| Locus | Gene model | Sequence | Description |
| AT1G02260 | AT1G02260.1 | GACGTGGCAG | transmembrane protein, putative; FUNCTIONS IN: citrate transmembrane transporter activity, transporter activity; INVOLVED IN: citrate transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Divalent ion symporter (InterPro:IPR004680); Has 5612 Blast hits to 3945 proteins in 1017 species: Archae - 185; Bacteria - 4274; Metazoa - 237; Fungi - 56; Plants - 87; Viruses - 2; Other Eukaryotes - 771 (source: NCBI BLink). |
| AT1G05570 | AT1G05570.1 | GATGACGTGGCAG | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
| AT1G06680 | AT1G06680.1 | CTGCCACGTGGCAC | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. |
| AT1G06680.2 | CTGCCACGTGGCAC | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. |
| AT1G07135 | AT1G07135.1 | CGTGGCAG | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; Has 21223 Blast hits to 7917 proteins in 705 species: Archae - 21; Bacteria - 6537; Metazoa - 6020; Fungi - 1304; Plants - 4042; Viruses - 441; Other Eukaryotes - 2858 (source: NCBI BLink). |
| AT1G07510 | AT1G07510.1 | CTGCCACGTG | encodes an FtsH protease that is localized to the mitochondrion |
| AT1G07645 | AT1G07645.1 | CACGTGGCAG | DESSICATION-INDUCED 1VOC SUPERFAMILY PROTEIN (ATDSI-1VOC); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to abiotic stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Has 442 Blast hits to 442 proteins in 189 species: Archae - 0; Bacteria - 413; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G08880 | AT1G08880.1 | CTGCCACGT | Encodes HTA5, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10–20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin. |
| AT1G10220 | AT1G10220.2 | TACGTGGCAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: ZCF37 (TAIR:AT1G59590.1); Has 30 Blast hits to 30 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G10960 | AT1G10960.1 | ACGCCACGTGGCAG | FERREDOXIN 1 (ATFD1); FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: FED A; 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G60950.1); Has 5347 Blast hits to 5345 proteins in 903 species: Archae - 63; Bacteria - 3637; Metazoa - 8; Fungi - 9; Plants - 447; Viruses - 2; Other Eukaryotes - 1181 (source: NCBI BLink). |
| AT1G11480 | AT1G11480.1 | CTGCCACGTA | eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT1G11480.2 | CTGCCACGTA | eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT1G16610 | AT1G16610.1 | CTGCCACGTA | SR spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP. |
| AT1G16610.2 | CTGCCACGTA | SR spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP. |
| AT1G21770 | AT1G21770.1 | CTGCCACGTGTAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: H3/H4 histone acetyltransferase (TAIR:AT1G77540.1); Has 221 Blast hits to 221 proteins in 107 species: Archae - 4; Bacteria - 182; Metazoa - 4; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G21780 | AT1G21780.1 | GTACACGTGGCAG | BTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B. |
| AT1G21780.2 | GTACACGTGGCAG | BTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B. |
| AT1G28540 | AT1G28540.1 | CTGCCACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G30520 | AT1G30520.1 | CTGCCACGTCATC | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT1G31480 | AT1G31480.1 | CTACGTGGCAG | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
| AT1G32170 | AT1G32170.1 | CGTGGCAG | xyloglucan endotransglycosylase-related protein (XTR4) |
| AT1G35720 | AT1G35720.1 | AACACGTGGCAG | Encodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion. |
| AT1G43670 | AT1G43670.1 | CTGCCACGTGTCAT | fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative; FUNCTIONS IN: fructose 1,6-bisphosphate 1-phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: carbohydrate metabolic process, fructose metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase/Fructose-1,6-bisphosphatase (InterPro:IPR017955), Fructose-1,6-bisphosphatase (InterPro:IPR000146); BEST Arabidopsis thaliana protein match is: fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative (TAIR:AT3G54050.1); Has 2339 Blast hits to 2334 proteins in 798 species: Archae - 22; Bacteria - 1225; Metazoa - 341; Fungi - 107; Plants - 205; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink). |
| AT1G52220 | AT1G52220.1 | CTGCCACGTGGCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G52220.2 | CTGCCACGTGGCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G52220.3 | CTGCCACGTGGCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G52230 | AT1G52230.1 | TCGCCACGTGGCAG | PHOTOSYSTEM I SUBUNIT H2 (PSAH2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem I reaction centre subunit VI (InterPro:IPR004928); BEST Arabidopsis thaliana protein match is: PSAH-1 (photosystem I subunit H-1) (TAIR:AT3G16140.1); Has 72 Blast hits to 72 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G52510 | AT1G52510.2 | CTGCCACG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G12830.1); Has 3440 Blast hits to 3440 proteins in 614 species: Archae - 16; Bacteria - 2126; Metazoa - 96; Fungi - 67; Plants - 194; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink). |
| AT1G53670 | AT1G53670.1 | CGACGTGGCAG | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). |
| AT1G53670.2 | CGACGTGGCAG | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). |
| AT1G55520 | AT1G55520.1 | AACACGTGGCAG | TATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex. |
| AT1G55520.2 | AACACGTGGCAG | TATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex. |
| AT1G67700 | AT1G67700.1 | AACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G67700.2 | AACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G67960 | AT1G67960.1 | AACACGTGGCAG | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT1G74730 | AT1G74730.1 | CTGACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1118 (InterPro:IPR009500); Has 41 Blast hits to 41 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G75350 | AT1G75350.1 | CTGCCACG | embryo defective 2184 (emb2184); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31 (InterPro:IPR002150); Has 673 Blast hits to 673 proteins in 229 species: Archae - 0; Bacteria - 418; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink). |
| AT1G76020 | AT1G76020.1 | CTGCCACGTCAC | INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20225.1); Has 118 Blast hits to 116 proteins in 37 species: Archae - 0; Bacteria - 51; Metazoa - 12; Fungi - 4; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT1G76030 | AT1G76030.1 | GTGACGTGGCAG | Encodes the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus. |
| AT1G77450 | AT1G77450.1 | CTGCCACGTGTCC | Arabidopsis NAC domain containing protein 32 (anac032); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ATAF1; transcription activator/ transcription factor (TAIR:AT1G01720.1); Has 1620 Blast hits to 1617 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1620; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G78140 | AT1G78140.1 | CTGCCACGTGTGA | methyltransferase-related; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: methyltransferase-related (TAIR:AT2G41040.1); Has 3459 Blast hits to 3458 proteins in 853 species: Archae - 143; Bacteria - 2524; Metazoa - 44; Fungi - 102; Plants - 117; Viruses - 0; Other Eukaryotes - 529 (source: NCBI BLink). |
| AT1G78150 | AT1G78150.1 | TCACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G78150.2 | TCACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G79440 | AT1G79440.1 | CGGTTAAACTGCCACGTGGAT | Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004). |
| AT2G06520 | AT2G06520.1 | CTGCCACGTA | Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX. |
| AT2G07718 | AT2G07718.1 | CGTGGCAG | cytochrome b, putative; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; INVOLVED IN: respiratory electron transport chain; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Cytochrome b/b6 (InterPro:IPR016175), Cytochrome b/b6, N-terminal (InterPro:IPR005797); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATMG00590.1); Has 22999 Blast hits to 22998 proteins in 3944 species: Archae - 0; Bacteria - 28; Metazoa - 21735; Fungi - 0; Plants - 517; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink). |
| AT2G13360 | AT2G13360.1 | CTGCCACG | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
| AT2G13360.2 | CTGCCACG | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
| AT2G15970 | AT2G15970.1 | CTGCCACGTGGCGT | encodes an alpha form of a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. |
| AT2G21410 | AT2G21410.1 | TACGTGGCAG | Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. |
| AT2G22470 | AT2G22470.1 | AACACGTGGCAG | Encodes arabinogalactan-protein (AGP2). |
| AT2G26770 | AT2G26770.1 | CGTGGCAG | plectin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40820.1); Has 3952 Blast hits to 3377 proteins in 399 species: Archae - 59; Bacteria - 505; Metazoa - 1940; Fungi - 261; Plants - 178; Viruses - 13; Other Eukaryotes - 996 (source: NCBI BLink). |
| AT2G26770.2 | CGTGGCAG | plectin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40820.1); Has 3952 Blast hits to 3377 proteins in 399 species: Archae - 59; Bacteria - 505; Metazoa - 1940; Fungi - 261; Plants - 178; Viruses - 13; Other Eukaryotes - 996 (source: NCBI BLink). |
| AT2G30170 | AT2G30170.2 | CGTGGCAG | catalytic; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932); BEST Arabidopsis thaliana protein match is: 5-azacytidine resistance protein -related (TAIR:AT5G66720.2); Has 637 Blast hits to 627 proteins in 184 species: Archae - 2; Bacteria - 71; Metazoa - 153; Fungi - 150; Plants - 121; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink). |
| AT2G34250 | AT2G34250.1 | GACGTGGCAG | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). |
| AT2G34250.2 | GACGTGGCAG | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). |
| AT2G36390 | AT2G36390.1 | TACACGTGGCAG | Encodes a starch branching enzyme (EC.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout plant tissues. |
| AT2G36895 | AT2G36895.1 | CACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G36895.2 | CACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G38290 | AT2G38290.2 | CGTGGCAG | encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively. |
| AT2G40490 | AT2G40490.1 | ATGACGTGGCAG | HEME2; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME1; uroporphyrinogen decarboxylase (TAIR:AT3G14930.2); Has 5539 Blast hits to 5539 proteins in 1187 species: Archae - 101; Bacteria - 2315; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2763 (source: NCBI BLink). |
| AT2G46910 | AT2G46910.1 | CTGCCACGTA | plastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 169 Blast hits to 169 proteins in 57 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G03590 | AT3G03590.1 | ACGTCGTCACGTGGCAG | SWIB complex BAF60b domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121); BEST Arabidopsis thaliana protein match is: SWIB complex BAF60b domain-containing protein (TAIR:AT2G35605.1); Has 852 Blast hits to 809 proteins in 169 species: Archae - 0; Bacteria - 136; Metazoa - 165; Fungi - 132; Plants - 207; Viruses - 8; Other Eukaryotes - 204 (source: NCBI BLink). |
| AT3G04040 | AT3G04040.1 | TAATTACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1); Has 32 Blast hits to 32 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06110 | AT3G06110.1 | CGTGGCAG | Encodes a nuclear-localized MAP kinase phosphatase. Plants with reduced levels of MKP2 transcripts are hypersensitive to ozone and ozone-mediated activation of MPK3 and MPK6 is prolonged in these plants. |
| AT3G06110.2 | CGTGGCAG | Encodes a nuclear-localized MAP kinase phosphatase. Plants with reduced levels of MKP2 transcripts are hypersensitive to ozone and ozone-mediated activation of MPK3 and MPK6 is prolonged in these plants. |
| AT3G06570 | AT3G06570.1 | CTGCCACGTA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT5G51250.1); Has 541 Blast hits to 526 proteins in 21 species: Archae - 0; Bacteria - 5; Metazoa - 6; Fungi - 0; Plants - 528; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G10410 | AT3G10410.1 | CTGCCACGTGTAC | serine carboxypeptidase-like 49 (scpl49); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl48 (serine carboxypeptidase-like 48); serine-type carboxypeptidase (TAIR:AT3G45010.1); Has 2453 Blast hits to 2354 proteins in 260 species: Archae - 0; Bacteria - 98; Metazoa - 602; Fungi - 570; Plants - 872; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink). |
| AT3G11397 | AT3G11397.1 | CTGCCACGTCATC | PRENYLATED RAB ACCEPTOR 1.A3 (PRA1.A3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum, membrane; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A2 (PRENYLATED RAB ACCEPTOR 1.A2) (TAIR:AT5G05987.1); Has 234 Blast hits to 234 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 155; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G12210 | AT3G12210.1 | CTGCCACGTGGCTTTAT | sequence-specific DNA binding; FUNCTIONS IN: sequence-specific DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583); Has 163 Blast hits to 163 proteins in 72 species: Archae - 1; Bacteria - 0; Metazoa - 86; Fungi - 51; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G12210.2 | CTGCCACGTGGCTTTAT | sequence-specific DNA binding; FUNCTIONS IN: sequence-specific DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583); Has 163 Blast hits to 163 proteins in 72 species: Archae - 1; Bacteria - 0; Metazoa - 86; Fungi - 51; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G13700 | AT3G13700.1 | GACGTGGCAG | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G13700.2 | GACGTGGCAG | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G13710 | AT3G13710.1 | GACGTGGCAG | PRENYLATED RAB ACCEPTOR 1.F4 (PRA1.F4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA8 (TAIR:AT3G13720.1); Has 294 Blast hits to 294 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 30; Plants - 172; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT3G15090 | AT3G15090.1 | CTGCCACGTC | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 20659 Blast hits to 20565 proteins in 1484 species: Archae - 253; Bacteria - 11042; Metazoa - 1064; Fungi - 2188; Plants - 463; Viruses - 0; Other Eukaryotes - 5649 (source: NCBI BLink). |
| AT3G19580 | AT3G19580.1 | CTGCCACG | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild dessication. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT3G19580.2 | CTGCCACG | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild dessication. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT3G20910 | AT3G20910.1 | CACGTGGCAG | NUCLEAR FACTOR Y, SUBUNIT A9 (NF-YA9); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289), CCAAT-binding factor, conserved site (InterPro:IPR018362); BEST Arabidopsis thaliana protein match is: NF-YA1 (NUCLEAR FACTOR Y, SUBUNIT A1); transcription factor (TAIR:AT5G12840.4); Has 452 Blast hits to 452 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 97; Plants - 214; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT3G27690 | AT3G27690.1 | CTGCCACG | Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. |
| AT3G53970 | AT3G53970.1 | CTGCCACG | proteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT3G53970.2 | CTGCCACG | proteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT3G55660 | AT3G55660.1 | CTGACGTGGCAG | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G55800 | AT3G55800.1 | CTGCCACGTGTCAC | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. |
| AT3G61710 | AT3G61710.1 | CGTGGCAG | autophagy protein Apg6 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Autophagy protein 6 (InterPro:IPR007243); Has 715 Blast hits to 685 proteins in 216 species: Archae - 7; Bacteria - 81; Metazoa - 283; Fungi - 103; Plants - 61; Viruses - 12; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT3G61710.2 | CGTGGCAG | autophagy protein Apg6 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Autophagy protein 6 (InterPro:IPR007243); Has 715 Blast hits to 685 proteins in 216 species: Archae - 7; Bacteria - 81; Metazoa - 283; Fungi - 103; Plants - 61; Viruses - 12; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT3G61710.3 | CGTGGCAG | autophagy protein Apg6 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Autophagy protein 6 (InterPro:IPR007243); Has 715 Blast hits to 685 proteins in 216 species: Archae - 7; Bacteria - 81; Metazoa - 283; Fungi - 103; Plants - 61; Viruses - 12; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT3G63340 | AT3G63340.1 | CTGCCACGTAG | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C-related / PP2C-related (TAIR:AT3G63320.1); Has 3271 Blast hits to 3269 proteins in 215 species: Archae - 0; Bacteria - 0; Metazoa - 1075; Fungi - 380; Plants - 1004; Viruses - 5; Other Eukaryotes - 807 (source: NCBI BLink). |
| AT3G63520 | AT3G63520.1 | CGACGTGGCAGCGTTT | Encodes a protein with 9-<i>cis</i>-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-<i>trans</i>-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-<i>cis</i>-double or allenic bonds. |
| AT4G01550 | AT4G01550.1 | CTGCCACGTGTT | Arabidopsis NAC domain containing protein 69 (anac069); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NTM1 (NAC WITH TRANSMEMBRANE MOTIF1); transcription activator/ transcription factor (TAIR:AT4G01540.1); Has 1433 Blast hits to 1425 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1431; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G01550.2 | CTGCCACGTGTT | Arabidopsis NAC domain containing protein 69 (anac069); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NTM1 (NAC WITH TRANSMEMBRANE MOTIF1); transcription activator/ transcription factor (TAIR:AT4G01540.1); Has 1433 Blast hits to 1425 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1431; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G14315 | AT4G14315.1 | AACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G14713 | AT4G14713.1 | TACGTGGCAG | PPD1 (and its paralog, PPD2) encode plant-specific putative DNA-binding proteins. PPD1 and PPD2 are not found in grasses. Overexpression of PPD reduces lamina size by promoting the early arrest of dispersed meristematic cells DMC proliferation during leaf and silique development. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. The curvature of a deltappd leaf reflects the difference between excess growth of the lamina and a limitation to the extension capacity of its perimeter. |
| AT4G14713.2 | TACGTGGCAG | PPD1 (and its paralog, PPD2) encode plant-specific putative DNA-binding proteins. PPD1 and PPD2 are not found in grasses. Overexpression of PPD reduces lamina size by promoting the early arrest of dispersed meristematic cells DMC proliferation during leaf and silique development. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. The curvature of a deltappd leaf reflects the difference between excess growth of the lamina and a limitation to the extension capacity of its perimeter. |
| AT4G19710 | AT4G19710.1 | AGACACGTGGCAG | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT4G19710.2 | AGACACGTGGCAG | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT4G22240 | AT4G22240.1 | CACGTGGCAG | plastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: fruit, guard cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: FIB (FIBRILLIN); structural molecule (TAIR:AT4G04020.1); Has 296 Blast hits to 296 proteins in 63 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 219; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT4G23920 | AT4G23920.1 | CTGCCACGTAG | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in growth and cell wall carbohydrate biosynthesis. |
| AT4G24644 | AT4G24644.1 | CGTGGCAG | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT4G27410 | AT4G27410.1 | GACGTGGCAG | Encodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
| AT4G27410.2 | GACGTGGCAG | Encodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
| AT4G27410.3 | GACGTGGCAG | Encodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
| AT4G27440 | AT4G27440.1 | TAAACGACGACGTGGCAG | light-dependent NADPH:protochlorophyllide oxidoreductase B |
| AT4G27440.2 | TAAACGACGACGTGGCAG | light-dependent NADPH:protochlorophyllide oxidoreductase B |
| AT4G28750 | AT4G28750.1 | GTACACGTGGCAG | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
| AT4G32470 | AT4G32470.1 | CGTGGCAG | ubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, plasma membrane, plastid, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT5G25450.1); Has 264 Blast hits to 264 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 41; Plants - 51; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G32470.2 | CGTGGCAG | ubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, plasma membrane, plastid, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT5G25450.1); Has 264 Blast hits to 264 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 41; Plants - 51; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G35250 | AT4G35250.1 | CGTGGCAG | vestitone reductase-related; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: flavin reductase-related (TAIR:AT2G34460.1); Has 2853 Blast hits to 2853 proteins in 675 species: Archae - 20; Bacteria - 1994; Metazoa - 46; Fungi - 85; Plants - 272; Viruses - 0; Other Eukaryotes - 436 (source: NCBI BLink). |
| AT4G35850 | AT4G35850.1 | GTACACGTGGCAGCCACGTG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G02150.1); Has 6373 Blast hits to 2522 proteins in 127 species: Archae - 1; Bacteria - 4; Metazoa - 104; Fungi - 77; Plants - 5853; Viruses - 0; Other Eukaryotes - 334 (source: NCBI BLink). |
| AT4G38220 | AT4G38220.1 | CTGCCACGTGGC | aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative; FUNCTIONS IN: hydrolase activity, metallopeptidase activity, aminoacylase activity, protein dimerization activity; INVOLVED IN: amino acid metabolic process, proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ArgE/DapE/ACY1/CPG2/YscS, conserved site (InterPro:IPR001261), Peptidase M20 (InterPro:IPR002933), N-acyl-L-amino-acid amidohydrolase (InterPro:IPR010159), Peptidase M20, dimerisation (InterPro:IPR011650); BEST Arabidopsis thaliana protein match is: aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative (TAIR:AT1G44820.1); Has 4312 Blast hits to 4309 proteins in 975 species: Archae - 99; Bacteria - 2604; Metazoa - 360; Fungi - 186; Plants - 40; Viruses - 2; Other Eukaryotes - 1021 (source: NCBI BLink). |
| AT4G38220.2 | CTGCCACGTGGC | aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative; FUNCTIONS IN: hydrolase activity, metallopeptidase activity, aminoacylase activity, protein dimerization activity; INVOLVED IN: amino acid metabolic process, proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ArgE/DapE/ACY1/CPG2/YscS, conserved site (InterPro:IPR001261), Peptidase M20 (InterPro:IPR002933), N-acyl-L-amino-acid amidohydrolase (InterPro:IPR010159), Peptidase M20, dimerisation (InterPro:IPR011650); BEST Arabidopsis thaliana protein match is: aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative (TAIR:AT1G44820.1); Has 4312 Blast hits to 4309 proteins in 975 species: Archae - 99; Bacteria - 2604; Metazoa - 360; Fungi - 186; Plants - 40; Viruses - 2; Other Eukaryotes - 1021 (source: NCBI BLink). |
| AT4G38680 | AT4G38680.1 | GTGACGTGGCAG | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
| AT5G01760 | AT5G01760.1 | ACGTGGCAG | VHS domain-containing protein / GAT domain-containing protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT2G38410.1); Has 1339 Blast hits to 1327 proteins in 151 species: Archae - 0; Bacteria - 8; Metazoa - 746; Fungi - 331; Plants - 152; Viruses - 2; Other Eukaryotes - 100 (source: NCBI BLink). |
| AT5G01990 | AT5G01990.1 | CGCACGTGGCAG | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT1G71090.1); Has 303 Blast hits to 283 proteins in 69 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 152; Plants - 93; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT5G02790 | AT5G02790.1 | CTGCCACGTGTAC | In2-1 protein, putative; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: In2-1 protein, putative (TAIR:AT5G02780.1); Has 2811 Blast hits to 2774 proteins in 481 species: Archae - 2; Bacteria - 698; Metazoa - 592; Fungi - 122; Plants - 984; Viruses - 0; Other Eukaryotes - 413 (source: NCBI BLink). |
| AT5G03160 | AT5G03160.1 | TACGTGGCAG | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. |
| AT5G04090 | AT5G04090.2 | ATCCACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G10250.2); Has 131 Blast hits to 129 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 118; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G11090 | AT5G11090.1 | TGACACGTGGCAG | serine-rich protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G25280.2); Has 1617 Blast hits to 241 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 631; Fungi - 53; Plants - 88; Viruses - 0; Other Eukaryotes - 841 (source: NCBI BLink). |
| AT5G14500 | AT5G14500.1 | CACACGTGGCAG | aldose 1-epimerase family protein; FUNCTIONS IN: carbohydrate binding, isomerase activity, aldose 1-epimerase activity, catalytic activity; INVOLVED IN: galactose metabolic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Aldose 1-epimerase (InterPro:IPR008183), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718); BEST Arabidopsis thaliana protein match is: aldose 1-epimerase family protein (TAIR:AT3G01590.2); Has 1231 Blast hits to 1228 proteins in 482 species: Archae - 0; Bacteria - 792; Metazoa - 38; Fungi - 86; Plants - 139; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink). |
| AT5G15500 | AT5G15500.1 | CTGCCACGTCAC | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). |
| AT5G15500.2 | CTGCCACGTCAC | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). |
| AT5G24130 | AT5G24130.1 | CTGCCACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: leaf whorl, petal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 31 Blast hits to 31 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G25280 | AT5G25280.1 | TACGTGGCAG | serine-rich protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G11090.1); Has 1714 Blast hits to 295 proteins in 53 species: Archae - 0; Bacteria - 6; Metazoa - 724; Fungi - 65; Plants - 92; Viruses - 0; Other Eukaryotes - 827 (source: NCBI BLink). |
| AT5G25280.2 | TACGTGGCAG | serine-rich protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G11090.1); Has 1714 Blast hits to 295 proteins in 53 species: Archae - 0; Bacteria - 6; Metazoa - 724; Fungi - 65; Plants - 92; Viruses - 0; Other Eukaryotes - 827 (source: NCBI BLink). |
| AT5G38410 | AT5G38410.1 | CTGCCACGTGGCCTTAT | ribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G38410.2 | CTGCCACGTGGCCTTAT | ribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G38410.3 | CTGCCACGTGGCCTTAT | ribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G38420 | AT5G38420.1 | CTGCCACGTG | ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 8 components; EXPRESSED IN: 10 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1722 Blast hits to 1701 proteins in 391 species: Archae - 0; Bacteria - 341; Metazoa - 0; Fungi - 0; Plants - 874; Viruses - 0; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT5G44110 | AT5G44110.1 | GTGACGTGGCAG | Encodes a member of the NAP subfamily of ABC transporters. |
| AT5G44110.2 | GTGACGTGGCAG | Encodes a member of the NAP subfamily of ABC transporters. |
| AT5G44110.3 | GTGACGTGGCAG | Encodes a member of the NAP subfamily of ABC transporters. |
| AT5G47180 | AT5G47180.1 | CTGCCACGTCATC | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 746 Blast hits to 741 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 101; Plants - 222; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G47180.2 | CTGCCACGTCATC | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 746 Blast hits to 741 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 101; Plants - 222; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G50375 | AT5G50375.1 | CTGCCACGTCAGC | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2 |
| AT5G52300 | AT5G52300.1 | GACGTGGCAG | encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. |
| AT5G52300.2 | GACGTGGCAG | encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. |
| AT5G53050 | AT5G53050.1 | CTACGTGGCAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). |
| AT5G53050.2 | CTACGTGGCAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). |
| AT5G53050.3 | CTACGTGGCAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). |
| AT5G66400 | AT5G66400.1 | CTGCCACG | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. ABA- and drought-induced glycine-rice dehydrin protein. The ABA-induced expression of RAB18 was reduced following ACC application, indicating that ethylene inhibits the ABA signaling pathway. RAB18 is also expressed in response to the formation of the phospholipid diacylglycerol pyrophosphate. COR47 and RAB18 double overexpressor plants are cold tolerant. Expressed in guard cells. |
| AT5G66400.2 | CTGCCACG | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. ABA- and drought-induced glycine-rice dehydrin protein. The ABA-induced expression of RAB18 was reduced following ACC application, indicating that ethylene inhibits the ABA signaling pathway. RAB18 is also expressed in response to the formation of the phospholipid diacylglycerol pyrophosphate. COR47 and RAB18 double overexpressor plants are cold tolerant. Expressed in guard cells. |
| AT5G66580 | AT5G66580.1 | CTGCCACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50800.1); Has 132 Blast hits to 132 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 132; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |