| Locus | Gene model | Sequence | Description |
| AT1G01260 | AT1G01260.1 | GACCCGGTTTAA | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ATAIB (ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR); DNA binding / transcription factor (TAIR:AT2G46510.1); Has 2098 Blast hits to 1892 proteins in 178 species: Archae - 0; Bacteria - 2; Metazoa - 163; Fungi - 52; Plants - 1843; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT1G01260.2 | GACCCGGTTTAA | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ATAIB (ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR); DNA binding / transcription factor (TAIR:AT2G46510.1); Has 2098 Blast hits to 1892 proteins in 178 species: Archae - 0; Bacteria - 2; Metazoa - 163; Fungi - 52; Plants - 1843; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT1G10430 | AT1G10430.1 | AAACCGAACCTTAACCGGGTC | Encodes one of two isoforms of the catalytic subunit of protein phosphatase 2A. |
| AT1G10500 | AT1G10500.1 | ACCGGGTCGA | Involved in chloroplast Fe-S cluster assembly. Located in the chloroplast stroma. Expressed preferentially in green tissues. |
| AT1G10510 | AT1G10510.1 | TCGACCCGGT | embryo defective 2004 (emb2004); INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: RANGAP1 (RAN GTPASE ACTIVATING PROTEIN 1); RAN GTPase activator/ protein binding (TAIR:AT3G63130.1); Has 17671 Blast hits to 5431 proteins in 235 species: Archae - 0; Bacteria - 744; Metazoa - 8658; Fungi - 337; Plants - 531; Viruses - 0; Other Eukaryotes - 7401 (source: NCBI BLink). |
| AT1G12770 | AT1G12770.1 | GACCCGGTT | embryo defective 1586 (EMB1586); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; INVOLVED IN: embryonic development ending in seed dormancy; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative (TAIR:AT3G19760.1); Has 25549 Blast hits to 25020 proteins in 1695 species: Archae - 449; Bacteria - 9955; Metazoa - 4809; Fungi - 3113; Plants - 1343; Viruses - 12; Other Eukaryotes - 5868 (source: NCBI BLink). |
| AT1G14230 | AT1G14230.1 | AACCCGACCCGGT | nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1089 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 22; Metazoa - 528; Fungi - 214; Plants - 198; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink). |
| AT1G16020 | AT1G16020.1 | AACCCGACCCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G16020.2 | AACCCGACCCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G17130 | AT1G17130.1 | CGACCCGGTTAA | cell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink). |
| AT1G17130.2 | CGACCCGGTTAA | cell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink). |
| AT1G18150 | AT1G18150.1 | CAAACCGGGTCG | ATMPK8, |
| AT1G18150.2 | CAAACCGGGTCG | ATMPK8, |
| AT1G19830 | AT1G19830.1 | GACCCGGT | auxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT1G75580.1); Has 651 Blast hits to 640 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 650; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G22040 | AT1G22040.1 | GACCCGGTTTAC | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G55270.1); Has 8530 Blast hits to 4244 proteins in 221 species: Archae - 18; Bacteria - 386; Metazoa - 6931; Fungi - 33; Plants - 777; Viruses - 68; Other Eukaryotes - 317 (source: NCBI BLink). |
| AT1G24706 | AT1G24706.1 | CTTAACCGGACCCGGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 25479 Blast hits to 15950 proteins in 654 species: Archae - 12; Bacteria - 897; Metazoa - 14432; Fungi - 3233; Plants - 1262; Viruses - 124; Other Eukaryotes - 5519 (source: NCBI BLink). |
| AT1G29700 | AT1G29700.1 | GTAAACCGGGTCCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 321 Blast hits to 321 proteins in 85 species: Archae - 0; Bacteria - 142; Metazoa - 0; Fungi - 2; Plants - 20; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT1G33490 | AT1G33490.1 | ACCGGGTCGACCCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G33500 | AT1G33500.1 | CTAAACCGGGTCGACCCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink). |
| AT1G33520 | AT1G33520.1 | GACCCGGTTTGG | Has single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4; |
| AT1G56440 | AT1G56440.1 | GGGCCTGACCCGGT | serine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink). |
| AT1G56450 | AT1G56450.1 | ACCGGGTCAGGCCC | 20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds |
| AT1G70980 | AT1G70980.1 | ACCGGGTC | SYNC3; FUNCTIONS IN: in 6 functions; INVOLVED IN: asparaginyl-tRNA aminoacylation, aspartyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Asparaginyl-tRNA synthetase, class IIb (InterPro:IPR004522), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: SYNC1; ATP binding / aminoacyl-tRNA ligase/ asparagine-tRNA ligase/ aspartate-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT5G56680.1); Has 10794 Blast hits to 8026 proteins in 1494 species: Archae - 413; Bacteria - 7139; Metazoa - 538; Fungi - 533; Plants - 135; Viruses - 0; Other Eukaryotes - 2036 (source: NCBI BLink). |
| AT1G71750 | AT1G71750.1 | ACCGGGTC | phosphoribosyltransferase family protein; FUNCTIONS IN: transferase activity, hypoxanthine phosphoribosyltransferase activity; INVOLVED IN: nucleoside metabolic process, purine ribonucleoside salvage; LOCATED IN: cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Hypoxanthine phosphoribosyl transferase (InterPro:IPR005904); Has 3239 Blast hits to 3239 proteins in 1142 species: Archae - 35; Bacteria - 2162; Metazoa - 212; Fungi - 2; Plants - 19; Viruses - 0; Other Eukaryotes - 809 (source: NCBI BLink). |
| AT1G74230 | AT1G74230.1 | TTTAACCGGGTC | encodes a glycine-rich RNA binding protein. |
| AT1G76630 | AT1G76630.1 | CAAACCGGGTC | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: SEC (secret agent); transferase, transferring glycosyl groups (TAIR:AT3G04240.1); Has 5924 Blast hits to 3836 proteins in 536 species: Archae - 384; Bacteria - 2298; Metazoa - 901; Fungi - 281; Plants - 131; Viruses - 0; Other Eukaryotes - 1929 (source: NCBI BLink). |
| AT2G01470 | AT2G01470.1 | TGAACCGGGTC | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER. |
| AT2G01860 | AT2G01860.1 | ACCGGGTCGG | EMBRYO DEFECTIVE 975 (EMB975); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G38420.1); Has 2464 Blast hits to 1412 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 8; Plants - 2414; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G17200 | AT2G17200.1 | TTTGACCCGACCCGGT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17190.1); Has 11842 Blast hits to 6071 proteins in 720 species: Archae - 6; Bacteria - 2895; Metazoa - 3957; Fungi - 1228; Plants - 1619; Viruses - 162; Other Eukaryotes - 1975 (source: NCBI BLink). |
| AT2G30000 | AT2G30000.1 | ACCGGGTC | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G07170.2); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G32235 | AT2G32235.1 | ACCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 4; Metazoa - 10; Fungi - 9; Plants - 3; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G33220 | AT2G33220.1 | TTTGACCCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, plastid, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: MEE4 (maternal effect embryo arrest 4) (TAIR:AT1G04630.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT2G35410 | AT2G35410.1 | GACCCGGTTCA | 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT4G09040.2); Has 19540 Blast hits to 13531 proteins in 594 species: Archae - 12; Bacteria - 1397; Metazoa - 10397; Fungi - 2454; Plants - 3010; Viruses - 0; Other Eukaryotes - 2270 (source: NCBI BLink). |
| AT2G38000 | AT2G38000.1 | GACCCGGTT | chaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT3G02820 | AT3G02820.1 | ATAAACCGGGTCAAA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: cell cycle, replication fork protection, response to DNA damage stimulus; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Replication fork protection component Swi3 (InterPro:IPR012923), Zinc finger, CCHC-type (InterPro:IPR001878); Has 310 Blast hits to 310 proteins in 102 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 74; Plants - 50; Viruses - 2; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT3G03600 | AT3G03600.1 | CGACCCGGTTTG | Structural component of the mitochondrial ribosome small subunit |
| AT3G03610 | AT3G03610.1 | CAAACCGGGTCG | phagocytosis and cell motility protein ELMO1-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: phagocytosis; LOCATED IN: cytoskeleton; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Engulfment and cell motility, ELMO (InterPro:IPR006816); BEST Arabidopsis thaliana protein match is: phagocytosis and cell motility protein ELMO1-related (TAIR:AT1G03620.1); Has 636 Blast hits to 636 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 422; Fungi - 25; Plants - 106; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT3G04830 | AT3G04830.1 | GACCCGGTTAT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT3G04830.2 | GACCCGGTTAT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT3G06240 | AT3G06240.1 | GACCCGGTTTG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G23880.1); Has 1173 Blast hits to 1161 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1171; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G18165 | AT3G18165.1 | TAGGGCCCTAGAAGCCCAAGGCCCAATAAAACCGGGTCGG | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
| AT3G18250 | AT3G18250.1 | ATAAACCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, LP.02 two leaves visible, petal differentiation and expansion stage; Has 20 Blast hits to 20 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G27416 | AT3G27416.1 | GACCCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 389 Blast hits to 362 proteins in 51 species: Archae - 0; Bacteria - 37; Metazoa - 207; Fungi - 19; Plants - 4; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink). |
| AT3G47500 | AT3G47500.1 | AACCCGACAACCCGACCCGGT | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT3G48730 | AT3G48730.1 | ACCGGGTC | glutamate-1-semialdehyde 2,1-aminomutase 2 (GSA2); FUNCTIONS IN: glutamate-1-semialdehyde 2,1-aminomutase activity, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase class-III (InterPro:IPR005814), Tetrapyrrole biosynthesis, glutamate-1-semialdehyde aminotransferase (InterPro:IPR004639), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GSA1 (GLUTAMATE-1-SEMIALDEHYDE-2,1-AMINOMUTASE); glutamate-1-semialdehyde 2,1-aminomutase (TAIR:AT5G63570.1); Has 22952 Blast hits to 22949 proteins in 1683 species: Archae - 419; Bacteria - 12643; Metazoa - 453; Fungi - 515; Plants - 232; Viruses - 10; Other Eukaryotes - 8680 (source: NCBI BLink). |
| AT3G51840 | AT3G51840.1 | CCGACTTAACCGGGTCGG | Encodes a short-chain acyl-CoA oxidase, which catalyzes the first step of peroxisomal fatty acid beta-oxidation during early, post-germinative growth in oilseed species. Null mutants virtually lack short-chain acyl-CoA and are resistant to 2,4-dichlorophenoxybutyric acid, which is converted to the herbicide and auxin analogue 2,4-dichlorophenoxyacetic acid by beta-oxidation. Despite the almost complete loss of short-chain activity, lipid catabolism and seedling growth and establishment was unaltered in the acx4 mutant. However, double mutants in acx3acx4 (acx3 encodes medium chain acyl CoA oxidase) were not viable and arrested during embryogenesis. |
| AT3G58460 | AT3G58460.1 | CCGACCCGGTT | ARABIDOPSIS RHOMBOID-LIKE PROTEIN 15 (ATRBL15); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Peptidase S54, rhomboid (InterPro:IPR002610), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ATRBL14 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 14); zinc ion binding (TAIR:AT3G17611.1); Has 1918 Blast hits to 1918 proteins in 675 species: Archae - 50; Bacteria - 1104; Metazoa - 148; Fungi - 104; Plants - 162; Viruses - 3; Other Eukaryotes - 347 (source: NCBI BLink). |
| AT3G62000 | AT3G62000.1 | TTTGACCCGACCCGGTT | O-methyltransferase family 3 protein; FUNCTIONS IN: O-methyltransferase activity; LOCATED IN: cytosol; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: O-methyltransferase family 3 protein (TAIR:AT3G61990.1); Has 3642 Blast hits to 3640 proteins in 775 species: Archae - 31; Bacteria - 1513; Metazoa - 236; Fungi - 112; Plants - 446; Viruses - 0; Other Eukaryotes - 1304 (source: NCBI BLink). |
| AT4G00090 | AT4G00090.1 | AACCCGACCCGACCCGGTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink). |
| AT4G01090 | AT4G01090.1 | GACCCGGT | extra-large G-protein-related; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: extra-large G-protein-related (TAIR:AT1G01440.1); Has 1293 Blast hits to 1199 proteins in 189 species: Archae - 0; Bacteria - 45; Metazoa - 453; Fungi - 263; Plants - 305; Viruses - 2; Other Eukaryotes - 225 (source: NCBI BLink). |
| AT4G03390 | AT4G03390.1 | CGGTTTAGACCCGGTTAA | STRUBBELIG-RECEPTOR FAMILY 3 (SRF3); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: SRF1 (strubbelig receptor family 1); kinase (TAIR:AT2G20850.1); Has 104562 Blast hits to 78934 proteins in 2893 species: Archae - 52; Bacteria - 7276; Metazoa - 35203; Fungi - 5374; Plants - 43078; Viruses - 296; Other Eukaryotes - 13283 (source: NCBI BLink). |
| AT4G12005 | AT4G12005.1 | GACCCGGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18880 | AT4G18880.1 | ACCGGGTC | member of Heat Stress Transcription Factor (Hsf) family |
| AT4G34090 | AT4G34090.1 | GGCCTAACCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G34090.2 | GGCCTAACCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G34100 | AT4G34100.1 | GACCCGGTTAGGCC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT4G34100.2 | GACCCGGTTAGGCC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT5G03630 | AT5G03630.1 | ACCGGGTCAAA | ATMDAR2; FUNCTIONS IN: monodehydroascorbate reductase (NADH) activity; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), FAD/NAD-linked reductase, dimerisation (InterPro:IPR016156); BEST Arabidopsis thaliana protein match is: MDHAR (MONODEHYDROASCORBATE REDUCTASE); monodehydroascorbate reductase (NADH) (TAIR:AT3G09940.1); Has 15548 Blast hits to 15528 proteins in 1711 species: Archae - 317; Bacteria - 10742; Metazoa - 673; Fungi - 378; Plants - 332; Viruses - 0; Other Eukaryotes - 3106 (source: NCBI BLink). |
| AT5G04750 | AT5G04750.1 | ACCCGACCCGGT | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G04750.2 | ACCCGACCCGGT | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G06410 | AT5G06410.1 | GACCCGGTTGACCCGGT | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: protein binding, heat shock protein binding, chaperone binding; INVOLVED IN: protein folding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock cognate protein B, C-terminal oligomerisation (InterPro:IPR009073), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Co-chaperone Hsc20 (InterPro:IPR004640); Has 1232 Blast hits to 1232 proteins in 576 species: Archae - 0; Bacteria - 899; Metazoa - 98; Fungi - 66; Plants - 20; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). |
| AT5G07120 | AT5G07120.1 | CGGACCCGGT | SORTING NEXIN 2b (SNX2b); FUNCTIONS IN: protein binding, phosphoinositide binding; INVOLVED IN: intracellular signaling cascade, cell communication; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2a (SORTING NEXIN 2a); phosphoinositide binding (TAIR:AT5G58440.1); Has 1877 Blast hits to 1867 proteins in 192 species: Archae - 11; Bacteria - 46; Metazoa - 1184; Fungi - 380; Plants - 83; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink). |
| AT5G13680 | AT5G13680.1 | ATAAACCGGGTC | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. |
| AT5G13690 | AT5G13690.1 | GACCCGGTTTAT | alpha-N-acetylglucosaminidase family / NAGLU family; FUNCTIONS IN: alpha-N-acetylglucosaminidase activity; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-N-acetylglucosaminidase (InterPro:IPR007781); Has 254 Blast hits to 246 proteins in 93 species: Archae - 0; Bacteria - 100; Metazoa - 87; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT5G16220 | AT5G16220.1 | ACCCGACCCGGTT | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT2G01190.1); Has 247 Blast hits to 246 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 12; Plants - 175; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G38880 | AT5G38880.1 | TCGACCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 379 Blast hits to 327 proteins in 103 species: Archae - 4; Bacteria - 53; Metazoa - 188; Fungi - 37; Plants - 26; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT5G45620 | AT5G45620.1 | GCCGGTTCAACCGGTTCACCGGGTC | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G45620.2 | GCCGGTTCAACCGGTTCACCGGGTC | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G46840 | AT5G46840.2 | AACCCGACCCGGT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink). |
| AT5G54960 | AT5G54960.1 | CGAACCGGGTCGG | pyruvate decarboxylase-2 |
| AT5G61790 | AT5G61790.1 | ACCGGGTC | calnexin 1 (CNX1); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: protein folding; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: calnexin, putative (TAIR:AT5G07340.1); Has 1344 Blast hits to 1252 proteins in 297 species: Archae - 2; Bacteria - 61; Metazoa - 623; Fungi - 137; Plants - 191; Viruses - 36; Other Eukaryotes - 294 (source: NCBI BLink). |
| AT5G62200 | AT5G62200.1 | TTTGACCCGGT | embryo-specific protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976), Embryo-specific 3 (InterPro:IPR010417); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41475.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G63400 | AT5G63400.1 | AACCCGACCCGGT | encodes a protein similar to adenylate kinase. |
| AT5G63400.2 | AACCCGACCCGGT | encodes a protein similar to adenylate kinase. |
| ATCG00750 | ATCG00750.1 | ACCGGGTC | 30S chloroplast ribosomal protein S11 |
| ATCG00760 | ATCG00760.1 | ACCGGGTC | encodes a chloroplast ribosomal protein L36, a constituent of the large subunit of the ribosomal complex |