 proteins in 1169 species: Archae - 69; Bacteria - 3430; Metazoa - 374; Fungi - 107; Plants - 67; Viruses - 0; Other Eukaryotes - 11970 (source: NCBI BLink). |
| AT1G11860.2 | GGCCTTTT | aminomethyltransferase, putative; FUNCTIONS IN: aminomethyltransferase activity; INVOLVED IN: response to cadmium ion; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycine cleavage system T protein (InterPro:IPR006223), Glycine cleavage T-protein, N-terminal (InterPro:IPR006222), Glycine cleavage T-protein, C-terminal barrel (InterPro:IPR013977); BEST Arabidopsis thaliana protein match is: aminomethyltransferase (TAIR:AT1G60990.3); Has 16017 Blast hits to 16014 proteins in 1169 species: Archae - 69; Bacteria - 3430; Metazoa - 374; Fungi - 107; Plants - 67; Viruses - 0; Other Eukaryotes - 11970 (source: NCBI BLink). |
| AT1G12480 | AT1G12480.1 | GGCCTTTT | Encodes a membrane protein with 10 predicted transmembrane helices. SLAC1 is a multispanning membrane protein expressed predominantly in guard cells that plays a role in regulating cellular ion homeostasis and S-type anion currents. SLAC1 is important for normal stomatal closure in response to a variety of signals including elevated CO2, ozone, ABA, darkness, and humidity. SLAC1:GFP localizes to the plasma membrane. |
| AT1G12760 | AT1G12760.1 | ACGGGCCTTTT | protein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink). |
| AT1G12760.2 | ACGGGCCTTTT | protein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink). |
| AT1G12920 | AT1G12920.1 | TAATTGGGCCTTTT | Encodes a eukaryotic release factor one homolog. |
| AT1G13120 | AT1G13120.1 | GGCCTTTTTAGGCCCAAT | embryo defective 1745 (emb1745); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nuclear pore; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GLE1-like (InterPro:IPR012476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G05523.1); Has 32122 Blast hits to 20275 proteins in 1392 species: Archae - 166; Bacteria - 5743; Metazoa - 12337; Fungi - 2633; Plants - 1041; Viruses - 221; Other Eukaryotes - 9981 (source: NCBI BLink). |
| AT1G13350 | AT1G13350.1 | AGCCCAAAAGGCCCAAAA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G53640.1); Has 80312 Blast hits to 71745 proteins in 1717 species: Archae - 65; Bacteria - 5105; Metazoa - 38133; Fungi - 9588; Plants - 8768; Viruses - 394; Other Eukaryotes - 18259 (source: NCBI BLink). |
| AT1G14030 | AT1G14030.1 | GGCCTTTT | ribulose-1,5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative; FUNCTIONS IN: [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase activity; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco methyltransferase (InterPro:IPR011192), SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 838 Blast hits to 833 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 218; Plants - 233; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink). |
| AT1G14980 | AT1G14980.1 | GGCCTTTT | Encodes mitochondrial-localized chaperonin 10 that complements the E.coli groES mutant. Its mRNA is upregulated in response to heat shock treatment and is expressed uniformly in various organs. |
| AT1G15270 | AT1G15270.1 | GGCCTTTTAATGGGCCATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT1G15280 | AT1G15280.1 | TATGGCCCATTAAAAGGCC | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). |
| AT1G15280.2 | TATGGCCCATTAAAAGGCC | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). |
| AT1G15370 | AT1G15370.1 | TAATTACGAAAAGGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); Has 48 Blast hits to 48 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 39; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G15810 | AT1G15810.1 | AATTGGGCCTTTT | ribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G80620.1); Has 5651 Blast hits to 5651 proteins in 1607 species: Archae - 0; Bacteria - 3067; Metazoa - 94; Fungi - 81; Plants - 397; Viruses - 0; Other Eukaryotes - 2012 (source: NCBI BLink). |
| AT1G16030 | AT1G16030.1 | ACTGGGCCTTTT | heat shock protein 70B (Hsp70b); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: cytosol, cell wall, plasma membrane, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP70 (heat shock protein 70); ATP binding (TAIR:AT3G12580.1); Has 24709 Blast hits to 24439 proteins in 3097 species: Archae - 107; Bacteria - 9686; Metazoa - 3084; Fungi - 1225; Plants - 724; Viruses - 242; Other Eukaryotes - 9641 (source: NCBI BLink). |
| AT1G16040 | AT1G16040.1 | AAAAGGCCCAGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI biosynthesis protein Pig-F (InterPro:IPR009580); Has 210 Blast hits to 210 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 80; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G16420 | AT1G16420.1 | AAAAGGCC | Encodes a metacaspase (cysteine-type endopeptidase) that is involved in promoting programmed cell death in response to hydrogen peroxide (H2O2), UV light, and methyl viologen (MV). Transcript levels rise in response to UV-C, H2O2, and MV. In vitro assays demonstrate that this enzyme has a preference for cleaving after an arginine residue, and it has a pH optimum of 8.0. |
| AT1G16900 | AT1G16900.1 | TAAAGGCCTTTT | curculin-like (mannose-binding) lectin family protein, very low similarity to Ser Thr protein kinase GI:2598067 from (Zea mays); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein |
| AT1G17470 | AT1G17470.1 | AAAAGGCC | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G17470.2 | AAAAGGCC | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G18850 | AT1G18850.1 | AAAAGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G19710 | AT1G19710.1 | AATAGGCCTTTTAAAGCCCATTAT | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G75420.1); Has 4243 Blast hits to 4240 proteins in 780 species: Archae - 115; Bacteria - 2336; Metazoa - 83; Fungi - 27; Plants - 65; Viruses - 0; Other Eukaryotes - 1617 (source: NCBI BLink). |
| AT1G19890 | AT1G19890.1 | TTTAGGCCTTTT | histone 3.3, male-gamete-specific expression |
| AT1G21190 | AT1G21190.1 | AAAAGGCC | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G76860.1); Has 924 Blast hits to 924 proteins in 209 species: Archae - 244; Bacteria - 0; Metazoa - 275; Fungi - 141; Plants - 102; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT1G21200 | AT1G21200.1 | GGCCTTTT | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76870.1); Has 251 Blast hits to 233 proteins in 48 species: Archae - 2; Bacteria - 24; Metazoa - 66; Fungi - 2; Plants - 75; Viruses - 9; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT1G24577 | AT1G24577.1 | GGCCTTTT | unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67910.1); Has 60 Blast hits to 60 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G25260 | AT1G25260.1 | AAAAGGCC | acidic ribosomal protein P0-related; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 809 Blast hits to 807 proteins in 249 species: Archae - 78; Bacteria - 0; Metazoa - 294; Fungi - 172; Plants - 102; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink). |
| AT1G26880 | AT1G26880.1 | AAAAGGCCCATATA | 60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). |
| AT1G26880.2 | AAAAGGCCCATATA | 60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). |
| AT1G28580 | AT1G28580.1 | AAAAGGCC | GDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase, putative (TAIR:AT1G28570.1); Has 1868 Blast hits to 1834 proteins in 164 species: Archae - 0; Bacteria - 265; Metazoa - 1; Fungi - 5; Plants - 1584; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G28580.2 | AAAAGGCC | GDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase, putative (TAIR:AT1G28570.1); Has 1868 Blast hits to 1834 proteins in 164 species: Archae - 0; Bacteria - 265; Metazoa - 1; Fungi - 5; Plants - 1584; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G29965 | AT1G29965.1 | AAAAGGCCCAATGGGCTTTA | 60S ribosomal protein L18A (RPL18aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: RPL18AA (60S RIBOSOMAL PROTEIN L18A-1); structural constituent of ribosome (TAIR:AT1G29970.2); Has 545 Blast hits to 543 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 93; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G30680 | AT1G30680.1 | TTAATGGGCCTTTT | toprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink). |
| AT1G30910 | AT1G30910.1 | GGCCTTTT | molybdenum cofactor sulfurase family protein; FUNCTIONS IN: molybdenum ion binding, Mo-molybdopterin cofactor sulfurase activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), MOSC, N-terminal beta barrel (InterPro:IPR005303), Molybdenum cofactor sulfurase, C-terminal (InterPro:IPR005302); BEST Arabidopsis thaliana protein match is: molybdenum cofactor sulfurase family protein (TAIR:AT5G44720.1); Has 1290 Blast hits to 1272 proteins in 428 species: Archae - 6; Bacteria - 645; Metazoa - 290; Fungi - 172; Plants - 53; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink). |
| AT1G31350 | AT1G31350.1 | GGCCTTTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G55270.1); Has 400 Blast hits to 400 proteins in 48 species: Archae - 0; Bacteria - 19; Metazoa - 76; Fungi - 0; Plants - 302; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G44835 | AT1G44835.1 | TGTTGGGCCTTTT | YbaK/prolyl-tRNA synthetase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YbaK/aminoacyl-tRNA synthetase associated region (InterPro:IPR007214); Has 745 Blast hits to 744 proteins in 221 species: Archae - 0; Bacteria - 335; Metazoa - 45; Fungi - 5; Plants - 21; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| AT1G44835.2 | TGTTGGGCCTTTT | YbaK/prolyl-tRNA synthetase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YbaK/aminoacyl-tRNA synthetase associated region (InterPro:IPR007214); Has 745 Blast hits to 744 proteins in 221 species: Archae - 0; Bacteria - 335; Metazoa - 45; Fungi - 5; Plants - 21; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| AT1G51570 | AT1G51570.1 | CTTATTGGCCTTTT | C2 domain-containing protein; INVOLVED IN: tryptophan biosynthetic process; LOCATED IN: endoplasmic reticulum, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Phosphoribosyltransferase C-terminal, plant (InterPro:IPR013583), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT3G57880.1); Has 4271 Blast hits to 3046 proteins in 187 species: Archae - 0; Bacteria - 0; Metazoa - 2967; Fungi - 155; Plants - 839; Viruses - 0; Other Eukaryotes - 310 (source: NCBI BLink). |
| AT1G51730 | AT1G51730.1 | AAAAGGCC | RWD domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), RWD (InterPro:IPR006575); Has 763 Blast hits to 761 proteins in 148 species: Archae - 0; Bacteria - 2; Metazoa - 493; Fungi - 159; Plants - 34; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT1G53520 | AT1G53520.1 | AAAAGGCC | chalcone-flavanone isomerase-related; FUNCTIONS IN: chalcone isomerase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chalcone isomerase, subgroup (InterPro:IPR003466), Chalcone isomerase, 3-layer sandwich (InterPro:IPR016088), Chalcone isomerase (InterPro:IPR016087); Has 294 Blast hits to 294 proteins in 53 species: Archae - 0; Bacteria - 3; Metazoa - 0; Fungi - 2; Plants - 284; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G53690 | AT1G53690.1 | AAAAGGCC | Protein of unknown function that is homologous to At5g41010, which encodes a non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
| AT1G54500 | AT1G54500.1 | AAAAGGCCACGTGGT | rubredoxin family protein; FUNCTIONS IN: electron carrier activity, metal ion binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubredoxin, iron-binding site (InterPro:IPR018527), Rubredoxin-type Fe(Cys)4 protein (InterPro:IPR004039), Rubredoxin (InterPro:IPR001052); Has 2007 Blast hits to 1988 proteins in 612 species: Archae - 138; Bacteria - 1563; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink). |
| AT1G55530 | AT1G55530.1 | AAAAGGCCCATCT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7739 Blast hits to 7642 proteins in 225 species: Archae - 0; Bacteria - 8; Metazoa - 2938; Fungi - 729; Plants - 2721; Viruses - 30; Other Eukaryotes - 1313 (source: NCBI BLink). |
| AT1G58380 | AT1G58380.1 | AAAAGGCCCAATAT | XW6; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, plasma membrane, chloroplast, membrane; EXPRESSED IN: guard cell, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 7963 Blast hits to 7153 proteins in 1715 species: Archae - 183; Bacteria - 3057; Metazoa - 1443; Fungi - 466; Plants - 299; Viruses - 25; Other Eukaryotes - 2490 (source: NCBI BLink). |
| AT1G60890 | AT1G60890.1 | ATAGGCCTTTT | phosphatidylinositol-4-phosphate 5-kinase family protein; FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity, ATP binding; INVOLVED IN: phosphatidylinositol metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, plant (InterPro:IPR017163), MORN motif (InterPro:IPR003409), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT1G10900.1); Has 22998 Blast hits to 6300 proteins in 384 species: Archae - 0; Bacteria - 2356; Metazoa - 3944; Fungi - 305; Plants - 691; Viruses - 0; Other Eukaryotes - 15702 (source: NCBI BLink). |
| AT1G64510 | AT1G64510.1 | AAAAGGCCCATGG | ribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: thylakoid, chloroplast thylakoid membrane, ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 978 Blast hits to 978 proteins in 282 species: Archae - 0; Bacteria - 578; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink). |
| AT1G64520 | AT1G64520.1 | CCATGGGCCTTTT | Regulatory Particle non-ATPase 12a (RPN12a); FUNCTIONS IN: peptidase activity; INVOLVED IN: in 14 processes; LOCATED IN: proteasome complex, nucleus, proteasome regulatory particle, lid subcomplex, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746), SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); BEST Arabidopsis thaliana protein match is: RPN12b (Regulatory Particle Non-ATPase 12b); peptidase (TAIR:AT5G42040.1); Has 353 Blast hits to 353 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 84; Plants - 39; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT1G68340 | AT1G68340.1 | AAAAGGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25370.1); Has 137 Blast hits to 137 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 135; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G71780 | AT1G71780.1 | GGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G72740 | AT1G72740.1 | AAAAGGCC | DNA-binding family protein / histone H1/H5 family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: nucleosome assembly, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Histone H1/H5 (InterPro:IPR005818), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT1G17520.1); Has 533 Blast hits to 527 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 46; Plants - 372; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT1G72740.2 | AAAAGGCC | DNA-binding family protein / histone H1/H5 family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: nucleosome assembly, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Histone H1/H5 (InterPro:IPR005818), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT1G17520.1); Has 533 Blast hits to 527 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 46; Plants - 372; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT1G73430 | AT1G73430.1 | TCTGGGCCCAATGGCCTTTT | sec34-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: chloroplast, membrane, cis-Golgi network; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec34-like protein (InterPro:IPR007265); Has 256 Blast hits to 248 proteins in 121 species: Archae - 0; Bacteria - 4; Metazoa - 107; Fungi - 89; Plants - 19; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT1G73430.2 | TCTGGGCCCAATGGCCTTTT | sec34-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: chloroplast, membrane, cis-Golgi network; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec34-like protein (InterPro:IPR007265); Has 256 Blast hits to 248 proteins in 121 species: Archae - 0; Bacteria - 4; Metazoa - 107; Fungi - 89; Plants - 19; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT1G73710 | AT1G73710.1 | AAAAGGCCCAC | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23020.1); Has 27768 Blast hits to 6414 proteins in 199 species: Archae - 2; Bacteria - 35; Metazoa - 962; Fungi - 509; Plants - 25092; Viruses - 0; Other Eukaryotes - 1168 (source: NCBI BLink). |
| AT1G74050 | AT1G74050.1 | AAAAGGCC | 60S ribosomal protein L6 (RPL6C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, intracellular, plasma membrane, membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6B) (TAIR:AT1G74060.1); Has 552 Blast hits to 551 proteins in 201 species: Archae - 13; Bacteria - 0; Metazoa - 258; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT1G75870 | AT1G75870.1 | AAAAGGCCCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G76730 | AT1G76730.1 | AAAAGGCCCATTTA | 5-formyltetrahydrofolate cyclo-ligase family protein; FUNCTIONS IN: catalytic activity, ATP binding, 5-formyltetrahydrofolate cyclo-ligase activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 5-formyltetrahydrofolate cyclo-ligase (InterPro:IPR002698); Has 270 Blast hits to 270 proteins in 109 species: Archae - 50; Bacteria - 73; Metazoa - 104; Fungi - 6; Plants - 17; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT1G76740 | AT1G76740.1 | TAAATGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76840.1); Has 3136 Blast hits to 2432 proteins in 274 species: Archae - 9; Bacteria - 251; Metazoa - 1340; Fungi - 208; Plants - 114; Viruses - 8; Other Eukaryotes - 1206 (source: NCBI BLink). |
| AT1G78190 | AT1G78190.1 | AAAAGGCCCATTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22270.1); Has 285 Blast hits to 285 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 81; Plants - 34; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G78882 | AT1G78882.1 | GGCCTTTT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF56 represents a conserved upstream opening reading frame relative to major ORF AT1G78880.1 |
| AT1G79810 | AT1G79810.1 | ATATGGGCCTTTT | Dominant suppressor of det1 phenotypes. Encodes a peroxisomal protein essential for Arabidopsis growth. Inserted directly from the cytosol into peroxisomes. |
| AT1G79810.2 | ATATGGGCCTTTT | Dominant suppressor of det1 phenotypes. Encodes a peroxisomal protein essential for Arabidopsis growth. Inserted directly from the cytosol into peroxisomes. |
| AT1G80360 | AT1G80360.1 | GGGCCTTTT | aminotransferase class I and II family protein; FUNCTIONS IN: transferase activity, transferring nitrogenous groups, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: asparagine catabolic process, biosynthetic process, glutamate catabolic process to oxaloacetate, aspartate transamidation; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminotransferase, class I and II (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferases, class-I, pyridoxal-phosphate-binding site (InterPro:IPR004838), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: aminotransferase class I and II family protein (TAIR:AT2G22250.3); Has 24017 Blast hits to 24017 proteins in 1733 species: Archae - 643; Bacteria - 14251; Metazoa - 522; Fungi - 502; Plants - 867; Viruses - 0; Other Eukaryotes - 7232 (source: NCBI BLink). |
| AT2G01110 | AT2G01110.1 | AAAAGGCCCAATAA | mutant is Albino and pale green; Chloroplast Protein Translocation (tatC). Core subunit of the chloroplast Tat translocase. Integral chloroplast thylakoid membrane protein. |
| AT2G01120 | AT2G01120.1 | TTATTGGGCCTTTT | Origin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
| AT2G01650 | AT2G01650.1 | TTGGCCCAAAAGGCCCATTAA | encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo. |
| AT2G01735 | AT2G01735.1 | AAAAGGCCTAAA | encodes a RING-H2 zinc finger protein essential for seed development. |
| AT2G02350 | AT2G02350.1 | AAAAGGCCCATAT | encodes a protein containing an F-box domain and physically interacts with SCF subunit SKP1/ASK1. The protein also exhibits similarity in sequence to phloem protein 2 (PP2) from cucumber. |
| AT2G02910 | AT2G02910.1 | AAAAGGCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: EMB2756 (EMBRYO DEFECTIVE 2756) (TAIR:AT1G34550.1); Has 191 Blast hits to 191 proteins in 22 species: Archae - 6; Bacteria - 21; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT2G03430 | AT2G03430.1 | AAAAGGCCCATAAACGGGCCCAATAT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G19150.1); Has 104929 Blast hits to 30234 proteins in 997 species: Archae - 84; Bacteria - 8435; Metazoa - 52441; Fungi - 8607; Plants - 4055; Viruses - 2006; Other Eukaryotes - 29301 (source: NCBI BLink). |
| AT2G04530 | AT2G04530.1 | AAAAGGCC | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast. |
| AT2G05310 | AT2G05310.1 | AAAAGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G13500.1); Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G18710 | AT2G18710.1 | TATTGGGCCTAAAAGGCCTGGCCCATTAG | SecY Homolog 1 (SCY1); FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion, protein transport; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: EMB2289 (EMBRYO DEFECTIVE 2289); P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT2G31530.1); Has 6517 Blast hits to 6501 proteins in 1505 species: Archae - 48; Bacteria - 2805; Metazoa - 25; Fungi - 2; Plants - 53; Viruses - 0; Other Eukaryotes - 3584 (source: NCBI BLink). |
| AT2G19080 | AT2G19080.1 | TGTGGGCCTTTTAAAGCCCAAAA | metaxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein targeting to mitochondrion; LOCATED IN: mitochondrial outer membrane, mitochondrion, mitochondrial inner membrane, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metaxin (InterPro:IPR017410); Has 384 Blast hits to 384 proteins in 77 species: Archae - 0; Bacteria - 46; Metazoa - 295; Fungi - 14; Plants - 20; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G19310 | AT2G19310.1 | AAAAGGCCTTTTCTATTGGGCTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress, response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: HSP18.2 (heat shock protein 18.2) (TAIR:AT5G59720.1); Has 527 Blast hits to 527 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 34; Plants - 479; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT2G20130 | AT2G20130.1 | TTTAGGCCTTTT | LIKE COV 1 (LCV1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, flower, root, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1965 Blast hits to 1965 proteins in 370 species: Archae - 6; Bacteria - 694; Metazoa - 0; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 1180 (source: NCBI BLink). |
| AT2G20140 | AT2G20140.1 | AAAAGGCCTAAA | 26S protease regulatory complex subunit 4, putative; FUNCTIONS IN: hydrolase activity, nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), 26S proteasome subunit P45 (InterPro:IPR005937); BEST Arabidopsis thaliana protein match is: RPT2a (regulatory particle AAA-ATPase 2a); ATPase (TAIR:AT4G29040.1); Has 21701 Blast hits to 20141 proteins in 1744 species: Archae - 831; Bacteria - 5748; Metazoa - 4078; Fungi - 2440; Plants - 1746; Viruses - 26; Other Eukaryotes - 6832 (source: NCBI BLink). |
| AT2G20410 | AT2G20410.1 | GGCCTTTT | activating signal cointegrator-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ASCH domain (InterPro:IPR007374); Has 193 Blast hits to 192 proteins in 83 species: Archae - 2; Bacteria - 44; Metazoa - 93; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT2G22660 | AT2G22660.1 | TTTAGGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1399 (InterPro:IPR009836); BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT4G37900.1); Has 14843 Blast hits to 4550 proteins in 469 species: Archae - 40; Bacteria - 5555; Metazoa - 4422; Fungi - 897; Plants - 1977; Viruses - 191; Other Eukaryotes - 1761 (source: NCBI BLink). |
| AT2G22660.2 | TTTAGGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1399 (InterPro:IPR009836); BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT4G37900.1); Has 14843 Blast hits to 4550 proteins in 469 species: Archae - 40; Bacteria - 5555; Metazoa - 4422; Fungi - 897; Plants - 1977; Viruses - 191; Other Eukaryotes - 1761 (source: NCBI BLink). |
| AT2G23120 | AT2G23120.1 | AAAAGGCCCATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein 18 (InterPro:IPR018930); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23110.1); Has 25 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G24960 | AT2G24960.1 | AAAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 838 Blast hits to 293 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 21; Plants - 817; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G24960.2 | AAAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 838 Blast hits to 293 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 21; Plants - 817; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G27030 | AT2G27030.1 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. |
| AT2G27030.2 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. |
| AT2G27030.3 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. |
| AT2G29360 | AT2G29360.1 | AAAAGGCC | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29150.1); Has 83809 Blast hits to 83613 proteins in 2239 species: Archae - 475; Bacteria - 45716; Metazoa - 5149; Fungi - 4359; Plants - 1662; Viruses - 5; Other Eukaryotes - 26443 (source: NCBI BLink). |
| AT2G31370 | AT2G31370.1 | AAAAGGCC | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.2 | AAAAGGCC | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.3 | AAAAGGCC | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.4 | AAAAGGCC | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.5 | AAAAGGCC | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G33220 | AT2G33220.1 | ATATGGGCCTTTTAAAGCCCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, plastid, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: MEE4 (maternal effect embryo arrest 4) (TAIR:AT1G04630.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT2G33370 | AT2G33370.1 | CATGGGCCTAAAAGGCCTTTT | 60S ribosomal protein L23 (RPL23B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14b/L23e (InterPro:IPR000218); BEST Arabidopsis thaliana protein match is: emb2171 (embryo defective 2171); structural constituent of ribosome (TAIR:AT3G04400.1); Has 6297 Blast hits to 6297 proteins in 1833 species: Archae - 236; Bacteria - 2977; Metazoa - 280; Fungi - 176; Plants - 586; Viruses - 0; Other Eukaryotes - 2042 (source: NCBI BLink). |
| AT2G34520 | AT2G34520.1 | AAAAGGCCCAAT | nuclear-encoded mitochondrial ribosomal protein S14 |
| AT2G34860 | AT2G34860.1 | GGCCTTTT | embryo sac development arrest 3 (EDA3); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: megagametogenesis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 481 Blast hits to 481 proteins in 149 species: Archae - 26; Bacteria - 225; Metazoa - 10; Fungi - 2; Plants - 96; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink). |
| AT2G34860.2 | GGCCTTTT | embryo sac development arrest 3 (EDA3); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: megagametogenesis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 481 Blast hits to 481 proteins in 149 species: Archae - 26; Bacteria - 225; Metazoa - 10; Fungi - 2; Plants - 96; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink). |
| AT2G35605 | AT2G35605.1 | AAAAGGCCCAGA | SWIB complex BAF60b domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121); BEST Arabidopsis thaliana protein match is: SWIB complex BAF60b domain-containing protein (TAIR:AT1G31760.1); Has 726 Blast hits to 687 proteins in 149 species: Archae - 0; Bacteria - 129; Metazoa - 56; Fungi - 126; Plants - 201; Viruses - 8; Other Eukaryotes - 206 (source: NCBI BLink). |
| AT2G35750 | AT2G35750.1 | AAAAGGCCCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G36130 | AT2G36130.1 | AAAAGGCCCAAA | peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 12476 Blast hits to 12426 proteins in 1530 species: Archae - 82; Bacteria - 4056; Metazoa - 2344; Fungi - 974; Plants - 734; Viruses - 0; Other Eukaryotes - 4286 (source: NCBI BLink). |
| AT2G36620 | AT2G36620.1 | AAAAGGCCCATTAA | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020). |
| AT2G39460 | AT2G39460.1 | AAAAGGCCCATTAT | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT2G39460.1 | AAAAGGCCCATTTA | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT2G39460.2 | AAAAGGCCCATTAT | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT2G39460.2 | AAAAGGCCCATTTA | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT2G40205 | AT2G40205.1 | AAAAGGCCCATAT | 60S ribosomal protein L41 (RPL41C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G40205.1 | AAAAGGCCCATATA | 60S ribosomal protein L41 (RPL41C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G41905 | AT2G41905.1 | AAAAGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; Has 27 Blast hits to 27 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G42160 | AT2G42160.1 | GGCCTTTT | zinc finger (ubiquitin-hydrolase) domain-containing protein; FUNCTIONS IN: protein binding, catalytic activity, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BRCA1-associated 2 (InterPro:IPR011422), Zinc finger, UBP-type (InterPro:IPR001607), Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G26000.2); Has 920 Blast hits to 905 proteins in 150 species: Archae - 0; Bacteria - 7; Metazoa - 531; Fungi - 172; Plants - 57; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). |
| AT2G42230 | AT2G42230.1 | GGCCTTTTTGACCC | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT2G42230.2 | GGCCTTTTTGACCC | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT2G44640 | AT2G44640.1 | AAAAGGCCCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G44920 | AT2G44920.1 | AACGGGCCTTTT | thylakoid lumenal 15 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal protein-related (TAIR:AT1G12250.2); Has 11947 Blast hits to 4967 proteins in 589 species: Archae - 251; Bacteria - 8237; Metazoa - 244; Fungi - 2; Plants - 139; Viruses - 34; Other Eukaryotes - 3040 (source: NCBI BLink). |
| AT2G44920.2 | AACGGGCCTTTT | thylakoid lumenal 15 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal protein-related (TAIR:AT1G12250.2); Has 11947 Blast hits to 4967 proteins in 589 species: Archae - 251; Bacteria - 8237; Metazoa - 244; Fungi - 2; Plants - 139; Viruses - 34; Other Eukaryotes - 3040 (source: NCBI BLink). |
| AT2G45640 | AT2G45640.1 | AAAAGGCCCATTAG | Involved in the regulation of salt stress. Expression of AtSAP18 is induced by NaCl, cold, drought, ABA, and ethylene treatment. AtSAP18 and HDA19 associate with ERF3 and ERF4 both in vitro and in vivo. |
| AT2G46090 | AT2G46090.1 | AATAGGCCTTTT | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
| AT2G47110 | AT2G47110.1 | AAAAGGCCTTTGAAGCCCAATG | polyubiquitin gene |
| AT2G47910 | AT2G47910.1 | AAAAGGCC | Encodes a chloroplast thylakoid membrane protein. Required for the assembly/accumulation of the NAD(P)H dehydrogenase complex of the photosynthetic electron transport chain. |
| AT2G47910.2 | AAAAGGCC | Encodes a chloroplast thylakoid membrane protein. Required for the assembly/accumulation of the NAD(P)H dehydrogenase complex of the photosynthetic electron transport chain. |
| AT3G01100 | AT3G01100.1 | TTAATGGGCCTTTT | unknown protein, has cDNAs and ESTs associated to it |
| AT3G01100.2 | TTAATGGGCCTTTT | unknown protein, has cDNAs and ESTs associated to it |
| AT3G02450 | AT3G02450.1 | AAAAGGCCCATG | cell division protein ftsH, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase M41, FtsH extracellular (InterPro:IPR011546); BEST Arabidopsis thaliana protein match is: FTSH6 (FTSH PROTEASE 6); ATP-dependent peptidase/ ATPase/ metallopeptidase/ peptidase/ zinc ion binding (TAIR:AT5G15250.1); Has 29914 Blast hits to 28201 proteins in 1898 species: Archae - 923; Bacteria - 10733; Metazoa - 4167; Fungi - 2480; Plants - 1767; Viruses - 20; Other Eukaryotes - 9824 (source: NCBI BLink). |
| AT3G02950 | AT3G02950.1 | TGTGGGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Tho complex subunit 7 (InterPro:IPR018018), Tho complex subunit 7/Mft1p (InterPro:IPR008501); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16790.1); Has 2049 Blast hits to 1787 proteins in 271 species: Archae - 31; Bacteria - 158; Metazoa - 1041; Fungi - 168; Plants - 75; Viruses - 26; Other Eukaryotes - 550 (source: NCBI BLink). |
| AT3G02990 | AT3G02990.1 | AAAAGGCC | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G04560 | AT3G04560.1 | AAAAGGCCCATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; Has 174 Blast hits to 172 proteins in 62 species: Archae - 0; Bacteria - 13; Metazoa - 84; Fungi - 25; Plants - 27; Viruses - 2; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT3G06300 | AT3G06300.1 | TGTTGGGCCTTTT | Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins. |
| AT3G06670 | AT3G06670.1 | GGCCTTTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Protein of unknown function DUF625 (InterPro:IPR006887); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49390.1); Has 2798 Blast hits to 2244 proteins in 244 species: Archae - 0; Bacteria - 63; Metazoa - 1367; Fungi - 471; Plants - 155; Viruses - 18; Other Eukaryotes - 724 (source: NCBI BLink). |
| AT3G06700 | AT3G06700.1 | AAAAGGCC | 60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT3G06700.2 | AAAAGGCC | 60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT3G06700.3 | AAAAGGCC | 60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT3G06710 | AT3G06710.1 | GGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06850 | AT3G06850.1 | GGCCTTTT | dihydrolipoamide branched chain acyltransferase |
| AT3G06850.2 | GGCCTTTT | dihydrolipoamide branched chain acyltransferase |
| AT3G07230 | AT3G07230.1 | AAAAGGCC | wound-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Wound-inducible basic (InterPro:IPR012643); Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G08030 | AT3G08030.1 | AAAAGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41800.1); Has 178 Blast hits to 157 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 176; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G08030.2 | AAAAGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41800.1); Has 178 Blast hits to 157 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 176; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G08770 | AT3G08770.1 | GGCCTTTT | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT3G09200 | AT3G09200.1 | AAAAGGCCCAACA | 60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae - 223; Bacteria - 1; Metazoa - 420; Fungi - 182; Plants - 109; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink). |
| AT3G09200.2 | AAAAGGCCCAACA | 60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae - 223; Bacteria - 1; Metazoa - 420; Fungi - 182; Plants - 109; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink). |
| AT3G09470 | AT3G09470.1 | AAAAGGCCAAGGCCCATTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT3G09470.2 | AAAAGGCCAAGGCCCATTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT3G09480 | AT3G09480.1 | AAAAGGCCAAGGCCCATTAG | histone H2B, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT5G02570.1); Has 2678 Blast hits to 2678 proteins in 284 species: Archae - 0; Bacteria - 0; Metazoa - 1868; Fungi - 162; Plants - 357; Viruses - 0; Other Eukaryotes - 291 (source: NCBI BLink). |
| AT3G09490 | AT3G09490.1 | CTAATGGGCCTTGGCCTTTT | chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: photosynthesis, light reaction; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 637 Blast hits to 548 proteins in 146 species: Archae - 92; Bacteria - 301; Metazoa - 8; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT3G12390 | AT3G12390.1 | TTTTGGGCCTTTT | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA3 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 3) (TAIR:AT5G13850.1); Has 5006 Blast hits to 2282 proteins in 284 species: Archae - 50; Bacteria - 639; Metazoa - 1963; Fungi - 710; Plants - 330; Viruses - 56; Other Eukaryotes - 1258 (source: NCBI BLink). |
| AT3G12740 | AT3G12740.1 | GGCCTTTT | Physically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3. |
| AT3G13120 | AT3G13120.1 | GGCCTTTT | 30S ribosomal protein S10, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, bacterial (InterPro:IPR005731), Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10 (InterPro:IPR001848); Has 5644 Blast hits to 5644 proteins in 1660 species: Archae - 168; Bacteria - 2943; Metazoa - 245; Fungi - 117; Plants - 130; Viruses - 0; Other Eukaryotes - 2041 (source: NCBI BLink). |
| AT3G13740 | AT3G13740.1 | AAAAGGCCCAAC | URF 4-related; FUNCTIONS IN: RNA binding, ribonuclease III activity; INVOLVED IN: RNA processing; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonuclease III (InterPro:IPR000999); BEST Arabidopsis thaliana protein match is: RNA binding / ribonuclease III (TAIR:AT1G55140.1); Has 698 Blast hits to 697 proteins in 302 species: Archae - 0; Bacteria - 571; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink). |
| AT3G13970 | AT3G13970.1 | GGCCTTTT | AUTOPHAGY 12 B (APG12B); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: autophagy, autophagic vacuole formation; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Autophagy protein 12 (InterPro:IPR007242); BEST Arabidopsis thaliana protein match is: ATG12A (AUTOPHAGY 12 A); protein binding (TAIR:AT1G54210.1); Has 228 Blast hits to 228 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 96; Plants - 30; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G14700 | AT3G14700.1 | GTTGGGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SART-1 protein (InterPro:IPR005011); BEST Arabidopsis thaliana protein match is: DOT2 (DEFECTIVELY ORGANIZED TRIBUTARIES 2) (TAIR:AT5G16780.1); Has 217 Blast hits to 217 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 65; Plants - 16; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G14730 | AT3G14730.1 | AAAAGGCCTAT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 14433 Blast hits to 4909 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 53; Fungi - 48; Plants - 14121; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT3G15150 | AT3G15150.1 | GGCCTTTT | zinc ion binding; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, MIZ-type (InterPro:IPR004181); Has 205 Blast hits to 205 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 36; Plants - 24; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT3G15160 | AT3G15160.1 | AAAAGGCC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 67 Blast hits to 65 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G15351 | AT3G15351.1 | TAGTGGGCCGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15351.2 | TAGTGGGCCGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15351.3 | TAGTGGGCCGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15354 | AT3G15354.1 | AAAAGGCC | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA3 (and SPA4) predominantly regulates elongation growth in adult plants. |
| AT3G16570 | AT3G16570.1 | AAAAGGCC | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G16840 | AT3G16840.1 | AAAAGGCCCAAAT | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 47629 Blast hits to 37227 proteins in 1876 species: Archae - 406; Bacteria - 10857; Metazoa - 14354; Fungi - 5782; Plants - 2214; Viruses - 278; Other Eukaryotes - 13738 (source: NCBI BLink). |
| AT3G17780 | AT3G17780.1 | CAATTGGGCCGTAAAAAGGCCCATCA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48440.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G17998 | AT3G17998.1 | AAAAGGCC | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF30 represents a conserved upstream opening reading frame relative to major ORF AT3G18000.1 |
| AT3G18000 | AT3G18000.1 | AAAAGGCC | Arabidopsis thaliana N-methyltransferase-like protein mRNA. |
| AT3G18190 | AT3G18190.1 | ACTGGGCCTTTTGGGCTAA | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, delta subunit (InterPro:IPR012717); BEST Arabidopsis thaliana protein match is: T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative (TAIR:AT1G24510.1); Has 14434 Blast hits to 14373 proteins in 2596 species: Archae - 394; Bacteria - 6460; Metazoa - 1798; Fungi - 981; Plants - 478; Viruses - 2; Other Eukaryotes - 4321 (source: NCBI BLink). |
| AT3G18410 | AT3G18410.1 | AAAAGGCC | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT1G49140.1); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G18410.2 | AAAAGGCC | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT1G49140.1); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G18420 | AT3G18420.1 | AAAAGGCC | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 2006 Blast hits to 1561 proteins in 415 species: Archae - 271; Bacteria - 982; Metazoa - 160; Fungi - 19; Plants - 64; Viruses - 0; Other Eukaryotes - 510 (source: NCBI BLink). |
| AT3G18430 | AT3G18430.1 | GGCCTTTT | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: CAM9 (CALMODULIN 9); calcium ion binding (TAIR:AT3G51920.1); Has 3772 Blast hits to 3771 proteins in 389 species: Archae - 0; Bacteria - 11; Metazoa - 2178; Fungi - 257; Plants - 701; Viruses - 0; Other Eukaryotes - 625 (source: NCBI BLink). |
| AT3G18740 | AT3G18740.1 | TATAGGCCTTTT | 60S ribosomal protein L30 (RPL30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L30e (InterPro:IPR000231); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L30 (RPL30B) (TAIR:AT1G77940.1); Has 768 Blast hits to 768 proteins in 281 species: Archae - 141; Bacteria - 3; Metazoa - 274; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink). |
| AT3G20570 | AT3G20570.1 | GGCCTTTT | plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT5G25090.1); Has 845 Blast hits to 834 proteins in 61 species: Archae - 0; Bacteria - 13; Metazoa - 2; Fungi - 4; Plants - 804; Viruses - 2; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT3G21175 | AT3G21175.1 | AAAAGGCCCAAG | member of a novel family of plant-specific GATA-type transcription factors. |
| AT3G21175.2 | AAAAGGCCCAAG | member of a novel family of plant-specific GATA-type transcription factors. |
| AT3G21175.3 | AAAAGGCCCAAG | member of a novel family of plant-specific GATA-type transcription factors. |
| AT3G21400 | AT3G21400.1 | GGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G22110 | AT3G22110.1 | ATTTGGGCCTTTT | Encodes the alpha-3 subunit of 20s proteasome. |
| AT3G22230 | AT3G22230.1 | CATGGGCCTTTT | 60S ribosomal protein L27 (RPL27B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27C) (TAIR:AT4G15000.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT3G22590 | AT3G22590.1 | GTTTGGGCCTTTT | RNA pol II accessory factor Cdc73 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase II accessory factor, Cdc73 (InterPro:IPR007852); Has 392 Blast hits to 300 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 87; Plants - 21; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT3G24420 | AT3G24420.1 | AAAAGGCC | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G37470.1); Has 4615 Blast hits to 4615 proteins in 817 species: Archae - 22; Bacteria - 3290; Metazoa - 123; Fungi - 31; Plants - 154; Viruses - 2; Other Eukaryotes - 993 (source: NCBI BLink). |
| AT3G24820 | AT3G24820.1 | TTATTGGGCCTTTT | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 97 Blast hits to 97 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G24830 | AT3G24830.1 | AAAAGGCCCAATAA | 60S ribosomal protein L13A (RPL13aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aA) (TAIR:AT3G07110.1); Has 1473 Blast hits to 1473 proteins in 438 species: Archae - 212; Bacteria - 283; Metazoa - 292; Fungi - 127; Plants - 164; Viruses - 0; Other Eukaryotes - 395 (source: NCBI BLink). |
| AT3G25800 | AT3G25800.1 | TGGGCCAAAAGGCCCGTTAAAGCCCATTTA | one of three genes encoding the protein phosphatase 2A regulatory subunit |
| AT3G25800.2 | TGGGCCAAAAGGCCCGTTAAAGCCCATTTA | one of three genes encoding the protein phosphatase 2A regulatory subunit |
| AT3G25920 | AT3G25920.1 | AAAAGGCCTAAA | encodes a plastid ribosomal protein CL15, a constituent of the large subunit of the ribosomal complex |
| AT3G26340 | AT3G26340.1 | AAAAGGCC | 20S proteasome beta subunit E, putative; FUNCTIONS IN: endopeptidase activity, threonine-type endopeptidase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome core complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Proteasome, beta-type subunit, conserved site (InterPro:IPR016050), Peptidase T1A, proteasome beta-subunit (InterPro:IPR000243), 20S proteasome, A and B subunits (InterPro:IPR001353); BEST Arabidopsis thaliana protein match is: PBE1; endopeptidase/ peptidase/ threonine-type endopeptidase (TAIR:AT1G13060.1); Has 4428 Blast hits to 4424 proteins in 409 species: Archae - 476; Bacteria - 181; Metazoa - 1589; Fungi - 914; Plants - 555; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink). |
| AT3G27430 | AT3G27430.1 | AAAAGGCCCATTTA | Encodes 20S proteasome beta subunit PBB1 (PBB1). |
| AT3G27430.2 | AAAAGGCCCATTTA | Encodes 20S proteasome beta subunit PBB1 (PBB1). |
| AT3G28050 | AT3G28050.1 | GGCCTTTT | nodulin MtN21 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT5G40240.1); Has 1000 Blast hits to 992 proteins in 148 species: Archae - 10; Bacteria - 254; Metazoa - 4; Fungi - 7; Plants - 617; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT3G28500 | AT3G28500.1 | AAAAGGCCCATTAA | 60S acidic ribosomal protein P2 (RPP2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2E) (TAIR:AT5G40040.1); Has 918 Blast hits to 917 proteins in 250 species: Archae - 48; Bacteria - 1; Metazoa - 282; Fungi - 204; Plants - 184; Viruses - 0; Other Eukaryotes - 199 (source: NCBI BLink). |
| AT3G29160 | AT3G29160.1 | AAAAGGCCC | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It has also been shown to interact with the WD protein PDL1. |
| AT3G29160.2 | AAAAGGCCC | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It has also been shown to interact with the WD protein PDL1. |
| AT3G29160.3 | AAAAGGCCC | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It has also been shown to interact with the WD protein PDL1. |
| AT3G46060 | AT3G46060.1 | AAAAGGCCCATAA | small GTP-binding protein (ara-3) |
| AT3G46060.2 | AAAAGGCCCATAA | small GTP-binding protein (ara-3) |
| AT3G46060.3 | AAAAGGCCCATAA | small GTP-binding protein (ara-3) |
| AT3G46520 | AT3G46520.1 | GGCCTTTT | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. |
| AT3G47930 | AT3G47930.1 | AAAAGGCCCAAAA | L-Galactono-1,4-lactone dehydrogenase, catalyzes the final step of ascorbate biosynthesis |
| AT3G47930.2 | AAAAGGCCCAAAA | L-Galactono-1,4-lactone dehydrogenase, catalyzes the final step of ascorbate biosynthesis |
| AT3G49110 | AT3G49110.1 | AAAAGGCC | Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. |
| AT3G49470 | AT3G49470.1 | GAAGCCCAATAAAAGGCCCAAT | NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 2 (NACA2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT4G10480.1); Has 1168 Blast hits to 1151 proteins in 231 species: Archae - 23; Bacteria - 6; Metazoa - 522; Fungi - 246; Plants - 124; Viruses - 7; Other Eukaryotes - 240 (source: NCBI BLink). |
| AT3G50110 | AT3G50110.1 | ACTGGGCCTTTT | ARABIDOPSIS THALIANA PTEN 3 (ATPEN3); FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Phosphatase tensin type (InterPro:IPR014019), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340), Tensin phosphatase, C2 domain (InterPro:IPR014020); BEST Arabidopsis thaliana protein match is: ATPEN2 (ARABIDOPSIS THALIANA PTEN 2); phosphatase/ protein tyrosine phosphatase (TAIR:AT3G19420.1); Has 4300 Blast hits to 1958 proteins in 193 species: Archae - 2; Bacteria - 2161; Metazoa - 1223; Fungi - 404; Plants - 85; Viruses - 3; Other Eukaryotes - 422 (source: NCBI BLink). |
| AT3G52590 | AT3G52590.1 | AGTGGGCTGGGCCTTTT | Ubiquitin extension protein |
| AT3G52860 | AT3G52860.1 | AAAAGGCCCAATAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 68 Blast hits to 68 proteins in 28 species: Archae - 0; Bacteria - 2; Metazoa - 36; Fungi - 13; Plants - 13; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G53120 | AT3G53120.1 | ATTTGGGCCTTTT | VPS37-1; LOCATED IN: ESCRT I complex; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36680.1); Has 356 Blast hits to 356 proteins in 75 species: Archae - 0; Bacteria - 4; Metazoa - 251; Fungi - 14; Plants - 42; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). |
| AT3G54540 | AT3G54540.1 | AAAAGGCCCAAAT | member of GCN subfamily |
| AT3G56820 | AT3G56820.1 | GGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT3G56990 | AT3G56990.1 | AAAAGGCCCAGA | embryo sac development arrest 7 (EDA7); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: megagametogenesis; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NUC153 (InterPro:IPR012580), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 3435 Blast hits to 2597 proteins in 327 species: Archae - 0; Bacteria - 215; Metazoa - 1552; Fungi - 648; Plants - 432; Viruses - 52; Other Eukaryotes - 536 (source: NCBI BLink). |
| AT3G57000 | AT3G57000.1 | TCTGGGCCTTTT | nucleolar essential protein-related; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal biogenesis, methyltransferase, EMG1/NEP1 (InterPro:IPR005304); Has 1252 Blast hits to 912 proteins in 202 species: Archae - 94; Bacteria - 9; Metazoa - 674; Fungi - 138; Plants - 36; Viruses - 2; Other Eukaryotes - 299 (source: NCBI BLink). |
| AT3G57220 | AT3G57220.1 | TTTTGGGCCTTTT | UDP-GlcNAc:dolichol phosphate N-acetylglucosamine-1-phosphate transferase, putative; FUNCTIONS IN: UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity; INVOLVED IN: polysaccharide biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 4, conserved region (InterPro:IPR018481); BEST Arabidopsis thaliana protein match is: GPT (UDP-GLCNAC%3ADOLICHOL+PHOSPHATE+GLCNAC-1-P+TRANSFERASE); UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase (TAIR:AT2G41490.1); Has 4108 Blast hits to 4107 proteins in 1267 species: Archae - 90; Bacteria - 2863; Metazoa - 110; Fungi - 83; Plants - 32; Viruses - 0; Other Eukaryotes - 930 (source: NCBI BLink). |
| AT3G57800 | AT3G57800.1 | ACCGGTTAAAGCCCAAAAGGCCCAAG | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G57800.2 | ACCGGTTAAAGCCCAAAAGGCCCAAG | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G58600 | AT3G58600.1 | AAAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: endocytosis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptin ear-binding coat-associated protein 1 NECAP-1 (InterPro:IPR012466); BEST Arabidopsis thaliana protein match is: ATNAP4 (Arabidopsis thaliana non-intrinsic ABC protein 4); ATPase, coupled to transmembrane movement of substances / transporter (TAIR:AT1G03900.1); Has 329 Blast hits to 329 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 43; Plants - 52; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT3G58610 | AT3G58610.1 | TTAATGGGCCTTTT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink). |
| AT3G58610.2 | TTAATGGGCCTTTT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink). |
| AT3G61240 | AT3G61240.1 | AAAAGGCC | DEAD/DEAH box helicase, putative (RH12); FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT2G45810.1); Has 38149 Blast hits to 31557 proteins in 1824 species: Archae - 426; Bacteria - 11683; Metazoa - 8068; Fungi - 4281; Plants - 1592; Viruses - 82; Other Eukaryotes - 12017 (source: NCBI BLink). |
| AT3G61240.2 | AAAAGGCC | DEAD/DEAH box helicase, putative (RH12); FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT2G45810.1); Has 38149 Blast hits to 31557 proteins in 1824 species: Archae - 426; Bacteria - 11683; Metazoa - 8068; Fungi - 4281; Plants - 1592; Viruses - 82; Other Eukaryotes - 12017 (source: NCBI BLink). |
| AT3G62580 | AT3G62580.1 | AATAGGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT1G72100.1); Has 237 Blast hits to 236 proteins in 85 species: Archae - 0; Bacteria - 4; Metazoa - 103; Fungi - 69; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G63220 | AT3G63220.1 | AAAAGGCC | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G16250.1); Has 4947 Blast hits to 3281 proteins in 155 species: Archae - 4; Bacteria - 274; Metazoa - 3818; Fungi - 8; Plants - 628; Viruses - 20; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT3G63220.2 | AAAAGGCC | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G16250.1); Has 4947 Blast hits to 3281 proteins in 155 species: Archae - 4; Bacteria - 274; Metazoa - 3818; Fungi - 8; Plants - 628; Viruses - 20; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT3G63340 | AT3G63340.1 | AAAAGGCCCAAAA | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C-related / PP2C-related (TAIR:AT3G63320.1); Has 3271 Blast hits to 3269 proteins in 215 species: Archae - 0; Bacteria - 0; Metazoa - 1075; Fungi - 380; Plants - 1004; Viruses - 5; Other Eukaryotes - 807 (source: NCBI BLink). |
| AT3G63340.1 | GGCCTTTT | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C-related / PP2C-related (TAIR:AT3G63320.1); Has 3271 Blast hits to 3269 proteins in 215 species: Archae - 0; Bacteria - 0; Metazoa - 1075; Fungi - 380; Plants - 1004; Viruses - 5; Other Eukaryotes - 807 (source: NCBI BLink). |
| AT4G00020 | AT4G00020.1 | AAAAGGCCGTGGCAT | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development. |
| AT4G00020.2 | AAAAGGCCGTGGCAT | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development. |
| AT4G00058 | AT4G00058.1 | AAAAGGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown. |
| AT4G00090 | AT4G00090.1 | GTGGGCCTTTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink). |
| AT4G00290 | AT4G00290.1 | ATTAGGCCCAAAAGGCCCAGA | mechanosensitive ion channel domain-containing protein / MS ion channel domain-containing protein; LOCATED IN: chloroplast, membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Mechanosensitive ion channel MscS, transmembrane-2 (InterPro:IPR011014), Mechanosensitive ion channel MscS (InterPro:IPR006685), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00234.1); Has 8044 Blast hits to 8044 proteins in 1230 species: Archae - 282; Bacteria - 5483; Metazoa - 2; Fungi - 2; Plants - 99; Viruses - 0; Other Eukaryotes - 2176 (source: NCBI BLink). |
| AT4G00810 | AT4G00810.1 | TACACGTGGCCTTTT | 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae - 60; Bacteria - 0; Metazoa - 672; Fungi - 360; Plants - 316; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink). |
| AT4G00810.2 | TACACGTGGCCTTTT | 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae - 60; Bacteria - 0; Metazoa - 672; Fungi - 360; Plants - 316; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink). |
| AT4G01790 | AT4G01790.1 | TTTTGGGCCTTTT | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein / ribonuclease P-related; FUNCTIONS IN: ribonuclease P activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); Has 68 Blast hits to 68 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G02080 | AT4G02080.1 | AAAAGGCC | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT4G02195 | AT4G02195.1 | TAAATGGGCCTAAAAAGGCCCAAAT | member of SYP4 Gene Family |
| AT4G03490 | AT4G03490.1 | AAAAGGCCCAAAT | protein binding; FUNCTIONS IN: protein binding; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G03500.1); Has 19395 Blast hits to 9360 proteins in 384 species: Archae - 23; Bacteria - 1025; Metazoa - 12359; Fungi - 1194; Plants - 1122; Viruses - 91; Other Eukaryotes - 3581 (source: NCBI BLink). |
| AT4G10120 | AT4G10120.1 | AAAAGGCC | Encodes a protein with putative sucrose-phosphate synthase activity. |
| AT4G10120.2 | AAAAGGCC | Encodes a protein with putative sucrose-phosphate synthase activity. |
| AT4G13200 | AT4G13200.1 | GGCCTTTTAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G13200.1 | TATATGGGCCTTTTAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G13310 | AT4G13310.1 | AAAAGGCC | putative cytochrome P450 |
| AT4G13310.2 | AAAAGGCC | putative cytochrome P450 |
| AT4G15410 | AT4G15410.1 | AAAAGGCC | Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma (PUX5); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBX (InterPro:IPR001012), SEP (InterPro:IPR012989), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: PUX4; protein binding (TAIR:AT4G04210.1); Has 2169 Blast hits to 897 proteins in 184 species: Archae - 0; Bacteria - 87; Metazoa - 456; Fungi - 202; Plants - 88; Viruses - 16; Other Eukaryotes - 1320 (source: NCBI BLink). |
| AT4G15410.1 | AAAAGGCCTTTT | Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma (PUX5); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBX (InterPro:IPR001012), SEP (InterPro:IPR012989), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: PUX4; protein binding (TAIR:AT4G04210.1); Has 2169 Blast hits to 897 proteins in 184 species: Archae - 0; Bacteria - 87; Metazoa - 456; Fungi - 202; Plants - 88; Viruses - 16; Other Eukaryotes - 1320 (source: NCBI BLink). |
| AT4G16440 | AT4G16440.1 | TGGGCCTTTT | Encodes a [FeFe]-hydrogenase-like protein named Gollum (for Growth in different Oxygen LeveLs inflUences Morphogenesis). Heterologous expression of Gollum in E. coli indicates that it probably contains two [Fe-S] clusters with different magnetic properties. Sequence alignment analysis indicates that these two clusters would be topologically equivalent to the mesial and proximal [Fe-S] centers of [FeFe]-hydrogenases. Knockdown mutants (RNAi) show a dwarf phenotype at the normal atmospheric partial oxygen pressure of 21 kPa. This dwarf phenotype could be rescued by growing the plant under low oxygen pressure (5kPa), suggesting a role for this gene in oxygen sensing. |
| AT4G16710 | AT4G16710.1 | CCCAATTGGGCCTTTT | glycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT4G16710.2 | CCCAATTGGGCCTTTT | glycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT4G17010 | AT4G17010.1 | AAAAGGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 8 growth stages; Has 58 Blast hits to 56 proteins in 16 species: Archae - 3; Bacteria - 2; Metazoa - 8; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT4G17390 | AT4G17390.1 | AAAAGGCCCAATAAGGGC | 60S ribosomal protein L15 (RPL15B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15A) (TAIR:AT4G16720.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT4G17410 | AT4G17410.1 | GCCCTTATTGGGCCTTTT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: DWNN domain (InterPro:IPR014891), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G47430.1); Has 8731 Blast hits to 6294 proteins in 276 species: Archae - 2; Bacteria - 71; Metazoa - 5540; Fungi - 1215; Plants - 632; Viruses - 56; Other Eukaryotes - 1215 (source: NCBI BLink). |
| AT4G18100 | AT4G18100.1 | AAAAGGCC | 60S ribosomal protein L32 (RPL32A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: callus, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L32e (InterPro:IPR001515), Ribosomal protein L32e, conserved site (InterPro:IPR018263); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L32 (RPL32B) (TAIR:AT5G46430.2); Has 1112 Blast hits to 1112 proteins in 342 species: Archae - 217; Bacteria - 0; Metazoa - 540; Fungi - 96; Plants - 104; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| AT4G18975 | AT4G18975.1 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18975.2 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18975.3 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G22260 | AT4G22260.1 | GGGCCTTTT | Similar to mitochondrial alternative oxidase. im mutants have a variegated phenotype and fail to differentiate chloroplasts in the majority of their cells under high light intensity continuous illumination. The white tissues of immutans accumulate phytoene, a non-colored C40 carotenoid intermediate. This suggests that immutans controls, either directly or indirectly, the activity of phytoene desaturase (PDS), the enzyme that converts phytoene to zeta-carotene in higher plants. However, im is not the structural gene for PDS. It is located in the lumenar face of the thylakoid membrane. IM is expressed ubiquitously in plant tissues. |
| AT4G22350 | AT4G22350.1 | GGCCTTTTAACCG | ubiquitin carboxyl-terminal hydrolase family protein; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase/ zinc ion binding (TAIR:AT4G22285.1); Has 2784 Blast hits to 2384 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1738; Fungi - 374; Plants - 244; Viruses - 0; Other Eukaryotes - 428 (source: NCBI BLink). |
| AT4G23170 | AT4G23170.1 | GGCCTTTT | Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression. |
| AT4G25820 | AT4G25820.1 | GGCCTTTT | Encodes a xyloglucan endotransglycosylase with a clear preference for non-fucosylated xyloglucan polymer. |
| AT4G29910 | AT4G29910.1 | GGCCTTTT | Origin Recognition Complex subunit 5. Involved in the initiation of DNA replication. Interacts strongly with all ORC subunits. |
| AT4G30500 | AT4G30500.1 | TTATGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF788 (InterPro:IPR008506); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23940.1); Has 218 Blast hits to 218 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 72; Plants - 29; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT4G31150 | AT4G31150.1 | ATAATGGGCCTTTTAAAGGCCC | endonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT4G31150.2 | ATAATGGGCCTTTTAAAGGCCC | endonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT4G31180 | AT4G31180.1 | GGGCCTTTT | aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, aspartyl-tRNA aminoacylation; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G26870.1); Has 17233 Blast hits to 14062 proteins in 1714 species: Archae - 297; Bacteria - 9930; Metazoa - 655; Fungi - 618; Plants - 225; Viruses - 0; Other Eukaryotes - 5508 (source: NCBI BLink). |
| AT4G31180.2 | GGGCCTTTT | aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, aspartyl-tRNA aminoacylation; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G26870.1); Has 17233 Blast hits to 14062 proteins in 1714 species: Archae - 297; Bacteria - 9930; Metazoa - 655; Fungi - 618; Plants - 225; Viruses - 0; Other Eukaryotes - 5508 (source: NCBI BLink). |
| AT4G31600 | AT4G31600.1 | TTTGGGCCTTTTGGGCCTTAC | UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32272.1); Has 1648 Blast hits to 1639 proteins in 227 species: Archae - 10; Bacteria - 72; Metazoa - 464; Fungi - 365; Plants - 570; Viruses - 0; Other Eukaryotes - 167 (source: NCBI BLink). |
| AT4G31600.2 | TTTGGGCCTTTTGGGCCTTAC | UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32272.1); Has 1648 Blast hits to 1639 proteins in 227 species: Archae - 10; Bacteria - 72; Metazoa - 464; Fungi - 365; Plants - 570; Viruses - 0; Other Eukaryotes - 167 (source: NCBI BLink). |
| AT4G32590 | AT4G32590.1 | AAAAGGCCCAC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.2 | AAAAGGCCCAC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.3 | AAAAGGCCCAC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.4 | AAAAGGCCCAC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32680 | AT4G32680.1 | AGTTGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G32690 | AT4G32690.1 | AAAAGGCCCAACT | Encodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast. |
| AT4G34270 | AT4G34270.1 | AAAAGGCC | TIP41-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: TIP41-like protein (InterPro:IPR007303); Has 248 Blast hits to 248 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 81; Plants - 27; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT4G35440 | AT4G35440.1 | GGCCTTTT | Enclodes a choride channel protein that is localized to the thlakoid membrane. |
| AT4G35450 | AT4G35450.1 | AAAAGGCC | Involved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. |
| AT4G35450.2 | AAAAGGCC | Involved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. |
| AT4G35450.3 | AAAAGGCC | Involved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. |
| AT4G35450.4 | AAAAGGCC | Involved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. |
| AT4G35580 | AT4G35580.1 | TTTGGGCTTTAAGGCCTTTTTGGGCCCTA | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G35580.2 | TTTGGGCTTTAAGGCCTTTTTGGGCCCTA | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G36910 | AT4G36910.1 | AAAAGGCCACGTGTT | Has a cystathionine Beta-synthase domain. |
| AT4G37090 | AT4G37090.1 | AAAAGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink). |
| AT4G37090.2 | AAAAGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink). |
| AT4G37300 | AT4G37300.1 | AAAAGGCCCACTAAAAGCCCATATA | maternal effect embryo arrest 59 (MEE59); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G37830 | AT4G37830.1 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT4G37830.2 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT4G37880 | AT4G37880.1 | AGTTGGGCCTTTT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22690.2); Has 631 Blast hits to 627 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 324; Fungi - 158; Plants - 74; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G38380 | AT4G38380.1 | AAAAGGCCCATTTA | antiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G38330.1); Has 7271 Blast hits to 7248 proteins in 1132 species: Archae - 174; Bacteria - 5061; Metazoa - 70; Fungi - 101; Plants - 194; Viruses - 0; Other Eukaryotes - 1671 (source: NCBI BLink). |
| AT4G38490 | AT4G38490.1 | TGAGCCCAAAAAAGGCCCATA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38790 | AT4G38790.1 | CATGGGCCTTTT | ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT2G21190.1); Has 626 Blast hits to 626 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 114; Plants - 120; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink). |
| AT5G01020 | AT5G01020.1 | AAAAGGCCCATAT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G05940.1); Has 84930 Blast hits to 83819 proteins in 2999 species: Archae - 48; Bacteria - 7829; Metazoa - 37401; Fungi - 6493; Plants - 18635; Viruses - 347; Other Eukaryotes - 14177 (source: NCBI BLink). |
| AT5G02370 | AT5G02370.1 | TAAATGGGCCCAAAAAAGGCC | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, sequence-specific DNA binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT5G23910.1); Has 7488 Blast hits to 7156 proteins in 245 species: Archae - 0; Bacteria - 21; Metazoa - 3823; Fungi - 875; Plants - 885; Viruses - 0; Other Eukaryotes - 1884 (source: NCBI BLink). |
| AT5G02470 | AT5G02470.1 | AAAAGGCCCATTTA | core cell cycle genes |
| AT5G02470.2 | AAAAGGCCCATTTA | core cell cycle genes |
| AT5G02470.3 | AAAAGGCCCATTTA | core cell cycle genes |
| AT5G02530 | AT5G02530.1 | AAAAGGCCCATTAAG | RNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT5G59950.4); Has 10734 Blast hits to 7876 proteins in 597 species: Archae - 2; Bacteria - 1111; Metazoa - 4776; Fungi - 1622; Plants - 1564; Viruses - 50; Other Eukaryotes - 1609 (source: NCBI BLink). |
| AT5G02740 | AT5G02740.1 | TTATGGGCTTTGGCCTTTT | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G02740.2 | TTATGGGCTTTGGCCTTTT | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G03150 | AT5G03150.1 | GGCCTTTT | JKD is a nuclear-localized putative transcription factor with three zinc finger domains. jkd mutants show a number of root patterning defects including ectopic periclinal divisions in the cortex, increased cell numbers in the cortical and epidermal layers, a disrupted QC marker expression pattern, and disorganized QC and columella cells. jkd mutants also have a reduced number of meristematic cells in their roots. JKD can interact with the SCR and SHR proteins implicated in root patterning, as well as another zinc finger transcription factor, MAGPIE. All of these interactions require the first zinc finger in JKD according to a Y2H assay. There are also transcriptional interactions among these proteins. The initiation of JKD transcription does not appear to depend on SCR and SHR, but later expression in the post-embryonic QC cells and ground tissue initials is reduced in scr and shr mutants. JKD also appears to be required for SCR transcription beginning in the embryo. There is also some evidence that JKD plays a role in promoting the movement of SHR into the nucleus, particularly in QC cells, but this may be indirect. |
| AT5G04260 | AT5G04260.1 | GGGCCTTTT | Encodes a thioredoxin (WCRKC2) localized in chloroplast stroma. Contains a WCRKC motif. |
| AT5G05370 | AT5G05370.1 | AAAAGGCCCATAT | ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT3G10860.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G05380 | AT5G05380.1 | ATATGGGCCTTTT | PRENYLATED RAB ACCEPTOR 1.B3 (PRA1.B3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 371 Blast hits to 371 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 59; Plants - 178; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT5G06160 | AT5G06160.1 | AAAAGGCCCAAAA | Encodes a protein with similarity to pre-mRNA splicing factor SF3a60 that is involved in gametic cell fate determination. Loss of function results in the ectopic expression of egg cell makers suggesting a role in restriction of gametic cell fate. Expressed strongly in gametophytes and weakly in sporophytes. |
| AT5G06160.1 | AAAAGGCCCAAAA | Encodes a protein with similarity to pre-mRNA splicing factor SF3a60 that is involved in gametic cell fate determination. Loss of function results in the ectopic expression of egg cell makers suggesting a role in restriction of gametic cell fate. Expressed strongly in gametophytes and weakly in sporophytes. |
| AT5G06160.1 | AAAAGGCCTAAA | Encodes a protein with similarity to pre-mRNA splicing factor SF3a60 that is involved in gametic cell fate determination. Loss of function results in the ectopic expression of egg cell makers suggesting a role in restriction of gametic cell fate. Expressed strongly in gametophytes and weakly in sporophytes. |
| AT5G06340 | AT5G06340.1 | GGCCTTTT | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27 (ATNUDX27); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 3191 Blast hits to 3191 proteins in 724 species: Archae - 2; Bacteria - 1483; Metazoa - 9; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1660 (source: NCBI BLink). |
| AT5G07550 | AT5G07550.1 | AAAAGGCC | member of Oleosin-like protein family |
| AT5G07550.2 | AAAAGGCC | member of Oleosin-like protein family |
| AT5G07550.3 | AAAAGGCC | member of Oleosin-like protein family |
| AT5G07840 | AT5G07840.1 | GGCCTTTT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT5G61230.1); Has 50208 Blast hits to 17627 proteins in 653 species: Archae - 46; Bacteria - 2813; Metazoa - 29912; Fungi - 2863; Plants - 1606; Viruses - 449; Other Eukaryotes - 12519 (source: NCBI BLink). |
| AT5G07842 | AT5G07842.1 | GGCCTTTT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF16 represents a conserved upstream opening reading frame relative to major ORF AT5G07840.1 |
| AT5G08540 | AT5G08540.1 | AAAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G09880 | AT5G09880.1 | TAAATGGGCCTTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Splicing factor, CC1-like (InterPro:IPR006509), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G16940.1); Has 75114 Blast hits to 36610 proteins in 1254 species: Archae - 65; Bacteria - 4369; Metazoa - 40620; Fungi - 8054; Plants - 5837; Viruses - 419; Other Eukaryotes - 15750 (source: NCBI BLink). |
| AT5G10160 | AT5G10160.1 | AAAAGGCCCATATA | beta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: hydro-lyase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT2G22230.1); Has 4912 Blast hits to 4909 proteins in 1231 species: Archae - 0; Bacteria - 2978; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1890 (source: NCBI BLink). |
| AT5G10910 | AT5G10910.1 | AAAAGGCCCAAAC | mraW methylase family protein; FUNCTIONS IN: methyltransferase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial methyltransferase (InterPro:IPR002903); Has 5437 Blast hits to 5435 proteins in 1466 species: Archae - 0; Bacteria - 2709; Metazoa - 101; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2607 (source: NCBI BLink). |
| AT5G12890 | AT5G12890.1 | AAAAGGCC | UDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT2G36780.1); Has 4978 Blast hits to 4939 proteins in 299 species: Archae - 0; Bacteria - 92; Metazoa - 2112; Fungi - 11; Plants - 2661; Viruses - 72; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT5G13010 | AT5G13010.1 | AAAAGGCCCATAT | embryo defective 3011 (EMB3011); FUNCTIONS IN: RNA helicase activity, helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP-dependent RNA helicase, putative (TAIR:AT3G26560.1); Has 7285 Blast hits to 6618 proteins in 979 species: Archae - 6; Bacteria - 1991; Metazoa - 2135; Fungi - 867; Plants - 393; Viruses - 401; Other Eukaryotes - 1492 (source: NCBI BLink). |
| AT5G13190 | AT5G13190.1 | AAAAGGCCCATTAAG | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: LPS-induced tumor necrosis factor alpha factor (InterPro:IPR006629); Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G13190.1 | ATTAGGCCTTTTGAGCCCAATAT | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: LPS-induced tumor necrosis factor alpha factor (InterPro:IPR006629); Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G13730 | AT5G13730.1 | TTATTGGGCCTTTT | Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity. |
| AT5G13970 | AT5G13970.1 | TAAATGGGTTAGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13310.1); Has 608 Blast hits to 543 proteins in 119 species: Archae - 2; Bacteria - 47; Metazoa - 119; Fungi - 63; Plants - 38; Viruses - 17; Other Eukaryotes - 322 (source: NCBI BLink). |
| AT5G14250 | AT5G14250.1 | AAAAGGCC | Encodes subunit 3 of the COP9 signalosome. |
| AT5G14250.2 | AAAAGGCC | Encodes subunit 3 of the COP9 signalosome. |
| AT5G15020 | AT5G15020.1 | GGGCCTTTT | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT5G15260 | AT5G15260.1 | CTTGGGCCTTTT | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT3G01170.1); Has 39 Blast hits to 39 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G17620 | AT5G17620.1 | AAAAGGCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plant nuclear matrix 1 (InterPro:IPR010604); Has 62 Blast hits to 62 proteins in 32 species: Archae - 0; Bacteria - 19; Metazoa - 8; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT5G19060 | AT5G19060.1 | GGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G06150.1); Has 19 Blast hits to 18 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G20620 | AT5G20620.1 | TTTTGGGCCTTTGGGCCTTTTGGGCCAAT | encodes a ubiquitin polyprotein. |
| AT5G22630 | AT5G22630.1 | AAAAGGCC | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT5G22950 | AT5G22950.1 | AAAAGGCCCAATAT | VPS24.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS24.2 (TAIR:AT3G45000.1); Has 1310 Blast hits to 1309 proteins in 191 species: Archae - 14; Bacteria - 29; Metazoa - 586; Fungi - 224; Plants - 254; Viruses - 0; Other Eukaryotes - 203 (source: NCBI BLink). |
| AT5G24520 | AT5G24520.1 | AAAAGGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24520.2 | AAAAGGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24520.3 | AAAAGGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24710 | AT5G24710.1 | TTATTGGGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 46946 Blast hits to 23834 proteins in 1336 species: Archae - 160; Bacteria - 9572; Metazoa - 15324; Fungi - 6794; Plants - 1938; Viruses - 1106; Other Eukaryotes - 12052 (source: NCBI BLink). |
| AT5G25490 | AT5G25490.1 | GGGCCTTTT | zinc finger (Ran-binding) family protein; FUNCTIONS IN: binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: zinc finger (Ran-binding) family protein (TAIR:AT3G15680.1); Has 1445 Blast hits to 838 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 868; Fungi - 124; Plants - 258; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT5G26360 | AT5G26360.1 | AAAAGGCCCAATG | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, gamma subunit (InterPro:IPR012719), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G11830.1); Has 12411 Blast hits to 12269 proteins in 2241 species: Archae - 394; Bacteria - 5329; Metazoa - 1841; Fungi - 951; Plants - 480; Viruses - 2; Other Eukaryotes - 3414 (source: NCBI BLink). |
| AT5G35400 | AT5G35400.1 | AAAAGGCCCAATAA | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 4676 Blast hits to 4649 proteins in 1359 species: Archae - 66; Bacteria - 2736; Metazoa - 98; Fungi - 50; Plants - 81; Viruses - 0; Other Eukaryotes - 1645 (source: NCBI BLink). |
| AT5G35530 | AT5G35530.1 | AAATGGGCCTTAAAAGGCCGGGCCTTG | 40S ribosomal protein S3 (RPS3C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, prokaryotic type (InterPro:IPR009019), K Homology, type 2 (InterPro:IPR004044), K Homology (InterPro:IPR004087), Ribosomal protein S3, C-terminal (InterPro:IPR001351), Ribosomal protein S3, conserved site (InterPro:IPR018280), Ribosomal protein S3, eukaryotic/archaeal (InterPro:IPR005703); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3 (RPS3A) (TAIR:AT2G31610.1); Has 3856 Blast hits to 3855 proteins in 1171 species: Archae - 174; Bacteria - 1930; Metazoa - 296; Fungi - 95; Plants - 109; Viruses - 0; Other Eukaryotes - 1252 (source: NCBI BLink). |
| AT5G38460 | AT5G38460.1 | GGGCCTTTT | ALG6, ALG8 glycosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; LOCATED IN: endoplasmic reticulum membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyltransferase, ALG6/ALG8 (InterPro:IPR004856); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT2G44660.1); Has 504 Blast hits to 492 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 258; Fungi - 169; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT5G39250 | AT5G39250.1 | TAATTGGGCTTCTATATGGGCTAAGGCCTTTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G39510 | AT5G39510.1 | AAAAGGCC | Encodes a member of SNARE gene family. Homologous with yeast VTI1 and is involved in vesicle transport. Mutant alleles such as sgr4/zig are defective in the shoots response to gravity resulting in a zigzag growth pattern of the stem. Involved in protein trafficking to lytic vacuoles. Can conditionally substitute VTI12 in protein storage vacuole trafficking when plants are devoid of VTI12. |
| AT5G40451 | AT5G40451.1 | AAAAGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40450.2); Has 9518 Blast hits to 5919 proteins in 574 species: Archae - 29; Bacteria - 1055; Metazoa - 3134; Fungi - 763; Plants - 338; Viruses - 136; Other Eukaryotes - 4063 (source: NCBI BLink). |
| AT5G40930 | AT5G40930.1 | AAAAGCCCATAAGGCCTTTTAAGCCCACT | Form of TOM20, which is a component of the TOM complex involved in transport of nuclear-encoded mitochondrial proteins |
| AT5G42220 | AT5G42220.1 | AAAAGGCCAGGCCCAG | ubiquitin family protein; INVOLVED IN: protein modification process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25270.1); Has 9149 Blast hits to 5042 proteins in 638 species: Archae - 2; Bacteria - 184; Metazoa - 4041; Fungi - 1003; Plants - 1687; Viruses - 163; Other Eukaryotes - 2069 (source: NCBI BLink). |
| AT5G44785 | AT5G44785.1 | GGCCTTTT | ORGANELLAR SINGLE-STRANDED DNA BINDING PROTEIN 3 (OSB3); FUNCTIONS IN: single-stranded DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Primosome PriB/single-strand DNA-binding (InterPro:IPR000424); BEST Arabidopsis thaliana protein match is: PTAC9 (PLASTID TRANSCRIPTIONALLY ACTIVE 9); single-stranded DNA binding (TAIR:AT4G20010.2); Has 170 Blast hits to 86 proteins in 15 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT5G44785.2 | GGCCTTTT | ORGANELLAR SINGLE-STRANDED DNA BINDING PROTEIN 3 (OSB3); FUNCTIONS IN: single-stranded DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Primosome PriB/single-strand DNA-binding (InterPro:IPR000424); BEST Arabidopsis thaliana protein match is: PTAC9 (PLASTID TRANSCRIPTIONALLY ACTIVE 9); single-stranded DNA binding (TAIR:AT4G20010.2); Has 170 Blast hits to 86 proteins in 15 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT5G47560 | AT5G47560.1 | AAAAGGCC | Encodes a tonoplast malate/fumarate transporter. |
| AT5G47580 | AT5G47580.1 | GGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17250.1); Has 17 Blast hits to 16 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G47630 | AT5G47630.1 | AAAAGGCC | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis. |
| AT5G47630.2 | AAAAGGCC | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis. |
| AT5G49510 | AT5G49510.1 | GGCCTTTT | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G49510.2 | GGCCTTTT | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G52180 | AT5G52180.1 | TTAAAGCCCATTGGGCCTTTT | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 50 Blast hits to 50 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 37; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G53400 | AT5G53400.1 | GTGGGCCTTTT | nuclear movement family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: nuclear movement family protein (TAIR:AT4G27890.1); Has 1930 Blast hits to 1478 proteins in 221 species: Archae - 7; Bacteria - 113; Metazoa - 767; Fungi - 136; Plants - 100; Viruses - 4; Other Eukaryotes - 803 (source: NCBI BLink). |
| AT5G57300 | AT5G57300.1 | ATAATGGGCCTTTT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57300.2 | ATAATGGGCCTTTT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57950 | AT5G57950.1 | CTATTGGGCCTTTT | 26S proteasome regulatory subunit, putative; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular signaling cascade; LOCATED IN: proteasome regulatory particle; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PDZ/DHR/GLGF (InterPro:IPR001478); Has 352 Blast hits to 352 proteins in 164 species: Archae - 0; Bacteria - 46; Metazoa - 112; Fungi - 85; Plants - 23; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT5G58220 | AT5G58220.1 | AAAAGGCCCAAT | Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). |
| AT5G58220.1 | AAAAGGCCCATTT | Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). |
| AT5G58220.2 | AAAAGGCCCAAT | Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). |
| AT5G58220.2 | AAAAGGCCCATTT | Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). |
| AT5G58220.3 | AAAAGGCCCAAT | Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). |
| AT5G58220.3 | AAAAGGCCCATTT | Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). |
| AT5G58230 | AT5G58230.1 | AAATGGGCCTTTT | Encodes a WD-40 repeat containing protein that functions in chromatin assembly as part of the CAF1 and FIE complex. Mutants exhibit parthenogenetic development that includes proliferation of unfertilized endosperm and embryos. In heterozygous plants 50% of embryos abort. Of the aborted embryos the early aborted class are homozygous and the later aborting lass are heterozygotes in which the defective allele is maternally transmitted. Other phenotypes include defects in ovule morphogenesis and organ initiation,as well as increased levels of heterochromatic DNA. MSI1 is needed for the transition to flowering. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. In the ovule, the MSI1 transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization. MSI is biallelically expressed, the paternall allele is expressed in the endosperm and embryo and is not imprinted. MSI1 forms a complex with RBR1 that is required for activation of the imprinted genes FIS2 and FWA. This activation is mediated by MSI1/RBR1 mediated repression of MET1. |
| AT5G58230.1 | TAATTGGGCCTTTT | Encodes a WD-40 repeat containing protein that functions in chromatin assembly as part of the CAF1 and FIE complex. Mutants exhibit parthenogenetic development that includes proliferation of unfertilized endosperm and embryos. In heterozygous plants 50% of embryos abort. Of the aborted embryos the early aborted class are homozygous and the later aborting lass are heterozygotes in which the defective allele is maternally transmitted. Other phenotypes include defects in ovule morphogenesis and organ initiation,as well as increased levels of heterochromatic DNA. MSI1 is needed for the transition to flowering. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. In the ovule, the MSI1 transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization. MSI is biallelically expressed, the paternall allele is expressed in the endosperm and embryo and is not imprinted. MSI1 forms a complex with RBR1 that is required for activation of the imprinted genes FIS2 and FWA. This activation is mediated by MSI1/RBR1 mediated repression of MET1. |
| AT5G58290 | AT5G58290.1 | AAAAGGCCCATTTA | 26S proteasome AAA-ATPase subunit RPT3 (RPT3) mRNA, |
| AT5G58510 | AT5G58510.1 | GGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55060.1); Has 187 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 2; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT5G59613 | AT5G59613.1 | GGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial respiratory chain complex III; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46430.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G59840 | AT5G59840.1 | AAAAGGCCCACA | Ras-related GTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB8; GTP binding (TAIR:AT3G53610.3); Has 23810 Blast hits to 23756 proteins in 654 species: Archae - 17; Bacteria - 124; Metazoa - 13243; Fungi - 2913; Plants - 2226; Viruses - 19; Other Eukaryotes - 5268 (source: NCBI BLink). |
| AT5G60140 | AT5G60140.1 | AAAAGGCC | transcriptional factor B3 family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: transcriptional factor B3 family protein (TAIR:AT5G60130.1); Has 35622 Blast hits to 9758 proteins in 600 species: Archae - 149; Bacteria - 18835; Metazoa - 6044; Fungi - 2604; Plants - 1070; Viruses - 420; Other Eukaryotes - 6500 (source: NCBI BLink). |
| AT5G60170 | AT5G60170.1 | AAAAGGCC | RNA binding / nucleic acid binding / nucleotide binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), RNA recognition motif, RNP-1 (InterPro:IPR000504), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), RNA recognition, region 1 (InterPro:IPR003954); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G45630.1); Has 1060 Blast hits to 628 proteins in 173 species: Archae - 0; Bacteria - 202; Metazoa - 240; Fungi - 159; Plants - 78; Viruses - 0; Other Eukaryotes - 381 (source: NCBI BLink). |
| AT5G61380 | AT5G61380.1 | GATGACGTGGCCTTTT | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. |
| AT5G63370 | AT5G63370.2 | AAAAGGCC | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G67580.2); Has 90774 Blast hits to 89322 proteins in 2847 species: Archae - 52; Bacteria - 8004; Metazoa - 39518; Fungi - 8567; Plants - 16625; Viruses - 438; Other Eukaryotes - 17570 (source: NCBI BLink). |
| AT5G63370.3 | AAAAGGCC | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G67580.2); Has 90774 Blast hits to 89322 proteins in 2847 species: Archae - 52; Bacteria - 8004; Metazoa - 39518; Fungi - 8567; Plants - 16625; Viruses - 438; Other Eukaryotes - 17570 (source: NCBI BLink). |
| AT5G63520 | AT5G63520.1 | AAAAGGCCCAAAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FIST domain, N-terminal (InterPro:IPR013702); Has 96 Blast hits to 96 proteins in 46 species: Archae - 0; Bacteria - 72; Metazoa - 6; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT5G65490 | AT5G65490.1 | GGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SGT1 (InterPro:IPR010770); Has 4480 Blast hits to 3390 proteins in 346 species: Archae - 8; Bacteria - 210; Metazoa - 1070; Fungi - 582; Plants - 124; Viruses - 61; Other Eukaryotes - 2425 (source: NCBI BLink). |
| AT5G65960 | AT5G65960.1 | TATTGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 294 Blast hits to 294 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 21; Plants - 119; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT5G66600 | AT5G66600.1 | GGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF547 (InterPro:IPR006869); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23700.1); Has 343 Blast hits to 338 proteins in 57 species: Archae - 0; Bacteria - 36; Metazoa - 44; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G66600.2 | GGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF547 (InterPro:IPR006869); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23700.1); Has 343 Blast hits to 338 proteins in 57 species: Archae - 0; Bacteria - 36; Metazoa - 44; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G66600.3 | GGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF547 (InterPro:IPR006869); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23700.1); Has 343 Blast hits to 338 proteins in 57 species: Archae - 0; Bacteria - 36; Metazoa - 44; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G66860 | AT5G66860.1 | AAAAGGCC | INVOLVED IN: translation; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035); BEST Arabidopsis thaliana protein match is: 50S ribosomal protein-related (TAIR:AT4G23620.1); Has 2346 Blast hits to 2345 proteins in 433 species: Archae - 0; Bacteria - 930; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 1375 (source: NCBI BLink). |
| AT5G66900 | AT5G66900.1 | AAAAGGCCCAAT | disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: defense response, apoptosis; CONTAINS InterPro DOMAIN/s: Disease resistance, plant (InterPro:IPR014011), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G66910.1); Has 22201 Blast hits to 13213 proteins in 513 species: Archae - 34; Bacteria - 1477; Metazoa - 3674; Fungi - 138; Plants - 15962; Viruses - 2; Other Eukaryotes - 914 (source: NCBI BLink). |
| AT5G67480 | AT5G67480.1 | AAAAGGCC | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT5G67480.2 | AAAAGGCC | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |