| Locus | Gene model | Sequence | Description |
| AT1G01500 | AT1G01500.1 | TCACACGTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G01720 | AT1G01720.1 | CCCACGTGTG | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. |
| AT1G02990 | AT1G02990.1 | CACACGTGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink). |
| AT1G02990.2 | CACACGTGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink). |
| AT1G07985 | AT1G07985.1 | AACACGTGTGA | Expressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 33 Blast hits to 33 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G08190 | AT1G08190.1 | CACACGTGGCAC | vacuolar assembly protein, putative (VPS41); FUNCTIONS IN: protein binding, binding, nucleotide binding, zinc ion binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), WD40 repeat (InterPro:IPR001680), Vacuolar protein sorting-associated protein 41 (InterPro:IPR016902), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Armadillo-type fold (InterPro:IPR016024), Clathrin, heavy chain/VPS, 7-fold repeat (InterPro:IPR000547); Has 18653 Blast hits to 4150 proteins in 294 species: Archae - 4; Bacteria - 280; Metazoa - 13631; Fungi - 995; Plants - 521; Viruses - 352; Other Eukaryotes - 2870 (source: NCBI BLink). |
| AT1G08460 | AT1G08460.1 | AACACGTGTG | HDA08; FUNCTIONS IN: histone deacetylase activity; INVOLVED IN: histone deacetylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone deacetylase superfamily (InterPro:IPR000286); BEST Arabidopsis thaliana protein match is: HDA15; histone deacetylase (TAIR:AT3G18520.2); Has 6845 Blast hits to 6725 proteins in 846 species: Archae - 124; Bacteria - 2006; Metazoa - 1106; Fungi - 418; Plants - 273; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink). |
| AT1G09500 | AT1G09500.1 | TCACACGTGAC | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase |
| AT1G09500.2 | TCACACGTGAC | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase |
| AT1G09500.3 | TCACACGTGAC | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase |
| AT1G09850 | AT1G09850.1 | CACACGTGGT | Arabidopsis thaliana papain-like cysteine peptidase |
| AT1G11480 | AT1G11480.1 | ATCCACGTGTG | eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT1G11480.2 | ATCCACGTGTG | eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT1G12250 | AT1G12250.1 | TCACACGTG | thylakoid lumenal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 15 kDa protein, chloroplast (TAIR:AT2G44920.2); Has 6004 Blast hits to 3393 proteins in 359 species: Archae - 127; Bacteria - 4195; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 4; Other Eukaryotes - 1572 (source: NCBI BLink). |
| AT1G12250.2 | TCACACGTG | thylakoid lumenal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 15 kDa protein, chloroplast (TAIR:AT2G44920.2); Has 6004 Blast hits to 3393 proteins in 359 species: Archae - 127; Bacteria - 4195; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 4; Other Eukaryotes - 1572 (source: NCBI BLink). |
| AT1G13560 | AT1G13560.1 | CACACGTGTG | Encodes aminoalcoholphosphotransferase AAPT1. |
| AT1G13560.2 | CACACGTGTG | Encodes aminoalcoholphosphotransferase AAPT1. |
| AT1G15200 | AT1G15200.1 | CACACGTGA | protein-protein interaction regulator family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pinin/SDK/memA protein (InterPro:IPR006786); Has 5080 Blast hits to 3694 proteins in 299 species: Archae - 6; Bacteria - 218; Metazoa - 2325; Fungi - 443; Plants - 161; Viruses - 52; Other Eukaryotes - 1875 (source: NCBI BLink). |
| AT1G16710 | AT1G16710.1 | TCACACGTGCGACATCG | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides. |
| AT1G17210 | AT1G17210.1 | CACACGTGGCT | zinc ion binding; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytosol, nucleus, phragmoplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC-like (InterPro:IPR012935), Proteinase inhibitor I32, inhibitor of apoptosis (InterPro:IPR001370); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G48950.1); Has 388 Blast hits to 192 proteins in 68 species: Archae - 2; Bacteria - 7; Metazoa - 100; Fungi - 38; Plants - 41; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink). |
| AT1G17220 | AT1G17220.1 | AGCCACGTGTG | Encodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal. |
| AT1G22400 | AT1G22400.1 | TCACACGTGACGT | UGT85A1; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: AtUGT85A3 (UDP-glucosyl transferase 85A3); glucuronosyltransferase/ transcription factor/ transferase, transferring glycosyl groups (TAIR:AT1G22380.1); Has 5011 Blast hits to 4962 proteins in 308 species: Archae - 0; Bacteria - 100; Metazoa - 2040; Fungi - 16; Plants - 2764; Viruses - 58; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT1G27461 | AT1G27461.1 | TCACACGTGTCC | unknown protein; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G27700 | AT1G27700.1 | CGCACGTGTG | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: Golgi vesicle transport, vesicle-mediated transport; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: t-SNARE (InterPro:IPR010989), Syntaxin 6, N-terminal (InterPro:IPR015260); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT4G30240.1); Has 64 Blast hits to 63 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27730 | AT1G27730.1 | CACACGTGTAC | Related to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress. |
| AT1G27760 | AT1G27760.1 | AGCCACGTGTGA | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
| AT1G27760.2 | AGCCACGTGTGA | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
| AT1G27760.3 | AGCCACGTGTGA | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
| AT1G30260 | AT1G30260.1 | CACACGTGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cytokinin stimulus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT4G21060.1); Has 16 Blast hits to 16 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G31420 | AT1G31420.1 | TGACACGTGTG | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. |
| AT1G32410 | AT1G32410.1 | CACACGTGGC | vacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT1G32410.2 | CACACGTGGC | vacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT1G32410.3 | CACACGTGGC | vacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT1G32410.4 | CACACGTGGC | vacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT1G32410.5 | CACACGTGGC | vacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT1G47970 | AT1G47970.1 | CGCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; Has 85194 Blast hits to 34173 proteins in 1291 species: Archae - 566; Bacteria - 13003; Metazoa - 26927; Fungi - 13823; Plants - 4747; Viruses - 1476; Other Eukaryotes - 24652 (source: NCBI BLink). |
| AT1G52710 | AT1G52710.1 | TCACACGTG | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial envelope; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT3G15640.2); Has 219 Blast hits to 219 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 17; Plants - 49; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT1G53750 | AT1G53750.1 | CACGTGTG | 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, |
| AT1G56330 | AT1G56330.1 | GCCACGTGTG | Encodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol. |
| AT1G64040 | AT1G64040.1 | CGCACGTGTG | Encodes the catalytic subunit of a Type 1 phosphoprotein Ser/Thr phosphatase, expressed in roots, shoots and flowers. |
| AT1G64142 | AT1G64142.1 | CACGTGTG | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF23 represents a conserved upstream opening reading frame relative to major ORF AT1G64140.1 |
| AT1G64200 | AT1G64200.1 | AACACGTGTGA | VACUOLAR H+-ATPASE SUBUNIT E ISOFORM 3 (VHA-E3); FUNCTIONS IN: proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole, mitochondrial proton-transporting ATP synthase complex; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, V1/A1 complex, subunit E (InterPro:IPR002842); BEST Arabidopsis thaliana protein match is: TUF (VACUOLAR ATP SYNTHASE SUBUNIT E1); proton-transporting ATPase, rotational mechanism (TAIR:AT4G11150.1); Has 579 Blast hits to 579 proteins in 214 species: Archae - 54; Bacteria - 8; Metazoa - 200; Fungi - 95; Plants - 83; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT1G65500 | AT1G65500.1 | TCACACGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65486.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G68110 | AT1G68110.1 | CACACGTGTG | epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: clathrin coat; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT1G25240.1); Has 192 Blast hits to 186 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 4; Plants - 177; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G68110.1 | TCACACGTG | epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: clathrin coat; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT1G25240.1); Has 192 Blast hits to 186 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 4; Plants - 177; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G70700 | AT1G70700.1 | AACACGTGTGA | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT1G70700.2 | AACACGTGTGA | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT1G72650 | AT1G72650.1 | CACACGTGAC | Arabidopsis thaliana myb family transcription factor (At1g72650) |
| AT1G72650.2 | CACACGTGAC | Arabidopsis thaliana myb family transcription factor (At1g72650) |
| AT1G73080 | AT1G73080.1 | ACCACGTGTG | Encodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks. |
| AT1G77090 | AT1G77090.1 | TGACACGTGTGA | thylakoid lumenal 29.8 kDa protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid lumen, chloroplast stroma, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 20 kDa protein (TAIR:AT3G56650.1); Has 139 Blast hits to 139 proteins in 25 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT1G78140 | AT1G78140.1 | CTGCCACGTGTGA | methyltransferase-related; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: methyltransferase-related (TAIR:AT2G41040.1); Has 3459 Blast hits to 3458 proteins in 853 species: Archae - 143; Bacteria - 2524; Metazoa - 44; Fungi - 102; Plants - 117; Viruses - 0; Other Eukaryotes - 529 (source: NCBI BLink). |
| AT1G78150 | AT1G78150.1 | TCACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G78150.2 | TCACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G80110 | AT1G80110.1 | AGACACGTGTG | ARABIDOPSIS THALIANA PHLOEM PROTEIN 2-B11 (ATPP2-B11); FUNCTIONS IN: carbohydrate binding; LOCATED IN: nucleus; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-B12 (Phloem protein 2-B12); carbohydrate binding (TAIR:AT5G24560.1); Has 276 Blast hits to 269 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 276; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G01320 | AT2G01320.1 | CACACGTGTCT | ABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink). |
| AT2G01320.2 | CACACGTGTCT | ABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink). |
| AT2G01320.3 | CACACGTGTCT | ABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink). |
| AT2G01320.4 | CACACGTGTCT | ABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink). |
| AT2G01980 | AT2G01980.1 | TACACGTGTG | Encodes a plasma membrane-localized Na+/H+ antiporter SOS1. Functions in the extrusion of toxic Na+ from cells and is essential for plant salt tolerance. Has 12 predicted transmembrane domains in the N-terminal region and a long cytoplasmic tail of approx. 700 aa at the C-terminal side. SOS1 interacts through its predicted cytoplasmic tail with RCD1, a regulator of oxidative-stress responses, suggesting that SOS1 might function in oxidative-stress tolerance. |
| AT2G17350 | AT2G17350.1 | CACACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 93 Blast hits to 67 proteins in 31 species: Archae - 0; Bacteria - 1; Metazoa - 16; Fungi - 13; Plants - 21; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G17360 | AT2G17360.1 | TCACACGTGTG | 40S ribosomal protein S4 (RPS4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). |
| AT2G17790 | AT2G17790.1 | GTACACGTGTGA | VPS35 HOMOLOG A (VPS35A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport, retrograde transport, endosome to Golgi; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated protein 35 (InterPro:IPR005378); BEST Arabidopsis thaliana protein match is: VPS35B (VPS35 HOMOLOG B) (TAIR:AT1G75850.1); Has 463 Blast hits to 387 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 144; Plants - 38; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT2G17870 | AT2G17870.1 | CACACGTGGT | cold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink). |
| AT2G20260 | AT2G20260.1 | TCACACGTGTCAT | Encodes subunit E of photosystem I. |
| AT2G20480 | AT2G20480.1 | GTCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 7 Blast hits to 7 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G20490 | AT2G20490.1 | TCACACGTGAC | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT2G20490.2 | TCACACGTGAC | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT2G30390 | AT2G30390.1 | GGACACGTGTG | Encodes one of two ferrochelatase genes in Arabidopsis. Ferrochelatase is the terminal enzyme of heme biosynthesis. FC-II is speculated to operate in photosynthetic cytochromes |
| AT2G32510 | AT2G32510.1 | ATCCACGTGTG | member of MEKK subfamily |
| AT2G34650 | AT2G34650.1 | TCACACGTGTCAT | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
| AT2G35620 | AT2G35620.1 | CACGTGTG | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. |
| AT2G37210 | AT2G37210.1 | TCACGTGTGA | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At5g11950. |
| AT2G38000 | AT2G38000.1 | TCACACGTGGCAAT | chaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT2G38130 | AT2G38130.1 | TGTCACGTGTG | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. |
| AT2G38130.2 | TGTCACGTGTG | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. |
| AT2G38140 | AT2G38140.1 | CACACGTGACA | plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete |
| AT2G38650 | AT2G38650.1 | CACACGTGTGA | GALACTURONOSYLTRANSFERASE 7 (GAUT7); FUNCTIONS IN: polygalacturonate 4-alpha-galacturonosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: GAUT4 (Galacturonosyltransferase 4); polygalacturonate 4-alpha-galacturonosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT5G47780.1); Has 882 Blast hits to 876 proteins in 179 species: Archae - 0; Bacteria - 255; Metazoa - 131; Fungi - 43; Plants - 430; Viruses - 2; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT2G38810 | AT2G38810.1 | GTACACGTGTG | Encodes HTA8, a histone H2A protein. |
| AT2G38810.2 | GTACACGTGTG | Encodes HTA8, a histone H2A protein. |
| AT2G38810.3 | GTACACGTGTG | Encodes HTA8, a histone H2A protein. |
| AT2G38820 | AT2G38820.1 | CACACGTGTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G38820.2 | CACACGTGTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G39450 | AT2G39450.1 | GTACACGTGTG | Encodes a Golgi-localized manganese transporter that is involved in Mn tolerance. When expressed into yeast cells, this gene confer Mn<sup>2+</sup> and Cu<sup>2+</sup> tolerance. |
| AT2G43945 | AT2G43945.1 | TCACACGTGTGA | unknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59870.1); Has 245 Blast hits to 245 proteins in 63 species: Archae - 0; Bacteria - 102; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT2G46020 | AT2G46020.1 | TCACACGTGTCT | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D. |
| AT2G46020.2 | TCACACGTGTCT | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D. |
| AT2G46110 | AT2G46110.1 | CACGTCATCTCACACGTGTG | Encodes a ketopentoate hydroxymethyltransferase that appears to localize to the mitochondria. This protein is expected to play a role in pantothenate (vitamin B5) biosynthesis. |
| AT2G47350 | AT2G47350.1 | CACACGTGTCT | PAPA-1-like family protein / zinc finger (HIT type) family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT1G56460.1); Has 2885 Blast hits to 2186 proteins in 266 species: Archae - 7; Bacteria - 140; Metazoa - 1186; Fungi - 340; Plants - 134; Viruses - 23; Other Eukaryotes - 1055 (source: NCBI BLink). |
| AT2G47350.2 | CACACGTGTCT | PAPA-1-like family protein / zinc finger (HIT type) family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT1G56460.1); Has 2885 Blast hits to 2186 proteins in 266 species: Archae - 7; Bacteria - 140; Metazoa - 1186; Fungi - 340; Plants - 134; Viruses - 23; Other Eukaryotes - 1055 (source: NCBI BLink). |
| AT2G47460 | AT2G47460.1 | CACACGTGTCAT | "MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. " The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. |
| AT3G04470 | AT3G04470.1 | TCACACGTGTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT1G04780.1); Has 842 Blast hits to 642 proteins in 95 species: Archae - 0; Bacteria - 6; Metazoa - 523; Fungi - 26; Plants - 165; Viruses - 4; Other Eukaryotes - 118 (source: NCBI BLink). |
| AT3G06760 | AT3G06760.1 | TACACGTGTGA | INVOLVED IN: response to water deprivation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: HRB1 (HYPERSENSITIVE TO RED AND BLUE); protein binding (TAIR:AT5G49230.1). |
| AT3G06760.2 | TACACGTGTGA | INVOLVED IN: response to water deprivation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: HRB1 (HYPERSENSITIVE TO RED AND BLUE); protein binding (TAIR:AT5G49230.1). |
| AT3G06780 | AT3G06780.1 | TCACGTGTGA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 4026 Blast hits to 2251 proteins in 290 species: Archae - 2; Bacteria - 737; Metazoa - 1865; Fungi - 196; Plants - 741; Viruses - 43; Other Eukaryotes - 442 (source: NCBI BLink). |
| AT3G08500 | AT3G08500.1 | CACACGTGTG | Encodes a putative R2R3-type MYB transcription factor (MYB83). |
| AT3G10800 | AT3G10800.1 | CACACGTGTT | Encodes bZIP28, a putative membrane-tethered transcriptional factor. Up-regulated in response to heat; a bZIP28 null mutant has a heat-sensitive phenotype. bZIP28 has a similar domain structure to the mammalian ATF6 protein involved in the unfolded protein response (UPR), and shares a bZIP domain, transmembrane domain, and a canonical S1P cleavage site. The bZIP28 seems to be glycosylated in vivo. bZIP28 does not appear to be transcriptionally up-regulated by UPR-inducing tunicamycin (TM) treatment. But, the expression level of three UPR-related genes is reduced in TM-treated zip28 mutants relative to wild type seedlings. And several UPR genes are transcriptionally upregulated when an N-terminal portion of the bZIP28 protein is expressed using the 35S promoter. A myc:bZIP28 fusion protein appears to be cleaved, likely at a canonical S2 cleavage site, following a TM treatment or a DTT stress-inducing treatment, but not a salt treatment. A portion of the mGFP:bZIP28 protein present in root cells appears to translocate from the cytoplasm and ER to the nucleus following TM treatment. |
| AT3G11150 | AT3G11150.1 | CGCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 262 Blast hits to 262 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 262; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G12010 | AT3G12010.1 | CACACGTGTCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: Colon cancer-associated Mic1-like (InterPro:IPR009755); Has 126 Blast hits to 120 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT3G12012 | AT3G12012.1 | CACACGTGTCG | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF20 represents a conserved upstream opening reading frame relative to major ORF AT3G12010.1 |
| AT3G12300 | AT3G12300.1 | CACACGTGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF667 (InterPro:IPR007714); Has 280 Blast hits to 278 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 2; Plants - 29; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT3G14590 | AT3G14590.1 | TCACACGTGTCTGACACGT | NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT3G14590.2 | TCACACGTGTCTGACACGT | NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT3G15640 | AT3G15640.1 | TGACACGTGTG | cytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity, metal ion binding; LOCATED IN: mitochondrial envelope, mitochondrion, chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT1G80230.1); Has 343 Blast hits to 343 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 63; Plants - 56; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G15640.2 | TGACACGTGTG | cytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity, metal ion binding; LOCATED IN: mitochondrial envelope, mitochondrion, chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT1G80230.1); Has 343 Blast hits to 343 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 63; Plants - 56; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G15940 | AT3G15940.1 | AACACGTGTGA | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G52420.1); Has 6481 Blast hits to 6467 proteins in 933 species: Archae - 176; Bacteria - 3946; Metazoa - 40; Fungi - 36; Plants - 110; Viruses - 0; Other Eukaryotes - 2173 (source: NCBI BLink). |
| AT3G18710 | AT3G18710.1 | TCACACGTGTA | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G30300 | AT3G30300.1 | TCACACGTGTCT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: EDA30 (embryo sac development arrest 30) (TAIR:AT3G03810.1); Has 512 Blast hits to 417 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 512; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G45730 | AT3G45730.1 | TCACACGTGTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G45740 | AT3G45740.1 | TCACACGTGTCT | hydrolase family protein / HAD-superfamily protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIA, CECR5 (InterPro:IPR006353), HAD-superfamily hydrolase, subfamily IIA (InterPro:IPR006357); Has 367 Blast hits to 355 proteins in 105 species: Archae - 5; Bacteria - 2; Metazoa - 102; Fungi - 197; Plants - 14; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT3G49810 | AT3G49810.1 | CACGTGTG | U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: U-box domain-containing protein (TAIR:AT5G65920.1); Has 1192 Blast hits to 1152 proteins in 72 species: Archae - 0; Bacteria - 14; Metazoa - 67; Fungi - 24; Plants - 1010; Viruses - 3; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT3G52220 | AT3G52220.1 | ACGACACGTGTCACACGTGTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 9607 Blast hits to 4937 proteins in 278 species: Archae - 10; Bacteria - 152; Metazoa - 4787; Fungi - 1223; Plants - 656; Viruses - 23; Other Eukaryotes - 2756 (source: NCBI BLink). |
| AT3G52230 | AT3G52230.1 | AGACACGTGTGACACGTGTCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast outer membrane, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52850 | AT3G52850.1 | CACACGTGTT | Encodes the Vacuolar Sorting Receptor-1 (VSR-1)/Epidermal Growth Factor Receptor-like protein1(VSR-1/ATELP1). Binds vacuolar targeting signals. Involved in sorting seed storage proteins into vacuoles. |
| AT3G53450 | AT3G53450.1 | TCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP00730 (InterPro:IPR005269); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37210.1); Has 3213 Blast hits to 3211 proteins in 782 species: Archae - 6; Bacteria - 1871; Metazoa - 10; Fungi - 79; Plants - 196; Viruses - 0; Other Eukaryotes - 1051 (source: NCBI BLink). |
| AT3G54110 | AT3G54110.1 | CACACGTG | Member of Uncoupling protein PUMP2 family. Encodes a mitochondrial uncoupling protein AtUCP1 involved in maintain the redox poise of the mitochondrial electron transport chain to facilitate photosynthetic metabolism. Disruption of UCP1 results in a photosynthetic phenotype. Specifically there is a restriction in photorespiration with a decrease in the rate of oxidation of photorespiratory glycine in the mitochondrion. This change leads to an associated reduced photosynthetic carbon assimilation rate. |
| AT3G57860 | AT3G57860.1 | CACACGTGTGA | Plant specific-protein of unknown function, shares 62% homology with UVI4 at aa level. |
| AT3G59500 | AT3G59500.1 | TCACACGTGCG | integral membrane HRF1 family protein; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT1G30890.2); Has 337 Blast hits to 337 proteins in 127 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 90; Plants - 38; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT3G59770 | AT3G59770.1 | TCACACGTGTCGT | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
| AT3G60340 | AT3G60340.1 | CACACGTG | palmitoyl protein thioesterase family protein; FUNCTIONS IN: palmitoyl-(protein) hydrolase activity; INVOLVED IN: protein modification process; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Palmitoyl protein thioesterase (InterPro:IPR002472); BEST Arabidopsis thaliana protein match is: palmitoyl protein thioesterase family protein (TAIR:AT5G47330.1); Has 463 Blast hits to 459 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 274; Fungi - 66; Plants - 80; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT3G60340.2 | CACACGTG | palmitoyl protein thioesterase family protein; FUNCTIONS IN: palmitoyl-(protein) hydrolase activity; INVOLVED IN: protein modification process; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Palmitoyl protein thioesterase (InterPro:IPR002472); BEST Arabidopsis thaliana protein match is: palmitoyl protein thioesterase family protein (TAIR:AT5G47330.1); Has 463 Blast hits to 459 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 274; Fungi - 66; Plants - 80; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT3G61580 | AT3G61580.1 | CACACGTGA | delta-8 sphingolipid desaturase (SLD1); FUNCTIONS IN: oxidoreductase activity, sphingolipid delta-4 desaturase activity; INVOLVED IN: lipid metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid desaturase, type 1 (InterPro:IPR005804), Cytochrome b5 (InterPro:IPR001199), Fatty acid/sphingolipid desaturase (InterPro:IPR012171); BEST Arabidopsis thaliana protein match is: delta-8 sphingolipid desaturase, putative (TAIR:AT2G46210.1); Has 3797 Blast hits to 3723 proteins in 598 species: Archae - 1; Bacteria - 564; Metazoa - 826; Fungi - 1045; Plants - 622; Viruses - 2; Other Eukaryotes - 737 (source: NCBI BLink). |
| AT3G63210 | AT3G63210.1 | CACACGTGGCG | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
| AT4G01026 | AT4G01026.1 | CACACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01360.1); Has 184 Blast hits to 184 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 180; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02020 | AT4G02020.1 | TCACACGTGTG | Encodes a polycomb group protein. Forms part of a large protein complex that can include VRN2 (VERNALIZATION 2), VIN3 (VERNALIZATION INSENSITIVE 3) and polycomb group proteins FERTILIZATION INDEPENDENT ENDOSPERM (FIE) and CURLY LEAF (CLF). The complex has a role in establishing FLC (FLOWERING LOCUS C) repression during vernalization. Performs a partially redundant role to MEA in controlling seed initiation by helping to suppress central cell nucleus endosperm proliferation within the FG. |
| AT4G11910 | AT4G11910.1 | TTAAAGCCACGTGTGA | INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: NYE1 (NON-YELLOWING 1) (TAIR:AT4G22920.1); Has 130 Blast hits to 128 proteins in 45 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G11980 | AT4G11980.1 | TACACGTGTGA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 14 (ATNUDX14); FUNCTIONS IN: hydrolase activity, ADP-sugar diphosphatase activity, ADP-ribose pyrophosphohydrolase activity, ADP-glucose pyrophosphohydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 845 Blast hits to 845 proteins in 388 species: Archae - 4; Bacteria - 636; Metazoa - 8; Fungi - 51; Plants - 17; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). |
| AT4G13590 | AT4G13590.1 | CACACGTGGC | unknown protein; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0016 (InterPro:IPR001727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64150.1); Has 1187 Blast hits to 1119 proteins in 441 species: Archae - 10; Bacteria - 644; Metazoa - 134; Fungi - 113; Plants - 109; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT4G14270 | AT4G14270.1 | TCACACGTGGC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT4G14270.2 | TCACACGTGGC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT4G14300 | AT4G14300.1 | CACGTGTG | heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative (TAIR:AT2G33410.1); Has 82956 Blast hits to 37358 proteins in 1472 species: Archae - 56; Bacteria - 18252; Metazoa - 33610; Fungi - 7047; Plants - 9752; Viruses - 546; Other Eukaryotes - 13693 (source: NCBI BLink). |
| AT4G14490 | AT4G14490.1 | TCACGTGTG | forkhead-associated domain-containing protein / FHA domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (InterPro:IPR000253); BEST Arabidopsis thaliana protein match is: forkhead-associated domain-containing protein / FHA domain-containing protein / AT hook motif-containing protein (TAIR:AT3G02400.1); Has 1075 Blast hits to 1048 proteins in 243 species: Archae - 14; Bacteria - 671; Metazoa - 68; Fungi - 54; Plants - 81; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink). |
| AT4G16660 | AT4G16660.1 | TCACACGTGGAA | heat shock protein 70, putative / HSP70, putative; FUNCTIONS IN: ATP binding; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: heat shock protein, putative (TAIR:AT1G11660.1); Has 18930 Blast hits to 18189 proteins in 2776 species: Archae - 119; Bacteria - 6307; Metazoa - 3629; Fungi - 1186; Plants - 638; Viruses - 97; Other Eukaryotes - 6954 (source: NCBI BLink). |
| AT4G17560 | AT4G17560.1 | TCACACGTGCG | ribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857), Ribosomal protein L19, conserved site (InterPro:IPR018257); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT5G47190.1); Has 5332 Blast hits to 5332 proteins in 1492 species: Archae - 0; Bacteria - 2922; Metazoa - 96; Fungi - 46; Plants - 97; Viruses - 0; Other Eukaryotes - 2171 (source: NCBI BLink). |
| AT4G17615 | AT4G17615.1 | TCACACGTGCG | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation. |
| AT4G17940 | AT4G17940.1 | CACACGTGTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G20190.1); Has 378 Blast hits to 251 proteins in 46 species: Archae - 2; Bacteria - 99; Metazoa - 16; Fungi - 0; Plants - 207; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
| AT4G18810 | AT4G18810.1 | CCCACGTGTG | binding / catalytic/ transcription repressor; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NADH:ubiquinone oxidoreductase complex I intermediate-associated protein 30 (InterPro:IPR013857), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: HCF173 (high chlorophyll fluorescence phenotype 173); binding / catalytic/ transcription repressor (TAIR:AT1G16720.1); Has 1715 Blast hits to 1540 proteins in 261 species: Archae - 12; Bacteria - 728; Metazoa - 8; Fungi - 25; Plants - 255; Viruses - 0; Other Eukaryotes - 687 (source: NCBI BLink). |
| AT4G19010 | AT4G19010.1 | TGTCACGTGTCACACGTGA | 4-coumarate--CoA ligase family protein / 4-coumaroyl-CoA synthase family protein; FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: OPCL1 (OPC-8:0 COA LIGASE1); 4-coumarate-CoA ligase (TAIR:AT1G20510.1); Has 54010 Blast hits to 49832 proteins in 2259 species: Archae - 568; Bacteria - 29489; Metazoa - 2956; Fungi - 3088; Plants - 1314; Viruses - 1; Other Eukaryotes - 16594 (source: NCBI BLink). |
| AT4G19020 | AT4G19020.1 | TCACGTGTGACACGTGACA | chromomethylase 2 (CMT2); FUNCTIONS IN: chromatin binding, DNA binding; INVOLVED IN: chromatin assembly or disassembly, DNA methylation; LOCATED IN: chromatin, nucleus; CONTAINS InterPro DOMAIN/s: C-5 cytosine-specific DNA methylase (InterPro:IPR001525), Bromo adjacent region (InterPro:IPR001025), Chromo domain-like (InterPro:IPR016197), Chromo domain (InterPro:IPR000953); BEST Arabidopsis thaliana protein match is: CMT3 (chromomethylase 3); DNA (cytosine-5-)-methyltransferase (TAIR:AT1G69770.1); Has 3518 Blast hits to 3037 proteins in 617 species: Archae - 106; Bacteria - 1441; Metazoa - 665; Fungi - 229; Plants - 237; Viruses - 21; Other Eukaryotes - 819 (source: NCBI BLink). |
| AT4G20440 | AT4G20440.1 | TACACGTGTG | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink). |
| AT4G20440.2 | TACACGTGTG | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink). |
| AT4G20440.3 | TACACGTGTG | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink). |
| AT4G20440.4 | TACACGTGTG | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink). |
| AT4G21020 | AT4G21020.1 | CACACGTGTCA | late embryogenesis abundant domain-containing protein / LEA domain-containing protein; INVOLVED IN: embryonic development ending in seed dormancy; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT5G44310.2); Has 20047 Blast hits to 9539 proteins in 1087 species: Archae - 69; Bacteria - 4524; Metazoa - 4955; Fungi - 1474; Plants - 1716; Viruses - 139; Other Eukaryotes - 7170 (source: NCBI BLink). |
| AT4G21300 | AT4G21300.1 | CACGTGTG | pentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G03580.1); Has 19749 Blast hits to 5268 proteins in 182 species: Archae - 1; Bacteria - 4; Metazoa - 89; Fungi - 126; Plants - 19072; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink). |
| AT4G22320 | AT4G22320.1 | CACACGTGTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55210.1); Has 9841 Blast hits to 5053 proteins in 396 species: Archae - 29; Bacteria - 556; Metazoa - 3805; Fungi - 755; Plants - 226; Viruses - 158; Other Eukaryotes - 4312 (source: NCBI BLink). |
| AT4G23050 | AT4G23050.1 | CACACGTGGCGT | protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein kinase activity, signal transducer activity; INVOLVED IN: signal transduction, protein amino acid phosphorylation, regulation of transcription, DNA-dependent; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: PAC motif (InterPro:IPR001610), Protein kinase, ATP binding site (InterPro:IPR017441), PAS fold (InterPro:IPR013767), PAS (InterPro:IPR000014), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G06620.1); Has 90573 Blast hits to 89352 proteins in 3493 species: Archae - 99; Bacteria - 7298; Metazoa - 40742; Fungi - 7306; Plants - 18732; Viruses - 471; Other Eukaryotes - 15925 (source: NCBI BLink). |
| AT4G23050.2 | CACACGTGGCGT | protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein kinase activity, signal transducer activity; INVOLVED IN: signal transduction, protein amino acid phosphorylation, regulation of transcription, DNA-dependent; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: PAC motif (InterPro:IPR001610), Protein kinase, ATP binding site (InterPro:IPR017441), PAS fold (InterPro:IPR013767), PAS (InterPro:IPR000014), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G06620.1); Has 90573 Blast hits to 89352 proteins in 3493 species: Archae - 99; Bacteria - 7298; Metazoa - 40742; Fungi - 7306; Plants - 18732; Viruses - 471; Other Eukaryotes - 15925 (source: NCBI BLink). |
| AT4G23910 | AT4G23910.1 | ATTAGGCCACGTGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10970.4); Has 29 Blast hits to 29 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G24000 | AT4G24000.1 | TCACACGTGTCT | encodes a protein similar to cellulose synthase |
| AT4G24240 | AT4G24240.1 | TCACACGTGTA | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
| AT4G24960 | AT4G24960.1 | TCGCCACGTGTG | Homologous to a eukaryote specific ABA- and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. |
| AT4G24960.2 | TCGCCACGTGTG | Homologous to a eukaryote specific ABA- and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. |
| AT4G28660 | AT4G28660.1 | GTGCCACGTGTG | Similar to PsbW subunit of photosystem II. |
| AT4G32400 | AT4G32400.1 | TCACACGTGA | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
| AT4G33520 | AT4G33520.1 | CACACGTGGAC | Encodes a putative metal-transporting P-type ATPase. |
| AT4G33520.2 | CACACGTGGAC | Encodes a putative metal-transporting P-type ATPase. |
| AT4G33520.3 | CACACGTGGAC | Encodes a putative metal-transporting P-type ATPase. |
| AT4G33890 | AT4G33890.1 | CGCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14850.1); Has 70 Blast hits to 68 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G33890.2 | CGCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14850.1); Has 70 Blast hits to 68 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 66; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G34380 | AT4G34380.1 | ACCACGTGTGA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G18950.1); Has 22712 Blast hits to 12420 proteins in 443 species: Archae - 16; Bacteria - 3157; Metazoa - 9533; Fungi - 4921; Plants - 1930; Viruses - 0; Other Eukaryotes - 3155 (source: NCBI BLink). |
| AT4G36780 | AT4G36780.1 | CACACGTGTG | transcription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: BES1 (BRI1-EMS-SUPPRESSOR 1); protein binding / transcription factor/ transcription regulator (TAIR:AT1G19350.6); Has 110 Blast hits to 110 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G36780.1 | TCACACGTGTA | transcription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: BES1 (BRI1-EMS-SUPPRESSOR 1); protein binding / transcription factor/ transcription regulator (TAIR:AT1G19350.6); Has 110 Blast hits to 110 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38740 | AT4G38740.1 | GGACACGTGTG | Encodes cytosolic cyclophilin ROC1. |
| AT4G39800 | AT4G39800.1 | CACACGTGTG | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT4G39800.1 | TCACGTGTGA | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G03204 | AT5G03204.1 | TCACACGTGTT | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT5G03210 | AT5G03210.1 | TCACACGTGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G04920 | AT5G04920.1 | TGACACGTGTG | vacuolar protein sorting 36 family protein / VPS36 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT II complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EAP30 (InterPro:IPR007286); Has 235 Blast hits to 233 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 113; Fungi - 67; Plants - 24; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT5G05480 | AT5G05480.1 | CACACGTGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14920.1); Has 138 Blast hits to 128 proteins in 53 species: Archae - 12; Bacteria - 7; Metazoa - 0; Fungi - 66; Plants - 50; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G05987 | AT5G05987.1 | CACACGTGTG | PRENYLATED RAB ACCEPTOR 1.A2 (PRA1.A2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A3 (PRENYLATED RAB ACCEPTOR 1.A3) (TAIR:AT3G11397.1); Has 209 Blast hits to 209 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 6; Plants - 67; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G07730 | AT5G07730.1 | ACGGCACGTGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61360.1); Has 12 Blast hits to 12 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 1; Plants - 7; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G07730.1 | CACGTGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61360.1); Has 12 Blast hits to 12 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 1; Plants - 7; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G08680 | AT5G08680.1 | TCACACGTGTCG | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT5G11630 | AT5G11630.1 | CACACGTGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.1); Has 60 Blast hits to 60 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G11630.2 | CACACGTGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.1); Has 60 Blast hits to 60 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G14500 | AT5G14500.1 | CACACGTGGCAG | aldose 1-epimerase family protein; FUNCTIONS IN: carbohydrate binding, isomerase activity, aldose 1-epimerase activity, catalytic activity; INVOLVED IN: galactose metabolic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Aldose 1-epimerase (InterPro:IPR008183), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718); BEST Arabidopsis thaliana protein match is: aldose 1-epimerase family protein (TAIR:AT3G01590.2); Has 1231 Blast hits to 1228 proteins in 482 species: Archae - 0; Bacteria - 792; Metazoa - 38; Fungi - 86; Plants - 139; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink). |
| AT5G14640 | AT5G14640.1 | ACGCCACGTGTG | SHAGGY-LIKE KINASE 13 (SK13); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK11; protein kinase/ protein serine/threonine kinase (TAIR:AT5G26751.1); Has 77993 Blast hits to 77020 proteins in 2468 species: Archae - 36; Bacteria - 6200; Metazoa - 32731; Fungi - 7832; Plants - 15487; Viruses - 357; Other Eukaryotes - 15350 (source: NCBI BLink). |
| AT5G15600 | AT5G15600.1 | CACACGTG | SPIRAL1-LIKE4 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT5G15800 | AT5G15800.1 | TCACACGTG | Encodes a MADS box transcription factor involved flower and ovule development. Functionally redundant with SEP2 and SEP3. |
| AT5G15800.2 | TCACACGTG | Encodes a MADS box transcription factor involved flower and ovule development. Functionally redundant with SEP2 and SEP3. |
| AT5G16750 | AT5G16750.1 | GTACACGTGTG | Encodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development. |
| AT5G16760 | AT5G16760.1 | CACACGTGTAC | Encodes a inositol 1,3,4-trisphosphate 5/6-kinase. |
| AT5G19120 | AT5G19120.1 | TCACACGTG | aspartic-type endopeptidase; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: extracellular dermal glycoprotein, putative / EDGP, putative (TAIR:AT1G03220.1); Has 701 Blast hits to 699 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 699; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G20070 | AT5G20070.1 | TACACGTGTG | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 19 (ATNUDX19); FUNCTIONS IN: hydrolase activity, metal ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc ribbon, NADH pyrophosphatase (InterPro:IPR015376), NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 3177 Blast hits to 3177 proteins in 828 species: Archae - 24; Bacteria - 2086; Metazoa - 110; Fungi - 80; Plants - 32; Viruses - 2; Other Eukaryotes - 843 (source: NCBI BLink). |
| AT5G20070.1 | TGACACGTGTGA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 19 (ATNUDX19); FUNCTIONS IN: hydrolase activity, metal ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc ribbon, NADH pyrophosphatase (InterPro:IPR015376), NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 3177 Blast hits to 3177 proteins in 828 species: Archae - 24; Bacteria - 2086; Metazoa - 110; Fungi - 80; Plants - 32; Viruses - 2; Other Eukaryotes - 843 (source: NCBI BLink). |
| AT5G22580 | AT5G22580.1 | CACACGTGTAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Stress responsive alpha-beta barrel (InterPro:IPR013097), Dimeric alpha-beta barrel (InterPro:IPR011008); BEST Arabidopsis thaliana protein match is: HS1 (HEAT STABLE PROTEIN 1) (TAIR:AT3G17210.1); Has 231 Blast hits to 231 proteins in 57 species: Archae - 0; Bacteria - 89; Metazoa - 0; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT5G24830 | AT5G24830.1 | TCACACGTG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G12300.1); Has 22335 Blast hits to 5701 proteins in 178 species: Archae - 6; Bacteria - 14; Metazoa - 418; Fungi - 405; Plants - 20611; Viruses - 0; Other Eukaryotes - 881 (source: NCBI BLink). |
| AT5G26680 | AT5G26680.1 | CACACGTGTT | endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink). |
| AT5G26680.2 | CACACGTGTT | endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink). |
| AT5G38480 | AT5G38480.1 | CACACGTGTCA | general regulatory factor, a 14-3-3 gene |
| AT5G38480.2 | CACACGTGTCA | general regulatory factor, a 14-3-3 gene |
| AT5G42990 | AT5G42990.1 | TAAACGACACGTGTGA | ubiquitin-conjugating enzyme 18 (UBC18); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ATUBC2-1; ubiquitin-protein ligase (TAIR:AT1G45050.1); Has 6584 Blast hits to 6583 proteins in 298 species: Archae - 0; Bacteria - 0; Metazoa - 3149; Fungi - 1325; Plants - 1019; Viruses - 16; Other Eukaryotes - 1075 (source: NCBI BLink). |
| AT5G42990.1 | TCACGTGTG | ubiquitin-conjugating enzyme 18 (UBC18); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ATUBC2-1; ubiquitin-protein ligase (TAIR:AT1G45050.1); Has 6584 Blast hits to 6583 proteins in 298 species: Archae - 0; Bacteria - 0; Metazoa - 3149; Fungi - 1325; Plants - 1019; Viruses - 16; Other Eukaryotes - 1075 (source: NCBI BLink). |
| AT5G46420 | AT5G46420.1 | TCACACGTGA | 16S rRNA processing protein RimM family; FUNCTIONS IN: ribosome binding, nucleotidyltransferase activity; INVOLVED IN: metabolic process, rRNA processing, ribosome biogenesis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRC-barrel (InterPro:IPR007903), UTP--glucose-1-phosphate uridylyltransferase (InterPro:IPR002618), RimM protein (InterPro:IPR002676), 16S rRNA processing protein RimM (InterPro:IPR011961); BEST Arabidopsis thaliana protein match is: UDP-N-acetylglucosamine pyrophosphorylase-related (TAIR:AT1G31070.2); Has 3596 Blast hits to 3596 proteins in 1249 species: Archae - 0; Bacteria - 2487; Metazoa - 162; Fungi - 86; Plants - 59; Viruses - 0; Other Eukaryotes - 802 (source: NCBI BLink). |
| AT5G47000 | AT5G47000.1 | TCACGTGTG | peroxidase, putative; FUNCTIONS IN: xylan 1,4-beta-xylosidase activity, peroxidase activity; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT4G17690.1); Has 3176 Blast hits to 3160 proteins in 242 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 301; Plants - 2821; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT5G47530 | AT5G47530.1 | GGACACGTGTGA | auxin-responsive protein, putative; INVOLVED IN: multicellular organismal development; LOCATED IN: membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, C globular stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17280.1); Has 390 Blast hits to 390 proteins in 77 species: Archae - 0; Bacteria - 8; Metazoa - 85; Fungi - 33; Plants - 251; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT5G49230 | AT5G49230.1 | TCACACGTGTGA | Identified in a screen for mutations hypersensitive to red and blue light. Mutants have shorter hypocotyls. Encodes a nuclear localized protein with similarity to drought induced proteins. Contains a ZZ zinc finger domain which is thought to mediate protein-protein interactions.May be involved in red and blue light signal transduction. |
| AT5G52990 | AT5G52990.1 | CACGTGTGA | vesicle-associated membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27840.1); Has 89 Blast hits to 89 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G57300 | AT5G57300.1 | AACACGTGTGA | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57300.2 | AACACGTGTGA | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57785 | AT5G57785.1 | TCACACGTGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G59570 | AT5G59570.1 | CACACGTGTCAC | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PCL1 (PHYTOCLOCK 1); DNA binding / transcription factor (TAIR:AT3G46640.2); Has 892 Blast hits to 892 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 875; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G59910 | AT5G59910.1 | GTCACGTGTGA | HTB4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT2G28720.1); Has 3079 Blast hits to 2919 proteins in 300 species: Archae - 0; Bacteria - 69; Metazoa - 1920; Fungi - 175; Plants - 374; Viruses - 0; Other Eukaryotes - 541 (source: NCBI BLink). |
| AT5G61410 | AT5G61410.1 | TCACACGTGGCGG | Arabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA |
| AT5G61410.2 | TCACACGTGGCGG | Arabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA |
| AT5G62910 | AT5G62910.1 | TCACACGTG | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G48070.2); Has 652 Blast hits to 540 proteins in 136 species: Archae - 0; Bacteria - 6; Metazoa - 264; Fungi - 175; Plants - 76; Viruses - 4; Other Eukaryotes - 127 (source: NCBI BLink). |
| AT5G65280 | AT5G65280.1 | AACACGTGTG | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor. Loss of function mutations in GCL1 show no ABA response defects based on assays of seed germination and seedling development.GCL1 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT5G65300 | AT5G65300.1 | TCACACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| ATMG01370 | ATMG01370.1 | GCCCTTATGGGCTGGGCCACACACGTG | hypothetical protein |