| Locus | Gene model | Sequence | Description |
| AT1G01670 | AT1G01670.1 | CGTGACGTGTCGT | U-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: U-box domain-containing protein (TAIR:AT1G01680.1); Has 2979 Blast hits to 2299 proteins in 198 species: Archae - 2; Bacteria - 86; Metazoa - 849; Fungi - 177; Plants - 922; Viruses - 10; Other Eukaryotes - 933 (source: NCBI BLink). |
| AT1G03520 | AT1G03520.1 | GACGTGTCT | glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein (TAIR:AT4G03340.1); Has 691 Blast hits to 688 proteins in 86 species: Archae - 0; Bacteria - 14; Metazoa - 462; Fungi - 0; Plants - 190; Viruses - 14; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT1G03520.2 | GACGTGTCT | glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein (TAIR:AT4G03340.1); Has 691 Blast hits to 688 proteins in 86 species: Archae - 0; Bacteria - 14; Metazoa - 462; Fungi - 0; Plants - 190; Viruses - 14; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT1G05500 | AT1G05500.1 | ATGACGTGTCAT | NTMC2T2.1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: SYTD (TAIR:AT5G11100.1); Has 9319 Blast hits to 5090 proteins in 209 species: Archae - 0; Bacteria - 0; Metazoa - 6456; Fungi - 877; Plants - 1262; Viruses - 0; Other Eukaryotes - 724 (source: NCBI BLink). |
| AT1G06360 | AT1G06360.1 | GGACACGTC | fatty acid desaturase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: lipid metabolic process; CONTAINS InterPro DOMAIN/s: Fatty acid desaturase, type 1, core (InterPro:IPR015876), Fatty acid desaturase, type 1 (InterPro:IPR005804); BEST Arabidopsis thaliana protein match is: fatty acid desaturase family protein (TAIR:AT1G06350.1); Has 2722 Blast hits to 2722 proteins in 596 species: Archae - 0; Bacteria - 1082; Metazoa - 698; Fungi - 152; Plants - 71; Viruses - 3; Other Eukaryotes - 716 (source: NCBI BLink). |
| AT1G07030 | AT1G07030.1 | GCTGACGTGTCA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G30160.1); Has 19774 Blast hits to 10070 proteins in 353 species: Archae - 0; Bacteria - 0; Metazoa - 9836; Fungi - 5154; Plants - 2928; Viruses - 0; Other Eukaryotes - 1856 (source: NCBI BLink). |
| AT1G08210 | AT1G08210.1 | GGACACGTCAT | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: anchored to membrane, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT5G22850.1); Has 3530 Blast hits to 3512 proteins in 308 species: Archae - 0; Bacteria - 0; Metazoa - 1402; Fungi - 712; Plants - 1209; Viruses - 0; Other Eukaryotes - 207 (source: NCBI BLink). |
| AT1G08570 | AT1G08570.3 | AGACACGTCGTC | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
| AT1G08570.4 | AGACACGTCGTC | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
| AT1G08720 | AT1G08720.1 | GACGTGTCAC | enhanced disease resistance 1 (EDR1) confers resistance to powdery mildew disease caused by the fungus Erysiphe cichoracearum |
| AT1G09210 | AT1G09210.1 | CTGACGTGTCG | calreticulin 2 (CRT2); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: response to oxidative stress, response to salt stress; LOCATED IN: mitochondrion, endoplasmic reticulum, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Calreticulin (InterPro:IPR009169), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein binding (TAIR:AT1G56340.2); Has 6897 Blast hits to 3331 proteins in 371 species: Archae - 6; Bacteria - 265; Metazoa - 3811; Fungi - 490; Plants - 317; Viruses - 187; Other Eukaryotes - 1821 (source: NCBI BLink). |
| AT1G10070 | AT1G10070.1 | AGACACGTC | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT1G10070.2 | AGACACGTC | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT1G10070.3 | AGACACGTC | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT1G12200 | AT1G12200.1 | GTGACACGTCATC | flavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960); BEST Arabidopsis thaliana protein match is: flavin-containing monooxygenase family protein / FMO family protein (TAIR:AT1G62580.1); Has 9107 Blast hits to 8683 proteins in 970 species: Archae - 28; Bacteria - 4021; Metazoa - 1067; Fungi - 1001; Plants - 456; Viruses - 0; Other Eukaryotes - 2534 (source: NCBI BLink). |
| AT1G15380 | AT1G15380.1 | GACGTGTCAC | lactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). |
| AT1G15380.2 | GACGTGTCAC | lactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). |
| AT1G16790 | AT1G16790.1 | TGACACGTCATC | ribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 4 Blast hits to 4 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G18740 | AT1G18740.1 | GACGTGTCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF793 (InterPro:IPR008511); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G74450.1); Has 97 Blast hits to 97 proteins in 13 species: Archae - 3; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G19310 | AT1G19310.1 | AGACACGTCA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G23780.1); Has 3650 Blast hits to 3643 proteins in 226 species: Archae - 0; Bacteria - 2; Metazoa - 2420; Fungi - 377; Plants - 427; Viruses - 21; Other Eukaryotes - 403 (source: NCBI BLink). |
| AT1G22160 | AT1G22160.1 | ATGACGTGTCGTAATTA | senescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT1G78020.1); Has 281 Blast hits to 281 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 281; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27150 | AT1G27150.1 | GGACACGTCAT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G27110.1); Has 297 Blast hits to 297 proteins in 82 species: Archae - 4; Bacteria - 114; Metazoa - 76; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). |
| AT1G27350 | AT1G27350.1 | ATGACACGTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27330.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT1G27840 | AT1G27840.1 | ATGACGTGTCA | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink). |
| AT1G27840.2 | ATGACGTGTCA | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink). |
| AT1G27840.3 | ATGACGTGTCA | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink). |
| AT1G30320 | AT1G30320.1 | GTGACGTGTCG | remorin family protein; FUNCTIONS IN: DNA binding; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516); BEST Arabidopsis thaliana protein match is: remorin family protein (TAIR:AT2G02170.2); Has 11227 Blast hits to 6329 proteins in 787 species: Archae - 19; Bacteria - 2109; Metazoa - 2795; Fungi - 948; Plants - 557; Viruses - 39; Other Eukaryotes - 4760 (source: NCBI BLink). |
| AT1G43130 | AT1G43130.1 | GATGACGTGTCG | LIKE COV 2 (LCV2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: stem vascular tissue pattern formation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1946 Blast hits to 1946 proteins in 369 species: Archae - 4; Bacteria - 692; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 1166 (source: NCBI BLink). |
| AT1G49670 | AT1G49670.1 | GACGTGTCAC | molecular function has not been defined. Was shown involved in oxidative stress tolerance. |
| AT1G50730 | AT1G50730.1 | GGACACGTC | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 182 Blast hits to 175 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 2; Plants - 11; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT1G52690 | AT1G52690.1 | ATGACGTGTCAC | late embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G15670.1); Has 2025 Blast hits to 947 proteins in 265 species: Archae - 6; Bacteria - 474; Metazoa - 312; Fungi - 113; Plants - 812; Viruses - 15; Other Eukaryotes - 293 (source: NCBI BLink). |
| AT1G52690.2 | ATGACGTGTCAC | late embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G15670.1); Has 2025 Blast hits to 947 proteins in 265 species: Archae - 6; Bacteria - 474; Metazoa - 312; Fungi - 113; Plants - 812; Viruses - 15; Other Eukaryotes - 293 (source: NCBI BLink). |
| AT1G53320 | AT1G53320.1 | GACGTGTCC | Member of TLP family |
| AT1G57850 | AT1G57850.1 | CTGACGTGTCA | Toll-Interleukin-Resistance (TIR) domain-containing protein; FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: signal transduction, defense response, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: leaf lamina base, leaf whorl, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.10 ten leaves visible, LP.02 two leaves visible, LP.12 twelve leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: Toll-Interleukin-Resistance (TIR) domain-containing protein (TAIR:AT2G03300.1); Has 846 Blast hits to 806 proteins in 40 species: Archae - 0; Bacteria - 3; Metazoa - 2; Fungi - 0; Plants - 841; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G62750 | AT1G62750.1 | GTGACGTGTCT | Nuclear encoded protein consists of the five domains conserved in EF-G proteins, with two GTP-binding sites in the first domain, and an additional transit peptide at the N-terminus. Localized in chloroplasts. Point mutation results in a delay in the onset of germination. At early developmental stage embryos still contain undifferentiated proplastids. The greening of cotyledons is severely impaired in light-grown mutant sco1 seedlings, whereas the following true leaves develop normally as in wild-type plants. |
| AT1G68310 | AT1G68310.1 | GATGACGTGTCG | Encodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized. |
| AT1G68310.2 | GATGACGTGTCG | Encodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized. |
| AT1G68830 | AT1G68830.1 | GACGTGTCC | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation |
| AT1G69410 | AT1G69410.1 | CGACACGTCA | EUKARYOTIC ELONGATION FACTOR 5A-3 (ELF5A-3); FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation protein SH3-like, subgroup (InterPro:IPR014722), Eukaryotic initiation factor 5A hypusine (eIF-5A) (InterPro:IPR001884); BEST Arabidopsis thaliana protein match is: ELF5A-1 (EUKARYOTIC ELONGATION FACTOR 5A-1); translation initiation factor (TAIR:AT1G13950.1); Has 986 Blast hits to 984 proteins in 296 species: Archae - 160; Bacteria - 0; Metazoa - 294; Fungi - 163; Plants - 195; Viruses - 0; Other Eukaryotes - 174 (source: NCBI BLink). |
| AT1G71840 | AT1G71840.1 | GTGACACGTCAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 67893 Blast hits to 26212 proteins in 696 species: Archae - 58; Bacteria - 6808; Metazoa - 32655; Fungi - 12563; Plants - 6168; Viruses - 0; Other Eukaryotes - 9641 (source: NCBI BLink). |
| AT1G73170 | AT1G73170.1 | GCTGACGTGTCT | ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT1G73170.2 | GCTGACGTGTCT | ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT1G79230 | AT1G79230.1 | GACGTGTCT | encodes a sulfurtransferase/rhodaneses, which belongs to a group of enzymes widely distributed in all three phyla that catalyze the transfer of sulfur from a donor to a thiophilic acceptor substrate. The protein and transcript levels are NOT affected by senescence or exogenous cyanide, suggesting that sulfurtransferases are involved in cyanide detoxification. |
| AT1G79230.2 | GACGTGTCT | encodes a sulfurtransferase/rhodaneses, which belongs to a group of enzymes widely distributed in all three phyla that catalyze the transfer of sulfur from a donor to a thiophilic acceptor substrate. The protein and transcript levels are NOT affected by senescence or exogenous cyanide, suggesting that sulfurtransferases are involved in cyanide detoxification. |
| AT1G79230.3 | GACGTGTCT | encodes a sulfurtransferase/rhodaneses, which belongs to a group of enzymes widely distributed in all three phyla that catalyze the transfer of sulfur from a donor to a thiophilic acceptor substrate. The protein and transcript levels are NOT affected by senescence or exogenous cyanide, suggesting that sulfurtransferases are involved in cyanide detoxification. |
| AT1G79750 | AT1G79750.1 | AGACACGTCA | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME4 is localized to chloroplasts. The gene is expressed throughout the whole plant and during embryogenesis and germination. A possible involvement in the fatty acid biosynthesis has been proposed. |
| AT1G80570 | AT1G80570.1 | ATGACGTGTCA | F-box family protein (FBL14); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL3) (TAIR:AT5G01720.1); Has 3926 Blast hits to 1921 proteins in 161 species: Archae - 0; Bacteria - 279; Metazoa - 1944; Fungi - 309; Plants - 1047; Viruses - 3; Other Eukaryotes - 344 (source: NCBI BLink). |
| AT1G80570.2 | ATGACGTGTCA | F-box family protein (FBL14); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL3) (TAIR:AT5G01720.1); Has 3926 Blast hits to 1921 proteins in 161 species: Archae - 0; Bacteria - 279; Metazoa - 1944; Fungi - 309; Plants - 1047; Viruses - 3; Other Eukaryotes - 344 (source: NCBI BLink). |
| AT1G80570.3 | ATGACGTGTCA | F-box family protein (FBL14); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL3) (TAIR:AT5G01720.1); Has 3926 Blast hits to 1921 proteins in 161 species: Archae - 0; Bacteria - 279; Metazoa - 1944; Fungi - 309; Plants - 1047; Viruses - 3; Other Eukaryotes - 344 (source: NCBI BLink). |
| AT1G80850 | AT1G80850.1 | GATGACGTGTCA | methyladenine glycosylase family protein; FUNCTIONS IN: DNA-3-methyladenine glycosylase I activity, catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), Methyladenine glycosylase (InterPro:IPR005019); BEST Arabidopsis thaliana protein match is: methyladenine glycosylase family protein (TAIR:AT1G15970.1); Has 1956 Blast hits to 1956 proteins in 800 species: Archae - 7; Bacteria - 1545; Metazoa - 4; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink). |
| AT2G03890 | AT2G03890.1 | GATGACGTGTCAT | phosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT1G13640.1); Has 415 Blast hits to 408 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 52; Plants - 137; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT2G03890.2 | GATGACGTGTCAT | phosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT1G13640.1); Has 415 Blast hits to 408 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 52; Plants - 137; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT2G23670 | AT2G23670.1 | GATGACGTGTCACGT | Arabidopsis homolog of Synechocystis YCF37 (YCF37); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G29630 | AT2G29630.1 | GGACACGTCAGC | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene. |
| AT2G29630.2 | GGACACGTCAGC | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene. |
| AT2G34740 | AT2G34740.1 | GCTGACGTGTCG | catalytic/ protein serine/threonine phosphatase; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 5333 Blast hits to 5320 proteins in 675 species: Archae - 7; Bacteria - 1029; Metazoa - 1363; Fungi - 524; Plants - 1327; Viruses - 11; Other Eukaryotes - 1072 (source: NCBI BLink). |
| AT2G37790 | AT2G37790.1 | GACGTGTCT | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37770.2); Has 14317 Blast hits to 14296 proteins in 1374 species: Archae - 187; Bacteria - 8146; Metazoa - 1861; Fungi - 1118; Plants - 723; Viruses - 0; Other Eukaryotes - 2282 (source: NCBI BLink). |
| AT2G43240 | AT2G43240.1 | ATGACACGTCAGC | nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G43240.2 | ATGACACGTCAGC | nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G45170 | AT2G45170.1 | GCTGACGTGTCT | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes. |
| AT2G45170.2 | GCTGACGTGTCT | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes. |
| AT2G46850 | AT2G46850.1 | CGACACGTCAG | ATP binding / protein kinase/ protein tyrosine kinase; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G23450.2); Has 14254 Blast hits to 14061 proteins in 404 species: Archae - 0; Bacteria - 73; Metazoa - 2017; Fungi - 136; Plants - 11571; Viruses - 17; Other Eukaryotes - 440 (source: NCBI BLink). |
| AT3G01520 | AT3G01520.1 | AGACACGTC | universal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT5G14680.1); Has 1147 Blast hits to 1145 proteins in 292 species: Archae - 54; Bacteria - 658; Metazoa - 30; Fungi - 22; Plants - 354; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT3G01740 | AT3G01740.1 | AGACACGTCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37, mitochondrial (InterPro:IPR013870); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14290.1); Has 117 Blast hits to 117 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 22; Plants - 27; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G02940 | AT3G02940.1 | GGACACGTCAG | Encodes a putative transcription factor (MYB107). |
| AT3G03630 | AT3G03630.1 | TGACACGTCAC | O-acetylserine (thiol) lyase |
| AT3G07690 | AT3G07690.1 | GACGTGTCA | NAD or NADH binding / binding / catalytic/ coenzyme binding / glycerol-3-phosphate dehydrogenase (NAD+)/ oxidoreductase/ oxidoreductase, acting on CH-OH group of donors / oxidoreductase, acting on the CH-OH group of donors, NAD or NADP as acceptor; FUNCTIONS IN: in 8 functions; INVOLVED IN: glycerol-3-phosphate catabolic process, glycerol-3-phosphate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: glycerol-3-phosphate dehydrogenase complex, cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), NAD-dependent glycerol-3-phosphate dehydrogenase, C-terminal (InterPro:IPR006109), NAD-dependent glycerol-3-phosphate dehydrogenase, N-terminal (InterPro:IPR011128), NAD-dependent glycerol-3-phosphate dehydrogenase (InterPro:IPR006168); BEST Arabidopsis thaliana protein match is: GPDHC1; NAD or NADH binding / glycerol-3-phosphate dehydrogenase (NAD+) (TAIR:AT2G41540.3); Has 2182 Blast hits to 2182 proteins in 581 species: Archae - 10; Bacteria - 1021; Metazoa - 281; Fungi - 47; Plants - 70; Viruses - 0; Other Eukaryotes - 753 (source: NCBI BLink). |
| AT3G12300 | AT3G12300.1 | GACGTGTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF667 (InterPro:IPR007714); Has 280 Blast hits to 278 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 2; Plants - 29; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT3G14690 | AT3G14690.1 | AGACACGTCAC | putative cytochrome P450 |
| AT3G17090 | AT3G17090.1 | AGACACGTC | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: endomembrane system, protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT4G38520.2); Has 3505 Blast hits to 3503 proteins in 212 species: Archae - 0; Bacteria - 7; Metazoa - 1150; Fungi - 358; Plants - 1267; Viruses - 5; Other Eukaryotes - 718 (source: NCBI BLink). |
| AT3G17090.2 | AGACACGTC | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: endomembrane system, protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT4G38520.2); Has 3505 Blast hits to 3503 proteins in 212 species: Archae - 0; Bacteria - 7; Metazoa - 1150; Fungi - 358; Plants - 1267; Viruses - 5; Other Eukaryotes - 718 (source: NCBI BLink). |
| AT3G18750 | AT3G18750.1 | TGACACGTCAT | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT3G18750.2 | TGACACGTCAT | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT3G18850 | AT3G18850.1 | GATGACGTGTCG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.2 | GATGACGTGTCG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.3 | GATGACGTGTCG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.4 | GATGACGTGTCG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18850.5 | GATGACGTGTCG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT3G18860 | AT3G18860.1 | CGACACGTCATC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink). |
| AT3G18860.2 | CGACACGTCATC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink). |
| AT3G20100 | AT3G20100.1 | TGACGTGTCG | member of CYP705A |
| AT3G21150 | AT3G21150.1 | ACGACACGTCAT | zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G15248.1); Has 570 Blast hits to 534 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 570; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G22200 | AT3G22200.1 | ATGACACGTCAC | Genetically redundant with POP3;mediates pollen tube guidance. Double mutants are self sterile; gamma-aminobutyrate transaminase subunit precursor; nuclear gene for mitochondrial product. Encodes gamma-aminobutyrate transaminase that uses pyruvate instead of alpha-ketoglutarate as cosubstrate. Mutations in POP2/HER1 render roots resistant to the inhibitory growth effects of the volatile organic compound E-2-hexenal implicated in plant defense. |
| AT3G22440 | AT3G22440.1 | GACGTGTCG | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G14900.1); Has 1107 Blast hits to 1058 proteins in 102 species: Archae - 0; Bacteria - 5; Metazoa - 133; Fungi - 62; Plants - 888; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT3G22968 | AT3G22968.1 | TGACACGTC | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF59 represents a conserved upstream opening reading frame relative to major ORF AT3G22970.1 |
| AT3G22970 | AT3G22970.1 | TGACACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G22970.2 | TGACACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G24500 | AT3G24500.1 | ATGACACGTCGTC | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses. |
| AT3G26935 | AT3G26935.1 | AGACACGTCAGC | zinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT5G41060.1); Has 3999 Blast hits to 3989 proteins in 185 species: Archae - 0; Bacteria - 0; Metazoa - 1952; Fungi - 537; Plants - 411; Viruses - 0; Other Eukaryotes - 1099 (source: NCBI BLink). |
| AT3G27690 | AT3G27690.1 | GCTGACGTGTCT | Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. |
| AT3G46460 | AT3G46460.1 | AGACACGTC | ubiquitin-conjugating enzyme 13 (UBC13); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC14 (ubiquitin-conjugating enzyme 14); ubiquitin-protein ligase (TAIR:AT3G55380.1); Has 7555 Blast hits to 7535 proteins in 307 species: Archae - 0; Bacteria - 0; Metazoa - 3565; Fungi - 1492; Plants - 1176; Viruses - 19; Other Eukaryotes - 1303 (source: NCBI BLink). |
| AT3G50110 | AT3G50110.1 | TGACACGTCACG | ARABIDOPSIS THALIANA PTEN 3 (ATPEN3); FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Phosphatase tensin type (InterPro:IPR014019), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340), Tensin phosphatase, C2 domain (InterPro:IPR014020); BEST Arabidopsis thaliana protein match is: ATPEN2 (ARABIDOPSIS THALIANA PTEN 2); phosphatase/ protein tyrosine phosphatase (TAIR:AT3G19420.1); Has 4300 Blast hits to 1958 proteins in 193 species: Archae - 2; Bacteria - 2161; Metazoa - 1223; Fungi - 404; Plants - 85; Viruses - 3; Other Eukaryotes - 422 (source: NCBI BLink). |
| AT3G50690 | AT3G50690.1 | GACGTGTCG | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 79321 Blast hits to 33428 proteins in 1262 species: Archae - 436; Bacteria - 8197; Metazoa - 29512; Fungi - 13019; Plants - 4257; Viruses - 1007; Other Eukaryotes - 22893 (source: NCBI BLink). |
| AT3G50830 | AT3G50830.1 | AACGACACGTCAC | cold acclimation protein WCOR413-like protein beta form. Transcript is not detectable. |
| AT3G57890 | AT3G57890.1 | CTGACGTGTCAT | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT2G42230.2); Has 286 Blast hits to 286 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT3G60640 | AT3G60640.1 | GCTGACGTGTCAT | AUTOPHAGY 8G (ATG8G); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: ATG8F (autophagy 8f); microtubule binding (TAIR:AT4G16520.2); Has 1156 Blast hits to 1154 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 574; Fungi - 125; Plants - 171; Viruses - 3; Other Eukaryotes - 283 (source: NCBI BLink). |
| AT3G63460 | AT3G63460.1 | TGACGTGTCAT | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). |
| AT3G63460.2 | TGACGTGTCAT | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). |
| AT4G00490 | AT4G00490.1 | CTGACGTGTCA | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. Mutant of BAM2 has no visible phenotype. |
| AT4G17530 | AT4G17530.1 | AGACACGTCAGC | ATRAB1C; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1A; GTP binding (TAIR:AT5G47200.1); Has 23593 Blast hits to 23542 proteins in 647 species: Archae - 17; Bacteria - 111; Metazoa - 13220; Fungi - 2827; Plants - 2160; Viruses - 19; Other Eukaryotes - 5239 (source: NCBI BLink). |
| AT4G17540 | AT4G17540.1 | GCTGACGTGTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 80 Blast hits to 67 proteins in 31 species: Archae - 4; Bacteria - 22; Metazoa - 9; Fungi - 3; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G18580 | AT4G18580.1 | AGACACGTCAGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18580.2 | AGACACGTCAGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18590 | AT4G18590.1 | GCTGACGTGTCT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Replication factor A protein 3 (InterPro:IPR013970), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52630.2); Has 58 Blast hits to 58 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G27350 | AT4G27350.1 | GACGTGTCACCGACCCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1223 (InterPro:IPR010634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G54240.1); Has 364 Blast hits to 364 proteins in 161 species: Archae - 0; Bacteria - 300; Metazoa - 0; Fungi - 2; Plants - 24; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT4G27570 | AT4G27570.1 | GACGTGTCT | glycosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: N-terminal protein myristoylation, metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: glycosyltransferase family protein (TAIR:AT4G27560.1); Has 2822 Blast hits to 2801 proteins in 194 species: Archae - 0; Bacteria - 20; Metazoa - 193; Fungi - 9; Plants - 2596; Viruses - 3; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G28660 | AT4G28660.1 | GTGACACGTCACG | Similar to PsbW subunit of photosystem II. |
| AT4G29960 | AT4G29960.1 | GTGACGTGTCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 25 Blast hits to 25 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G30060 | AT4G30060.1 | AGACACGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19160.1); Has 337 Blast hits to 337 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G32480 | AT4G32480.1 | TGACACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20670.1); Has 203 Blast hits to 203 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 201; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G33330 | AT4G33330.1 | TGACACGTC | PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 3 (PGSIP3); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: sperm cell, inflorescence meristem, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: PGSIP1 (PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 1); transferase, transferring glycosyl groups (TAIR:AT3G18660.2). |
| AT4G33330.2 | TGACACGTC | PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 3 (PGSIP3); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: sperm cell, inflorescence meristem, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: PGSIP1 (PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 1); transferase, transferring glycosyl groups (TAIR:AT3G18660.2). |
| AT4G38460 | AT4G38460.1 | GACGTGTCT | geranylgeranyl reductase (GGR); FUNCTIONS IN: farnesyltranstransferase activity; INVOLVED IN: isoprenoid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polyprenyl synthetase-related (InterPro:IPR017446), Terpenoid synthase (InterPro:IPR008949), Polyprenyl synthetase (InterPro:IPR000092); BEST Arabidopsis thaliana protein match is: GGPS1 (GERANYLGERANYL PYROPHOSPHATE SYNTHASE 1); farnesyltranstransferase (TAIR:AT4G36810.1); Has 9804 Blast hits to 9803 proteins in 1646 species: Archae - 213; Bacteria - 4792; Metazoa - 110; Fungi - 109; Plants - 266; Viruses - 6; Other Eukaryotes - 4308 (source: NCBI BLink). |
| AT4G39210 | AT4G39210.1 | GACGTGTCC | Encodes the large subunit of ADP-Glucose Pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL3 is the major large subunit isoform present in inflorescences, fruits and roots. |
| AT4G39660 | AT4G39660.1 | GTGACACGTCAT | alanine:glyoxylate aminotransferase 2 homolog (AGT2) mRNA, |
| AT4G39660.1 | TGACACGTCATC | alanine:glyoxylate aminotransferase 2 homolog (AGT2) mRNA, |
| AT4G39800 | AT4G39800.1 | CTGACGTGTCA | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G02050 | AT5G02050.1 | GACGTGTCC | mitochondrial glycoprotein family protein / MAM33 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, mitochondrial matrix; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT3G55605.1); Has 329 Blast hits to 328 proteins in 116 species: Archae - 0; Bacteria - 2; Metazoa - 39; Fungi - 94; Plants - 115; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT5G02150 | AT5G02150.1 | CGTGACGTGTCAC | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 416 Blast hits to 414 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT5G02150.2 | CGTGACGTGTCAC | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 416 Blast hits to 414 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT5G02160 | AT5G02160.1 | GTGACACGTCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G04410 | AT5G04410.1 | TGACGTGTCAC | NAC family member, hypothetical transcriptional regulator |
| AT5G04710 | AT5G04710.1 | AGACACGTC | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G60160.1); Has 1276 Blast hits to 1273 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 40; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink). |
| AT5G04720 | AT5G04720.1 | GACGTGTCT | ADR1-like 2 (ADR1-L2); FUNCTIONS IN: protein binding, nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: defense response, apoptosis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Disease resistance, plant (InterPro:IPR014011), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: ADR1-L1 (ADR1-like 1); ATP binding / protein binding (TAIR:AT4G33300.2); Has 16716 Blast hits to 11049 proteins in 439 species: Archae - 24; Bacteria - 1102; Metazoa - 2478; Fungi - 82; Plants - 12542; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink). |
| AT5G04920 | AT5G04920.1 | AAAACGACACGTC | vacuolar protein sorting 36 family protein / VPS36 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT II complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EAP30 (InterPro:IPR007286); Has 235 Blast hits to 233 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 113; Fungi - 67; Plants - 24; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT5G06760 | AT5G06760.1 | ATGACACGTC | late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); Has 477 Blast hits to 328 proteins in 98 species: Archae - 0; Bacteria - 70; Metazoa - 102; Fungi - 37; Plants - 214; Viruses - 1; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G06760.1 | CTGACGTGTCGT | late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); Has 477 Blast hits to 328 proteins in 98 species: Archae - 0; Bacteria - 70; Metazoa - 102; Fungi - 37; Plants - 214; Viruses - 1; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G07190 | AT5G07190.1 | GATGACGTGTCA | Gene is expressed preferentially in the embryo and encodes a unique protein of unknown function. |
| AT5G07190.2 | GATGACGTGTCA | Gene is expressed preferentially in the embryo and encodes a unique protein of unknown function. |
| AT5G10490 | AT5G10490.1 | CTGACGTGTCG | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. |
| AT5G10490.2 | CTGACGTGTCG | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. |
| AT5G13390 | AT5G13390.1 | GGACACGTCAC | Required for normal pollen development and lipid accumulation within the tapetum |
| AT5G15500 | AT5G15500.1 | CTGACGTGTCCACGT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). |
| AT5G15500.2 | CTGACGTGTCCACGT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). |
| AT5G21920 | AT5G21920.1 | TGACACGTC | YGGT family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function YGGT (InterPro:IPR003425); BEST Arabidopsis thaliana protein match is: YGGT family protein (TAIR:AT4G27990.1); Has 1060 Blast hits to 1060 proteins in 353 species: Archae - 0; Bacteria - 642; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 348 (source: NCBI BLink). |
| AT5G21930 | AT5G21930.1 | GACGTGTCA | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport |
| AT5G21930.2 | GACGTGTCA | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport |
| AT5G22510 | AT5G22510.1 | AGACACGTCGTCGTTTCACACGCGT | beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT1G56560.1); Has 513 Blast hits to 512 proteins in 79 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 230 (source: NCBI BLink). |
| AT5G22630 | AT5G22630.1 | AGACACGTCA | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT5G25540 | AT5G25540.1 | AGACACGTCAGC | Expressed protein contains PAM2 PABC interacting domain. |
| AT5G40670 | AT5G40670.1 | ATGACACGTCATC | PQ-loop repeat family protein / transmembrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Lysosomal cystine transporter (InterPro:IPR005282); Has 261 Blast hits to 261 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 89; Plants - 21; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT5G42570 | AT5G42570.1 | GATGACGTGTCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B-cell receptor-associated 31-like (InterPro:IPR008417); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11905.1); Has 311 Blast hits to 268 proteins in 81 species: Archae - 2; Bacteria - 2; Metazoa - 134; Fungi - 41; Plants - 73; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT5G46250 | AT5G46250.1 | GACGTGTCG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G46250.2 | GACGTGTCG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G46250.3 | GACGTGTCG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G47780 | AT5G47780.1 | CGACACGTCAC | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G47810 | AT5G47810.1 | GTGACGTGTCG | PHOSPHOFRUCTOKINASE 2 (PFK2); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: cytosol, 6-phosphofructokinase complex; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK3 (PHOSPHOFRUCTOKINASE 3); 6-phosphofructokinase (TAIR:AT4G26270.1); Has 4565 Blast hits to 4222 proteins in 1114 species: Archae - 20; Bacteria - 2500; Metazoa - 504; Fungi - 230; Plants - 224; Viruses - 2; Other Eukaryotes - 1085 (source: NCBI BLink). |
| AT5G49020 | AT5G49020.1 | CGACACGTCAT | Encodes a type I protein arginine methyltransferase. PRMT4a can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
| AT5G49020.2 | CGACACGTCAT | Encodes a type I protein arginine methyltransferase. PRMT4a can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
| AT5G50460 | AT5G50460.1 | GACGTGTCAT | protein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT4G24920.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G50800 | AT5G50800.1 | GTGACACGTC | nodulin MtN3 family protein; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MtN3 and saliva related transmembrane protein, conserved region (InterPro:IPR018169), RAG1-activating protein 1 homologue (InterPro:IPR018179), MtN3 and saliva related transmembrane protein (InterPro:IPR004316); BEST Arabidopsis thaliana protein match is: nodulin MtN3 family protein (TAIR:AT4G25010.1); Has 585 Blast hits to 542 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 231; Fungi - 0; Plants - 290; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT5G51070 | AT5G51070.1 | TGACGTGTCAT | ATP-dependent Clp protease regulatory subunit |
| AT5G51150 | AT5G51150.1 | AAATGACGTGTCAT | unknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34630.1); Has 381 Blast hits to 298 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 87; Plants - 35; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). |
| AT5G51390 | AT5G51390.1 | GACGTGTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55180 | AT5G55180.1 | AGACACGTCATC | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G26830.1). |
| AT5G55180.2 | AGACACGTCATC | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G26830.1). |
| AT5G57300 | AT5G57300.1 | GACGTGTCT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57300.2 | GACGTGTCT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G59910 | AT5G59910.1 | GGACACGTCA | HTB4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT2G28720.1); Has 3079 Blast hits to 2919 proteins in 300 species: Archae - 0; Bacteria - 69; Metazoa - 1920; Fungi - 175; Plants - 374; Viruses - 0; Other Eukaryotes - 541 (source: NCBI BLink). |
| AT5G60360 | AT5G60360.1 | GGACACGTCA | Encodes a senescence-associated thiol protease. |
| AT5G60360.2 | GGACACGTCA | Encodes a senescence-associated thiol protease. |
| AT5G60360.3 | GGACACGTCA | Encodes a senescence-associated thiol protease. |
| AT5G64400 | AT5G64400.1 | AGACACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09570.1); Has 102 Blast hits to 100 proteins in 33 species: Archae - 0; Bacteria - 9; Metazoa - 16; Fungi - 2; Plants - 47; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT5G64400.2 | AGACACGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09570.1); Has 102 Blast hits to 100 proteins in 33 species: Archae - 0; Bacteria - 9; Metazoa - 16; Fungi - 2; Plants - 47; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT5G64970 | AT5G64970.1 | GATGACGTGTCA | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrion, mitochondrial inner membrane, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G78180.1); Has 18195 Blast hits to 9659 proteins in 353 species: Archae - 0; Bacteria - 0; Metazoa - 9099; Fungi - 4929; Plants - 2524; Viruses - 0; Other Eukaryotes - 1643 (source: NCBI BLink). |
| AT5G65110 | AT5G65110.1 | AACGACGTGTCCACGTCATC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT5G65110.2 | AACGACGTGTCCACGTCATC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT5G65260 | AT5G65260.1 | GATGACGTGTCT | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G10350.1); Has 5533 Blast hits to 5115 proteins in 414 species: Archae - 6; Bacteria - 543; Metazoa - 2461; Fungi - 1041; Plants - 837; Viruses - 0; Other Eukaryotes - 645 (source: NCBI BLink). |
| AT5G65270 | AT5G65270.1 | AGACACGTCATC | Arabidopsis Rab GTPase homolog A4a (AtRABA4a); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: RABA4B (RAB GTPASE HOMOLOG A4B); GTP binding (TAIR:AT4G39990.1); Has 23029 Blast hits to 22998 proteins in 639 species: Archae - 17; Bacteria - 108; Metazoa - 12691; Fungi - 2978; Plants - 2157; Viruses - 19; Other Eukaryotes - 5059 (source: NCBI BLink). |
| AT5G65960 | AT5G65960.1 | GACGTGTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 294 Blast hits to 294 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 21; Plants - 119; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT5G66120 | AT5G66120.1 | CGTGACGTGTCA | 3-dehydroquinate synthase, putative; FUNCTIONS IN: 3-dehydroquinate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 3-dehydroquinate synthase AroB, subgroup (InterPro:IPR016037), 3-dehydroquinate synthase AroB (InterPro:IPR002658); Has 5882 Blast hits to 5880 proteins in 1401 species: Archae - 124; Bacteria - 2775; Metazoa - 7; Fungi - 133; Plants - 27; Viruses - 2; Other Eukaryotes - 2814 (source: NCBI BLink). |
| AT5G66120.2 | CGTGACGTGTCA | 3-dehydroquinate synthase, putative; FUNCTIONS IN: 3-dehydroquinate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 3-dehydroquinate synthase AroB, subgroup (InterPro:IPR016037), 3-dehydroquinate synthase AroB (InterPro:IPR002658); Has 5882 Blast hits to 5880 proteins in 1401 species: Archae - 124; Bacteria - 2775; Metazoa - 7; Fungi - 133; Plants - 27; Viruses - 2; Other Eukaryotes - 2814 (source: NCBI BLink). |
| AT5G66130 | AT5G66130.1 | TGACACGTCACG | Encodes a homolog to yeast RAD17. Involved in the regulation of DNA damage repair and homologous recombination. Mutant has increased sensitivity to MMS and increased telomere lengths. |
| AT5G66631 | AT5G66631.1 | AGACACGTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G16010.1); Has 7784 Blast hits to 2776 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 51; Plants - 7639; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). |