| Locus | Gene model | Sequence | Description |
| AT1G01100 | AT1G01100.1 | ATTTGGGCTC | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G01100.2 | ATTTGGGCTC | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G01100.3 | ATTTGGGCTC | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G01100.4 | ATTTGGGCTC | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G02090 | AT1G02090.1 | GTTTGGGCTCA | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. |
| AT1G02090.2 | GTTTGGGCTCA | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. |
| AT1G02090.3 | GTTTGGGCTCA | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. |
| AT1G02100 | AT1G02100.1 | TGAGCCCAAAC | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT1G02100.2 | TGAGCCCAAAC | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT1G02100.3 | TGAGCCCAAAC | leucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT1G02150 | AT1G02150.1 | GGCCTTTGGGCTTTG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 5042 Blast hits to 2597 proteins in 108 species: Archae - 0; Bacteria - 2; Metazoa - 25; Fungi - 66; Plants - 4783; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink). |
| AT1G02405 | AT1G02405.1 | TTGGCCCAATAAAGCCCAAAT | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G70990.1); Has 43114 Blast hits to 16780 proteins in 897 species: Archae - 84; Bacteria - 5479; Metazoa - 15161; Fungi - 3897; Plants - 10314; Viruses - 1979; Other Eukaryotes - 6200 (source: NCBI BLink). |
| AT1G02410 | AT1G02410.1 | ATTTGGGCTTTATTGGGCCAA | cytochrome c oxidase assembly protein CtaG / Cox11 family; FUNCTIONS IN: copper ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein CtaG/Cox11 (InterPro:IPR007533); Has 2371 Blast hits to 2371 proteins in 476 species: Archae - 0; Bacteria - 724; Metazoa - 77; Fungi - 85; Plants - 18; Viruses - 0; Other Eukaryotes - 1467 (source: NCBI BLink). |
| AT1G02816 | AT1G02816.1 | AGCCCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G02816.1 | TAAGCCCAAAATTAGCCCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G04120 | AT1G04120.1 | AAAAAGCCCAAA | member of MRP subfamily |
| AT1G04270 | AT1G04270.1 | ATTTGGGCTTT | Encodes cytosolic ribosomal protein S15. |
| AT1G04270.2 | ATTTGGGCTTT | Encodes cytosolic ribosomal protein S15. |
| AT1G04950 | AT1G04950.1 | AGCCCAAAT | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G04950.2 | AGCCCAAAT | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G04950.3 | AGCCCAAAT | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G05805 | AT1G05805.1 | CAAAGCCCAAA | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT2G43140.1); Has 2445 Blast hits to 1444 proteins in 113 species: Archae - 2; Bacteria - 55; Metazoa - 778; Fungi - 140; Plants - 840; Viruses - 0; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT1G06060 | AT1G06060.1 | TTTTGGGCTTT | RanBPM-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61150.6); Has 659 Blast hits to 568 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 95; Plants - 120; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT1G06670 | AT1G06670.1 | TGGCCCAAAAGGCCCAAAAAGCCCAAAA | nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins |
| AT1G07110 | AT1G07110.1 | CAAGCCCAGCCCAAAA | Encodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase. |
| AT1G08220 | AT1G08220.1 | GAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: mitochondrial proton-transporting ATP synthase complex assembly; LOCATED IN: mitochondrial inner membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: ATPase assembly factor ATP10, mitochondria (InterPro:IPR007849); Has 100 Blast hits to 100 proteins in 48 species: Archae - 6; Bacteria - 0; Metazoa - 2; Fungi - 63; Plants - 15; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT1G08220.2 | GAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: mitochondrial proton-transporting ATP synthase complex assembly; LOCATED IN: mitochondrial inner membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: ATPase assembly factor ATP10, mitochondria (InterPro:IPR007849); Has 100 Blast hits to 100 proteins in 48 species: Archae - 6; Bacteria - 0; Metazoa - 2; Fungi - 63; Plants - 15; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT1G08350 | AT1G08350.1 | AAAAGCCCAAAC | endomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink). |
| AT1G08350.2 | AAAAGCCCAAAC | endomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink). |
| AT1G08360 | AT1G08360.1 | GTTTGGGCTTTT | 60S ribosomal protein L10A (RPL10aA); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: PGY1 (PIGGYBACK1); RNA binding / structural constituent of ribosome (TAIR:AT2G27530.2); Has 2469 Blast hits to 2469 proteins in 759 species: Archae - 186; Bacteria - 980; Metazoa - 354; Fungi - 122; Plants - 236; Viruses - 0; Other Eukaryotes - 591 (source: NCBI BLink). |
| AT1G08680 | AT1G08680.1 | TCAGCCCAAAAGCCCAC | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15. |
| AT1G08680.2 | TCAGCCCAAAAGCCCAC | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15. |
| AT1G08680.3 | TCAGCCCAAAAGCCCAC | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15. |
| AT1G08700 | AT1G08700.1 | TTTTGGGCTTTAA | Encodes a protein similar to animal presenilin whose expression is increased in response to potassium (K+) deprivation. |
| AT1G08710 | AT1G08710.1 | TTAAAGCCCAAAA | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G08710.2 | TTAAAGCCCAAAA | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G09130 | AT1G09130.1 | ATTTGGGCT | ATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink). |
| AT1G09130.2 | ATTTGGGCT | ATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink). |
| AT1G09320 | AT1G09320.1 | TAAGCCCAAAT | agenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT3G06520.1); Has 424 Blast hits to 179 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 3; Plants - 387; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G09590 | AT1G09590.1 | TCAGCCCAAAT | 60S ribosomal protein L21 (RPL21A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus, chloroplast; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21C) (TAIR:AT1G09690.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT1G10210 | AT1G10210.1 | TAAGCCCAAAT | Encodes ATMPK1. |
| AT1G10210.2 | TAAGCCCAAAT | Encodes ATMPK1. |
| AT1G10230 | AT1G10230.1 | GTTTGGGCTTTAT | ARABIDOPSIS SKP1-LIKE 18 (ASK18); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: ASK15 (ARABIDOPSIS SKP1-LIKE 15); protein binding / ubiquitin-protein ligase (TAIR:AT3G25650.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 473; Fungi - 107; Plants - 362; Viruses - 11; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT1G10890 | AT1G10890.1 | ATAAGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: petal, flower, leaf; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13340.1); Has 124670 Blast hits to 55842 proteins in 2000 species: Archae - 645; Bacteria - 12681; Metazoa - 61376; Fungi - 8660; Plants - 4059; Viruses - 685; Other Eukaryotes - 36564 (source: NCBI BLink). |
| AT1G10890.1 | ATAAGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: petal, flower, leaf; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13340.1); Has 124670 Blast hits to 55842 proteins in 2000 species: Archae - 645; Bacteria - 12681; Metazoa - 61376; Fungi - 8660; Plants - 4059; Viruses - 685; Other Eukaryotes - 36564 (source: NCBI BLink). |
| AT1G11180 | AT1G11180.1 | ATTTGGGCTTG | secretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: SC3 (SECRETORY CARRIER 3); transmembrane transporter (TAIR:AT1G61250.1); Has 511 Blast hits to 511 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 333; Fungi - 12; Plants - 121; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). |
| AT1G11270 | AT1G11270.1 | GAGCCCAAAA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: heat acclimation; EXPRESSED IN: embryo, pedicel; EXPRESSED DURING: 4 anthesis, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527); BEST Arabidopsis thaliana protein match is: S locus F-box-related / SLF-related (TAIR:AT2G34280.1); Has 674 Blast hits to 664 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 672; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G11270.2 | GAGCCCAAAA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: heat acclimation; EXPRESSED IN: embryo, pedicel; EXPRESSED DURING: 4 anthesis, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527); BEST Arabidopsis thaliana protein match is: S locus F-box-related / SLF-related (TAIR:AT2G34280.1); Has 674 Blast hits to 664 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 672; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G11270.3 | GAGCCCAAAA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: heat acclimation; EXPRESSED IN: embryo, pedicel; EXPRESSED DURING: 4 anthesis, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527); BEST Arabidopsis thaliana protein match is: S locus F-box-related / SLF-related (TAIR:AT2G34280.1); Has 674 Blast hits to 664 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 672; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G11750 | AT1G11750.1 | ATTTGGGCTTAT | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
| AT1G11750.1 | ATTTGGGCTTAT | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
| AT1G12000 | AT1G12000.1 | AAAAGCCCAAAA | pyrophosphate--fructose-6-phosphate 1-phosphotransferase beta subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, beta-subunit complex, cell wall, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: MEE51 (maternal effect embryo arrest 51); diphosphate-fructose-6-phosphate 1-phosphotransferase (TAIR:AT4G04040.1); Has 3585 Blast hits to 3515 proteins in 1006 species: Archae - 20; Bacteria - 2321; Metazoa - 52; Fungi - 90; Plants - 237; Viruses - 2; Other Eukaryotes - 863 (source: NCBI BLink). |
| AT1G13350 | AT1G13350.1 | AGCCCAAAAGGCCCAAAA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G53640.1); Has 80312 Blast hits to 71745 proteins in 1717 species: Archae - 65; Bacteria - 5105; Metazoa - 38133; Fungi - 9588; Plants - 8768; Viruses - 394; Other Eukaryotes - 18259 (source: NCBI BLink). |
| AT1G13380 | AT1G13380.1 | ATTTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27435.1); Has 150 Blast hits to 150 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G14450 | AT1G14450.1 | GAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02510.1); Has 41 Blast hits to 41 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G14560 | AT1G14560.1 | GTTTGGGCTAA | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Graves disease carrier protein (InterPro:IPR002167); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT4G26180.1); Has 18676 Blast hits to 9940 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 9411; Fungi - 4887; Plants - 2588; Viruses - 0; Other Eukaryotes - 1790 (source: NCBI BLink). |
| AT1G15060 | AT1G15060.1 | ATTTGGGCTTTT | LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP031088, alpha/beta hydrolase, At1g15070 (InterPro:IPR016969); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G73750.1); Has 120 Blast hits to 104 proteins in 29 species: Archae - 0; Bacteria - 61; Metazoa - 1; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT1G15930 | AT1G15930.1 | AGCCCAATTAATAGGCCCATTTAAGCCCAAAT | 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| AT1G15930.2 | AGCCCAATTAATAGGCCCATTTAAGCCCAAAT | 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| AT1G16410 | AT1G16410.1 | AAAAGCCCAAAC | member of CYP79F |
| AT1G16410.2 | AAAAGCCCAAAC | member of CYP79F |
| AT1G17130 | AT1G17130.1 | CAAGCCCAAAAAAGCCC | cell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink). |
| AT1G17130.2 | CAAGCCCAAAAAAGCCC | cell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink). |
| AT1G17780 | AT1G17780.1 | ATTTGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16575.1); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G17780.2 | ATTTGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16575.1); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G18485 | AT1G18485.1 | ATTTGGGCTGA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 16634 Blast hits to 4852 proteins in 154 species: Archae - 0; Bacteria - 2; Metazoa - 40; Fungi - 40; Plants - 16325; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink). |
| AT1G19480 | AT1G19480.1 | GTTTGGGCTTTAA | HhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink). |
| AT1G19480.1 | TTTTGGGCTTTA | HhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink). |
| AT1G19480.2 | GTTTGGGCTTTAA | HhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink). |
| AT1G19480.2 | TTTTGGGCTTTA | HhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink). |
| AT1G20110 | AT1G20110.1 | AAAAGCCCAAAA | zinc finger (FYVE type) family protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT3G14270.1); Has 25361 Blast hits to 16508 proteins in 676 species: Archae - 11; Bacteria - 1450; Metazoa - 10130; Fungi - 5149; Plants - 3412; Viruses - 575; Other Eukaryotes - 4634 (source: NCBI BLink). |
| AT1G20200 | AT1G20200.1 | TTTTGGGCTATT | EMBRYO DEFECTIVE 2719 (EMB2719); FUNCTIONS IN: enzyme regulator activity; INVOLVED IN: embryonic development ending in seed dormancy, ubiquitin-dependent protein catabolic process; LOCATED IN: plasma membrane, proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717), PCI/PINT associated module (InterPro:IPR013143), 26S proteasome regulatory subunit, C-terminal (InterPro:IPR013586); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit S3, putative (RPN3) (TAIR:AT1G75990.1); Has 549 Blast hits to 549 proteins in 160 species: Archae - 0; Bacteria - 0; Metazoa - 253; Fungi - 109; Plants - 101; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT1G20370 | AT1G20370.1 | ATTTGGGCTTAAAGGCCCAATAT | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G76120.1); Has 2413 Blast hits to 2196 proteins in 790 species: Archae - 88; Bacteria - 1223; Metazoa - 281; Fungi - 214; Plants - 87; Viruses - 0; Other Eukaryotes - 520 (source: NCBI BLink). |
| AT1G20510 | AT1G20510.1 | TTTGGGCTTTTA | OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink). |
| AT1G20510.2 | TTTGGGCTTTTA | OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink). |
| AT1G20575 | AT1G20575.1 | TTTTGGGCTTTATATAGGCCCATAT | dolichyl-phosphate beta-D-mannosyltransferase, putative / dolichol-phosphate mannosyltransferase, putative / mannose-P-dolichol synthase, putative; FUNCTIONS IN: elongation factor-2 kinase activity, dolichyl-phosphate beta-D-mannosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 2 (InterPro:IPR001173); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 2 protein (TAIR:AT2G39630.1); Has 14265 Blast hits to 14249 proteins in 1426 species: Archae - 553; Bacteria - 8256; Metazoa - 255; Fungi - 173; Plants - 49; Viruses - 21; Other Eukaryotes - 4958 (source: NCBI BLink). |
| AT1G20580 | AT1G20580.1 | ATATGGGCCTATATAAAGCCCAAAA | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SmD3 (snRNP core protein SmD3) (TAIR:AT1G76300.1); Has 893 Blast hits to 893 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 219; Plants - 128; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| AT1G21190 | AT1G21190.1 | GAGCCCAAAA | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G76860.1); Has 924 Blast hits to 924 proteins in 209 species: Archae - 244; Bacteria - 0; Metazoa - 275; Fungi - 141; Plants - 102; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT1G21200 | AT1G21200.1 | TTTTGGGCTC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76870.1); Has 251 Blast hits to 233 proteins in 48 species: Archae - 2; Bacteria - 24; Metazoa - 66; Fungi - 2; Plants - 75; Viruses - 9; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT1G21280 | AT1G21280.1 | TTTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 594 Blast hits to 592 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 590; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G23280 | AT1G23280.1 | TTTTGGGCTTTTT | MAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink). |
| AT1G23290 | AT1G23290.1 | AAAAAGCCCAAAA | Encodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20. |
| AT1G24040 | AT1G24040.1 | ATATGGGCCTTAAGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G24040.2 | ATATGGGCCTTAAGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G24050 | AT1G24050.1 | ATTTGGGCTTAAGGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70220.1); Has 153 Blast hits to 153 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 73; Fungi - 34; Plants - 30; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT1G24510 | AT1G24510.1 | ATAAGCCCAAAC | T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink). |
| AT1G24510.2 | ATAAGCCCAAAC | T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink). |
| AT1G24560 | AT1G24560.1 | CAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49055.1); Has 56279 Blast hits to 28796 proteins in 1542 species: Archae - 818; Bacteria - 6598; Metazoa - 28656; Fungi - 4716; Plants - 2272; Viruses - 181; Other Eukaryotes - 13038 (source: NCBI BLink). |
| AT1G25490 | AT1G25490.1 | AAAGCCCAAAATGGCCCAATTA | One of three genes encoding phosphoprotein phosphatase 2A regulatory subunit A; Recessive ethylene-response mutant EER1 displays increased ethylene sensitivity in the hypocotyl and stem |
| AT1G26460 | AT1G26460.1 | GTTTGGGCT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 4278 Blast hits to 2050 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 59; Plants - 4056; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink). |
| AT1G26630 | AT1G26630.1 | GTTTGGGCTGGGCTGA | Eukaryotic translation initiation factor 5A-2. Involved in programmed cell death triggered as a response to pseudomonas syringae infection. Loss of function mutants are more resistant to infection. |
| AT1G26630.2 | GTTTGGGCTGGGCTGA | Eukaryotic translation initiation factor 5A-2. Involved in programmed cell death triggered as a response to pseudomonas syringae infection. Loss of function mutants are more resistant to infection. |
| AT1G30380 | AT1G30380.1 | GAAGCCCAAAA | Encodes subunit K of photosystem I reaction center. |
| AT1G31340 | AT1G31340.1 | AGCCCAAAA | Encodes a ubiquitin-related protein that is conjugated to target proteins by neddylation. It has been shown to be conjugated to the cullin AtCUL1. The RUB-conjugation pathway has been implicated in in auxin response. |
| AT1G32210 | AT1G32210.1 | TAAAGCCCAAAT | Encodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation. |
| AT1G32220 | AT1G32220.1 | ATTTGGGCTTTA | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT1G32500 | AT1G32500.1 | GAAGCCCATTTAGCCCAAAC | Encodes a member of a heterogenous group of non-intrinsic ATP-binding cassette (ABC) proteins. Members of this group bear no close resemblance to each other nor to representatives of specific ABC protein subfamilies from other organisms. This grouping is arbitrary and will likely change upon acquisition of further data. |
| AT1G32730 | AT1G32730.1 | TTGGGCTTTTTTTGGGCTTAT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G33810 | AT1G33810.1 | ATTTGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G34130 | AT1G34130.1 | ATAATGGGCTCAATAAAGCCCAAAC | Encodes homolog of yeast STT3, a subunit of oligosaccharyltransferase. |
| AT1G36370 | AT1G36370.1 | TTTTGGGCT | Encodes a putative serine hydroxymethyltransferase. |
| AT1G44810 | AT1G44810.1 | AAAAGCCCAAAC | transcription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF573 (InterPro:IPR007592); BEST Arabidopsis thaliana protein match is: DNA-binding storekeeper protein-related (TAIR:AT4G00250.1); Has 1057 Blast hits to 708 proteins in 132 species: Archae - 0; Bacteria - 85; Metazoa - 306; Fungi - 207; Plants - 172; Viruses - 6; Other Eukaryotes - 281 (source: NCBI BLink). |
| AT1G44835 | AT1G44835.1 | AGCCCAAAT | YbaK/prolyl-tRNA synthetase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YbaK/aminoacyl-tRNA synthetase associated region (InterPro:IPR007214); Has 745 Blast hits to 744 proteins in 221 species: Archae - 0; Bacteria - 335; Metazoa - 45; Fungi - 5; Plants - 21; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| AT1G44835.2 | AGCCCAAAT | YbaK/prolyl-tRNA synthetase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YbaK/aminoacyl-tRNA synthetase associated region (InterPro:IPR007214); Has 745 Blast hits to 744 proteins in 221 species: Archae - 0; Bacteria - 335; Metazoa - 45; Fungi - 5; Plants - 21; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). |
| AT1G45976 | AT1G45976.1 | ATTTGGGCTAA | s-ribonuclease binding protein 1 (SBP1); FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), S-ribonuclease binding protein, SBP1, pollen (InterPro:IPR017066); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G10650.2); Has 850 Blast hits to 850 proteins in 129 species: Archae - 0; Bacteria - 2; Metazoa - 475; Fungi - 4; Plants - 238; Viruses - 48; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT1G48870 | AT1G48870.1 | ATAAGCCCAAAA | WD-40 repeat family protein; FUNCTIONS IN: protein phosphatase type 2A regulator activity, signal transducer activity; INVOLVED IN: signal transduction; LOCATED IN: protein phosphatase type 2A complex, heterotrimeric G-protein complex; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory subunit PR55 (InterPro:IPR000009), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein (TAIR:AT1G64610.2); Has 25332 Blast hits to 16442 proteins in 516 species: Archae - 36; Bacteria - 3914; Metazoa - 11168; Fungi - 4844; Plants - 2054; Viruses - 0; Other Eukaryotes - 3316 (source: NCBI BLink). |
| AT1G51510 | AT1G51510.1 | GAGCCCAAAATAAGCCCACTA | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
| AT1G51510.1 | TAAAAGCCCAAAATAAGCCCACT | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
| AT1G53165 | AT1G53165.1 | GTTTGGGCTGGGCCTAT | ATMAP4K ALPHA1; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response, response to wounding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G15220.1); Has 96724 Blast hits to 95040 proteins in 2970 species: Archae - 80; Bacteria - 8655; Metazoa - 42218; Fungi - 8499; Plants - 18630; Viruses - 533; Other Eukaryotes - 18109 (source: NCBI BLink). |
| AT1G53165.2 | GTTTGGGCTGGGCCTAT | ATMAP4K ALPHA1; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response, response to wounding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G15220.1); Has 96724 Blast hits to 95040 proteins in 2970 species: Archae - 80; Bacteria - 8655; Metazoa - 42218; Fungi - 8499; Plants - 18630; Viruses - 533; Other Eukaryotes - 18109 (source: NCBI BLink). |
| AT1G53920 | AT1G53920.1 | AGCCCAAAA | Contains lipase signature motif and GDSL domain. |
| AT1G54320 | AT1G54320.1 | TTTTGGGCTTC | LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF284, transmembrane eukaryotic (InterPro:IPR005045); BEST Arabidopsis thaliana protein match is: ALIS1 (ALA-INTERACTING SUBUNIT 1); phospholipid transporter (TAIR:AT3G12740.1); Has 648 Blast hits to 646 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 218; Fungi - 139; Plants - 105; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink). |
| AT1G54340 | AT1G54340.1 | ATTTGGGCTTTT | NADP-specific isocitrate dehydrogenase (ICDH) |
| AT1G54410 | AT1G54410.1 | TTTTGGGCT | dehydrin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water, response to stress; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dehydrin (InterPro:IPR000167); Has 570 Blast hits to 469 proteins in 114 species: Archae - 0; Bacteria - 12; Metazoa - 159; Fungi - 66; Plants - 127; Viruses - 0; Other Eukaryotes - 206 (source: NCBI BLink). |
| AT1G55370 | AT1G55370.1 | TAAAGCCCAAA | NDH-DEPENDENT CYCLIC ELECTRON FLOW 5 (NDF5); FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: positive regulation of gene expression, photosynthetic electron transport in photosystem I; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013); BEST Arabidopsis thaliana protein match is: NDF2 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); carbohydrate binding / catalytic (TAIR:AT1G64770.1); Has 99 Blast hits to 98 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G55370.2 | TAAAGCCCAAA | NDH-DEPENDENT CYCLIC ELECTRON FLOW 5 (NDF5); FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: positive regulation of gene expression, photosynthetic electron transport in photosystem I; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013); BEST Arabidopsis thaliana protein match is: NDF2 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); carbohydrate binding / catalytic (TAIR:AT1G64770.1); Has 99 Blast hits to 98 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G55590 | AT1G55590.1 | TAAGCCCAAAT | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL10) (TAIR:AT2G17020.1); Has 4433 Blast hits to 2197 proteins in 167 species: Archae - 0; Bacteria - 310; Metazoa - 2293; Fungi - 371; Plants - 930; Viruses - 3; Other Eukaryotes - 526 (source: NCBI BLink). |
| AT1G58025 | AT1G58025.1 | GTGGCCCATTGTAAGCCCAAAA | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Bromodomain, conserved site (InterPro:IPR018359), Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: GTE6 (GENERAL TRANSCRIPTION FACTOR GROUP E6); DNA binding / H3/H4 histone acetyltransferase (TAIR:AT3G52280.1); Has 1681 Blast hits to 1341 proteins in 127 species: Archae - 0; Bacteria - 31; Metazoa - 1070; Fungi - 94; Plants - 24; Viruses - 13; Other Eukaryotes - 449 (source: NCBI BLink). |
| AT1G59580 | AT1G59580.1 | TAAGCCCAAA | encodes a mitogen-activated kinase involved in innate immunity |
| AT1G59580.2 | TAAGCCCAAA | encodes a mitogen-activated kinase involved in innate immunity |
| AT1G61990 | AT1G61990.1 | TTTTGGGCTTG | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT1G61960.1); Has 369 Blast hits to 350 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 366; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G64650 | AT1G64650.1 | ATAAAGCCCAAA | LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 565 Blast hits to 562 proteins in 197 species: Archae - 7; Bacteria - 312; Metazoa - 76; Fungi - 39; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT1G64650.2 | ATAAAGCCCAAA | LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 565 Blast hits to 562 proteins in 197 species: Archae - 7; Bacteria - 312; Metazoa - 76; Fungi - 39; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT1G66410 | AT1G66410.1 | TTTGGGCTTC | encodes a calmodulin |
| AT1G68790 | AT1G68790.1 | GAAGCCCAAAA | LITTLE NUCLEI3 (LINC3); INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LINC2 (LITTLE NUCLEI2) (TAIR:AT1G13220.2); Has 250284 Blast hits to 107694 proteins in 2507 species: Archae - 2115; Bacteria - 37052; Metazoa - 113182; Fungi - 17848; Plants - 9025; Viruses - 1093; Other Eukaryotes - 69969 (source: NCBI BLink). |
| AT1G69420 | AT1G69420.1 | CAAAGCCCAAA | zinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT4G15080.1); Has 3791 Blast hits to 3785 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1905; Fungi - 464; Plants - 413; Viruses - 0; Other Eukaryotes - 1009 (source: NCBI BLink). |
| AT1G69420.2 | CAAAGCCCAAA | zinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT4G15080.1); Has 3791 Blast hits to 3785 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1905; Fungi - 464; Plants - 413; Viruses - 0; Other Eukaryotes - 1009 (source: NCBI BLink). |
| AT1G70600 | AT1G70600.1 | AATAGCCCAAAA | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15 (InterPro:IPR001196); BEST Arabidopsis thaliana protein match is: RPL27AB; structural constituent of ribosome (TAIR:AT1G23290.1); Has 825 Blast hits to 825 proteins in 317 species: Archae - 121; Bacteria - 11; Metazoa - 289; Fungi - 107; Plants - 96; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G71050 | AT1G71050.1 | TTAGCCCAAAA | heavy-metal-associated domain-containing protein / copper chaperone (CCH)-related; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein / copper chaperone (CCH)-related (TAIR:AT1G22990.1); Has 726 Blast hits to 679 proteins in 41 species: Archae - 0; Bacteria - 10; Metazoa - 2; Fungi - 12; Plants - 702; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G72320 | AT1G72320.1 | TTTTGGGCT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.2 | TTTTGGGCT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.3 | TTTTGGGCT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72330 | AT1G72330.1 | AGCCCAAAA | Encodes for alanine aminotransferase ALAAT2. |
| AT1G72330.2 | AGCCCAAAA | Encodes for alanine aminotransferase ALAAT2. |
| AT1G74070 | AT1G74070.1 | TATATGGGCTTGGGCTTTAGTTTGGGCTTTTA | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase (TAIR:AT5G35100.1); Has 2382 Blast hits to 2382 proteins in 343 species: Archae - 0; Bacteria - 64; Metazoa - 1168; Fungi - 403; Plants - 432; Viruses - 0; Other Eukaryotes - 315 (source: NCBI BLink). |
| AT1G74410 | AT1G74410.1 | AAAGCCCAAAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G66070.1); Has 5472 Blast hits to 5456 proteins in 200 species: Archae - 0; Bacteria - 2; Metazoa - 1838; Fungi - 348; Plants - 2530; Viruses - 21; Other Eukaryotes - 733 (source: NCBI BLink). |
| AT1G75560 | AT1G75560.1 | AAAAAGCCCAGCCCAAA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT1G75560.2 | AAAAAGCCCAGCCCAAA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT1G76120 | AT1G76120.1 | ATTTGGGCTTG | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink). |
| AT1G76120.2 | ATTTGGGCTTG | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink). |
| AT1G78920 | AT1G78920.1 | TTTTGGGCTAGGCCCATATA | vacuolar-type H+-translocating inorganic pyrophosphatase |
| AT1G78920.2 | TTTTGGGCTAGGCCCATATA | vacuolar-type H+-translocating inorganic pyrophosphatase |
| AT1G79590 | AT1G79590.1 | GAAGCCCAAA | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
| AT1G79590.2 | GAAGCCCAAA | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
| AT1G79610 | AT1G79610.1 | ATTAGGCCCATAAAAGCCCAAAA | sodium proton exchanger, putative (NHX6); FUNCTIONS IN: solute:hydrogen antiporter activity, sodium:hydrogen antiporter activity; INVOLVED IN: cation transport, sodium ion transport, regulation of pH; LOCATED IN: integral to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Na+/H+ exchanger, subfamily (InterPro:IPR004709), Cation/H+ exchanger, conserved region (InterPro:IPR018422), Na+/H+ exchanger, isoform 5/6/8, conserved region (InterPro:IPR018409), Cation/H+ exchanger (InterPro:IPR006153), Na+/H+ exchanger, conserved region (InterPro:IPR018406); BEST Arabidopsis thaliana protein match is: NHX5; sodium ion transmembrane transporter/ sodium:hydrogen antiporter (TAIR:AT1G54370.1); Has 4010 Blast hits to 4005 proteins in 1041 species: Archae - 71; Bacteria - 2418; Metazoa - 735; Fungi - 95; Plants - 280; Viruses - 0; Other Eukaryotes - 411 (source: NCBI BLink). |
| AT1G79610.1 | TCAGCCCAAAA | sodium proton exchanger, putative (NHX6); FUNCTIONS IN: solute:hydrogen antiporter activity, sodium:hydrogen antiporter activity; INVOLVED IN: cation transport, sodium ion transport, regulation of pH; LOCATED IN: integral to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Na+/H+ exchanger, subfamily (InterPro:IPR004709), Cation/H+ exchanger, conserved region (InterPro:IPR018422), Na+/H+ exchanger, isoform 5/6/8, conserved region (InterPro:IPR018409), Cation/H+ exchanger (InterPro:IPR006153), Na+/H+ exchanger, conserved region (InterPro:IPR018406); BEST Arabidopsis thaliana protein match is: NHX5; sodium ion transmembrane transporter/ sodium:hydrogen antiporter (TAIR:AT1G54370.1); Has 4010 Blast hits to 4005 proteins in 1041 species: Archae - 71; Bacteria - 2418; Metazoa - 735; Fungi - 95; Plants - 280; Viruses - 0; Other Eukaryotes - 411 (source: NCBI BLink). |
| AT1G80080 | AT1G80080.1 | AAATGGGCTCAGCCCAAAT | Encodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. |
| AT2G01640 | AT2G01640.1 | TTTGGGCTCATAATGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 18; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G04378 | AT2G04378.1 | TTTTGGGCTTG | beta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G04378.2 | TTTTGGGCTTG | beta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G04390 | AT2G04390.1 | CAAGCCCAAAA | 40S ribosomal protein S17 (RPS17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus, plasma membrane; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G05220 | AT2G05220.1 | ATTTGGGCT | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G05220.2 | ATTTGGGCT | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G06000 | AT2G06000.1 | TGAGCCCAAAC | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 21558 Blast hits to 5826 proteins in 169 species: Archae - 4; Bacteria - 18; Metazoa - 474; Fungi - 383; Plants - 19917; Viruses - 0; Other Eukaryotes - 762 (source: NCBI BLink). |
| AT2G06000.2 | TGAGCCCAAAC | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 21558 Blast hits to 5826 proteins in 169 species: Archae - 4; Bacteria - 18; Metazoa - 474; Fungi - 383; Plants - 19917; Viruses - 0; Other Eukaryotes - 762 (source: NCBI BLink). |
| AT2G06990 | AT2G06990.1 | TTAAAGCCCAAAACGACA | encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl. |
| AT2G13510 | AT2G13510.1 | GTTTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf; EXPRESSED DURING: LP.10 ten leaves visible, LP.02 two leaves visible; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G13500.1); Has 122 Blast hits to 102 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 122; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G15270 | AT2G15270.1 | CAAGCCCAAAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1168 (InterPro:IPR009548); Has 2059 Blast hits to 1352 proteins in 169 species: Archae - 0; Bacteria - 30; Metazoa - 987; Fungi - 240; Plants - 61; Viruses - 3; Other Eukaryotes - 738 (source: NCBI BLink). |
| AT2G16500 | AT2G16500.1 | TAGGGCCCAAGCCCAAAA | encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements. |
| AT2G16530 | AT2G16530.1 | GTTTGGGCTTG | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein / steroid 5-alpha-reductase family protein; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, 3-oxo-5-alpha-steroid 4-dehydrogenase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104); BEST Arabidopsis thaliana protein match is: 3-oxo-5-alpha-steroid 4-dehydrogenase family protein / steroid 5-alpha-reductase family protein (TAIR:AT1G72590.1); Has 802 Blast hits to 802 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 320; Fungi - 111; Plants - 85; Viruses - 0; Other Eukaryotes - 266 (source: NCBI BLink). |
| AT2G16530.2 | GTTTGGGCTTG | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein / steroid 5-alpha-reductase family protein; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, 3-oxo-5-alpha-steroid 4-dehydrogenase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104); BEST Arabidopsis thaliana protein match is: 3-oxo-5-alpha-steroid 4-dehydrogenase family protein / steroid 5-alpha-reductase family protein (TAIR:AT1G72590.1); Has 802 Blast hits to 802 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 320; Fungi - 111; Plants - 85; Viruses - 0; Other Eukaryotes - 266 (source: NCBI BLink). |
| AT2G17670 | AT2G17670.1 | TTTGGGCT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink). |
| AT2G17670.2 | TTTGGGCT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink). |
| AT2G18400 | AT2G18400.1 | GGGCTTTTGGGCTTTAT | ribosomal protein L6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: emb2394 (embryo defective 2394); structural constituent of ribosome (TAIR:AT1G05190.1); Has 5053 Blast hits to 5053 proteins in 1481 species: Archae - 1; Bacteria - 2961; Metazoa - 3; Fungi - 77; Plants - 71; Viruses - 0; Other Eukaryotes - 1940 (source: NCBI BLink). |
| AT2G19080 | AT2G19080.1 | TGTGGGCCTTTTAAAGCCCAAAA | metaxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein targeting to mitochondrion; LOCATED IN: mitochondrial outer membrane, mitochondrion, mitochondrial inner membrane, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metaxin (InterPro:IPR017410); Has 384 Blast hits to 384 proteins in 77 species: Archae - 0; Bacteria - 46; Metazoa - 295; Fungi - 14; Plants - 20; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G19640 | AT2G19640.1 | AGCCCAAA | ASH1-RELATED PROTEIN 2 (ASHR2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: shoot apex, root; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214); BEST Arabidopsis thaliana protein match is: SDG38 (SET DOMAIN PROTEIN 38) (TAIR:AT5G06620.1); Has 1291 Blast hits to 1273 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 669; Fungi - 239; Plants - 166; Viruses - 3; Other Eukaryotes - 214 (source: NCBI BLink). |
| AT2G19640.2 | AGCCCAAA | ASH1-RELATED PROTEIN 2 (ASHR2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: shoot apex, root; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214); BEST Arabidopsis thaliana protein match is: SDG38 (SET DOMAIN PROTEIN 38) (TAIR:AT5G06620.1); Has 1291 Blast hits to 1273 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 669; Fungi - 239; Plants - 166; Viruses - 3; Other Eukaryotes - 214 (source: NCBI BLink). |
| AT2G20400 | AT2G20400.1 | TTTGGGCTATT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PHR1 (PHOSPHATE STARVATION RESPONSE 1); transcription factor (TAIR:AT4G28610.1); Has 913 Blast hits to 906 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 900; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT2G20870 | AT2G20870.1 | ATTTGGGCTC | cell wall protein precursor, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G28160.1); Has 60 Blast hits to 60 proteins in 14 species: Archae - 0; Bacteria - 27; Metazoa - 5; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G21270 | AT2G21270.1 | GAAGCCCAAAC | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT4G38930.2); Has 506 Blast hits to 506 proteins in 158 species: Archae - 8; Bacteria - 2; Metazoa - 131; Fungi - 142; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT2G21270.2 | GAAGCCCAAAC | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT4G38930.2); Has 506 Blast hits to 506 proteins in 158 species: Archae - 8; Bacteria - 2; Metazoa - 131; Fungi - 142; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT2G21270.3 | GAAGCCCAAAC | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT4G38930.2); Has 506 Blast hits to 506 proteins in 158 species: Archae - 8; Bacteria - 2; Metazoa - 131; Fungi - 142; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT2G23390 | AT2G23390.1 | GTTTGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF482 (InterPro:IPR007434), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 1806 Blast hits to 1806 proteins in 374 species: Archae - 0; Bacteria - 707; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 1084 (source: NCBI BLink). |
| AT2G24290 | AT2G24290.1 | CTAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30996.1); Has 51 Blast hits to 51 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G24395 | AT2G24395.1 | TTTGGGCT | chaperone protein dnaJ-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 17 Blast hits to 17 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G24590 | AT2G24590.1 | CGGCCCATTTTAAGCCCAAAT | splicing factor, putative; FUNCTIONS IN: zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA splicing; LOCATED IN: nucleolus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: SRZ-22; protein binding (TAIR:AT4G31580.2); Has 9855 Blast hits to 8604 proteins in 578 species: Archae - 6; Bacteria - 593; Metazoa - 5438; Fungi - 1074; Plants - 1815; Viruses - 79; Other Eukaryotes - 850 (source: NCBI BLink). |
| AT2G25625 | AT2G25625.1 | TTTGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G25625.2 | TTTGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G25670 | AT2G25670.1 | GTTTGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32610.1); Has 39716 Blast hits to 23014 proteins in 1226 species: Archae - 64; Bacteria - 4437; Metazoa - 16033; Fungi - 4681; Plants - 1370; Viruses - 266; Other Eukaryotes - 12865 (source: NCBI BLink). |
| AT2G25670.2 | GTTTGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32610.1); Has 39716 Blast hits to 23014 proteins in 1226 species: Archae - 64; Bacteria - 4437; Metazoa - 16033; Fungi - 4681; Plants - 1370; Viruses - 266; Other Eukaryotes - 12865 (source: NCBI BLink). |
| AT2G25910 | AT2G25910.1 | CAAGCCCAAAT | 3'-5' exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein; FUNCTIONS IN: 3'-5' exonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25920.1); Has 798 Blast hits to 798 proteins in 239 species: Archae - 0; Bacteria - 274; Metazoa - 164; Fungi - 38; Plants - 61; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT2G25910.2 | CAAGCCCAAAT | 3'-5' exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein; FUNCTIONS IN: 3'-5' exonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25920.1); Has 798 Blast hits to 798 proteins in 239 species: Archae - 0; Bacteria - 274; Metazoa - 164; Fungi - 38; Plants - 61; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT2G25930 | AT2G25930.1 | TTTTGGGCTC | Encodes a novel nuclear protein that is expressed rhythmically and interacts with phytochrome B to control plant development and flowering through a signal transduction pathway Elf3 controls rhythmic circadian outputs under constant light conditions. |
| AT2G26280 | AT2G26280.1 | CAAAGCCCAAAA | smr (Small MutS Related) domain-containing protein mRNA, complete cds |
| AT2G27580 | AT2G27580.1 | AGCCCAAAA | zinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT3G52800.1); Has 764 Blast hits to 761 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 387; Fungi - 2; Plants - 272; Viruses - 6; Other Eukaryotes - 97 (source: NCBI BLink). |
| AT2G27820 | AT2G27820.1 | GTTTGGGCTTAT | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT2G28290 | AT2G28290.1 | ATTTGGGCTTTAT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. |
| AT2G28290.2 | ATTTGGGCTTTAT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. |
| AT2G28290.3 | ATTTGGGCTTTAT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. |
| AT2G28910 | AT2G28910.1 | CCAGGCCCAGCCCAAAT | Encodes a CAX-interacting protein (CXIP4). The gene product is located in the nucleus of GFP-CXIP4-expressing yeast cells. When transiently expressed in the tobacco leaves, GFP-CXIP4 locates to the nucleus as well as in discrete areas of the cytoplasm (which do not overlap with mitochondria). |
| AT2G29210 | AT2G29210.1 | TTTGGGCTAA | splicing factor PWI domain-containing protein; INVOLVED IN: RNA splicing; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Splicing factor PWI (InterPro:IPR002483); Has 142243 Blast hits to 70953 proteins in 1843 species: Archae - 141; Bacteria - 12024; Metazoa - 66362; Fungi - 19459; Plants - 11660; Viruses - 2650; Other Eukaryotes - 29947 (source: NCBI BLink). |
| AT2G30000 | AT2G30000.1 | TTTGGGCTTTAA | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G07170.2); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G30120 | AT2G30120.1 | ATTTGGGCTTAG | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14750.1). |
| AT2G30120.1 | GTTTGGGCTCA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14750.1). |
| AT2G30120.2 | ATTTGGGCTTAG | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14750.1). |
| AT2G30120.2 | GTTTGGGCTCA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14750.1). |
| AT2G30280 | AT2G30280.1 | CGGTTTGGGCTTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 44325 Blast hits to 17174 proteins in 814 species: Archae - 92; Bacteria - 12397; Metazoa - 14270; Fungi - 4388; Plants - 1716; Viruses - 607; Other Eukaryotes - 10855 (source: NCBI BLink). |
| AT2G31810 | AT2G31810.1 | TTTTGGGCTTTT | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink). |
| AT2G31810.2 | TTTTGGGCTTTT | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink). |
| AT2G31810.3 | TTTTGGGCTTTT | acetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink). |
| AT2G32070 | AT2G32070.1 | GTTTGGGCTAA | CCR4-NOT transcription complex protein, putative; FUNCTIONS IN: ribonuclease activity, nucleic acid binding; INVOLVED IN: RNA modification; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonuclease CAF1 (InterPro:IPR006941), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis thaliana protein match is: CCR4-NOT transcription complex protein, putative (TAIR:AT1G80780.2); Has 654 Blast hits to 646 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 94; Plants - 219; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT2G32810 | AT2G32810.1 | TTTTGGGCT | putative beta-galactosidase |
| AT2G33800 | AT2G33800.1 | GAGCCCAAAT | ribosomal protein S5 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: response to cadmium ion, response to cold, translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, N-terminal (InterPro:IPR013810), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, bacterial-type (InterPro:IPR005712), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192); Has 6397 Blast hits to 6393 proteins in 1672 species: Archae - 183; Bacteria - 2911; Metazoa - 467; Fungi - 174; Plants - 113; Viruses - 0; Other Eukaryotes - 2549 (source: NCBI BLink). |
| AT2G34260 | AT2G34260.1 | GAGCCCAAAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD repeat protein 55 (InterPro:IPR017422); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 16318 Blast hits to 9709 proteins in 465 species: Archae - 44; Bacteria - 3325; Metazoa - 6190; Fungi - 3093; Plants - 1110; Viruses - 0; Other Eukaryotes - 2556 (source: NCBI BLink). |
| AT2G34260.2 | GAGCCCAAAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD repeat protein 55 (InterPro:IPR017422); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 16318 Blast hits to 9709 proteins in 465 species: Archae - 44; Bacteria - 3325; Metazoa - 6190; Fungi - 3093; Plants - 1110; Viruses - 0; Other Eukaryotes - 2556 (source: NCBI BLink). |
| AT2G34590 | AT2G34590.1 | TTTTGGGCTC | transketolase family protein; FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity, transketolase activity; INVOLVED IN: pollen tube development; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transketolase, C-terminal (InterPro:IPR005476), Transketolase C-terminal-like (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: PDH-E1 BETA (PYRUVATE DEHYDROGENASE E1 BETA); pyruvate dehydrogenase (acetyl-transferring) (TAIR:AT1G30120.1); Has 9465 Blast hits to 9457 proteins in 1366 species: Archae - 92; Bacteria - 4722; Metazoa - 387; Fungi - 143; Plants - 155; Viruses - 0; Other Eukaryotes - 3966 (source: NCBI BLink). |
| AT2G36990 | AT2G36990.1 | ATTTGGGCTTTTAAGCCCAATATAAGGCCCAACA | Encodes a general sigma factor in chloroplasts and is probably responsible for the recognition of sigma 70 type standard bacteria-type multi-subunit RNA polymerase (PEP) promoters in young cotyledons. |
| AT2G38130 | AT2G38130.1 | ATTTGGGCTTTAA | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. |
| AT2G38130.1 | TTAAAGCCCAAAT | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. |
| AT2G38130.2 | ATTTGGGCTTTAA | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. |
| AT2G38130.2 | TTAAAGCCCAAAT | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. |
| AT2G38140 | AT2G38140.1 | ATTTGGGCTTTAA | plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete |
| AT2G38140.1 | TTAAAGCCCAAAT | plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete |
| AT2G38730 | AT2G38730.1 | CAAAGCCCAAAT | peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase (TAIR:AT2G21130.1); Has 10133 Blast hits to 10113 proteins in 1461 species: Archae - 80; Bacteria - 3058; Metazoa - 2388; Fungi - 954; Plants - 718; Viruses - 4; Other Eukaryotes - 2931 (source: NCBI BLink). |
| AT2G38730.1 | TAAAGCCCAAAA | peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase (TAIR:AT2G21130.1); Has 10133 Blast hits to 10113 proteins in 1461 species: Archae - 80; Bacteria - 3058; Metazoa - 2388; Fungi - 954; Plants - 718; Viruses - 4; Other Eukaryotes - 2931 (source: NCBI BLink). |
| AT2G39020 | AT2G39020.1 | GTTTGGGCT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G39030.1); Has 1431 Blast hits to 1430 proteins in 453 species: Archae - 20; Bacteria - 756; Metazoa - 246; Fungi - 55; Plants - 37; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink). |
| AT2G39020.1 | TTTGGGCTGGGCTCA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G39030.1); Has 1431 Blast hits to 1430 proteins in 453 species: Archae - 20; Bacteria - 756; Metazoa - 246; Fungi - 55; Plants - 37; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink). |
| AT2G39270 | AT2G39270.1 | AAAAAGCCCAAACGGGTCAAA | adenylate kinase family protein; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; CONTAINS InterPro DOMAIN/s: Adenylate kinase, subfamily (InterPro:IPR006259), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: ADK (ADENOSINE KINASE); adenylate kinase/ nucleotide kinase (TAIR:AT2G37250.1); Has 8604 Blast hits to 8484 proteins in 1852 species: Archae - 61; Bacteria - 4479; Metazoa - 995; Fungi - 287; Plants - 246; Viruses - 0; Other Eukaryotes - 2536 (source: NCBI BLink). |
| AT2G39390 | AT2G39390.1 | CAAAGCCCAAAT | 60S ribosomal protein L35 (RPL35B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 796 Blast hits to 796 proteins in 298 species: Archae - 108; Bacteria - 128; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink). |
| AT2G40060 | AT2G40060.1 | ATTTGGGCTC | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT3G51890.1); Has 403 Blast hits to 391 proteins in 99 species: Archae - 2; Bacteria - 32; Metazoa - 184; Fungi - 36; Plants - 54; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink). |
| AT2G41060 | AT2G41060.1 | TTTTGGGCTAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: UBP1 interacting protein 2a (UBA2a) (TAIR:AT3G56860.3); Has 17419 Blast hits to 11431 proteins in 532 species: Archae - 0; Bacteria - 698; Metazoa - 10129; Fungi - 1624; Plants - 2756; Viruses - 123; Other Eukaryotes - 2089 (source: NCBI BLink). |
| AT2G41060.2 | TTTTGGGCTAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: UBP1 interacting protein 2a (UBA2a) (TAIR:AT3G56860.3); Has 17419 Blast hits to 11431 proteins in 532 species: Archae - 0; Bacteria - 698; Metazoa - 10129; Fungi - 1624; Plants - 2756; Viruses - 123; Other Eukaryotes - 2089 (source: NCBI BLink). |
| AT2G41160 | AT2G41160.1 | ATTTGGGCTTTAT | ubiquitin-associated (UBA)/TS-N domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin-associated (UBA)/TS-N domain-containing protein (TAIR:AT3G56740.1); Has 179 Blast hits to 179 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 65; Plants - 43; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT2G41670 | AT2G41670.1 | ATAAGCCCAAAA | GTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP binding (TAIR:AT4G10650.1); Has 2332 Blast hits to 2332 proteins in 753 species: Archae - 70; Bacteria - 1127; Metazoa - 335; Fungi - 275; Plants - 106; Viruses - 0; Other Eukaryotes - 419 (source: NCBI BLink). |
| AT2G41670.1 | GAAGCCCATCTTAAGCCCAAAT | GTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP binding (TAIR:AT4G10650.1); Has 2332 Blast hits to 2332 proteins in 753 species: Archae - 70; Bacteria - 1127; Metazoa - 335; Fungi - 275; Plants - 106; Viruses - 0; Other Eukaryotes - 419 (source: NCBI BLink). |
| AT2G42700 | AT2G42700.1 | CAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport, vesicle docking during exocytosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Sec1-like protein (InterPro:IPR001619); Has 95 Blast hits to 92 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT2G43770 | AT2G43770.1 | TCAGCCCAAAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 76665 Blast hits to 29470 proteins in 693 species: Archae - 72; Bacteria - 7530; Metazoa - 35994; Fungi - 14726; Plants - 7106; Viruses - 6; Other Eukaryotes - 11231 (source: NCBI BLink). |
| AT2G44610 | AT2G44610.1 | AGCCCAAAT | Encodes a GTP-binding protein with similarity to yeast YPT6 . RAB6 can complement the yeast YTP mutant. |
| AT2G45070 | AT2G45070.1 | ATTTGGGCTTC | Sec61 Beta Subunit |
| AT2G45070.1 | ATTTGGGCTTTAA | Sec61 Beta Subunit |
| AT2G45070.2 | ATTTGGGCTTC | Sec61 Beta Subunit |
| AT2G45070.2 | ATTTGGGCTTTAA | Sec61 Beta Subunit |
| AT2G45070.3 | ATTTGGGCTTC | Sec61 Beta Subunit |
| AT2G45070.3 | ATTTGGGCTTTAA | Sec61 Beta Subunit |
| AT2G45070.4 | ATTTGGGCTTC | Sec61 Beta Subunit |
| AT2G45070.4 | ATTTGGGCTTTAA | Sec61 Beta Subunit |
| AT2G45470 | AT2G45470.1 | GAAGCCCAAAT | FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 8 (FLA8); LOCATED IN: anchored to plasma membrane, apoplast, plasma membrane, anchored to membrane, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); BEST Arabidopsis thaliana protein match is: FLA10 (TAIR:AT3G60900.1); Has 13304 Blast hits to 6149 proteins in 712 species: Archae - 78; Bacteria - 4055; Metazoa - 1332; Fungi - 777; Plants - 1681; Viruses - 864; Other Eukaryotes - 4517 (source: NCBI BLink). |
| AT2G45710 | AT2G45710.1 | TCAGCCCAAAA | 40S ribosomal protein S27 (RPS27A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, nucleolus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein S27e (InterPro:IPR000592); BEST Arabidopsis thaliana protein match is: ARS27A (ARABIDOPSIS RIBOSOMAL PROTEIN S27); structural constituent of ribosome (TAIR:AT3G61110.1); Has 690 Blast hits to 690 proteins in 269 species: Archae - 76; Bacteria - 0; Metazoa - 297; Fungi - 98; Plants - 99; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). |
| AT2G46505 | AT2G46505.1 | GTTTGGGCTTC | Encodes succinate dehydrogenase ,a component of mitochondrial respiratory complex II. Nuclear encoded gene which is imported into the mitochondrion. |
| AT2G46580 | AT2G46580.1 | TAAGCCCAAAA | pyridoxine 5'-phosphate oxidase-related; FUNCTIONS IN: FMN binding, pyridoxamine-phosphate oxidase activity; INVOLVED IN: pyridoxine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxamine 5'-phosphate oxidase (InterPro:IPR000659), FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002); Has 1089 Blast hits to 1089 proteins in 214 species: Archae - 0; Bacteria - 365; Metazoa - 49; Fungi - 36; Plants - 20; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). |
| AT2G47580 | AT2G47580.1 | GAAGCCCAAA | encodes spliceosomal protein U1A |
| AT3G01100 | AT3G01100.1 | GAGCCCAAAA | unknown protein, has cDNAs and ESTs associated to it |
| AT3G01100.2 | GAGCCCAAAA | unknown protein, has cDNAs and ESTs associated to it |
| AT3G01220 | AT3G01220.1 | TTTGGGCTTC | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein, its expression is auxin-inducible and dependent on MP gene activity. |
| AT3G01390 | AT3G01390.1 | TTTGGGCTTTTT | Subunit G of the vacuolar membrane ATPAse complex |
| AT3G01390.2 | TTTGGGCTTTTT | Subunit G of the vacuolar membrane ATPAse complex |
| AT3G01400 | AT3G01400.1 | AAAAAGCCCAAA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT5G58680.1); Has 3812 Blast hits to 2325 proteins in 207 species: Archae - 0; Bacteria - 2; Metazoa - 1580; Fungi - 356; Plants - 1453; Viruses - 0; Other Eukaryotes - 421 (source: NCBI BLink). |
| AT3G01560 | AT3G01560.1 | ATTTGGGCTTTAA | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Protein of unknown function DUF1421 (InterPro:IPR010820), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT5G14540.1); Has 76923 Blast hits to 40691 proteins in 1566 species: Archae - 110; Bacteria - 8440; Metazoa - 31149; Fungi - 13515; Plants - 10280; Viruses - 1804; Other Eukaryotes - 11625 (source: NCBI BLink). |
| AT3G01910 | AT3G01910.1 | GTTTGGGCTCAATTTGGGCTC | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT3G01910.2 | GTTTGGGCTCAATTTGGGCTC | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT3G01910.3 | GTTTGGGCTCAATTTGGGCTC | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT3G02180 | AT3G02180.1 | AAAAGCCCAAATCAAAGCCC | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT3G02180.1 | ATAAGCCCAAAA | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT3G02180.2 | AAAAGCCCAAATCAAAGCCC | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT3G02180.2 | ATAAGCCCAAAA | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT3G02180.3 | AAAAGCCCAAATCAAAGCCC | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT3G02180.3 | ATAAGCCCAAAA | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT3G02450 | AT3G02450.1 | ATAAGCCCAAAA | cell division protein ftsH, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase M41, FtsH extracellular (InterPro:IPR011546); BEST Arabidopsis thaliana protein match is: FTSH6 (FTSH PROTEASE 6); ATP-dependent peptidase/ ATPase/ metallopeptidase/ peptidase/ zinc ion binding (TAIR:AT5G15250.1); Has 29914 Blast hits to 28201 proteins in 1898 species: Archae - 923; Bacteria - 10733; Metazoa - 4167; Fungi - 2480; Plants - 1767; Viruses - 20; Other Eukaryotes - 9824 (source: NCBI BLink). |
| AT3G02530 | AT3G02530.1 | GAAGCCCAAAA | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: membrane, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, zeta subunit (InterPro:IPR012722), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT5G16070.1); Has 13554 Blast hits to 13062 proteins in 2289 species: Archae - 391; Bacteria - 5634; Metazoa - 1855; Fungi - 975; Plants - 487; Viruses - 0; Other Eukaryotes - 4212 (source: NCBI BLink). |
| AT3G02700 | AT3G02700.1 | ATTTGGGCTTTTT | NC domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein (TAIR:AT5G16330.1); Has 105 Blast hits to 104 proteins in 28 species: Archae - 0; Bacteria - 23; Metazoa - 12; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G03070 | AT3G03070.1 | TAAAGCCCAAAT | NADH-ubiquinone oxidoreductase-related; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NADH dehydrogenase [ubiquinone] (complex I), iron-sulphur protein 6, mitochondria (InterPro:IPR016668); Has 203 Blast hits to 203 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 55; Plants - 28; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT3G04040 | AT3G04040.1 | TTTGGGCTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1); Has 32 Blast hits to 32 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G04760 | AT3G04760.1 | TAAAGCCCAAAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 26507 Blast hits to 6286 proteins in 193 species: Archae - 4; Bacteria - 28; Metazoa - 952; Fungi - 704; Plants - 23378; Viruses - 0; Other Eukaryotes - 1441 (source: NCBI BLink). |
| AT3G04770 | AT3G04770.1 | TTTTGGGCT | 40S ribosomal protein SA B (RPSAb); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S2 (InterPro:IPR001865), Ribosomal protein S2, conserved site (InterPro:IPR018130), Ribosomal protein S2, eukaryotic/archaeal (InterPro:IPR005707); BEST Arabidopsis thaliana protein match is: P40; structural constituent of ribosome (TAIR:AT1G72370.2); Has 2091 Blast hits to 2089 proteins in 628 species: Archae - 182; Bacteria - 757; Metazoa - 444; Fungi - 181; Plants - 133; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). |
| AT3G04770.1 | TTTTGGGCTTGAAAGCCCATTTA | 40S ribosomal protein SA B (RPSAb); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S2 (InterPro:IPR001865), Ribosomal protein S2, conserved site (InterPro:IPR018130), Ribosomal protein S2, eukaryotic/archaeal (InterPro:IPR005707); BEST Arabidopsis thaliana protein match is: P40; structural constituent of ribosome (TAIR:AT1G72370.2); Has 2091 Blast hits to 2089 proteins in 628 species: Archae - 182; Bacteria - 757; Metazoa - 444; Fungi - 181; Plants - 133; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). |
| AT3G04770.2 | TTTTGGGCT | 40S ribosomal protein SA B (RPSAb); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S2 (InterPro:IPR001865), Ribosomal protein S2, conserved site (InterPro:IPR018130), Ribosomal protein S2, eukaryotic/archaeal (InterPro:IPR005707); BEST Arabidopsis thaliana protein match is: P40; structural constituent of ribosome (TAIR:AT1G72370.2); Has 2091 Blast hits to 2089 proteins in 628 species: Archae - 182; Bacteria - 757; Metazoa - 444; Fungi - 181; Plants - 133; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). |
| AT3G04770.2 | TTTTGGGCTTGAAAGCCCATTTA | 40S ribosomal protein SA B (RPSAb); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S2 (InterPro:IPR001865), Ribosomal protein S2, conserved site (InterPro:IPR018130), Ribosomal protein S2, eukaryotic/archaeal (InterPro:IPR005707); BEST Arabidopsis thaliana protein match is: P40; structural constituent of ribosome (TAIR:AT1G72370.2); Has 2091 Blast hits to 2089 proteins in 628 species: Archae - 182; Bacteria - 757; Metazoa - 444; Fungi - 181; Plants - 133; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). |
| AT3G04920 | AT3G04920.1 | TAAGCCCAAAT | 40S ribosomal protein S24 (RPS24A); FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S24e (InterPro:IPR001976), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal S24e conserved site (InterPro:IPR018098); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S24 (RPS24B) (TAIR:AT5G28060.1); Has 643 Blast hits to 643 proteins in 254 species: Archae - 56; Bacteria - 0; Metazoa - 305; Fungi - 103; Plants - 74; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT3G05370 | AT3G05370.1 | TGGCCCAAATAAAAAGCCCAAAT | Receptor Like Protein 31 (AtRLP31); FUNCTIONS IN: protein binding, kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP12 (Receptor Like Protein 12); protein binding (TAIR:AT1G71400.1); Has 71485 Blast hits to 19659 proteins in 809 species: Archae - 36; Bacteria - 3854; Metazoa - 21831; Fungi - 684; Plants - 39507; Viruses - 4; Other Eukaryotes - 5569 (source: NCBI BLink). |
| AT3G06400 | AT3G06400.1 | CAAAGCCCAAAT | Encodes a SWI2/SNF2 chromatin remodeling protein belonging to the ISWI family. Involved in nuclear proliferation during megagametogenesis and cell expansion in the sporophyte. Constitutively expressed. RNAi induced loss of function in megagametogenesis results in female sterility.35S:RNAi plants have reduced stature. |
| AT3G06570 | AT3G06570.1 | AGCCCAAAA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT5G51250.1); Has 541 Blast hits to 526 proteins in 21 species: Archae - 0; Bacteria - 5; Metazoa - 6; Fungi - 0; Plants - 528; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06780 | AT3G06780.1 | TTTGGGCTTT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 4026 Blast hits to 2251 proteins in 290 species: Archae - 2; Bacteria - 737; Metazoa - 1865; Fungi - 196; Plants - 741; Viruses - 43; Other Eukaryotes - 442 (source: NCBI BLink). |
| AT3G07140 | AT3G07140.1 | GAAGCCCAAAC | GPI transamidase component Gpi16 subunit family protein; FUNCTIONS IN: GPI-anchor transamidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gpi16 subunit, GPI transamidase component (InterPro:IPR007245); Has 252 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 88; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G07140.2 | GAAGCCCAAAC | GPI transamidase component Gpi16 subunit family protein; FUNCTIONS IN: GPI-anchor transamidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gpi16 subunit, GPI transamidase component (InterPro:IPR007245); Has 252 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 88; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G07300 | AT3G07300.1 | TTTTGGGCTTATTTTAGGCCCAAAT | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink). |
| AT3G07300.2 | TTTTGGGCTTATTTTAGGCCCAAAT | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink). |
| AT3G07300.3 | TTTTGGGCTTATTTTAGGCCCAAAT | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink). |
| AT3G07440 | AT3G07440.1 | GAGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48530.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G07480 | AT3G07480.1 | ATTTGGGCTTG | electron carrier/ iron-sulfur cluster binding; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); Has 1153 Blast hits to 1153 proteins in 168 species: Archae - 0; Bacteria - 236; Metazoa - 115; Fungi - 5; Plants - 23; Viruses - 0; Other Eukaryotes - 774 (source: NCBI BLink). |
| AT3G07480.1 | TTTGGGCTTAT | electron carrier/ iron-sulfur cluster binding; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); Has 1153 Blast hits to 1153 proteins in 168 species: Archae - 0; Bacteria - 236; Metazoa - 115; Fungi - 5; Plants - 23; Viruses - 0; Other Eukaryotes - 774 (source: NCBI BLink). |
| AT3G07950 | AT3G07950.1 | GAGCCCAAAA | rhomboid protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1751, integral membrane, eukaryotic (InterPro:IPR013861); Has 397 Blast hits to 397 proteins in 163 species: Archae - 6; Bacteria - 95; Metazoa - 104; Fungi - 97; Plants - 47; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT3G08590 | AT3G08590.1 | TGAGCCCAAA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G08590.2 | TGAGCCCAAA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G08610 | AT3G08610.1 | GAAGCCCAAAAGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G08960 | AT3G08960.1 | ATTTGGGCTTAT | binding / protein transporter; FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, cytoplasm; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT1G26170.1); Has 1034 Blast hits to 933 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 468; Fungi - 402; Plants - 81; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT3G08960.1 | TTAGCCCAAAA | binding / protein transporter; FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, cytoplasm; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT1G26170.1); Has 1034 Blast hits to 933 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 468; Fungi - 402; Plants - 81; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT3G09030 | AT3G09030.1 | GTTTGGGCTGA | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT5G41330.1); Has 1331 Blast hits to 1319 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 1177; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT3G09350 | AT3G09350.1 | ATTTGGGCTTG | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G09350.2 | ATTTGGGCTTG | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G09350.3 | ATTTGGGCTTG | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G09720 | AT3G09720.1 | ATTTGGGCTTTAATAGGCCCATTTA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ethylene-responsive DEAD box RNA helicase, putative (RH30) (TAIR:AT5G63120.2); Has 31352 Blast hits to 30822 proteins in 1800 species: Archae - 599; Bacteria - 13582; Metazoa - 5089; Fungi - 3376; Plants - 1453; Viruses - 31; Other Eukaryotes - 7222 (source: NCBI BLink). |
| AT3G10270 | AT3G10270.1 | TTTTGGGCT | Protein targeting to mitochondria is influenced by UTR sequences. |
| AT3G10572 | AT3G10572.1 | TTTTGGGCTTAG | 3-phosphoinositide-dependent protein kinase-1, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G11400 | AT3G11400.1 | AAAAGCCCAAAA | One of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3). |
| AT3G11400.2 | AAAAGCCCAAAA | One of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3). |
| AT3G11450 | AT3G11450.1 | TATGGGCCTGTAGCCCAAA | DNAJ heat shock N-terminal domain-containing protein / cell division protein-related; FUNCTIONS IN: heat shock protein binding, DNA binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), MYB-like (InterPro:IPR017877), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT5G06110.1); Has 51717 Blast hits to 34681 proteins in 2122 species: Archae - 166; Bacteria - 8879; Metazoa - 19405; Fungi - 4515; Plants - 2164; Viruses - 194; Other Eukaryotes - 16394 (source: NCBI BLink). |
| AT3G11690 | AT3G11690.1 | AAAGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06380.1); Has 48 Blast hits to 48 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G11730 | AT3G11730.1 | AAAAAGCCCAAAT | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein. |
| AT3G11940 | AT3G11940.1 | GAGCCCAAAC | One of two genes encoding the ribosomal protein S5. Mutants have semi-dominant developmental phenotypes. Most cell-division processes are delayed or disturbed in the heterozygous mutant, and development is completely arrested at an early embryonic stage in the homozygous mutant. |
| AT3G11940.2 | GAGCCCAAAC | One of two genes encoding the ribosomal protein S5. Mutants have semi-dominant developmental phenotypes. Most cell-division processes are delayed or disturbed in the heterozygous mutant, and development is completely arrested at an early embryonic stage in the homozygous mutant. |
| AT3G12370 | AT3G12370.1 | AATAGCCCAAA | ribosomal protein L10 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: ribosomal protein L10 family protein (TAIR:AT5G13510.1); Has 2905 Blast hits to 2905 proteins in 855 species: Archae - 0; Bacteria - 1744; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 1122 (source: NCBI BLink). |
| AT3G12650 | AT3G12650.1 | TGAGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13050 | AT3G13050.1 | AAAGCCCAAAT | transporter-related; FUNCTIONS IN: carbohydrate transmembrane transporter activity, transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: AtOCT4 (Arabidopsis thaliana ORGANIC CATION/CARNITINE TRANSPORTER4); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G20660.1); Has 24061 Blast hits to 23627 proteins in 1387 species: Archae - 383; Bacteria - 12067; Metazoa - 4488; Fungi - 4369; Plants - 1324; Viruses - 0; Other Eukaryotes - 1430 (source: NCBI BLink). |
| AT3G13410 | AT3G13410.1 | CAAGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55546.1); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13870 | AT3G13870.2 | TTTGGGCTTA | required for regulated cell expansion and normal root hair development. Encodes an evolutionarily conserved protein with putative GTP-binding motifs that is implicated in the control of vesicle trafficking between the endoplasmic reticulum and the Golgi compartments. |
| AT3G14150 | AT3G14150.1 | TTTTGGGCTGA | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink). |
| AT3G14150.2 | TTTTGGGCTGA | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink). |
| AT3G14160 | AT3G14160.1 | TCAGCCCAAAA | oxidoreductase; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G14140.1); Has 756 Blast hits to 755 proteins in 353 species: Archae - 0; Bacteria - 523; Metazoa - 76; Fungi - 30; Plants - 41; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT3G14410 | AT3G14410.1 | ATTTGGGCTTTAA | transporter-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: organic anion transmembrane transporter (TAIR:AT1G53660.1); Has 1496 Blast hits to 1495 proteins in 199 species: Archae - 4; Bacteria - 38; Metazoa - 438; Fungi - 259; Plants - 598; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT3G14415 | AT3G14415.1 | TTAAAGCCCAAAT | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: cotyledon, fruit, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14420.2); Has 8872 Blast hits to 8856 proteins in 1094 species: Archae - 112; Bacteria - 3084; Metazoa - 295; Fungi - 423; Plants - 161; Viruses - 0; Other Eukaryotes - 4797 (source: NCBI BLink). |
| AT3G14520 | AT3G14520.1 | AGCCCAAAC | terpene synthase/cyclase family protein; FUNCTIONS IN: lyase activity, magnesium ion binding; INVOLVED IN: metabolic process; EXPRESSED IN: embryo, sepal, pedicel; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Terpene synthase, metal-binding domain (InterPro:IPR005630), Terpenoid synthase (InterPro:IPR008949), Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Terpene synthase-like (InterPro:IPR001906); BEST Arabidopsis thaliana protein match is: terpene synthase/cyclase family protein (TAIR:AT3G14540.1); Has 1079 Blast hits to 1068 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1076; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G14890 | AT3G14890.1 | GTTAGGCCTTTAAAGCCCAAATAAGCCCAATG | phosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink). |
| AT3G14890.2 | GTTAGGCCTTTAAAGCCCAAATAAGCCCAATG | phosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink). |
| AT3G15260 | AT3G15260.1 | GTTTGGGCTTTG | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 4540 Blast hits to 4534 proteins in 402 species: Archae - 3; Bacteria - 375; Metazoa - 1354; Fungi - 535; Plants - 1305; Viruses - 11; Other Eukaryotes - 957 (source: NCBI BLink). |
| AT3G15260.2 | GTTTGGGCTTTG | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 4540 Blast hits to 4534 proteins in 402 species: Archae - 3; Bacteria - 375; Metazoa - 1354; Fungi - 535; Plants - 1305; Viruses - 11; Other Eukaryotes - 957 (source: NCBI BLink). |
| AT3G15351 | AT3G15351.1 | AGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15351.2 | AGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15351.3 | AGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15420 | AT3G15420.1 | TTTTGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80745.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15430 | AT3G15430.1 | TAAAGCCCAAAA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink). |
| AT3G15430.2 | TAAAGCCCAAAA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink). |
| AT3G16200 | AT3G16200.1 | TAACCGGTTTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 70 Blast hits to 70 proteins in 9 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT3G16640 | AT3G16640.1 | TTAAAGCCCAAAA | Encodes a protein homologous to translationally controlled tumor protein (TCTP) from Drosophila. In flies, TCTP functions guanine nucleotide exchange factor in the TOR signaling pathway. TCTP is expressed throughout the plant with highest levels seen in meristematic regions of the shoot and root. Loss of function alleles are not transmitted through the male gametophyte due to defects in pollen tube growth. Hypomorphs, generated through RNAi, are dwarf and have smaller cells. These plants also have defects in lateral and primary root growth as well as root hair growth. The phenotypes are similar to TOR mutants suggesting that TCTP functions in the is pathway in Arabidopsis as well. |
| AT3G16650 | AT3G16650.1 | TTTTGGGCTTTAA | PP1/PP2A phosphatases pleiotropic regulator 2 (PRL2); FUNCTIONS IN: nucleotide binding; INVOLVED IN: response to salt stress; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: PRL1 (PLEIOTROPIC REGULATORY LOCUS 1); basal transcription repressor/ nucleotide binding / protein binding (TAIR:AT4G15900.1); Has 58179 Blast hits to 24123 proteins in 639 species: Archae - 64; Bacteria - 6308; Metazoa - 27345; Fungi - 10914; Plants - 5200; Viruses - 0; Other Eukaryotes - 8348 (source: NCBI BLink). |
| AT3G16740 | AT3G16740.1 | ATTTGGGCT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G18780.1); Has 799 Blast hits to 770 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 797; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G17590 | AT3G17590.1 | TTAAAGCCCAAAT | Encodes the Arabidopsis homologue of yeast SNF5 and represents a conserved subunit of plant SWI/SNF complexes. |
| AT3G18070 | AT3G18070.1 | TTTTGGGCTC | BETA GLUCOSIDASE 43 (BGLU43); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU44 (B-S GLUCOSIDASE 44); (R)-amygdalin beta-glucosidase/ 4-methylumbelliferyl-beta-D-glucopyranoside beta-glucosidase/ beta-gentiobiose beta-glucosidase/ cellobiose glucosidase/ esculin beta-glucosidase/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT3G18080.1); Has 5757 Blast hits to 5525 proteins in 798 species: Archae - 100; Bacteria - 3122; Metazoa - 605; Fungi - 134; Plants - 855; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink). |
| AT3G18070.2 | TTTTGGGCTC | BETA GLUCOSIDASE 43 (BGLU43); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU44 (B-S GLUCOSIDASE 44); (R)-amygdalin beta-glucosidase/ 4-methylumbelliferyl-beta-D-glucopyranoside beta-glucosidase/ beta-gentiobiose beta-glucosidase/ cellobiose glucosidase/ esculin beta-glucosidase/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT3G18080.1); Has 5757 Blast hits to 5525 proteins in 798 species: Archae - 100; Bacteria - 3122; Metazoa - 605; Fungi - 134; Plants - 855; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink). |
| AT3G18190 | AT3G18190.1 | ACTGGGCCTTTTGGGCTAA | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, delta subunit (InterPro:IPR012717); BEST Arabidopsis thaliana protein match is: T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative (TAIR:AT1G24510.1); Has 14434 Blast hits to 14373 proteins in 2596 species: Archae - 394; Bacteria - 6460; Metazoa - 1798; Fungi - 981; Plants - 478; Viruses - 2; Other Eukaryotes - 4321 (source: NCBI BLink). |
| AT3G18420 | AT3G18420.1 | CAAGCCCAAAT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 2006 Blast hits to 1561 proteins in 415 species: Archae - 271; Bacteria - 982; Metazoa - 160; Fungi - 19; Plants - 64; Viruses - 0; Other Eukaryotes - 510 (source: NCBI BLink). |
| AT3G18430 | AT3G18430.1 | ATTTGGGCTTG | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: CAM9 (CALMODULIN 9); calcium ion binding (TAIR:AT3G51920.1); Has 3772 Blast hits to 3771 proteins in 389 species: Archae - 0; Bacteria - 11; Metazoa - 2178; Fungi - 257; Plants - 701; Viruses - 0; Other Eukaryotes - 625 (source: NCBI BLink). |
| AT3G18520 | AT3G18520.1 | TCAGCCCAAAT | Encodes a protein with similarity to histone deacetylases. Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation. |
| AT3G18520.2 | TCAGCCCAAAT | Encodes a protein with similarity to histone deacetylases. Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation. |
| AT3G18740 | AT3G18740.1 | TTTTGGGCTTC | 60S ribosomal protein L30 (RPL30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L30e (InterPro:IPR000231); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L30 (RPL30B) (TAIR:AT1G77940.1); Has 768 Blast hits to 768 proteins in 281 species: Archae - 141; Bacteria - 3; Metazoa - 274; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink). |
| AT3G19120 | AT3G19120.1 | ATAAGCCCAAAA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12010.1); Has 450 Blast hits to 448 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 288; Fungi - 49; Plants - 98; Viruses - 3; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G19460 | AT3G19460.1 | TTTGGGCTAA | reticulon family protein (RTNLB11); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB10) (TAIR:AT2G15280.1); Has 778 Blast hits to 778 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 530; Fungi - 0; Plants - 239; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G19460.2 | TTTGGGCTAA | reticulon family protein (RTNLB11); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB10) (TAIR:AT2G15280.1); Has 778 Blast hits to 778 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 530; Fungi - 0; Plants - 239; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G19470 | AT3G19470.1 | TTTTGGGCTTTTA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein-related (TAIR:AT3G22770.1); Has 770 Blast hits to 739 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 769; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G19470.2 | TTTTGGGCTTTTA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein-related (TAIR:AT3G22770.1); Has 770 Blast hits to 739 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 769; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G19590 | AT3G19590.1 | TTTTGGGCTTG | WD-40 repeat family protein / mitotic checkpoint protein, putative; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / mitotic checkpoint protein, putative (TAIR:AT1G49910.1); Has 5445 Blast hits to 4008 proteins in 309 species: Archae - 14; Bacteria - 1198; Metazoa - 1895; Fungi - 1134; Plants - 290; Viruses - 0; Other Eukaryotes - 914 (source: NCBI BLink). |
| AT3G19950 | AT3G19950.1 | TATGGGCTTCAGCCCAAAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G55530.1); Has 7591 Blast hits to 7571 proteins in 232 species: Archae - 0; Bacteria - 6; Metazoa - 2575; Fungi - 757; Plants - 2818; Viruses - 60; Other Eukaryotes - 1375 (source: NCBI BLink). |
| AT3G20270 | AT3G20270.1 | ATTTGGGCTTC | lipid-binding serum glycoprotein family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Bactericidal permeability-increasing protein, alpha/beta domain (InterPro:IPR017943), Lipid-binding serum glycoprotein, N-terminal (InterPro:IPR017942), Lipid-binding serum glycoprotein, C-terminal (InterPro:IPR001124); BEST Arabidopsis thaliana protein match is: lipid-binding serum glycoprotein family protein (TAIR:AT1G04970.1); Has 353 Blast hits to 347 proteins in 49 species: Archae - 2; Bacteria - 0; Metazoa - 298; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT3G20330 | AT3G20330.1 | GTTTGGGCTTC | encodes aspartate carbamoyltransferase catalyzing the second step in the de novo pyrimidine ribonucleotide biosynthesis |
| AT3G20330.1 | TTATGGGCTTTAGAAGCCCAAAT | encodes aspartate carbamoyltransferase catalyzing the second step in the de novo pyrimidine ribonucleotide biosynthesis |
| AT3G21350 | AT3G21350.1 | AAAGCCCAAAT | RNA polymerase transcriptional regulation mediator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit 6, metazoa/plant (InterPro:IPR016820), MED6 mediator (InterPro:IPR007018). |
| AT3G21350.2 | AAAGCCCAAAT | RNA polymerase transcriptional regulation mediator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit 6, metazoa/plant (InterPro:IPR016820), MED6 mediator (InterPro:IPR007018). |
| AT3G21370 | AT3G21370.1 | ATTTGGGCTTTG | BETA GLUCOSIDASE 19 (BGLU19); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU18 (BETA GLUCOSIDASE 18); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G52400.1); Has 5737 Blast hits to 5490 proteins in 796 species: Archae - 98; Bacteria - 3105; Metazoa - 607; Fungi - 134; Plants - 850; Viruses - 0; Other Eukaryotes - 943 (source: NCBI BLink). |
| AT3G22150 | AT3G22150.1 | GTTTGGGCTTCTTAAAGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 17039 Blast hits to 5252 proteins in 171 species: Archae - 2; Bacteria - 4; Metazoa - 101; Fungi - 62; Plants - 16511; Viruses - 0; Other Eukaryotes - 359 (source: NCBI BLink). |
| AT3G22310 | AT3G22310.1 | TTTGGGCTCA | Sequence similarity ot DEAD-box RNA helicases. Binds RNA and DNA. Involved in drought, salt and cold stress responses. |
| AT3G24070 | AT3G24070.1 | GTTTGGGCT | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G13450.1); Has 72 Blast hits to 72 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G24070.1 | GTTTGGGCTTTAGTAGGCCCAACT | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G13450.1); Has 72 Blast hits to 72 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G24860 | AT3G24860.1 | AAAAAGCCCAAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT2G44730.1); Has 700 Blast hits to 557 proteins in 131 species: Archae - 0; Bacteria - 29; Metazoa - 100; Fungi - 40; Plants - 346; Viruses - 61; Other Eukaryotes - 124 (source: NCBI BLink). |
| AT3G24929 | AT3G24929.1 | ATTTGGGCTTTGGGCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown. |
| AT3G25040 | AT3G25040.1 | AGCCCAAAACTAGGCCCATAA | ER lumen protein retaining receptor, putative / HDEL receptor, putative; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ERD2 (ENDOPLASMIC RETICULUM RETENTION DEFECTIVE 2); KDEL sequence binding / receptor (TAIR:AT1G29330.1); Has 642 Blast hits to 641 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 121; Plants - 119; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). |
| AT3G26650 | AT3G26650.1 | GAAGCCCAAAT | Encodes one of the two subunits forming the photosynthetic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and as such a constituent of the supramolecular complex with phosphoribulokinase (PRK) thought to be linked by a small peptide encoded by CP12-2. GapA-1 is coordinately expressed by light with PRK and CP12-2. The enzyme activity, tested in leaf protein extracts dropped significantly after external sucrose treatment for the photosynthetic GAPDH (NADPH-dependent) but not for the cytosolic GAPDH (NADH-dependent). |
| AT3G26670 | AT3G26670.1 | AAAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT3G23870.1); Has 715 Blast hits to 711 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 298; Fungi - 244; Plants - 119; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G26670.2 | AAAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT3G23870.1); Has 715 Blast hits to 711 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 298; Fungi - 244; Plants - 119; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G26670.3 | AAAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT3G23870.1); Has 715 Blast hits to 711 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 298; Fungi - 244; Plants - 119; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G29575 | AT3G29575.1 | TTTGGGCTC | ABI FIVE BINDING PROTEIN 3 (AFP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: TMAC2 (TWO OR MORE ABRES-CONTAINING GENE 2) (TAIR:AT3G02140.1); Has 97 Blast hits to 94 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G29575.3 | TTTGGGCTC | ABI FIVE BINDING PROTEIN 3 (AFP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: TMAC2 (TWO OR MORE ABRES-CONTAINING GENE 2) (TAIR:AT3G02140.1); Has 97 Blast hits to 94 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G29575.4 | TTTGGGCTC | ABI FIVE BINDING PROTEIN 3 (AFP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: TMAC2 (TWO OR MORE ABRES-CONTAINING GENE 2) (TAIR:AT3G02140.1); Has 97 Blast hits to 94 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G42790 | AT3G42790.1 | ATTTGGGCTTTTGGGCTTC | AL3 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. |
| AT3G46580 | AT3G46580.1 | CTTAATGGGCCCAAAAGCCCAAAA | Protein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G47390 | AT3G47390.1 | TGAGCCCAAAT | cytidine/deoxycytidylate deaminase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: riboflavin biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP02464 (InterPro:IPR012816), CMP/dCMP deaminase, zinc-binding (InterPro:IPR002125), Cytidine deaminase-like (InterPro:IPR016193), Riboflavin-specific deaminase, C-terminal (InterPro:IPR011549), Bacterial bifunctional deaminase-reductase, C-terminal (InterPro:IPR002734), Riboflavin biosynthesis protein RibD (InterPro:IPR004794); BEST Arabidopsis thaliana protein match is: cytidine/deoxycytidylate deaminase family protein (TAIR:AT4G20960.1); Has 5155 Blast hits to 5155 proteins in 1224 species: Archae - 129; Bacteria - 2674; Metazoa - 23; Fungi - 93; Plants - 54; Viruses - 14; Other Eukaryotes - 2168 (source: NCBI BLink). |
| AT3G49010 | AT3G49010.1 | CAAGCCCAAA | Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). |
| AT3G49010.2 | CAAGCCCAAA | Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). |
| AT3G49010.3 | CAAGCCCAAA | Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). |
| AT3G49010.4 | CAAGCCCAAA | Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). |
| AT3G49010.5 | CAAGCCCAAA | Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). |
| AT3G49400 | AT3G49400.1 | ATTTGGGCTTAGCCCATCA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 724 Blast hits to 645 proteins in 140 species: Archae - 0; Bacteria - 177; Metazoa - 195; Fungi - 136; Plants - 78; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT3G50210 | AT3G50210.1 | TTAGCCCAAAA | 2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). |
| AT3G50210.2 | TTAGCCCAAAA | 2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). |
| AT3G50210.3 | TTAGCCCAAAA | 2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). |
| AT3G51520 | AT3G51520.1 | ATTTGGGCTC | diacylglycerol acyltransferase family; FUNCTIONS IN: diacylglycerol O-acyltransferase activity, transferase activity, transferring acyl groups other than amino-acyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Diacylglycerol acyltransferase (InterPro:IPR007130); Has 889 Blast hits to 882 proteins in 180 species: Archae - 0; Bacteria - 135; Metazoa - 472; Fungi - 110; Plants - 62; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT3G51820 | AT3G51820.1 | GTTTGGGCTTTG | Encodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP. |
| AT3G51820.1 | TTTTGGGCTTTAT | Encodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP. |
| AT3G52140 | AT3G52140.1 | AAAAAGCCCAAACAAAGCCCATTAG | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G15290.1); Has 9395 Blast hits to 2929 proteins in 282 species: Archae - 109; Bacteria - 2193; Metazoa - 5294; Fungi - 854; Plants - 176; Viruses - 9; Other Eukaryotes - 760 (source: NCBI BLink). |
| AT3G52420 | AT3G52420.1 | GAAGCCCAAACCGGCCCATTT | encodes a 7 kDa chloroplast outer envelope membrane protein. |
| AT3G52480 | AT3G52480.1 | ATTTGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 11 Blast hits to 11 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52860 | AT3G52860.1 | AAAAGGCCCAATAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 68 Blast hits to 68 proteins in 28 species: Archae - 0; Bacteria - 2; Metazoa - 36; Fungi - 13; Plants - 13; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G53740 | AT3G53740.1 | ATAAGGCCCAATAAAAGCCCAAAC | 60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT3G53740.2 | ATAAGGCCCAATAAAAGCCCAAAC | 60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT3G53740.3 | ATAAGGCCCAATAAAAGCCCAAAC | 60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT3G53740.4 | ATAAGGCCCAATAAAAGCCCAAAC | 60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT3G53750 | AT3G53750.1 | GTTTGGGCTTTTATTGGGCCTTAT | Member of the Actin gene family. Expressed in mature pollen. |
| AT3G53970 | AT3G53970.1 | GAGCCCAAAA | proteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT3G53970.2 | GAGCCCAAAA | proteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT3G54210 | AT3G54210.1 | AGCCCAAAT | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 5385 Blast hits to 5385 proteins in 1530 species: Archae - 0; Bacteria - 3017; Metazoa - 102; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2110 (source: NCBI BLink). |
| AT3G55070 | AT3G55070.1 | CAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT3G55070.2 | CAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT3G57800 | AT3G57800.1 | ACCGGTTAAAGCCCAAAAGGCCCAAG | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G57800.2 | ACCGGTTAAAGCCCAAAAGGCCCAAG | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G57930 | AT3G57930.1 | CTAATGGGCCAAAGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae - 0; Bacteria - 32; Metazoa - 833; Fungi - 105; Plants - 87; Viruses - 30; Other Eukaryotes - 578 (source: NCBI BLink). |
| AT3G57930.2 | CTAATGGGCCAAAGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae - 0; Bacteria - 32; Metazoa - 833; Fungi - 105; Plants - 87; Viruses - 30; Other Eukaryotes - 578 (source: NCBI BLink). |
| AT3G57940 | AT3G57940.1 | GTTTGGGCTTTGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1726 (InterPro:IPR013562), Protein of unknown function DUF699, ATPase putative (InterPro:IPR007807); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10490.1); Has 915 Blast hits to 873 proteins in 391 species: Archae - 82; Bacteria - 412; Metazoa - 163; Fungi - 92; Plants - 21; Viruses - 3; Other Eukaryotes - 142 (source: NCBI BLink). |
| AT3G58690 | AT3G58690.1 | GTTTGGGCT | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G54820.1); Has 86522 Blast hits to 85517 proteins in 2739 species: Archae - 60; Bacteria - 8012; Metazoa - 37169; Fungi - 6786; Plants - 19292; Viruses - 369; Other Eukaryotes - 14834 (source: NCBI BLink). |
| AT3G60820 | AT3G60820.1 | CAAAGCCCAAATAAGGCCCATTATAAAGCC | Encodes 20S proteasome beta subunit PBF1 (PBF1). |
| AT3G60820.2 | CAAAGCCCAAATAAGGCCCATTATAAAGCC | Encodes 20S proteasome beta subunit PBF1 (PBF1). |
| AT3G61130 | AT3G61130.1 | TCAGCCCAAAA | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G61470 | AT3G61470.1 | AAAAAGCCCAAAA | Encodes a component of the light harvesting antenna complex of photosystem I. |
| AT3G61770 | AT3G61770.1 | CAAGCCCAAAGGCCCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 613 Blast hits to 613 proteins in 199 species: Archae - 0; Bacteria - 356; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). |
| AT3G62240 | AT3G62240.1 | ATTTGGGCTTAGTTTTGGGCTTT | zinc finger (C2H2 type) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: nucleic acid binding / protein binding / zinc ion binding (TAIR:AT2G47090.1); Has 3224 Blast hits to 1336 proteins in 208 species: Archae - 0; Bacteria - 156; Metazoa - 809; Fungi - 335; Plants - 89; Viruses - 4; Other Eukaryotes - 1831 (source: NCBI BLink). |
| AT3G62250 | AT3G62250.1 | AAAGCCCAAAACTAAGCCCAAAT | ubiquitin 5 (UBQ5); FUNCTIONS IN: protein binding, structural constituent of ribosome; INVOLVED IN: protein ubiquitination during ubiquitin-dependent protein catabolic process, protein modification process, translation; LOCATED IN: cytosolic small ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein S27a (InterPro:IPR002906), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: UBQ6; protein binding (TAIR:AT2G47110.1); Has 9355 Blast hits to 5604 proteins in 655 species: Archae - 78; Bacteria - 7; Metazoa - 4233; Fungi - 952; Plants - 1981; Viruses - 176; Other Eukaryotes - 1928 (source: NCBI BLink). |
| AT3G63170 | AT3G63170.1 | AAAGCCCAAAC | chalcone isomerase; FUNCTIONS IN: chalcone isomerase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chalcone isomerase, subgroup (InterPro:IPR003466), Chalcone isomerase (InterPro:IPR016087); BEST Arabidopsis thaliana protein match is: chalcone isomerase (TAIR:AT2G26310.1); Has 67 Blast hits to 67 proteins in 17 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G63170.1 | AAAGCCCAAAT | chalcone isomerase; FUNCTIONS IN: chalcone isomerase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chalcone isomerase, subgroup (InterPro:IPR003466), Chalcone isomerase (InterPro:IPR016087); BEST Arabidopsis thaliana protein match is: chalcone isomerase (TAIR:AT2G26310.1); Has 67 Blast hits to 67 proteins in 17 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G00020 | AT4G00020.1 | CAAGCCCAAA | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development. |
| AT4G00020.2 | CAAGCCCAAA | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development. |
| AT4G00500 | AT4G00500.1 | TAAAAGCCCAAAT | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT4G00500.2 | TAAAAGCCCAAAT | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT4G00520 | AT4G00520.2 | ATTTGGGCTTTTA | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink). |
| AT4G00520.3 | ATTTGGGCTTTTA | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink). |
| AT4G00740 | AT4G00740.1 | AGCCCAAAT | dehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive family protein (TAIR:AT4G10440.1); Has 538 Blast hits to 531 proteins in 57 species: Archae - 2; Bacteria - 72; Metazoa - 0; Fungi - 0; Plants - 461; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G01310 | AT4G01310.1 | GAAGCCCAAAT | ribosomal protein L5 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); Has 6408 Blast hits to 6408 proteins in 1765 species: Archae - 218; Bacteria - 2994; Metazoa - 181; Fungi - 187; Plants - 230; Viruses - 0; Other Eukaryotes - 2598 (source: NCBI BLink). |
| AT4G01320 | AT4G01320.1 | ATTTGGGCTTC | CAAX protease with broad substrate specificity. Localized exclusively to the endoplasmic reticulum. |
| AT4G01400 | AT4G01400.2 | GTGGGCCTTATTTGGGCTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COG4 transport (InterPro:IPR013167), Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 11639 Blast hits to 3936 proteins in 180 species: Archae - 0; Bacteria - 2; Metazoa - 206; Fungi - 141; Plants - 11004; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink). |
| AT4G01860 | AT4G01860.1 | GAAGCCCAAAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). |
| AT4G01860.2 | GAAGCCCAAAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). |
| AT4G02150 | AT4G02150.1 | TTTGGGCTTTAAAAAGCC | Encodes IMPORTIN ALPHA 3. Mutant plants act as suppressors of snc1 response and salicylic acid accumulation. Located in the nucleus. Involved in protein import. Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT4G02550 | AT4G02550.1 | GTTTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02550.2 | GTTTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02550.3 | GTTTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G04620 | AT4G04620.1 | AAAAGCCCAAAC | autophagy 8b (ATG8B); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: APG8A (AUTOPHAGY 8A); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase (TAIR:AT4G21980.2); Has 1162 Blast hits to 1160 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 581; Fungi - 125; Plants - 172; Viruses - 3; Other Eukaryotes - 281 (source: NCBI BLink). |
| AT4G04620.2 | AAAAGCCCAAAC | autophagy 8b (ATG8B); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: APG8A (AUTOPHAGY 8A); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase (TAIR:AT4G21980.2); Has 1162 Blast hits to 1160 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 581; Fungi - 125; Plants - 172; Viruses - 3; Other Eukaryotes - 281 (source: NCBI BLink). |
| AT4G08960 | AT4G08960.1 | TTTGGGCTTAT | phosphotyrosyl phosphatase activator (PTPA) family protein; FUNCTIONS IN: phosphatase activator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphotyrosyl phosphatase activator, PTPA (InterPro:IPR004327); Has 593 Blast hits to 585 proteins in 175 species: Archae - 0; Bacteria - 4; Metazoa - 247; Fungi - 211; Plants - 54; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT4G08960.1 | TTTGGGCTTATTATTGGG | phosphotyrosyl phosphatase activator (PTPA) family protein; FUNCTIONS IN: phosphatase activator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphotyrosyl phosphatase activator, PTPA (InterPro:IPR004327); Has 593 Blast hits to 585 proteins in 175 species: Archae - 0; Bacteria - 4; Metazoa - 247; Fungi - 211; Plants - 54; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT4G08960.1 | TTTGGGCTTATTATTGGG | phosphotyrosyl phosphatase activator (PTPA) family protein; FUNCTIONS IN: phosphatase activator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphotyrosyl phosphatase activator, PTPA (InterPro:IPR004327); Has 593 Blast hits to 585 proteins in 175 species: Archae - 0; Bacteria - 4; Metazoa - 247; Fungi - 211; Plants - 54; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT4G10100 | AT4G10100.1 | ATTTGGGCTTC | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT4G10100.2 | ATTTGGGCTTC | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT4G10100.3 | ATTTGGGCTTC | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT4G10140 | AT4G10140.1 | GTTTGGGCTTGGGCCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33490.1); Has 39 Blast hits to 39 proteins in 13 species: Archae - 0; Bacteria - 14; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G10430 | AT4G10430.1 | TTTTGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TMPIT-like (InterPro:IPR012926); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33230.1); Has 196 Blast hits to 196 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 146; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G10430.2 | TTTTGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TMPIT-like (InterPro:IPR012926); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33230.1); Has 196 Blast hits to 196 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 146; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G10430.3 | TTTTGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TMPIT-like (InterPro:IPR012926); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33230.1); Has 196 Blast hits to 196 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 146; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G10480 | AT4G10480.1 | TAAGCCCAAAT | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). |
| AT4G10480.2 | TAAGCCCAAAT | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). |
| AT4G11740 | AT4G11740.1 | AAAAAGCCCAAAA | Isolated as a suppressor of a dominant mutant in the Ara4 gene that was expressed in yeast ypt1 mutant strains. A novel protein with a small region of similarity to coil-coiled domain of yeast VSP27 protein. |
| AT4G13010 | AT4G13010.1 | TTAAAGCCCAAACAAGCCCAT | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 22117 Blast hits to 22019 proteins in 1513 species: Archae - 254; Bacteria - 11468; Metazoa - 1023; Fungi - 2323; Plants - 851; Viruses - 3; Other Eukaryotes - 6195 (source: NCBI BLink). |
| AT4G13170 | AT4G13170.1 | TTTTGGGCTTC | 60S ribosomal protein L13A (RPL13aC); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1401 Blast hits to 1401 proteins in 423 species: Archae - 212; Bacteria - 236; Metazoa - 292; Fungi - 130; Plants - 165; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink). |
| AT4G13200 | AT4G13200.1 | GGCCTTTTAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G13200.1 | TATATGGGCCTTTTAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G13830 | AT4G13830.1 | GAAGCCCAAAA | DnaJ-like protein (J20); nuclear gene |
| AT4G13830.2 | GAAGCCCAAAA | DnaJ-like protein (J20); nuclear gene |
| AT4G14870 | AT4G14870.1 | ATTTGGGCTTTATAAGGCCCATAA | P-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecE subunit of protein translocation complex (InterPro:IPR005807); Has 24 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G15000 | AT4G15000.1 | ATAAAGCCCAAAT | 60S ribosomal protein L27 (RPL27C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27B) (TAIR:AT3G22230.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT4G15000.2 | ATAAAGCCCAAAT | 60S ribosomal protein L27 (RPL27C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27B) (TAIR:AT3G22230.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT4G15240 | AT4G15240.1 | TGAGCCCAAAT | fringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT1G05280.1); Has 368 Blast hits to 364 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 109; Plants - 125; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT4G15910 | AT4G15910.1 | GTAAGGCCCATGAGCCCAAAT | encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants. |
| AT4G16630 | AT4G16630.1 | ATAAGCCCAGCCCAAA | DEAD/DEAH box helicase, putative (RH28); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G16280.1); Has 75014 Blast hits to 49574 proteins in 2104 species: Archae - 542; Bacteria - 21437; Metazoa - 22382; Fungi - 7369; Plants - 2826; Viruses - 629; Other Eukaryotes - 19829 (source: NCBI BLink). |
| AT4G18905 | AT4G18905.1 | TTTTGGGCTTTTA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G18900.1); Has 21032 Blast hits to 13958 proteins in 467 species: Archae - 10; Bacteria - 2153; Metazoa - 9350; Fungi - 4672; Plants - 2086; Viruses - 7; Other Eukaryotes - 2754 (source: NCBI BLink). |
| AT4G19006 | AT4G19006.1 | TGAGCCCAAAA | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus, proteasome regulatory particle, lid subcomplex; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT5G45620.1); Has 799 Blast hits to 796 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 466; Fungi - 144; Plants - 91; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT4G19150 | AT4G19150.1 | ATTTGGGCTTAGTTTGGGCTTA | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT3G09890.1); Has 67868 Blast hits to 22594 proteins in 807 species: Archae - 53; Bacteria - 4070; Metazoa - 36594; Fungi - 4728; Plants - 2294; Viruses - 864; Other Eukaryotes - 19265 (source: NCBI BLink). |
| AT4G19150.2 | ATTTGGGCTTAGTTTGGGCTTA | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT3G09890.1); Has 67868 Blast hits to 22594 proteins in 807 species: Archae - 53; Bacteria - 4070; Metazoa - 36594; Fungi - 4728; Plants - 2294; Viruses - 864; Other Eukaryotes - 19265 (source: NCBI BLink). |
| AT4G19710 | AT4G19710.1 | TAAGCCCAAAA | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT4G19710.2 | TAAGCCCAAAA | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT4G20280 | AT4G20280.1 | TGAGCCCAGCCCAAAT | Encodes TAF11, a putative TBP-associated factor (TBP: TATA binding protein). |
| AT4G20980 | AT4G20980.1 | TAAAGCCCATGAGCCCAAAC | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT5G44320.1); Has 344 Blast hits to 335 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 41; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT4G20980.2 | TAAAGCCCATGAGCCCAAAC | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT5G44320.1); Has 344 Blast hits to 335 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 41; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT4G20980.3 | TAAAGCCCATGAGCCCAAAC | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT5G44320.1); Has 344 Blast hits to 335 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 41; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT4G21980 | AT4G21980.1 | TAAAGGCCCAATTAGCCCAAAACGACAC | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. Highest expression in flowers. mRNA abundance increased during dark-induced carbon starvation. Predominantly cytoplasmic with or without N starvation. Upon concanamycin A the protein accumulates in the central vacuole as punctuate structures that resemble autophagic bodies. This localization is more abundant upon N starvation. |
| AT4G21980.2 | TAAAGGCCCAATTAGCCCAAAACGACAC | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. Highest expression in flowers. mRNA abundance increased during dark-induced carbon starvation. Predominantly cytoplasmic with or without N starvation. Upon concanamycin A the protein accumulates in the central vacuole as punctuate structures that resemble autophagic bodies. This localization is more abundant upon N starvation. |
| AT4G22285 | AT4G22285.1 | AGCCCAAAA | ubiquitin thiolesterase/ zinc ion binding; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin carboxyl-terminal hydrolase family protein (TAIR:AT4G22350.1); Has 2853 Blast hits to 2457 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1787; Fungi - 363; Plants - 246; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink). |
| AT4G22285.1 | TTAAAGCCCAAAT | ubiquitin thiolesterase/ zinc ion binding; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin carboxyl-terminal hydrolase family protein (TAIR:AT4G22350.1); Has 2853 Blast hits to 2457 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1787; Fungi - 363; Plants - 246; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink). |
| AT4G23820 | AT4G23820.1 | CTTATTGGGCCACTAAAGCCCAAAC | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G41870.1); Has 2405 Blast hits to 2400 proteins in 312 species: Archae - 2; Bacteria - 563; Metazoa - 8; Fungi - 896; Plants - 841; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). |
| AT4G23840 | AT4G23840.1 | GTTTGGGCTTTAGTGGCCCAATAAG | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT1G15740.1); Has 7635 Blast hits to 5145 proteins in 376 species: Archae - 2; Bacteria - 2863; Metazoa - 1987; Fungi - 78; Plants - 1868; Viruses - 40; Other Eukaryotes - 797 (source: NCBI BLink). |
| AT4G23890 | AT4G23890.1 | CAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 252 Blast hits to 252 proteins in 67 species: Archae - 0; Bacteria - 101; Metazoa - 15; Fungi - 4; Plants - 21; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). |
| AT4G25130 | AT4G25130.1 | TTTGGGCTC | peptide methionine sulfoxide reductase, putative; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity, oxidoreductase activity, acting on sulfur group of donors, disulfide as acceptor; INVOLVED IN: protein modification process, protein metabolic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase A (InterPro:IPR002569); BEST Arabidopsis thaliana protein match is: PMSR1 (PEPTIDEMETHIONINE SULFOXIDE REDUCTASE 1); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor / peptide-methionine-(S)-S-oxide reductase (TAIR:AT5G61640.1); Has 7185 Blast hits to 7183 proteins in 1356 species: Archae - 86; Bacteria - 3332; Metazoa - 164; Fungi - 91; Plants - 129; Viruses - 1; Other Eukaryotes - 3382 (source: NCBI BLink). |
| AT4G25140 | AT4G25140.1 | GAGCCCAAA | Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds. |
| AT4G25740 | AT4G25740.1 | TCAGCCCAATAAAAGCCCAAAT | 40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). |
| AT4G25740.2 | TCAGCCCAATAAAAGCCCAAAT | 40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). |
| AT4G26000 | AT4G26000.1 | AAAAGCCCAAACCATTAAG | Encodes a novel Arabidopsis gene encoding a polypeptide with K-homology (KH) RNA-binding modules, which acts on vegetative growth and pistil development. Genetic studies suggest that PEP interacts with element(s) of the CLAVATA signaling pathway. |
| AT4G26760 | AT4G26760.1 | GTTTGGGCT | MAP65-2; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anaphase; LOCATED IN: cortical microtubule, preprophase band, phragmoplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MAP65/ASE1 (InterPro:IPR007145); BEST Arabidopsis thaliana protein match is: ATMAP65-1 (MICROTUBULE-ASSOCIATED PROTEINS 65-1); microtubule binding (TAIR:AT5G55230.1); Has 7158 Blast hits to 5289 proteins in 462 species: Archae - 120; Bacteria - 495; Metazoa - 4190; Fungi - 430; Plants - 357; Viruses - 13; Other Eukaryotes - 1553 (source: NCBI BLink). |
| AT4G27800 | AT4G27800.1 | ATTTGGGCCTAAGCCCAAAA | protein phosphatase 2C PPH1 / PP2C PPH1 (PPH1); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: nucleolus, nucleus, chloroplast, protein serine/threonine phosphatase complex, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT1G43900.1); Has 3934 Blast hits to 3925 proteins in 294 species: Archae - 1; Bacteria - 130; Metazoa - 1167; Fungi - 465; Plants - 1291; Viruses - 9; Other Eukaryotes - 871 (source: NCBI BLink). |
| AT4G27800.2 | ATTTGGGCCTAAGCCCAAAA | protein phosphatase 2C PPH1 / PP2C PPH1 (PPH1); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: nucleolus, nucleus, chloroplast, protein serine/threonine phosphatase complex, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT1G43900.1); Has 3934 Blast hits to 3925 proteins in 294 species: Archae - 1; Bacteria - 130; Metazoa - 1167; Fungi - 465; Plants - 1291; Viruses - 9; Other Eukaryotes - 871 (source: NCBI BLink). |
| AT4G27800.3 | ATTTGGGCCTAAGCCCAAAA | protein phosphatase 2C PPH1 / PP2C PPH1 (PPH1); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: nucleolus, nucleus, chloroplast, protein serine/threonine phosphatase complex, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT1G43900.1); Has 3934 Blast hits to 3925 proteins in 294 species: Archae - 1; Bacteria - 130; Metazoa - 1167; Fungi - 465; Plants - 1291; Viruses - 9; Other Eukaryotes - 871 (source: NCBI BLink). |
| AT4G28030 | AT4G28030.1 | AAAAGCCCAAAC | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G06025.1); Has 235 Blast hits to 234 proteins in 78 species: Archae - 4; Bacteria - 115; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT4G28030.2 | AAAAGCCCAAAC | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G06025.1); Has 235 Blast hits to 234 proteins in 78 species: Archae - 4; Bacteria - 115; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT4G29220 | AT4G29220.1 | AGCCCAAAT | PHOSPHOFRUCTOKINASE 1 (PFK1); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: cytosol, 6-phosphofructokinase complex, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK3 (PHOSPHOFRUCTOKINASE 3); 6-phosphofructokinase (TAIR:AT4G26270.1); Has 4869 Blast hits to 4507 proteins in 1179 species: Archae - 20; Bacteria - 2587; Metazoa - 578; Fungi - 223; Plants - 227; Viruses - 2; Other Eukaryotes - 1232 (source: NCBI BLink). |
| AT4G30170 | AT4G30170.1 | AGCCCAAAT | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT2G18980.1); Has 2989 Blast hits to 2973 proteins in 233 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 149; Plants - 2794; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT4G30500 | AT4G30500.1 | AAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF788 (InterPro:IPR008506); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23940.1); Has 218 Blast hits to 218 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 72; Plants - 29; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT4G30620 | AT4G30620.1 | TTTGGGCTTTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0133 (InterPro:IPR004401); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24020.1); Has 1303 Blast hits to 1303 proteins in 522 species: Archae - 0; Bacteria - 1050; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). |
| AT4G30800 | AT4G30800.1 | TAAGCCCAAAA | 40S ribosomal protein S11 (RPS11B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: EMB1080 (embryo defective 1080); structural constituent of ribosome (TAIR:AT3G48930.1); Has 1016 Blast hits to 1014 proteins in 353 species: Archae - 160; Bacteria - 205; Metazoa - 241; Fungi - 98; Plants - 98; Viruses - 0; Other Eukaryotes - 214 (source: NCBI BLink). |
| AT4G31130 | AT4G31130.1 | GAGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); Has 47 Blast hits to 46 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31480 | AT4G31480.1 | ATTTGGGCTTTT | coatomer beta subunit, putative / beta-coat protein, putative / beta-COP, putative; FUNCTIONS IN: protein binding, clathrin binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat, endomembrane system, COPI vesicle coat; EXPRESSED IN: male gametophyte, guard cell; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Coatomer, beta subunit, C-terminal (InterPro:IPR011710), Armadillo-like helical (InterPro:IPR011989), Coatomer, beta subunit (InterPro:IPR016460), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: coatomer beta subunit, putative / beta-coat protein, putative / beta-COP, putative (TAIR:AT4G31490.1); Has 2128 Blast hits to 2064 proteins in 250 species: Archae - 0; Bacteria - 0; Metazoa - 1038; Fungi - 407; Plants - 225; Viruses - 0; Other Eukaryotes - 458 (source: NCBI BLink). |
| AT4G31770 | AT4G31770.1 | TTTTGGGCTTTT | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, protein serine/threonine phosphatase activity; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lariat debranching enzyme, C-terminal (InterPro:IPR007708), Metallophosphoesterase (InterPro:IPR004843); Has 452 Blast hits to 397 proteins in 153 species: Archae - 0; Bacteria - 12; Metazoa - 181; Fungi - 155; Plants - 28; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT4G32272 | AT4G32272.1 | TTAGCCCAAAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related (TAIR:AT4G31600.1); Has 1302 Blast hits to 1300 proteins in 174 species: Archae - 0; Bacteria - 4; Metazoa - 376; Fungi - 239; Plants - 567; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). |
| AT4G32570 | AT4G32570.1 | TTTTGGGCTGA | TIFY DOMAIN PROTEIN 8 (TIFY8); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G33250 | AT4G33250.1 | TTAGCCCAAACGACA | Encodes initiation factor 3k (EIF3k). |
| AT4G34160 | AT4G34160.1 | AATAGCCCAAAA | encodes a cyclin D-type protein involved in the switch from cell proliferation to the final stages of differentiation. The gene is transcriptionally regulated by cytokinin and brassinosteroid. Protein interacts with cyclin-dependent kinase inhibitor ICK1. |
| AT4G34900 | AT4G34900.1 | ATATTGGGCTTATTTTGGGCT | XXANTHINE DEHYDROGENASE 2 (XDH2); FUNCTIONS IN: in 8 functions; INVOLVED IN: allantoin biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Aldehyde oxidase/xanthine dehydrogenase (InterPro:IPR016208), Ferredoxin (InterPro:IPR001041), Molybdopterin dehydrogenase, FAD-binding (InterPro:IPR002346), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), [2Fe-2S]-binding (InterPro:IPR002888), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167), FAD-binding, type 2 (InterPro:IPR016166), CO dehydrogenase flavoprotein, C-terminal (InterPro:IPR005107), 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (InterPro:IPR016169), Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead (InterPro:IPR000674), Aldehyde oxidase and xanthine dehydrogenase, molybdopterin binding (InterPro:IPR008274); BEST Arabidopsis thaliana protein match is: XDH1 (XANTHINE DEHYDROGENASE 1); xanthine dehydrogenase (TAIR:AT4G34890.1); Has 15600 Blast hits to 15136 proteins in 810 species: Archae - 184; Bacteria - 7544; Metazoa - 1009; Fungi - 62; Plants - 139; Viruses - 0; Other Eukaryotes - 6662 (source: NCBI BLink). |
| AT4G34910 | AT4G34910.1 | AGCCCAAAATAAGCCCAATAT | DEAD/DEAH box helicase, putative (RH16); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 23736 Blast hits to 23298 proteins in 1666 species: Archae - 321; Bacteria - 8811; Metazoa - 4714; Fungi - 2993; Plants - 1279; Viruses - 4; Other Eukaryotes - 5614 (source: NCBI BLink). |
| AT4G35140 | AT4G35140.1 | GAAGCCCAAAAAGCCCAATG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G38480.1); Has 7738 Blast hits to 5690 proteins in 350 species: Archae - 10; Bacteria - 1449; Metazoa - 3242; Fungi - 1387; Plants - 483; Viruses - 0; Other Eukaryotes - 1167 (source: NCBI BLink). |
| AT4G35580 | AT4G35580.1 | TTTGGGCTTTAAGGCCTTTTTGGGCCCTA | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G35580.2 | TTTGGGCTTTAAGGCCTTTTTGGGCCCTA | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G36130 | AT4G36130.1 | GTTTGGGCTTCATAAGGCCCAATTA | 60S ribosomal protein L8 (RPL8C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, vacuole; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein L2, domain 3 (InterPro:IPR014726), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: EMB2296 (embryo defective 2296); structural constituent of ribosome (TAIR:AT2G18020.1); Has 7437 Blast hits to 7435 proteins in 2204 species: Archae - 236; Bacteria - 3125; Metazoa - 339; Fungi - 188; Plants - 929; Viruses - 0; Other Eukaryotes - 2620 (source: NCBI BLink). |
| AT4G36660 | AT4G36660.1 | ATTTGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65650.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G37470 | AT4G37470.1 | TTTTGGGCTTG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: catechol catabolic process, ortho-cleavage, protocatechuate catabolic process, ortho-cleavage; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT3G03990.1); Has 5337 Blast hits to 5337 proteins in 931 species: Archae - 35; Bacteria - 3866; Metazoa - 99; Fungi - 70; Plants - 165; Viruses - 18; Other Eukaryotes - 1084 (source: NCBI BLink). |
| AT4G37680 | AT4G37680.1 | TTAGCCCAAAC | heptahelical transmembrane protein HHP4 |
| AT4G38490 | AT4G38490.1 | TGAGCCCAAAAAAGGCCCATA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38930 | AT4G38930.1 | CAAAGCCCAAA | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 484 Blast hits to 484 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 135; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT4G38930.1 | GAAGCCCAAAC | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 484 Blast hits to 484 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 135; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT4G38930.2 | CAAAGCCCAAA | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 484 Blast hits to 484 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 135; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT4G38930.2 | GAAGCCCAAAC | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 484 Blast hits to 484 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 135; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT4G38980 | AT4G38980.1 | ATTTGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 6; Plants - 11; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT4G39150 | AT4G39150.1 | TAAAAGCCCAAAT | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G21510.1); Has 15752 Blast hits to 15663 proteins in 1939 species: Archae - 106; Bacteria - 5221; Metazoa - 3289; Fungi - 1398; Plants - 1148; Viruses - 18; Other Eukaryotes - 4572 (source: NCBI BLink). |
| AT5G01930 | AT5G01930.1 | TTTTGGGCTGA | (1-4)-beta-mannan endohydrolase, putative; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 5 (InterPro:IPR001547), Glycoside hydrolase, family 5, conserved site (InterPro:IPR018087), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: (1-4)-beta-mannan endohydrolase, putative (TAIR:AT5G66460.1); Has 442 Blast hits to 438 proteins in 116 species: Archae - 4; Bacteria - 111; Metazoa - 0; Fungi - 119; Plants - 187; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT5G01990 | AT5G01990.1 | GGGCTTTTGGGCTTAG | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT1G71090.1); Has 303 Blast hits to 283 proteins in 69 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 152; Plants - 93; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT5G02960 | AT5G02960.1 | TAAAAGCCCAAAA | 40S ribosomal protein S23 (RPS23B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S23, eukaryotic/archaeal (InterPro:IPR005680), Ribosomal protein S12/S23 (InterPro:IPR006032), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S23 (RPS23A) (TAIR:AT3G09680.1); Has 6124 Blast hits to 6121 proteins in 1817 species: Archae - 180; Bacteria - 2807; Metazoa - 329; Fungi - 198; Plants - 755; Viruses - 0; Other Eukaryotes - 1855 (source: NCBI BLink). |
| AT5G03240 | AT5G03240.1 | TTTTGGGCTTTT | encodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. |
| AT5G03240.2 | TTTTGGGCTTTT | encodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. |
| AT5G03240.3 | TTTTGGGCTTTT | encodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. |
| AT5G04130 | AT5G04130.1 | ATTTGGGCTTTTA | DNA topoisomerase, ATP-hydrolyzing, putative / DNA topoisomerase II, putative / DNA gyrase, putative; FUNCTIONS IN: DNA topoisomerase (ATP-hydrolyzing) activity, DNA binding, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IIA, conserved site (InterPro:IPR018522), DNA topoisomerase, type IIA, subunit B, region 2 (InterPro:IPR013506), DNA topoisomerase, type IIA, subunit B (InterPro:IPR000565), ATP-binding region, ATPase-like (InterPro:IPR003594), DNA topoisomerase, type IIA, subunit B, C-terminal (InterPro:IPR002288), DNA topoisomerase, type IIA, subunit B or N-terminal (InterPro:IPR001241), DNA topoisomerase, type IIA, subunit B or N-terminal, alpha-beta (InterPro:IPR013759), TOPRIM (InterPro:IPR006171), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), DNA topoisomerase, type IIA, central (InterPro:IPR013760); BEST Arabidopsis thaliana protein match is: ATP binding / DNA binding / DNA topoisomerase (ATP-hydrolyzing) (TAIR:AT3G10270.1); Has 23506 Blast hits to 21729 proteins in 4482 species: Archae - 75; Bacteria - 14076; Metazoa - 167; Fungi - 179; Plants - 62; Viruses - 72; Other Eukaryotes - 8875 (source: NCBI BLink). |
| AT5G04130.2 | ATTTGGGCTTTTA | DNA topoisomerase, ATP-hydrolyzing, putative / DNA topoisomerase II, putative / DNA gyrase, putative; FUNCTIONS IN: DNA topoisomerase (ATP-hydrolyzing) activity, DNA binding, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IIA, conserved site (InterPro:IPR018522), DNA topoisomerase, type IIA, subunit B, region 2 (InterPro:IPR013506), DNA topoisomerase, type IIA, subunit B (InterPro:IPR000565), ATP-binding region, ATPase-like (InterPro:IPR003594), DNA topoisomerase, type IIA, subunit B, C-terminal (InterPro:IPR002288), DNA topoisomerase, type IIA, subunit B or N-terminal (InterPro:IPR001241), DNA topoisomerase, type IIA, subunit B or N-terminal, alpha-beta (InterPro:IPR013759), TOPRIM (InterPro:IPR006171), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), DNA topoisomerase, type IIA, central (InterPro:IPR013760); BEST Arabidopsis thaliana protein match is: ATP binding / DNA binding / DNA topoisomerase (ATP-hydrolyzing) (TAIR:AT3G10270.1); Has 23506 Blast hits to 21729 proteins in 4482 species: Archae - 75; Bacteria - 14076; Metazoa - 167; Fungi - 179; Plants - 62; Viruses - 72; Other Eukaryotes - 8875 (source: NCBI BLink). |
| AT5G05820 | AT5G05820.1 | TTAGCCCAAA | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: organic anion transmembrane transporter (TAIR:AT3G11320.1); Has 2065 Blast hits to 2060 proteins in 219 species: Archae - 12; Bacteria - 61; Metazoa - 649; Fungi - 309; Plants - 765; Viruses - 0; Other Eukaryotes - 269 (source: NCBI BLink). |
| AT5G06130 | AT5G06130.1 | TTAGCCCAAAA | chaperone protein dnaJ-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61670.2); Has 65 Blast hits to 65 proteins in 13 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G06130.2 | TTAGCCCAAAA | chaperone protein dnaJ-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61670.2); Has 65 Blast hits to 65 proteins in 13 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G07230 | AT5G07230.1 | GAAGCCCAAAA | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, sepal, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G62080.1); Has 76 Blast hits to 76 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G07710 | AT5G07710.1 | TTTTGGGCTAA | exonuclease family protein; FUNCTIONS IN: exonuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G61390.1); Has 443 Blast hits to 439 proteins in 151 species: Archae - 0; Bacteria - 285; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT5G08280 | AT5G08280.1 | GTTTGGGCTAAGCCC | Encodes a protein with porphobilinogen deaminase activity. This protein is targeted to the chloroplast. |
| AT5G08290 | AT5G08290.1 | GGGCTTAGCCCAAAC | Encodes Dim1 homolog. |
| AT5G08300 | AT5G08300.1 | TAAATGGGTTTGGGCTAA | succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative; FUNCTIONS IN: succinate-CoA ligase (GDP-forming) activity, metal ion binding; INVOLVED IN: response to cadmium ion, metabolic process; LOCATED IN: mitochondrion, cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Succinyl-CoA ligase, alpha subunit (InterPro:IPR005810), ATP-citrate lyase/succinyl-CoA ligase (InterPro:IPR005811), NAD(P)-binding (InterPro:IPR016040), CoA-binding (InterPro:IPR003781), ATP-citrate lyase/succinyl-CoA ligase, active site (InterPro:IPR017440), Succinyl-CoA synthetase-like (InterPro:IPR016102); BEST Arabidopsis thaliana protein match is: succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative (TAIR:AT5G23250.1); Has 7223 Blast hits to 7222 proteins in 1236 species: Archae - 218; Bacteria - 2742; Metazoa - 383; Fungi - 188; Plants - 87; Viruses - 0; Other Eukaryotes - 3605 (source: NCBI BLink). |
| AT5G09770 | AT5G09770.1 | TATATGGGCCCAAAGCCCAAAC | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G64650.1); Has 5413 Blast hits to 5398 proteins in 1518 species: Archae - 0; Bacteria - 3032; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT5G09995 | AT5G09995.1 | TCAGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08530.1); Has 86 Blast hits to 86 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G09995.2 | TCAGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08530.1); Has 86 Blast hits to 86 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G09995.3 | TCAGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08530.1); Has 86 Blast hits to 86 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G11200 | AT5G11200.1 | TTTGGGCTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1). |
| AT5G11200.2 | TTTGGGCTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1). |
| AT5G11200.3 | TTTGGGCTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1). |
| AT5G13010 | AT5G13010.1 | TGAGCCCAAAC | embryo defective 3011 (EMB3011); FUNCTIONS IN: RNA helicase activity, helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP-dependent RNA helicase, putative (TAIR:AT3G26560.1); Has 7285 Blast hits to 6618 proteins in 979 species: Archae - 6; Bacteria - 1991; Metazoa - 2135; Fungi - 867; Plants - 393; Viruses - 401; Other Eukaryotes - 1492 (source: NCBI BLink). |
| AT5G13520 | AT5G13520.1 | CAAGCCCAAAA | peptidase M1 family protein; FUNCTIONS IN: metallopeptidase activity, binding, zinc ion binding; INVOLVED IN: proteolysis, leukotriene biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M1, membrane alanine aminopeptidase (InterPro:IPR001930), Peptidase M1, membrane alanine aminopeptidase, N-terminal (InterPro:IPR014782), Peptidase M1, leukotriene A4 hydrolase, aminopeptidase C-terminal (InterPro:IPR015211), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APM1 (AMINOPEPTIDASE M1); aminopeptidase (TAIR:AT4G33090.1); Has 5405 Blast hits to 5373 proteins in 1099 species: Archae - 78; Bacteria - 2335; Metazoa - 1533; Fungi - 322; Plants - 75; Viruses - 0; Other Eukaryotes - 1062 (source: NCBI BLink). |
| AT5G13900 | AT5G13900.1 | AGCCCAAAC | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: anchored to membrane; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT3G22600.1); Has 216 Blast hits to 214 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 216; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G14800 | AT5G14800.1 | AAAAGCCCAAAA | Delta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis. |
| AT5G14800.2 | AAAAGCCCAAAA | Delta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis. |
| AT5G15540 | AT5G15540.1 | AGCCCAAAA | Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis. |
| AT5G15640 | AT5G15640.1 | GGCTTTTAAGCCCAAAT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrion, mitochondrial inner membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT1G72820.1); Has 16366 Blast hits to 9494 proteins in 331 species: Archae - 0; Bacteria - 0; Metazoa - 7934; Fungi - 4673; Plants - 2394; Viruses - 0; Other Eukaryotes - 1365 (source: NCBI BLink). |
| AT5G16200 | AT5G16200.1 | TTTTGGGCTTT | 50S ribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G66890.1); Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G16486 | AT5G16486.1 | TGAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA-directed DNA polymerase (reverse transcriptase), related (InterPro:IPR015706); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G04650.1); Has 335 Blast hits to 332 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 335; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G16490 | AT5G16490.1 | TGAGCCCAAAA | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). It interacts with Rop1 and is involved in pollen tube growth and function, and exocytosis in the pollen tube tip. Protein most similar to RIC2 (family subgroup V). Gene is expressed in all tissues examined.Interacts with ROP2 during pavement cell morphogenesis and with ROP1 to promote apical F-actin assembly. |
| AT5G16610 | AT5G16610.1 | ATTGGCCCATTAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G16610.2 | ATTGGCCCATTAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G16830 | AT5G16830.1 | AGCCCAAAA | member of SYP2 Gene Family. Over-expression of the gene in tobacco protoplasts leads to a disruption of vacuolar transport from the prevacuolar compartment (PVC) to the vacuole, but not from the Golgi apparatus to the plasma membrane. |
| AT5G17230 | AT5G17230.1 | TTTTGGGCTC | Encodes phytoene synthase. |
| AT5G17230.2 | TTTTGGGCTC | Encodes phytoene synthase. |
| AT5G17230.3 | TTTTGGGCTC | Encodes phytoene synthase. |
| AT5G18770 | AT5G18770.1 | TTTTGGGCTAA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G18780.1); Has 1198 Blast hits to 1165 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1198; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G19380 | AT5G19380.1 | AATAGCCCAAAC | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12170.2). |
| AT5G19380.2 | AATAGCCCAAAC | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12170.2). |
| AT5G19510 | AT5G19510.1 | AAGGCCCATAAATAAGCCCAAAT | elongation factor 1B alpha-subunit 2 (eEF1Balpha2); FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation, defense response to bacterium; LOCATED IN: apoplast, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1B alpha-subunit 1 (eEF1Balpha1) (TAIR:AT5G12110.1); Has 715 Blast hits to 715 proteins in 199 species: Archae - 0; Bacteria - 2; Metazoa - 371; Fungi - 103; Plants - 110; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). |
| AT5G19750 | AT5G19750.1 | TAAAGCCCATATAAAAGCCCAAAA | peroxisomal membrane 22 kDa family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisomal membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein 22 kDa, putative (TAIR:AT2G14860.1); Has 15236 Blast hits to 7051 proteins in 599 species: Archae - 10; Bacteria - 4387; Metazoa - 5579; Fungi - 966; Plants - 2426; Viruses - 138; Other Eukaryotes - 1730 (source: NCBI BLink). |
| AT5G20090 | AT5G20090.1 | GAAGCCCAAACCCATTTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G20090.2 | GAAGCCCAAACCCATTTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G20090.3 | GAAGCCCAAACCCATTTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G20140 | AT5G20140.1 | AGCCCAAAT | SOUL heme-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790), SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT3G10130.1); Has 1348 Blast hits to 1346 proteins in 137 species: Archae - 10; Bacteria - 204; Metazoa - 88; Fungi - 0; Plants - 111; Viruses - 0; Other Eukaryotes - 935 (source: NCBI BLink). |
| AT5G20160 | AT5G20160.1 | TTTTGGGCTTTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT5G20160.2 | TTTTGGGCTTTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT5G20160.3 | TTTTGGGCTTTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT5G20165 | AT5G20165.1 | AGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1242 (InterPro:IPR009653); Has 273 Blast hits to 273 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 172; Fungi - 45; Plants - 20; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). |
| AT5G20165.2 | AGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1242 (InterPro:IPR009653); Has 273 Blast hits to 273 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 172; Fungi - 45; Plants - 20; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). |
| AT5G20170 | AT5G20170.1 | TTTTGGGCTTTTAATGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 53 Blast hits to 53 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 35; Fungi - 3; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G20180 | AT5G20180.1 | TAAAGCCCATTAAAAGCCCAAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G20180.2 | TAAAGCCCATTAAAAGCCCAAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G20500 | AT5G20500.1 | TTTTGGGCTTTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT1G77370.1); Has 4164 Blast hits to 4161 proteins in 811 species: Archae - 10; Bacteria - 1751; Metazoa - 378; Fungi - 232; Plants - 403; Viruses - 108; Other Eukaryotes - 1282 (source: NCBI BLink). |
| AT5G20570 | AT5G20570.1 | CAAAGCCCAAA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein. |
| AT5G20570.2 | CAAAGCCCAAA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein. |
| AT5G20570.3 | CAAAGCCCAAA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein. |
| AT5G20790 | AT5G20790.1 | TTTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43110.1); Has 11 Blast hits to 11 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G20850 | AT5G20850.1 | ATTTGGGCTTTAA | Encodes a homolog of yeast RAD51. Its mRNA is most abundant in early flower buds and is expressed at high levels in exponentially growing cells in suspension cultures and is induced in response to gamma radiation. |
| AT5G21050 | AT5G21050.1 | ATTTGGGCTTCTAGCCCATAA | LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Hyccin (InterPro:IPR018619); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64090.1); Has 170 Blast hits to 170 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 133; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G22100 | AT5G22100.1 | TAAGCCCAAAA | RNA cyclase family protein; FUNCTIONS IN: RNA-3'-phosphate cyclase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA 3'-terminal phosphate cyclase- like (InterPro:IPR000228), RNA 3'-terminal phosphate cyclase, insert region (InterPro:IPR013796), RNA 3'-terminal phosphate cyclase-like, eukaryotic (InterPro:IPR016443), RNA 3'-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta (InterPro:IPR013792); Has 760 Blast hits to 750 proteins in 310 species: Archae - 113; Bacteria - 208; Metazoa - 233; Fungi - 95; Plants - 22; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). |
| AT5G23250 | AT5G23250.1 | TAAGCCCAAAA | succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative; FUNCTIONS IN: succinate-CoA ligase (ADP-forming) activity, succinate-CoA ligase (GDP-forming) activity, binding, ATP citrate synthase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Succinyl-CoA ligase, alpha subunit (InterPro:IPR005810), ATP-citrate lyase/succinyl-CoA ligase (InterPro:IPR005811), NAD(P)-binding (InterPro:IPR016040), CoA-binding (InterPro:IPR003781), ATP-citrate lyase/succinyl-CoA ligase, active site (InterPro:IPR017440), Succinyl-CoA synthetase-like (InterPro:IPR016102); BEST Arabidopsis thaliana protein match is: succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative (TAIR:AT5G08300.1); Has 7114 Blast hits to 7113 proteins in 1234 species: Archae - 196; Bacteria - 2692; Metazoa - 350; Fungi - 188; Plants - 87; Viruses - 0; Other Eukaryotes - 3601 (source: NCBI BLink). |
| AT5G23250.2 | TAAGCCCAAAA | succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative; FUNCTIONS IN: succinate-CoA ligase (ADP-forming) activity, succinate-CoA ligase (GDP-forming) activity, binding, ATP citrate synthase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Succinyl-CoA ligase, alpha subunit (InterPro:IPR005810), ATP-citrate lyase/succinyl-CoA ligase (InterPro:IPR005811), NAD(P)-binding (InterPro:IPR016040), CoA-binding (InterPro:IPR003781), ATP-citrate lyase/succinyl-CoA ligase, active site (InterPro:IPR017440), Succinyl-CoA synthetase-like (InterPro:IPR016102); BEST Arabidopsis thaliana protein match is: succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative (TAIR:AT5G08300.1); Has 7114 Blast hits to 7113 proteins in 1234 species: Archae - 196; Bacteria - 2692; Metazoa - 350; Fungi - 188; Plants - 87; Viruses - 0; Other Eukaryotes - 3601 (source: NCBI BLink). |
| AT5G24130 | AT5G24130.1 | GAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: leaf whorl, petal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 31 Blast hits to 31 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G24640 | AT5G24640.1 | ATAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41730.1); Has 13 Blast hits to 13 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G24650 | AT5G24650.1 | ATAAAGCCCAAAT | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, plasma membrane, vacuole, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT3G49560.1); Has 132 Blast hits to 130 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G24830 | AT5G24830.1 | TTAATGGGCCATAGCCCAAAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G12300.1); Has 22335 Blast hits to 5701 proteins in 178 species: Archae - 6; Bacteria - 14; Metazoa - 418; Fungi - 405; Plants - 20611; Viruses - 0; Other Eukaryotes - 881 (source: NCBI BLink). |
| AT5G27395 | AT5G27395.1 | GCGTTTTGGGCTCA | P-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim44 (InterPro:IPR007379); Has 247 Blast hits to 247 proteins in 89 species: Archae - 0; Bacteria - 90; Metazoa - 76; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G27395.2 | GCGTTTTGGGCTCA | P-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim44 (InterPro:IPR007379); Has 247 Blast hits to 247 proteins in 89 species: Archae - 0; Bacteria - 90; Metazoa - 76; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G27770 | AT5G27770.1 | ATTTGGGCTTG | 60S ribosomal protein L22 (RPL22C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22e (InterPro:IPR002671); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L22-2 (RPL22B) (TAIR:AT3G05560.3); Has 492 Blast hits to 492 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 89; Plants - 73; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT5G28370 | AT5G28370.1 | ATTTGGGCTAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G28460.1); Has 22506 Blast hits to 6026 proteins in 190 species: Archae - 7; Bacteria - 27; Metazoa - 841; Fungi - 534; Plants - 20012; Viruses - 0; Other Eukaryotes - 1085 (source: NCBI BLink). |
| AT5G35730 | AT5G35730.1 | TAAAGCCCAAAT | EXS family protein / ERD1/XPR1/SYG1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EXS, C-terminal (InterPro:IPR004342); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32295.1); Has 598 Blast hits to 593 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 226; Fungi - 179; Plants - 106; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G37510 | AT5G37510.1 | AAAAAGCCCACAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. |
| AT5G37510.1 | TAAAAGCCCATAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. |
| AT5G37510.2 | AAAAAGCCCACAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. |
| AT5G37510.2 | TAAAAGCCCATAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. |
| AT5G38650 | AT5G38650.1 | AAAAGCCCAAATGGGCCTTG | proteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT1G67250.1); Has 161 Blast hits to 161 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT5G39530 | AT5G39530.1 | GAAGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39520.1); Has 172 Blast hits to 172 proteins in 54 species: Archae - 0; Bacteria - 88; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G41350 | AT5G41350.1 | TGAGCCCAAAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: RHB1A; protein binding / zinc ion binding (TAIR:AT4G00335.2); Has 5625 Blast hits to 5615 proteins in 210 species: Archae - 0; Bacteria - 0; Metazoa - 1934; Fungi - 450; Plants - 2157; Viruses - 38; Other Eukaryotes - 1046 (source: NCBI BLink). |
| AT5G41760 | AT5G41760.1 | TAAAAGCCCAAAGGCCCAGA | nucleotide-sugar transporter family protein; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, CMP-sialic acid transmembrane transporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: endomembrane system, integral to membrane, Golgi membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271), UDP-galactose transporter (InterPro:IPR004689); BEST Arabidopsis thaliana protein match is: nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT4G35335.1); Has 819 Blast hits to 807 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 511; Fungi - 85; Plants - 92; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). |
| AT5G41760.2 | TAAAAGCCCAAAGGCCCAGA | nucleotide-sugar transporter family protein; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, CMP-sialic acid transmembrane transporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: endomembrane system, integral to membrane, Golgi membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271), UDP-galactose transporter (InterPro:IPR004689); BEST Arabidopsis thaliana protein match is: nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT4G35335.1); Has 819 Blast hits to 807 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 511; Fungi - 85; Plants - 92; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). |
| AT5G42340 | AT5G42340.1 | ATTTGGGCTTG | binding / ubiquitin-protein ligase; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: PUB13 (PLANT U-BOX 13); ubiquitin-protein ligase (TAIR:AT3G46510.1); Has 5217 Blast hits to 3549 proteins in 234 species: Archae - 0; Bacteria - 37; Metazoa - 2238; Fungi - 444; Plants - 1898; Viruses - 3; Other Eukaryotes - 597 (source: NCBI BLink). |
| AT5G44320 | AT5G44320.1 | AGCCCAAAC | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT4G20980.3); Has 341 Blast hits to 337 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 40; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G45420 | AT5G45420.1 | AAAAGCCCAAAA | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Homeodomain-like (InterPro:IPR009057), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT3G11450.1); Has 321 Blast hits to 281 proteins in 86 species: Archae - 0; Bacteria - 2; Metazoa - 227; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT5G45730 | AT5G45730.1 | TTTTGGGCTTA | DC1 domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT3G07000.1); Has 1228 Blast hits to 487 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 1213; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G45950 | AT5G45950.1 | TTAAAGCCCAAAA | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT5G45960.1); Has 1989 Blast hits to 1968 proteins in 231 species: Archae - 0; Bacteria - 404; Metazoa - 1; Fungi - 6; Plants - 1558; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G45990 | AT5G45990.1 | TTTTGGGCTTTTGGGCTTTTT | crooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3943 Blast hits to 1642 proteins in 191 species: Archae - 15; Bacteria - 34; Metazoa - 1807; Fungi - 1089; Plants - 496; Viruses - 0; Other Eukaryotes - 502 (source: NCBI BLink). |
| AT5G49920 | AT5G49920.1 | AGCCCAAAT | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G46920.1); Has 185 Blast hits to 185 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G51300 | AT5G51300.1 | ATTTGGGCTTATAATGGGCCAA | splicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). |
| AT5G51300.2 | ATTTGGGCTTATAATGGGCCAA | splicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). |
| AT5G51300.3 | ATTTGGGCTTATAATGGGCCAA | splicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). |
| AT5G51780 | AT5G51780.1 | TTTTGGGCTCA | basix helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basix helix-loop-helix (bHLH) family protein (TAIR:AT4G25400.1); Has 144 Blast hits to 143 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 143; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G52440 | AT5G52440.1 | CAAGCCCAAAT | HCF106; nuclear gene for chloroplast. Thylakoid membrane delta pH translocation pathway component protein; related to Escherichia coli TatA and TatB |
| AT5G54600 | AT5G54600.1 | ATTTGGGCT | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). |
| AT5G54600.2 | ATTTGGGCT | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). |
| AT5G54680 | AT5G54680.1 | AAAGCCCAAAA | iaa-leucine resistant3 (ILR3); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G51070.1); Has 563 Blast hits to 555 proteins in 74 species: Archae - 4; Bacteria - 10; Metazoa - 69; Fungi - 13; Plants - 431; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). |
| AT5G54770 | AT5G54770.1 | ATTTGGGCTTG | Encodes a thiamine biosynthetic gene that has a dual function in thiamine biosynthesis and mitochondrial DNA damage tolerance. It appears to be involved in producing the thiazole portion of thiamine (vitamin B1). A crystal structure of the protein reveals that it forms a 2-ring homo-octamer. |
| AT5G54930 | AT5G54930.1 | TAAAAGCCCAAAC | AT hook motif-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif-containing protein (TAIR:AT5G52890.1); Has 26 Blast hits to 26 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G54930.2 | TAAAAGCCCAAAC | AT hook motif-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif-containing protein (TAIR:AT5G52890.1); Has 26 Blast hits to 26 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55140 | AT5G55140.1 | TAATTGGGCCCAGATAAAGCCCAAAT | ribosomal protein L30 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L30, bacterial-type (InterPro:IPR005996), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); Has 388 Blast hits to 388 proteins in 155 species: Archae - 0; Bacteria - 328; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT5G57160 | AT5G57160.1 | AGCCCAAAA | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
| AT5G58020 | AT5G58020.1 | AGCCCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF602 (InterPro:IPR006735); Has 270 Blast hits to 270 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 71; Plants - 21; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). |
| AT5G58020.1 | CAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF602 (InterPro:IPR006735); Has 270 Blast hits to 270 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 71; Plants - 21; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). |
| AT5G58240 | AT5G58240.1 | ATTTGGGCTTC | Encodes a Fhit protein. Has nucleoside phosphoramidase and adenylylsulfatase activities. |
| AT5G58240.2 | ATTTGGGCTTC | Encodes a Fhit protein. Has nucleoside phosphoramidase and adenylylsulfatase activities. |
| AT5G58250 | AT5G58250.1 | GAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 230 Blast hits to 230 proteins in 64 species: Archae - 0; Bacteria - 88; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). |
| AT5G58560 | AT5G58560.1 | AGCCCAAAT | phosphatidate cytidylyltransferase family protein; FUNCTIONS IN: phosphatidate cytidylyltransferase activity, transferase activity, transferring phosphorus-containing groups; INVOLVED IN: phospholipid biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidate cytidylyltransferase (InterPro:IPR000374); BEST Arabidopsis thaliana protein match is: VTE5 (vitamin E pathway gene5); phosphatidate cytidylyltransferase/ phytol kinase (TAIR:AT5G04490.1); Has 383 Blast hits to 383 proteins in 126 species: Archae - 22; Bacteria - 164; Metazoa - 0; Fungi - 29; Plants - 70; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G58560.1 | ATAAAGCCCAAACTAGGCCCACA | phosphatidate cytidylyltransferase family protein; FUNCTIONS IN: phosphatidate cytidylyltransferase activity, transferase activity, transferring phosphorus-containing groups; INVOLVED IN: phospholipid biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidate cytidylyltransferase (InterPro:IPR000374); BEST Arabidopsis thaliana protein match is: VTE5 (vitamin E pathway gene5); phosphatidate cytidylyltransferase/ phytol kinase (TAIR:AT5G04490.1); Has 383 Blast hits to 383 proteins in 126 species: Archae - 22; Bacteria - 164; Metazoa - 0; Fungi - 29; Plants - 70; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G58800 | AT5G58800.1 | CAAGCCCAAAA | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). |
| AT5G58800.2 | CAAGCCCAAAA | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). |
| AT5G58900 | AT5G58900.1 | GAGCCCAAAT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), SANT, eukarya (InterPro:IPR017884), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-related (InterPro:IPR012287), Myb-type HTH DNA-binding domain (InterPro:IPR017930); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT2G38090.1); Has 1021 Blast hits to 1019 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 2; Plants - 822; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT5G59210 | AT5G59210.1 | ATAAGCCCAAAT | myosin heavy chain-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05320.3); Has 52386 Blast hits to 29309 proteins in 1451 species: Archae - 516; Bacteria - 4841; Metazoa - 28674; Fungi - 3719; Plants - 1637; Viruses - 146; Other Eukaryotes - 12853 (source: NCBI BLink). |
| AT5G59210.2 | ATAAGCCCAAAT | myosin heavy chain-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05320.3); Has 52386 Blast hits to 29309 proteins in 1451 species: Archae - 516; Bacteria - 4841; Metazoa - 28674; Fungi - 3719; Plants - 1637; Viruses - 146; Other Eukaryotes - 12853 (source: NCBI BLink). |
| AT5G59570 | AT5G59570.1 | AGCCCAAAC | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PCL1 (PHYTOCLOCK 1); DNA binding / transcription factor (TAIR:AT3G46640.2); Has 892 Blast hits to 892 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 875; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G60030 | AT5G60030.1 | GTTTGGGCTTTTT | unknown protein; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75335.1); Has 210106 Blast hits to 83883 proteins in 2248 species: Archae - 772; Bacteria - 18533; Metazoa - 91346; Fungi - 18704; Plants - 7840; Viruses - 1079; Other Eukaryotes - 71832 (source: NCBI BLink). |
| AT5G60030.1 | TTTTGGGCTTTGTTGGCCCATCT | unknown protein; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75335.1); Has 210106 Blast hits to 83883 proteins in 2248 species: Archae - 772; Bacteria - 18533; Metazoa - 91346; Fungi - 18704; Plants - 7840; Viruses - 1079; Other Eukaryotes - 71832 (source: NCBI BLink). |
| AT5G60980 | AT5G60980.1 | GAAGCCCAAA | nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: transport, nucleocytoplasmic transport; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear transport factor 2 (InterPro:IPR002075), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nuclear transport factor 2, Eukaryote (InterPro:IPR018222), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G25150.1); Has 32736 Blast hits to 13928 proteins in 925 species: Archae - 9; Bacteria - 11373; Metazoa - 9852; Fungi - 2838; Plants - 4351; Viruses - 467; Other Eukaryotes - 3846 (source: NCBI BLink). |
| AT5G60980.2 | GAAGCCCAAA | nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: transport, nucleocytoplasmic transport; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear transport factor 2 (InterPro:IPR002075), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nuclear transport factor 2, Eukaryote (InterPro:IPR018222), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G25150.1); Has 32736 Blast hits to 13928 proteins in 925 species: Archae - 9; Bacteria - 11373; Metazoa - 9852; Fungi - 2838; Plants - 4351; Viruses - 467; Other Eukaryotes - 3846 (source: NCBI BLink). |
| AT5G63190 | AT5G63190.1 | AGCCCAAAA | MA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 1077; Fungi - 6; Plants - 322; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). |
| AT5G63190.2 | AGCCCAAAA | MA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 1077; Fungi - 6; Plants - 322; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). |
| AT5G63670 | AT5G63670.1 | TAAAAGCCCAAATACGGCCCAATAA | SPT4 HOMOLOG 2 (SPT42); FUNCTIONS IN: positive transcription elongation factor activity, zinc ion binding; INVOLVED IN: positive regulation of transcription, N-terminal protein myristoylation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation Spt4 (InterPro:IPR009287), Transcription initiation Spt4-like (InterPro:IPR016046); BEST Arabidopsis thaliana protein match is: positive transcription elongation factor/ zinc ion binding (TAIR:AT5G08565.1); Has 324 Blast hits to 324 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 119; Plants - 27; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT5G63840 | AT5G63840.1 | TTTGGGCTATGGGCCTT | radial swelling mutant shown to be specifically impaired in cellulose production. Encodes the alpha-subunit of a glucosidase II enzyme. |
| AT5G64270 | AT5G64270.1 | TTAGCCCAAAT | splicing factor, putative; FUNCTIONS IN: binding; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Splicing factor 3B subunit 1 (InterPro:IPR015016), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A regulator (TAIR:AT1G25490.1); Has 1441 Blast hits to 1324 proteins in 270 species: Archae - 12; Bacteria - 198; Metazoa - 607; Fungi - 267; Plants - 142; Viruses - 10; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT5G64350 | AT5G64350.1 | TTTTGGGCT | FK506-BINDING PROTEIN (FKBP12); FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin-related / FKBP-type peptidyl-prolyl cis-trans isomerase-related (TAIR:AT4G25340.1); Has 5723 Blast hits to 5615 proteins in 1032 species: Archae - 25; Bacteria - 2709; Metazoa - 1179; Fungi - 351; Plants - 350; Viruses - 0; Other Eukaryotes - 1109 (source: NCBI BLink). |
| AT5G64400 | AT5G64400.1 | GTTTGGGCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09570.1); Has 102 Blast hits to 100 proteins in 33 species: Archae - 0; Bacteria - 9; Metazoa - 16; Fungi - 2; Plants - 47; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT5G64400.2 | GTTTGGGCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09570.1); Has 102 Blast hits to 100 proteins in 33 species: Archae - 0; Bacteria - 9; Metazoa - 16; Fungi - 2; Plants - 47; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT5G65110 | AT5G65110.1 | ATAAAGCCCAAAAGCCCAC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT5G65110.2 | ATAAAGCCCAAAAGCCCAC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT5G65650 | AT5G65650.1 | TAAGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G36660.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G65960 | AT5G65960.1 | ATTTGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 294 Blast hits to 294 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 21; Plants - 119; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT5G66410 | AT5G66410.1 | ATTTGGGCTCA | Encodes a protein that functions in microtubule assembly. Plants with reduced levels of both PLP3a (At3g50960) and PLP3b show defects in cytokinesis, cortical microtubule array formation, oriented cell growth, and maintenance of proper ploidy. |
| AT5G67070 | AT5G67070.1 | GAAGCCCAAAA | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT5G67100 | AT5G67100.1 | TTTTGGGCTTTAT | Encodes the putative catalytic subunit of the DNA polymerase alpha. Interacts with genes involved in chromatin-mediated cellular memory. ICU2 genetically interacts with TERMINAL FLOWER2, the ortholog of HETEROCHROMATIN PROTEIN1 of animals and yeasts, and with the Polycomb group (PcG) gene CURLY LEAF. A number of regulatory genes were derepressed in the icu2-1 mutant, including genes associated with flowering time, floral meristem, and floral organ identity. Mutant has curled, involute leaves and causes early flowering. |
| AT5G67220 | AT5G67220.1 | TAAGCCCACTAAAGCCCAAAA | nitrogen regulation family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, oxidation reduction, tRNA processing, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G49640.1); Has 7771 Blast hits to 7769 proteins in 1423 species: Archae - 42; Bacteria - 4261; Metazoa - 411; Fungi - 347; Plants - 96; Viruses - 0; Other Eukaryotes - 2614 (source: NCBI BLink). |
| AT5G67270 | AT5G67270.1 | TTTTGGGCTTAG | encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
| AT5G67520 | AT5G67520.1 | CAAGCCCAAAA | adenylylsulfate kinase, putative; FUNCTIONS IN: kinase activity, transferase activity, transferring phosphorus-containing groups, ATP binding; INVOLVED IN: sulfate assimilation; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Adenylylsulphate kinase, C-terminal (InterPro:IPR002891); BEST Arabidopsis thaliana protein match is: AKN2 (APS-kinase 2); ATP binding / adenylylsulfate kinase/ kinase/ transferase, transferring phosphorus-containing groups (TAIR:AT4G39940.1); Has 3571 Blast hits to 3571 proteins in 926 species: Archae - 35; Bacteria - 1801; Metazoa - 220; Fungi - 202; Plants - 70; Viruses - 2; Other Eukaryotes - 1241 (source: NCBI BLink). |
| ATCG00330 | ATCG00330.1 | GTTTGGGCT | 30S chloroplast ribosomal protein S14 |
| ATCG00340 | ATCG00340.1 | GTTTGGGCTCA | Encodes the D1 subunit of photosystem I and II reaction centers. |