| Locus | Gene model | Sequence | Description |
| AT1G02080 | AT1G02080.1 | TGTGGGCCTTAA | transcriptional regulator-related; FUNCTIONS IN: transcription regulator activity; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CCR4-Not complex component, Not1 (InterPro:IPR007196); Has 1072 Blast hits to 502 proteins in 170 species: Archae - 0; Bacteria - 115; Metazoa - 354; Fungi - 245; Plants - 79; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink). |
| AT1G02330 | AT1G02330.1 | GTGGGCCTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink). |
| AT1G04400 | AT1G04400.1 | TTTAGGCCCAC | Blue light receptor mediating blue-light regulated cotyledon expansion and flowering time. Positive regulator of the flowering-time gene CONSTANS. This gene possesses a light-induced CNT2 N-terminal homodimerisation domain.Involved in blue-light induced stomatal opening. Involved in triggering chromatin decondensation. An 80-residue motif (NC80) is sufficient to confer CRY2's physiological function. It is proposed that the PHR domain and the C-terminal tail of the unphosphorylated CRY2 form a "closed" conformation to suppress the NC80 motif in the absence of light. In response to blue light, the C-terminal tail of CRY2 is phosphorylated and electrostatically repelled from the surface of the PHR domain to form an "open" conformation, resulting in derepression of the NC80 motif and signal transduction to trigger photomorphogenic responses. Cry2 phosphorylation and degradation both occur in the nucleus. |
| AT1G04400.2 | TTTAGGCCCAC | Blue light receptor mediating blue-light regulated cotyledon expansion and flowering time. Positive regulator of the flowering-time gene CONSTANS. This gene possesses a light-induced CNT2 N-terminal homodimerisation domain.Involved in blue-light induced stomatal opening. Involved in triggering chromatin decondensation. An 80-residue motif (NC80) is sufficient to confer CRY2's physiological function. It is proposed that the PHR domain and the C-terminal tail of the unphosphorylated CRY2 form a "closed" conformation to suppress the NC80 motif in the absence of light. In response to blue light, the C-terminal tail of CRY2 is phosphorylated and electrostatically repelled from the surface of the PHR domain to form an "open" conformation, resulting in derepression of the NC80 motif and signal transduction to trigger photomorphogenic responses. Cry2 phosphorylation and degradation both occur in the nucleus. |
| AT1G08125 | AT1G08125.1 | GTGGGCCTAAACCGT | Expressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G73320.1); Has 986 Blast hits to 984 proteins in 169 species: Archae - 0; Bacteria - 58; Metazoa - 387; Fungi - 270; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G11750 | AT1G11750.1 | GTGGGCCTATT | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
| AT1G16000 | AT1G16000.1 | TGATGGGCCATAATAAGGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80890.1); Has 24 Blast hits to 23 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G19890 | AT1G19890.1 | ATTAGGCCCACTGGCCCAGA | histone 3.3, male-gamete-specific expression |
| AT1G26660 | AT1G26660.1 | GTGGGCCTTTA | c-myc binding protein, putative / prefoldin, putative; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053); Has 263 Blast hits to 263 proteins in 87 species: Archae - 12; Bacteria - 2; Metazoa - 174; Fungi - 30; Plants - 21; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT1G30230 | AT1G30230.1 | TATAGGCCCACTA | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G30230.2 | TATAGGCCCACTA | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G33120 | AT1G33120.1 | TAAAGGCCCACA | 60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G35220 | AT1G35220.1 | TCAGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 247 Blast hits to 143 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT1G48770 | AT1G48770.1 | TAGTGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18295.1); Has 142 Blast hits to 142 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 142; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G54320 | AT1G54320.1 | GTGGGCCTTT | LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF284, transmembrane eukaryotic (InterPro:IPR005045); BEST Arabidopsis thaliana protein match is: ALIS1 (ALA-INTERACTING SUBUNIT 1); phospholipid transporter (TAIR:AT3G12740.1); Has 648 Blast hits to 646 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 218; Fungi - 139; Plants - 105; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink). |
| AT1G60600 | AT1G60600.1 | TAATGGGCCTTAAAGGCCCAC | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
| AT1G60600.2 | TAATGGGCCTTAAAGGCCCAC | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
| AT1G65290 | AT1G65290.1 | ATAGGCCCAC | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. As part of the mitochondrial matrix, it is likely to be involved in fatty acid or lipoic acid biogenesis. |
| AT1G67760 | AT1G67760.1 | CAAAGGCCCACGTAG | ATP binding / protein binding / unfolded protein binding; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), T-complex protein 1, epsilon subunit (InterPro:IPR012718); BEST Arabidopsis thaliana protein match is: T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative (TAIR:AT1G24510.1); Has 767 Blast hits to 665 proteins in 236 species: Archae - 251; Bacteria - 0; Metazoa - 166; Fungi - 119; Plants - 66; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink). |
| AT1G71500 | AT1G71500.1 | CTAAGGCCCACATTGGCCCAACT | Rieske (2Fe-2S) domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, 2 iron, 2 sulfur cluster binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rieske [2Fe-2S] iron-sulphur domain (InterPro:IPR017941), Rieske [2Fe-2S] region (InterPro:IPR005806); Has 207 Blast hits to 207 proteins in 61 species: Archae - 0; Bacteria - 101; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G71860 | AT1G71860.1 | TTTAGGCCCAC | Encodes a protein with tyrosine phosphatase activity that is downregulated in response to cold and upregulated in response to salt stress. |
| AT1G71860.2 | TTTAGGCCCAC | Encodes a protein with tyrosine phosphatase activity that is downregulated in response to cold and upregulated in response to salt stress. |
| AT1G71860.3 | TTTAGGCCCAC | Encodes a protein with tyrosine phosphatase activity that is downregulated in response to cold and upregulated in response to salt stress. |
| AT1G72240 | AT1G72240.1 | TGTGGGCCTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22470.1); Has 35 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G73710 | AT1G73710.1 | AAAAGGCCCAC | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23020.1); Has 27768 Blast hits to 6414 proteins in 199 species: Archae - 2; Bacteria - 35; Metazoa - 962; Fungi - 509; Plants - 25092; Viruses - 0; Other Eukaryotes - 1168 (source: NCBI BLink). |
| AT1G78800 | AT1G78800.1 | TGTGGGCCTTG | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: SUS5; UDP-glycosyltransferase/ sucrose synthase (TAIR:AT5G37180.1); Has 9928 Blast hits to 9895 proteins in 1204 species: Archae - 399; Bacteria - 5805; Metazoa - 243; Fungi - 183; Plants - 319; Viruses - 0; Other Eukaryotes - 2979 (source: NCBI BLink). |
| AT1G80790 | AT1G80790.1 | GTGGGCCTAATATAAGGCCCAC | XH/XS domain-containing protein / XS zinc finger domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function XS (InterPro:IPR005380), Region of unknown function XH (InterPro:IPR005379), Region of unknown function, putative Zinc finger, XS and XH (InterPro:IPR005381); BEST Arabidopsis thaliana protein match is: XH/XS domain-containing protein / XS zinc finger domain-containing protein (TAIR:AT1G15910.1); Has 67806 Blast hits to 38036 proteins in 1354 species: Archae - 728; Bacteria - 6143; Metazoa - 32571; Fungi - 3879; Plants - 1839; Viruses - 312; Other Eukaryotes - 22334 (source: NCBI BLink). |
| AT2G01220 | AT2G01220.1 | GTGGGCCTATT | nucleotidyltransferase; FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cytidylyltransferase (InterPro:IPR004820); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G27610.1); Has 373 Blast hits to 367 proteins in 37 species: Archae - 6; Bacteria - 25; Metazoa - 0; Fungi - 5; Plants - 35; Viruses - 0; Other Eukaryotes - 302 (source: NCBI BLink). |
| AT2G01220.2 | GTGGGCCTATT | nucleotidyltransferase; FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cytidylyltransferase (InterPro:IPR004820); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G27610.1); Has 373 Blast hits to 367 proteins in 37 species: Archae - 6; Bacteria - 25; Metazoa - 0; Fungi - 5; Plants - 35; Viruses - 0; Other Eukaryotes - 302 (source: NCBI BLink). |
| AT2G14660 | AT2G14660.1 | TAGTGGGCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0310 (InterPro:IPR002740); Has 2334 Blast hits to 2333 proteins in 479 species: Archae - 5; Bacteria - 781; Metazoa - 60; Fungi - 50; Plants - 22; Viruses - 0; Other Eukaryotes - 1416 (source: NCBI BLink). |
| AT2G19080 | AT2G19080.1 | TGTGGGCCTTTTAAAGCCCAAAA | metaxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein targeting to mitochondrion; LOCATED IN: mitochondrial outer membrane, mitochondrion, mitochondrial inner membrane, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metaxin (InterPro:IPR017410); Has 384 Blast hits to 384 proteins in 77 species: Archae - 0; Bacteria - 46; Metazoa - 295; Fungi - 14; Plants - 20; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G20130 | AT2G20130.1 | TAGTGGGCCTTAG | LIKE COV 1 (LCV1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, flower, root, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1965 Blast hits to 1965 proteins in 370 species: Archae - 6; Bacteria - 694; Metazoa - 0; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 1180 (source: NCBI BLink). |
| AT2G20140 | AT2G20140.1 | CTAAGGCCCACTA | 26S protease regulatory complex subunit 4, putative; FUNCTIONS IN: hydrolase activity, nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), 26S proteasome subunit P45 (InterPro:IPR005937); BEST Arabidopsis thaliana protein match is: RPT2a (regulatory particle AAA-ATPase 2a); ATPase (TAIR:AT4G29040.1); Has 21701 Blast hits to 20141 proteins in 1744 species: Archae - 831; Bacteria - 5748; Metazoa - 4078; Fungi - 2440; Plants - 1746; Viruses - 26; Other Eukaryotes - 6832 (source: NCBI BLink). |
| AT2G24280 | AT2G24280.1 | TGTGGGCCTAAA | serine carboxypeptidase S28 family protein; FUNCTIONS IN: serine-type peptidase activity, serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system, lysosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S28 (InterPro:IPR008758); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase S28 family protein (TAIR:AT5G65760.1); Has 915 Blast hits to 887 proteins in 113 species: Archae - 0; Bacteria - 3; Metazoa - 520; Fungi - 132; Plants - 108; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT2G29180 | AT2G29180.1 | ATAAGGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 21 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G34630 | AT2G34630.2 | GTGGGCCTCT | Encodes a geranyl diphosphate synthase. RNAi lines are dwarf. T-DNA knock-out lines are embryo lethal. |
| AT2G35620 | AT2G35620.1 | CAATGGGCTTTAGTAGGCCCAC | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. |
| AT2G36120 | AT2G36120.1 | TGTGGGCCTCAACGTGTGA | Encodes a glycine rich protein that is involved in leaf vascular patterning. dot1 mutants have an aberrant open-class venation pattern in leaves and cotyledons, as well as several other leaf development defects. |
| AT2G36420 | AT2G36420.1 | TGAGGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03670.1); Has 11237 Blast hits to 6364 proteins in 349 species: Archae - 8; Bacteria - 288; Metazoa - 5131; Fungi - 1107; Plants - 404; Viruses - 219; Other Eukaryotes - 4080 (source: NCBI BLink). |
| AT2G40090 | AT2G40090.1 | CAAGCCCAATAAGTAAGGCCCACA | member of ATH subfamily |
| AT2G40700 | AT2G40700.1 | AGAGGCCCACA | DEAD/DEAH box helicase, putative (RH17); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT5G65900.1); Has 26770 Blast hits to 25070 proteins in 1684 species: Archae - 453; Bacteria - 10406; Metazoa - 5242; Fungi - 3151; Plants - 1377; Viruses - 5; Other Eukaryotes - 6136 (source: NCBI BLink). |
| AT2G42210 | AT2G42210.1 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.2 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.3 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.4 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G44120 | AT2G44120.1 | AATAGGCCCAC | 60S ribosomal protein L7 (RPL7C); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7B) (TAIR:AT2G01250.1); Has 982 Blast hits to 980 proteins in 291 species: Archae - 151; Bacteria - 0; Metazoa - 383; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT2G44120.2 | AATAGGCCCAC | 60S ribosomal protein L7 (RPL7C); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7B) (TAIR:AT2G01250.1); Has 982 Blast hits to 980 proteins in 291 species: Archae - 151; Bacteria - 0; Metazoa - 383; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink). |
| AT2G44180 | AT2G44180.1 | GTGGGCCTATT | Encodes a MAP2 like methionine aminopeptidase. In MAP1A mutant background plants show an increased sensitivity to fumagillin resulting in defects in development. Phenotype is similar to RNAi lines which knock out all MAP2/MAP1 loci. |
| AT2G46580 | AT2G46580.1 | GTGGGCCTCGTCGTT | pyridoxine 5'-phosphate oxidase-related; FUNCTIONS IN: FMN binding, pyridoxamine-phosphate oxidase activity; INVOLVED IN: pyridoxine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxamine 5'-phosphate oxidase (InterPro:IPR000659), FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002); Has 1089 Blast hits to 1089 proteins in 214 species: Archae - 0; Bacteria - 365; Metazoa - 49; Fungi - 36; Plants - 20; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). |
| AT3G01700 | AT3G01700.1 | TGTGGGCCTGA | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth. |
| AT3G02950 | AT3G02950.1 | TGTGGGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Tho complex subunit 7 (InterPro:IPR018018), Tho complex subunit 7/Mft1p (InterPro:IPR008501); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16790.1); Has 2049 Blast hits to 1787 proteins in 271 species: Archae - 31; Bacteria - 158; Metazoa - 1041; Fungi - 168; Plants - 75; Viruses - 26; Other Eukaryotes - 550 (source: NCBI BLink). |
| AT3G05120 | AT3G05120.1 | TGAGGCCCAC | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The DELLA region alone can interact with GID1A in GA-dependent manner in a Y2H assay. |
| AT3G05210 | AT3G05210.1 | TTAAGGCCCACA | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
| AT3G06790 | AT3G06790.1 | CAAAGGCCCACTAAGCCCATATA | plastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1); Has 160 Blast hits to 148 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06790.2 | CAAAGGCCCACTAAGCCCATATA | plastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1); Has 160 Blast hits to 148 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G09630 | AT3G09630.1 | ATAAGGCCCACTA | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G09630.1 | ATTAGGCCCACTA | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G09630.2 | ATAAGGCCCACTA | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G09630.2 | ATTAGGCCCACTA | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G12140 | AT3G12140.1 | GTGGGCCTTAG | emsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G12140.2 | GTGGGCCTTAG | emsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G12140.3 | GTGGGCCTTAG | emsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G16080 | AT3G16080.1 | TCAGGCCCACA | 60S ribosomal protein L37 (RPL37C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37e (InterPro:IPR001569), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37B) (TAIR:AT1G52300.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT3G18410 | AT3G18410.1 | AATAGGCCCACA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT1G49140.1); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G18410.2 | AATAGGCCCACA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT1G49140.1); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G18910 | AT3G18910.1 | GTGGGCCTTG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18900.1); Has 733 Blast hits to 711 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 731; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G19760 | AT3G19760.1 | TAAAGGCCCACTA | eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: nucleolus, nucleus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative (TAIR:AT1G51380.1); Has 32402 Blast hits to 31825 proteins in 1817 species: Archae - 512; Bacteria - 14379; Metazoa - 5291; Fungi - 3422; Plants - 1433; Viruses - 38; Other Eukaryotes - 7327 (source: NCBI BLink). |
| AT3G26410 | AT3G26410.1 | GTGGGCCTGA | methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT3G26420 | AT3G26420.1 | TCAGGCCCAC | Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. |
| AT3G26770 | AT3G26770.1 | CTAGGCCCACA | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G26760.1); Has 84124 Blast hits to 83955 proteins in 2264 species: Archae - 482; Bacteria - 45536; Metazoa - 5627; Fungi - 4443; Plants - 1587; Viruses - 7; Other Eukaryotes - 26442 (source: NCBI BLink). |
| AT3G27770 | AT3G27770.1 | GTGGGCCTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G27770.2 | GTGGGCCTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G46960 | AT3G46960.1 | GTGGGCCTAAA | ATP binding / ATP-dependent helicase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides, helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DSH, C-terminal (InterPro:IPR012961), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), RNA helicase, ATP-dependent, SK12/DOB1 (InterPro:IPR016438), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: HEN2 (hua enhancer 2); ATP-dependent helicase/ RNA helicase (TAIR:AT2G06990.1); Has 7311 Blast hits to 5276 proteins in 657 species: Archae - 463; Bacteria - 1480; Metazoa - 1237; Fungi - 1015; Plants - 265; Viruses - 46; Other Eukaryotes - 2805 (source: NCBI BLink). |
| AT3G52960 | AT3G52960.1 | TTTAGGCCCACTA | peroxiredoxin type 2, putative; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: defense response to bacterium, peptidyl-cysteine S-nitrosylation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336), Redoxin (InterPro:IPR013740); BEST Arabidopsis thaliana protein match is: TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase (TAIR:AT1G65980.1); Has 3329 Blast hits to 3329 proteins in 622 species: Archae - 43; Bacteria - 1005; Metazoa - 160; Fungi - 217; Plants - 175; Viruses - 0; Other Eukaryotes - 1729 (source: NCBI BLink). |
| AT3G53710 | AT3G53710.1 | GTGGGCCTGA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT3G53710.2 | GTGGGCCTGA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT3G61770 | AT3G61770.1 | CAAGCCCAAAGGCCCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 613 Blast hits to 613 proteins in 199 species: Archae - 0; Bacteria - 356; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). |
| AT3G61860 | AT3G61860.1 | TGTGGGCCTATT | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. |
| AT3G61870 | AT3G61870.1 | AATAGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G61870.2 | AATAGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G62220 | AT3G62220.1 | CCCAATTAATTAGGCCCACTA | serine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G47060.2); Has 82520 Blast hits to 81517 proteins in 3289 species: Archae - 50; Bacteria - 7570; Metazoa - 36328; Fungi - 6173; Plants - 18156; Viruses - 365; Other Eukaryotes - 13878 (source: NCBI BLink). |
| AT3G62290 | AT3G62290.1 | CCAGGCCCACTA | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT3G63190 | AT3G63190.1 | TACGGCCCATTAAGGCCCACA | RIBOSOME RECYCLING FACTOR, CHLOROPLAST PRECURSOR (RRF); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: defense response to bacterium, translation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosome recycling factor, bacterial-like (InterPro:IPR015998), Ribosome recycling factor (InterPro:IPR002661); BEST Arabidopsis thaliana protein match is: ribosome recycling factor family protein / ribosome releasing factor family protein (TAIR:AT3G01800.1); Has 5492 Blast hits to 5492 proteins in 1475 species: Archae - 0; Bacteria - 2924; Metazoa - 104; Fungi - 52; Plants - 56; Viruses - 0; Other Eukaryotes - 2356 (source: NCBI BLink). |
| AT4G00090 | AT4G00090.1 | GTGGGCCTTTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink). |
| AT4G00100 | AT4G00100.1 | AAAGGCCCAC | Encodes a cytoplasmic ribosomal protein S13 homologue involved in early leaf development |
| AT4G00170 | AT4G00170.1 | AAGGCCCACA | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 758 Blast hits to 742 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 363; Fungi - 101; Plants - 232; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT4G01400 | AT4G01400.2 | GTGGGCCTTATTTGGGCTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COG4 transport (InterPro:IPR013167), Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 11639 Blast hits to 3936 proteins in 180 species: Archae - 0; Bacteria - 2; Metazoa - 206; Fungi - 141; Plants - 11004; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink). |
| AT4G03280 | AT4G03280.1 | TCAGCCCAATAAGGCCCAC | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT4G03280.2 | TCAGCCCAATAAGGCCCAC | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT4G04180 | AT4G04180.1 | ATTAGGCCCAC | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: mitochondrion; EXPRESSED IN: shoot apex, embryo, pedicel, flower, seed; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: cell division cycle protein 48, putative / CDC48, putative (TAIR:AT3G53230.1); Has 21649 Blast hits to 20150 proteins in 1744 species: Archae - 853; Bacteria - 6915; Metazoa - 3915; Fungi - 2439; Plants - 1410; Viruses - 16; Other Eukaryotes - 6101 (source: NCBI BLink). |
| AT4G09900 | AT4G09900.1 | GTGGGCCTGGGCTTTGGGCCTG | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT4G17010 | AT4G17010.1 | AAAAGGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 8 growth stages; Has 58 Blast hits to 56 proteins in 16 species: Archae - 3; Bacteria - 2; Metazoa - 8; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT4G17560 | AT4G17560.1 | TAAAGGCCCACA | ribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857), Ribosomal protein L19, conserved site (InterPro:IPR018257); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT5G47190.1); Has 5332 Blast hits to 5332 proteins in 1492 species: Archae - 0; Bacteria - 2922; Metazoa - 96; Fungi - 46; Plants - 97; Viruses - 0; Other Eukaryotes - 2171 (source: NCBI BLink). |
| AT4G20300 | AT4G20300.1 | TAGTGGGCCTGATAATGGGCCGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G20300.2 | TAGTGGGCCTGATAATGGGCCGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G21320 | AT4G21320.1 | GTGGGCCTTTA | Encodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment. |
| AT4G25570 | AT4G25570.1 | TGAGGCCCACGTGTCT | Encodes cytochrome b561. |
| AT4G26240 | AT4G26240.1 | GTTAGGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 17 Blast hits to 17 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G26870 | AT4G26870.1 | TGTGGGCCTTTCAAGCCCAACA | aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G31180.2); Has 18508 Blast hits to 15212 proteins in 1719 species: Archae - 299; Bacteria - 10385; Metazoa - 672; Fungi - 662; Plants - 233; Viruses - 0; Other Eukaryotes - 6257 (source: NCBI BLink). |
| AT4G27720 | AT4G27720.1 | GTGGGCCTTAA | LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64650.1); Has 496 Blast hits to 491 proteins in 183 species: Archae - 5; Bacteria - 234; Metazoa - 75; Fungi - 33; Plants - 96; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT4G27960 | AT4G27960.1 | GTTAGGCCCAC | ubiquitin conjugating enzyme |
| AT4G27960.2 | GTTAGGCCCAC | ubiquitin conjugating enzyme |
| AT4G28230 | AT4G28230.1 | AGAGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; Has 385 Blast hits to 299 proteins in 88 species: Archae - 0; Bacteria - 7; Metazoa - 168; Fungi - 23; Plants - 22; Viruses - 2; Other Eukaryotes - 163 (source: NCBI BLink). |
| AT4G28365 | AT4G28365.1 | AAAGGCCCACTA | plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to membrane; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT4G32490.1); Has 721 Blast hits to 710 proteins in 49 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 4; Plants - 711; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31750 | AT4G31750.1 | TTTAGGCCCAC | Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). |
| AT4G32272 | AT4G32272.1 | TGTGGGCCTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related (TAIR:AT4G31600.1); Has 1302 Blast hits to 1300 proteins in 174 species: Archae - 0; Bacteria - 4; Metazoa - 376; Fungi - 239; Plants - 567; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). |
| AT4G32390 | AT4G32390.1 | TAGTGGGCCTATA | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT2G25520.1); Has 1575 Blast hits to 1573 proteins in 180 species: Archae - 0; Bacteria - 6; Metazoa - 425; Fungi - 287; Plants - 687; Viruses - 0; Other Eukaryotes - 170 (source: NCBI BLink). |
| AT4G32590 | AT4G32590.1 | AAAAGGCCCAC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.2 | AAAAGGCCCAC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.3 | AAAAGGCCCAC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.4 | AAAAGGCCCAC | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G35050 | AT4G35050.1 | TAGTGGGCCTC | Encodes a WD-40 repeat protein similar to yeast MSI1. The predicted protein has a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT4G37300 | AT4G37300.1 | AAAAGGCCCACTAAAAGCCCATATA | maternal effect embryo arrest 59 (MEE59); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G37660 | AT4G37660.1 | TGTGGGCCTTAG | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT1G70190.1); Has 5731 Blast hits to 5731 proteins in 1563 species: Archae - 0; Bacteria - 3202; Metazoa - 131; Fungi - 85; Plants - 177; Viruses - 0; Other Eukaryotes - 2136 (source: NCBI BLink). |
| AT4G38130 | AT4G38130.1 | GTGGGCCTCA | Encodes a histone deacetylase that enhances AtERF7-mediated transcriptional repression. Binds SIM3 and ERF7. Expressed in the nucleus in most tissues examined and throughout the life of the plant. Involved in jasmonic acid and ethylene dependent pathogen resistance. The sequence in GenBank has 17 AG dinucleotide repeats missing, which is also missing in Ler shotgun sequence from Cereon. Although it is annotated to be in Columbia, the GB sequence is probably not of Columbia origin. Plays a role in embryogenesis as mutants grown at higher temperatures display abnormalities in the organization of the root and shoot. Plant lines expressing an RNAi construct targeted against HDA19 shows some resistance to agrobacterium-mediated root transformation. |
| AT4G38130.1 | GTGGGCCTTT | Encodes a histone deacetylase that enhances AtERF7-mediated transcriptional repression. Binds SIM3 and ERF7. Expressed in the nucleus in most tissues examined and throughout the life of the plant. Involved in jasmonic acid and ethylene dependent pathogen resistance. The sequence in GenBank has 17 AG dinucleotide repeats missing, which is also missing in Ler shotgun sequence from Cereon. Although it is annotated to be in Columbia, the GB sequence is probably not of Columbia origin. Plays a role in embryogenesis as mutants grown at higher temperatures display abnormalities in the organization of the root and shoot. Plant lines expressing an RNAi construct targeted against HDA19 shows some resistance to agrobacterium-mediated root transformation. |
| AT4G38130.2 | GTGGGCCTCA | Encodes a histone deacetylase that enhances AtERF7-mediated transcriptional repression. Binds SIM3 and ERF7. Expressed in the nucleus in most tissues examined and throughout the life of the plant. Involved in jasmonic acid and ethylene dependent pathogen resistance. The sequence in GenBank has 17 AG dinucleotide repeats missing, which is also missing in Ler shotgun sequence from Cereon. Although it is annotated to be in Columbia, the GB sequence is probably not of Columbia origin. Plays a role in embryogenesis as mutants grown at higher temperatures display abnormalities in the organization of the root and shoot. Plant lines expressing an RNAi construct targeted against HDA19 shows some resistance to agrobacterium-mediated root transformation. |
| AT4G38130.2 | GTGGGCCTTT | Encodes a histone deacetylase that enhances AtERF7-mediated transcriptional repression. Binds SIM3 and ERF7. Expressed in the nucleus in most tissues examined and throughout the life of the plant. Involved in jasmonic acid and ethylene dependent pathogen resistance. The sequence in GenBank has 17 AG dinucleotide repeats missing, which is also missing in Ler shotgun sequence from Cereon. Although it is annotated to be in Columbia, the GB sequence is probably not of Columbia origin. Plays a role in embryogenesis as mutants grown at higher temperatures display abnormalities in the organization of the root and shoot. Plant lines expressing an RNAi construct targeted against HDA19 shows some resistance to agrobacterium-mediated root transformation. |
| AT4G38180 | AT4G38180.1 | GTGGGCCTTAT | FAR1-related sequence 5 (FRS5); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS3 (FAR1-related sequence 3); zinc ion binding (TAIR:AT2G27110.2); Has 1009 Blast hits to 905 proteins in 33 species: Archae - 2; Bacteria - 0; Metazoa - 1; Fungi - 125; Plants - 879; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G38210 | AT4G38210.1 | GTGGGCCTC | expansin -like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G38570 | AT4G38570.1 | TGAGGCCCAC | PROBABLE CDP-DIACYLGLYCEROL--INOSITOL 3-PHOSPHATIDYLTRANSFERASE 2 (PIS2); FUNCTIONS IN: phosphotransferase activity, for other substituted phosphate groups; INVOLVED IN: phosphatidylinositol biosynthetic process; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CDP-alcohol phosphatidyltransferase (InterPro:IPR000462), CDP-diacylglycerol-inositol 3-phosphatidyltransferase, eukaryote (InterPro:IPR014387); BEST Arabidopsis thaliana protein match is: ATPIS1 (PHOSPHATIDYLINOSITOL SYNTHASE 1); CDP-diacylglycerol-inositol 3-phosphatidyltransferase (TAIR:AT1G68000.1); Has 1789 Blast hits to 1789 proteins in 607 species: Archae - 10; Bacteria - 915; Metazoa - 140; Fungi - 115; Plants - 45; Viruses - 0; Other Eukaryotes - 564 (source: NCBI BLink). |
| AT4G39150 | AT4G39150.1 | GTGGGCCTAACGGGC | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G21510.1); Has 15752 Blast hits to 15663 proteins in 1939 species: Archae - 106; Bacteria - 5221; Metazoa - 3289; Fungi - 1398; Plants - 1148; Viruses - 18; Other Eukaryotes - 4572 (source: NCBI BLink). |
| AT4G39260 | AT4G39260.1 | TGTGGGCCTAAC | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT4G39260.2 | TGTGGGCCTAAC | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT4G39260.3 | TGTGGGCCTAAC | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT4G39260.4 | TGTGGGCCTAAC | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT5G01400 | AT5G01400.1 | AATAGGCCCACATCGGCCCATTAT | Encodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64. |
| AT5G10860 | AT5G10860.1 | GTGGGCCTGT | CBS domain-containing protein; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G47271.1); Has 5362 Blast hits to 5261 proteins in 950 species: Archae - 671; Bacteria - 3582; Metazoa - 2; Fungi - 45; Plants - 149; Viruses - 0; Other Eukaryotes - 913 (source: NCBI BLink). |
| AT5G10860.1 | GTGGGCCTTAA | CBS domain-containing protein; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G47271.1); Has 5362 Blast hits to 5261 proteins in 950 species: Archae - 671; Bacteria - 3582; Metazoa - 2; Fungi - 45; Plants - 149; Viruses - 0; Other Eukaryotes - 913 (source: NCBI BLink). |
| AT5G14550 | AT5G14550.1 | AGAGGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62305.1); Has 333 Blast hits to 333 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 307; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT5G14550.2 | AGAGGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62305.1); Has 333 Blast hits to 333 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 307; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT5G16200 | AT5G16200.1 | TGTGGGCCTC | 50S ribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G66890.1); Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G16250 | AT5G16250.1 | ACGGCCCACTAGGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G02640.1); Has 56 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G16260 | AT5G16260.1 | GTGGGCCTAGTGGGCCGT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), GYF (InterPro:IPR003169); Has 1767 Blast hits to 1758 proteins in 207 species: Archae - 0; Bacteria - 82; Metazoa - 1049; Fungi - 296; Plants - 184; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink). |
| AT5G19680 | AT5G19680.1 | TCAGGCCCAC | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G15410.1); Has 29854 Blast hits to 15686 proteins in 655 species: Archae - 20; Bacteria - 8097; Metazoa - 15577; Fungi - 752; Plants - 2607; Viruses - 68; Other Eukaryotes - 2733 (source: NCBI BLink). |
| AT5G19950 | AT5G19950.1 | ATATGGGCCATTAGGCCCACTA | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19950.2 | ATATGGGCCATTAGGCCCACTA | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19950.3 | ATATGGGCCATTAGGCCCACTA | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19960 | AT5G19960.1 | TAGTGGGCCTAATGGCCCATAT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: GR-RBP8; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G39260.2); Has 17397 Blast hits to 14212 proteins in 592 species: Archae - 12; Bacteria - 964; Metazoa - 9774; Fungi - 1887; Plants - 2774; Viruses - 3; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT5G22440 | AT5G22440.1 | TGTGGGCCTAAATACTGGGCTTTAA | 60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink). |
| AT5G22440.2 | TGTGGGCCTAAATACTGGGCTTTAA | 60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink). |
| AT5G23520 | AT5G23520.1 | ATATGGGCCGTTAAGGCCCACTA | LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Region of unknown function DUF1771 (InterPro:IPR013899); Has 91 Blast hits to 91 proteins in 45 species: Archae - 0; Bacteria - 6; Metazoa - 8; Fungi - 45; Plants - 27; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G23710 | AT5G23710.1 | TTTAGGCCCACA | DNA binding / DNA-directed RNA polymerase; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpc34-like (InterPro:IPR016049), RNA polymerase Rpc34 (InterPro:IPR007832); Has 254 Blast hits to 241 proteins in 127 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 89; Plants - 19; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT5G40451 | AT5G40451.1 | AAAAGGCCCACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40450.2); Has 9518 Blast hits to 5919 proteins in 574 species: Archae - 29; Bacteria - 1055; Metazoa - 3134; Fungi - 763; Plants - 338; Viruses - 136; Other Eukaryotes - 4063 (source: NCBI BLink). |
| AT5G49000 | AT5G49000.1 | TAAAGGCCCACTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae - 10; Bacteria - 167; Metazoa - 4114; Fungi - 13; Plants - 659; Viruses - 110; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT5G49000.2 | TAAAGGCCCACTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae - 10; Bacteria - 167; Metazoa - 4114; Fungi - 13; Plants - 659; Viruses - 110; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT5G49940 | AT5G49940.1 | GTGGGCCTTG | Encodes a protein containing the NFU domain and functions as a molecular scaffold for iron-sulfur cluster assembly and delivery. Homologous to the cyanobacterial CNFU protein and is targeted to the chloroplast. |
| AT5G49940.2 | GTGGGCCTTG | Encodes a protein containing the NFU domain and functions as a molecular scaffold for iron-sulfur cluster assembly and delivery. Homologous to the cyanobacterial CNFU protein and is targeted to the chloroplast. |
| AT5G50375 | AT5G50375.1 | ATAGGCCCAC | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2 |
| AT5G51940 | AT5G51940.1 | TGTGGGCCTAAATTGGGCTTG | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At2g04630. |
| AT5G53400 | AT5G53400.1 | GTGGGCCTTTT | nuclear movement family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: nuclear movement family protein (TAIR:AT4G27890.1); Has 1930 Blast hits to 1478 proteins in 221 species: Archae - 7; Bacteria - 113; Metazoa - 767; Fungi - 136; Plants - 100; Viruses - 4; Other Eukaryotes - 803 (source: NCBI BLink). |
| AT5G54520 | AT5G54520.1 | TACACGTGGGCCTGG | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G10580.1); Has 17905 Blast hits to 12742 proteins in 467 species: Archae - 38; Bacteria - 2465; Metazoa - 8443; Fungi - 2995; Plants - 1496; Viruses - 0; Other Eukaryotes - 2468 (source: NCBI BLink). |
| AT5G57930 | AT5G57930.1 | GTGGGCCTAATGGG | ACCUMULATION OF PHOTOSYSTEM ONE 2 |
| AT5G57930.2 | GTGGGCCTAATGGG | ACCUMULATION OF PHOTOSYSTEM ONE 2 |
| AT5G58560 | AT5G58560.1 | ATAAAGCCCAAACTAGGCCCACA | phosphatidate cytidylyltransferase family protein; FUNCTIONS IN: phosphatidate cytidylyltransferase activity, transferase activity, transferring phosphorus-containing groups; INVOLVED IN: phospholipid biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidate cytidylyltransferase (InterPro:IPR000374); BEST Arabidopsis thaliana protein match is: VTE5 (vitamin E pathway gene5); phosphatidate cytidylyltransferase/ phytol kinase (TAIR:AT5G04490.1); Has 383 Blast hits to 383 proteins in 126 species: Archae - 22; Bacteria - 164; Metazoa - 0; Fungi - 29; Plants - 70; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G59840 | AT5G59840.1 | AAAAGGCCCACA | Ras-related GTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB8; GTP binding (TAIR:AT3G53610.3); Has 23810 Blast hits to 23756 proteins in 654 species: Archae - 17; Bacteria - 124; Metazoa - 13243; Fungi - 2913; Plants - 2226; Viruses - 19; Other Eukaryotes - 5268 (source: NCBI BLink). |
| AT5G62390 | AT5G62390.1 | CAAGGCCCAC | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G63890 | AT5G63890.1 | GTGGGCCTTTG | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
| AT5G63890.2 | GTGGGCCTTTG | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |