version

Summary of AtREG484 (All List)

OrganismArabidopsis thaliana  
IDAtREG484  
SequenceTGGGCCAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE MotifGGGCC  one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);  
TGGGCY  "Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);)  
Total Entry Count384  

Entry Sequences (384 entries)

LocusGene modelSequenceDescription
AT1G01160AT1G01160.1ATTGGCCCAAATArabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA 
AT1G01160.2ATTGGCCCAAATArabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA 
AT1G01650AT1G01650.2TTGGCCCAACaspartic-type endopeptidase/ peptidase; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: protease-associated (PA) domain-containing protein (TAIR:AT1G63690.1); Has 1108 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 119; Metazoa - 534; Fungi - 104; Plants - 174; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT1G02090AT1G02090.1TTGGCCCAGAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. 
AT1G02090.2TTGGCCCAGAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. 
AT1G02090.3TTGGCCCAGAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. 
AT1G02100AT1G02100.1TCTGGGCCAAleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT1G02100.2TCTGGGCCAAleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT1G02100.3TCTGGGCCAAleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT1G02180AT1G02180.1ATTGGCCCAferredoxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G02190AT1G02190.1TGGGCCAATCER1 protein, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid hydroxylase (InterPro:IPR006694); BEST Arabidopsis thaliana protein match is: catalytic/ iron ion binding / oxidoreductase (TAIR:AT2G37700.1); Has 1933 Blast hits to 1933 proteins in 393 species: Archae - 0; Bacteria - 634; Metazoa - 240; Fungi - 255; Plants - 298; Viruses - 2; Other Eukaryotes - 504 (source: NCBI BLink). 
AT1G02190.2TGGGCCAATCER1 protein, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid hydroxylase (InterPro:IPR006694); BEST Arabidopsis thaliana protein match is: catalytic/ iron ion binding / oxidoreductase (TAIR:AT2G37700.1); Has 1933 Blast hits to 1933 proteins in 393 species: Archae - 0; Bacteria - 634; Metazoa - 240; Fungi - 255; Plants - 298; Viruses - 2; Other Eukaryotes - 504 (source: NCBI BLink). 
AT1G02405AT1G02405.1TTGGCCCAATAAAGCCCAAATproline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G70990.1); Has 43114 Blast hits to 16780 proteins in 897 species: Archae - 84; Bacteria - 5479; Metazoa - 15161; Fungi - 3897; Plants - 10314; Viruses - 1979; Other Eukaryotes - 6200 (source: NCBI BLink). 
AT1G02410AT1G02410.1ATTTGGGCTTTATTGGGCCAAcytochrome c oxidase assembly protein CtaG / Cox11 family; FUNCTIONS IN: copper ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein CtaG/Cox11 (InterPro:IPR007533); Has 2371 Blast hits to 2371 proteins in 476 species: Archae - 0; Bacteria - 724; Metazoa - 77; Fungi - 85; Plants - 18; Viruses - 0; Other Eukaryotes - 1467 (source: NCBI BLink). 
AT1G02560AT1G02560.1TTGGCCCATTTOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). 
AT1G02960AT1G02960.1TTGGCCCAAAAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT1G02960.2TTGGCCCAAAAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT1G02960.3TTGGCCCAAAAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT1G04170AT1G04170.1TGTTGGGCCAAprotein synthesis initiation factor eIF2 gamma 
AT1G04590AT1G04590.1TTAATGGGCCAATFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G04590.1TTAATGGGCCAATFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G04590.2TTAATGGGCCAATFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G04590.2TTAATGGGCCAATFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G04950AT1G04950.1CTTATTGGGCCTTGGCCCAAAAEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. 
AT1G04950.2CTTATTGGGCCTTGGCCCAAAAEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. 
AT1G04950.3CTTATTGGGCCTTGGCCCAAAAEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. 
AT1G05360AT1G05360.1CAATGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT1G05940AT1G05940.1TTGGCCCAATATEncodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. 
AT1G06790AT1G06790.1TTGGCCCARNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G06790.1TTGGCCCAATTRNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G06790.2TTGGCCCARNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G06790.2TTGGCCCAATTRNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G07250AT1G07250.1TTGGCCCACAUDP-GLUCOSYL TRANSFERASE 71C4 (UGT71C4); FUNCTIONS IN: quercetin 3-O-glucosyltransferase activity, quercetin 7-O-glucosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71C3 (UDP-GLUCOSYL TRANSFERASE 71C3); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT1G07260.1); Has 4707 Blast hits to 4690 proteins in 296 species: Archae - 0; Bacteria - 123; Metazoa - 1851; Fungi - 11; Plants - 2658; Viruses - 37; Other Eukaryotes - 27 (source: NCBI BLink). 
AT1G08130AT1G08130.1TTGGCCCAACAEncodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. Indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus. 
AT1G08540AT1G08540.1ATTGGGCCAAEnodes a subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme. SIG1 is induced by red and blue light. 
AT1G08610AT1G08610.1ATTGGCCCAAAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 19965 Blast hits to 5457 proteins in 167 species: Archae - 5; Bacteria - 16; Metazoa - 328; Fungi - 289; Plants - 18418; Viruses - 0; Other Eukaryotes - 909 (source: NCBI BLink). 
AT1G09415AT1G09415.1TTTGGGCCAAencodes a kinase that physically interacts with NPR1/NIM1 
AT1G09520AT1G09520.1TTGGCCCAAGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G09760AT1G09760.1TTATGGGCCTAACCGACTGGGCCAATU2 small nuclear ribonucleoprotein A (U2A'); FUNCTIONS IN: protein binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U2A'/phosphoprotein 32 family A, C-terminal (InterPro:IPR003603); Has 5479 Blast hits to 4495 proteins in 302 species: Archae - 0; Bacteria - 1581; Metazoa - 2979; Fungi - 220; Plants - 106; Viruses - 2; Other Eukaryotes - 591 (source: NCBI BLink). 
AT1G09770AT1G09770.1ATTGGCCCAGTCGGTTAGGCCCATAAMember of MYB3R- and R2R3- type MYB- encoding genes. Essential for plant innate immunity. Interacts with MOS4 and PRL1. 
AT1G11240AT1G11240.1TACCCTTATAATGGGCCAAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 2452 Blast hits to 1845 proteins in 201 species: Archae - 0; Bacteria - 81; Metazoa - 1026; Fungi - 315; Plants - 107; Viruses - 18; Other Eukaryotes - 905 (source: NCBI BLink). 
AT1G12800AT1G12800.1CTATTGGGCCAATTTTAGGCCCATGS1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink). 
AT1G12830AT1G12830.1TAAATGGGCTAATACTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 39113 Blast hits to 20367 proteins in 821 species: Archae - 97; Bacteria - 5453; Metazoa - 15540; Fungi - 5514; Plants - 1861; Viruses - 608; Other Eukaryotes - 10040 (source: NCBI BLink). 
AT1G12840AT1G12840.1TTGGCCCAGTATTAGCCCATTTAEncodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. 
AT1G13690AT1G13690.1TTATTGGGCCAATAtE1 - stimulates the ATPase activity of DnaK/DnaJ 
AT1G16180AT1G16180.1ATTTGGGCCATTAGTGGGCCAATMS membrane family protein / tumour differentially expressed (TDE) family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TMS membrane protein/tumour differentially expressed protein (InterPro:IPR005016); BEST Arabidopsis thaliana protein match is: TMS membrane family protein / tumour differentially expressed (TDE) family protein (TAIR:AT3G06170.1); Has 608 Blast hits to 602 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 87; Plants - 80; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). 
AT1G16970AT1G16970.1TTGGCCCAATAAKu80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity. 
AT1G17760AT1G17760.1TTAATGGGCCAAEncodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. 
AT1G17880AT1G17880.1ATTGGCCCAGTnascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein (TAIR:AT1G73230.1); Has 620 Blast hits to 620 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). 
AT1G17880.1TTTTGGGCCTTATGGGCCAATnascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein (TAIR:AT1G73230.1); Has 620 Blast hits to 620 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). 
AT1G19140AT1G19140.1TAGTGGGCCAATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). 
AT1G19140.2TAGTGGGCCAATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). 
AT1G19150AT1G19150.1ATTGGCCCACTAPSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA, 
AT1G23280AT1G23280.1TTGGCCCAATTAMAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink). 
AT1G23290AT1G23290.1TAATTGGGCCAAEncodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20. 
AT1G23710AT1G23710.1ATTGGCCCAATTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70420.1); Has 203 Blast hits to 197 proteins in 42 species: Archae - 0; Bacteria - 4; Metazoa - 16; Fungi - 9; Plants - 112; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT1G24170AT1G24170.1CTTAATGGGCCAAEncodes a protein with putative galacturonosyltransferase activity. 
AT1G28120AT1G28120.1TGTTGGGCCAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin thioesterase Otubain (InterPro:IPR016615), Ovarian tumour, otubain (InterPro:IPR003323); Has 295 Blast hits to 295 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 50; Plants - 47; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). 
AT1G28610AT1G28610.1TTGGCCCAGDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: lipase, putative (TAIR:AT2G27360.1); Has 1800 Blast hits to 1773 proteins in 147 species: Archae - 0; Bacteria - 219; Metazoa - 1; Fungi - 4; Plants - 1572; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G28610.2TTGGCCCAGDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: lipase, putative (TAIR:AT2G27360.1); Has 1800 Blast hits to 1773 proteins in 147 species: Archae - 0; Bacteria - 219; Metazoa - 1; Fungi - 4; Plants - 1572; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G30880AT1G30880.1ATTTGGGCCTAAATTGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G30890AT1G30890.1ATTGGCCCAATTTAGGCCCAAATintegral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). 
AT1G30890.2ATTGGCCCAATTTAGGCCCAAATintegral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). 
AT1G32260AT1G32260.1TGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35480.1); Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G32490AT1G32490.1TTGGCCCATTTAEncodes a homolog of the yeast PRP2 protein, one of four related DEAH RNA helicases identified as essential cofactors for RNA splicing. 
AT1G32580AT1G32580.1ATTGGCCCATTTAplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 151 Blast hits to 138 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G33330AT1G33330.1TAAATGGGCCAAGCCCApeptide chain release factor, putative; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); BEST Arabidopsis thaliana protein match is: peptide chain release factor, putative (TAIR:AT1G56350.1); Has 9739 Blast hits to 9739 proteins in 1553 species: Archae - 0; Bacteria - 5377; Metazoa - 210; Fungi - 152; Plants - 96; Viruses - 10; Other Eukaryotes - 3894 (source: NCBI BLink). 
AT1G41880AT1G41880.1ATTTGGGCCAA60S ribosomal protein L35a (RPL35aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aD) (TAIR:AT3G55750.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). 
AT1G41880.1GTTTGGGCCAA60S ribosomal protein L35a (RPL35aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aD) (TAIR:AT3G55750.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). 
AT1G44750AT1G44750.1ATTGGCCCATTAAMember of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. 
AT1G49200AT1G49200.1TATGGGCCAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G49210.1); Has 5860 Blast hits to 5841 proteins in 212 species: Archae - 0; Bacteria - 0; Metazoa - 1984; Fungi - 368; Plants - 2596; Viruses - 40; Other Eukaryotes - 872 (source: NCBI BLink). 
AT1G50480AT1G50480.1TGGGCCAA10-formyltetrahydrofolate synthetase (THFS) mRNA, complete 
AT1G51070AT1G51070.1TGGGCCAATbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ILR3 (iaa-leucine resistant3); DNA binding / transcription factor (TAIR:AT5G54680.1); Has 513 Blast hits to 498 proteins in 83 species: Archae - 4; Bacteria - 26; Metazoa - 75; Fungi - 9; Plants - 282; Viruses - 2; Other Eukaryotes - 115 (source: NCBI BLink). 
AT1G51980AT1G51980.1ATTGGGCCAAGCCCATAAmitochondrial processing peptidase alpha subunit, putative; FUNCTIONS IN: metalloendopeptidase activity, ATP binding; INVOLVED IN: proteolysis, response to salt stress; LOCATED IN: in 6 components; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: MPPalpha (mitochondrial processing peptidase alpha subunit); catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding (TAIR:AT3G16480.1); Has 4104 Blast hits to 4031 proteins in 871 species: Archae - 10; Bacteria - 1938; Metazoa - 533; Fungi - 396; Plants - 134; Viruses - 3; Other Eukaryotes - 1090 (source: NCBI BLink). 
AT1G51980.2ATTGGGCCAAGCCCATAAmitochondrial processing peptidase alpha subunit, putative; FUNCTIONS IN: metalloendopeptidase activity, ATP binding; INVOLVED IN: proteolysis, response to salt stress; LOCATED IN: in 6 components; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: MPPalpha (mitochondrial processing peptidase alpha subunit); catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding (TAIR:AT3G16480.1); Has 4104 Blast hits to 4031 proteins in 871 species: Archae - 10; Bacteria - 1938; Metazoa - 533; Fungi - 396; Plants - 134; Viruses - 3; Other Eukaryotes - 1090 (source: NCBI BLink). 
AT1G52270AT1G52270.1TAGTGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28310.1); Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G55330AT1G55330.1GTTTGGGCCAAEncodes a putative arabinogalactan-protein (AGP21). 
AT1G56060AT1G56060.1ATTGGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32190.1); Has 124 Blast hits to 124 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G56070AT1G56070.1ATTGGCCCATTAAGGCCCATTAAGencodes a translation elongation factor 2-like protein that is involved in cold-induced translation. Mutations in this gene specifically blocks low temperature-induced transcription of cold-responsive genes but induces the expression of CBF genes and mutants carrying the recessive mutations fail to acclimate to cold and is freezing sensitive. 
AT1G62150AT1G62150.1ATTGGCCCAGmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G62085.1); Has 429 Blast hits to 366 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 418; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G64350AT1G64350.1TTGGCCCAAGseh1-like protein 
AT1G64850AT1G64850.1ATTGGCCCAAATcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G37445.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G65040AT1G65040.2TAATTGGGCCAAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink). 
AT1G65040.3TAATTGGGCCAAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink). 
AT1G67970AT1G67970.1TGTTGGGCCAAmember of Heat Stress Transcription Factor (Hsf) family 
AT1G68100AT1G68100.1CAATGGGCCAAmember of IAA-alanine resistance protein 1 
AT1G68590AT1G68590.1TGATGGGCCAAplastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, PSRP-3/Ycf65 (InterPro:IPR006924); BEST Arabidopsis thaliana protein match is: plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative (TAIR:AT5G15760.1); Has 334 Blast hits to 334 proteins in 87 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). 
AT1G68590.2TGATGGGCCAAplastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, PSRP-3/Ycf65 (InterPro:IPR006924); BEST Arabidopsis thaliana protein match is: plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative (TAIR:AT5G15760.1); Has 334 Blast hits to 334 proteins in 87 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). 
AT1G69510AT1G69510.1TTGGCCCAATTAAGGCCCAAACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G69510.2TTGGCCCAATTAAGGCCCAAACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G69510.3TTGGCCCAATTAAGGCCCAAACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G69620AT1G69620.1AGATGGGCCTTTGGGCCAAputative 60S ribosomal protein L34 
AT1G70190AT1G70190.1TTTTGGGCCAAribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G37660.1); Has 5742 Blast hits to 5742 proteins in 1557 species: Archae - 0; Bacteria - 3189; Metazoa - 133; Fungi - 84; Plants - 174; Viruses - 0; Other Eukaryotes - 2162 (source: NCBI BLink). 
AT1G70570AT1G70570.1CTTATTGGGCCAAanthranilate phosphoribosyltransferase, putative; FUNCTIONS IN: anthranilate phosphoribosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: tryptophan biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 3, N-terminal (InterPro:IPR017459), Glycosyl transferase, family 3 (InterPro:IPR000312); Has 991 Blast hits to 991 proteins in 393 species: Archae - 46; Bacteria - 770; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). 
AT1G71500AT1G71500.1CTAAGGCCCACATTGGCCCAACTRieske (2Fe-2S) domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, 2 iron, 2 sulfur cluster binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rieske [2Fe-2S] iron-sulphur domain (InterPro:IPR017941), Rieske [2Fe-2S] region (InterPro:IPR005806); Has 207 Blast hits to 207 proteins in 61 species: Archae - 0; Bacteria - 101; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT1G73840AT1G73840.1TTGGCCCAGResembles the CstF64 family of RNA processing factors that are conserved between yeast and mammals. In mammals, CstF64 is a component of the CstF complex which is required for mRNA 3'end formation along with other factors. 
AT1G77270AT1G77270.1ACTGGGCCAAAAAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07730.1); Has 365 Blast hits to 331 proteins in 76 species: Archae - 0; Bacteria - 25; Metazoa - 174; Fungi - 10; Plants - 59; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). 
AT1G79610AT1G79610.1AGTTGGGCCAAsodium proton exchanger, putative (NHX6); FUNCTIONS IN: solute:hydrogen antiporter activity, sodium:hydrogen antiporter activity; INVOLVED IN: cation transport, sodium ion transport, regulation of pH; LOCATED IN: integral to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Na+/H+ exchanger, subfamily (InterPro:IPR004709), Cation/H+ exchanger, conserved region (InterPro:IPR018422), Na+/H+ exchanger, isoform 5/6/8, conserved region (InterPro:IPR018409), Cation/H+ exchanger (InterPro:IPR006153), Na+/H+ exchanger, conserved region (InterPro:IPR018406); BEST Arabidopsis thaliana protein match is: NHX5; sodium ion transmembrane transporter/ sodium:hydrogen antiporter (TAIR:AT1G54370.1); Has 4010 Blast hits to 4005 proteins in 1041 species: Archae - 71; Bacteria - 2418; Metazoa - 735; Fungi - 95; Plants - 280; Viruses - 0; Other Eukaryotes - 411 (source: NCBI BLink). 
AT2G01650AT2G01650.1CTTGGGCCAATencodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo. 
AT2G01650.1TTGGCCCAAAAencodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo. 
AT2G01650.1TTGGCCCAAAAGGCCCATTAAencodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo. 
AT2G01880AT2G01880.1ATTGGCCCATAPURPLE ACID PHOSPHATASE 7 (PAP7); FUNCTIONS IN: protein serine/threonine phosphatase activity, acid phosphatase activity; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: PAP17; acid phosphatase/ phosphatase/ protein serine/threonine phosphatase (TAIR:AT3G17790.1); Has 806 Blast hits to 802 proteins in 206 species: Archae - 0; Bacteria - 163; Metazoa - 324; Fungi - 6; Plants - 100; Viruses - 0; Other Eukaryotes - 213 (source: NCBI BLink). 
AT2G02050AT2G02050.1AAATGGGCTTTTGGCCCATATNADH-ubiquinone oxidoreductase B18 subunit, putative; FUNCTIONS IN: NADH dehydrogenase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NADH-ubiquinone oxidoreductase B18 subunit (InterPro:IPR008698); Has 184 Blast hits to 184 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 97; Fungi - 49; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT2G03667AT2G03667.1ATTGGGCCAAasparagine synthase (glutamine-hydrolyzing); FUNCTIONS IN: asparagine synthase (glutamine-hydrolyzing) activity; INVOLVED IN: asparagine biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Asparagine synthase (InterPro:IPR001962), Glutamine amidotransferase, type II (InterPro:IPR017932); Has 804 Blast hits to 751 proteins in 286 species: Archae - 66; Bacteria - 218; Metazoa - 123; Fungi - 87; Plants - 17; Viruses - 3; Other Eukaryotes - 290 (source: NCBI BLink). 
AT2G03690AT2G03690.1TTATGGGCCAAUbiquinone biosynthesis protein COQ4 homolog. 
AT2G04378AT2G04378.1TTTTGGGCCAAbeta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G04378.2TTTTGGGCCAAbeta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G04390AT2G04390.1TTGGCCCAAAA40S ribosomal protein S17 (RPS17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus, plasma membrane; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). 
AT2G11890AT2G11890.1AAATGGGCCAAadenylate cyclase 
AT2G11890.2AAATGGGCCAAadenylate cyclase 
AT2G18740AT2G18740.1ATTTGGGCCAAsmall nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative (TAIR:AT4G30330.1); Has 513 Blast hits to 513 proteins in 151 species: Archae - 78; Bacteria - 0; Metazoa - 173; Fungi - 106; Plants - 69; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink). 
AT2G18740.2ATTTGGGCCAAsmall nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative (TAIR:AT4G30330.1); Has 513 Blast hits to 513 proteins in 151 species: Archae - 78; Bacteria - 0; Metazoa - 173; Fungi - 106; Plants - 69; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink). 
AT2G20585AT2G20585.1TTGGCCCAAAANUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G20585.2TTGGCCCAAAANUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G20585.3TTGGCCCAAAANUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G24500AT2G24500.1GTTTGGGCCAAEncodes a C2H2 zinc finger protein FZF. 
AT2G27020AT2G27020.1GAATGGGCCAAEncodes 20S proteasome subunit PAG1 (PAG1). 
AT2G27820AT2G27820.1TTGGCCCAEncodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. 
AT2G29180AT2G29180.1TTGGCCCATCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 21 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G29580AT2G29580.1AATTGGGCCAAzinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT1G07360.1); Has 10655 Blast hits to 8392 proteins in 419 species: Archae - 8; Bacteria - 299; Metazoa - 5085; Fungi - 2309; Plants - 1897; Viruses - 119; Other Eukaryotes - 938 (source: NCBI BLink). 
AT2G32415AT2G32415.1TTTTGGGCCAA3'-5' exonuclease/ nucleic acid binding; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: shoot apex, cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Helicase and RNase D C-terminal, HRDC (InterPro:IPR002121), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease domain-containing protein / helicase and RNase D C-terminal domain-containing protein / HRDC domain-containing protein (TAIR:AT5G35910.1); Has 2895 Blast hits to 2797 proteins in 774 species: Archae - 0; Bacteria - 1374; Metazoa - 367; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 953 (source: NCBI BLink). 
AT2G36060AT2G36060.1TTGGCCCATCAMMZ3/UEV1C encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1C can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. It can also rescue an mms2 ubc13 double mutant in yeast in combination with UBC13A. MMZ3/UEV1C transcripts are found at moderate levels in most plant organs, but cannot be detected in the pollen or 2 days after germination. Transcript levels do not appear to be stress-inducible. 
AT2G36060.2TTGGCCCATCAMMZ3/UEV1C encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1C can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. It can also rescue an mms2 ubc13 double mutant in yeast in combination with UBC13A. MMZ3/UEV1C transcripts are found at moderate levels in most plant organs, but cannot be detected in the pollen or 2 days after germination. Transcript levels do not appear to be stress-inducible. 
AT2G36060.3TTGGCCCATCAMMZ3/UEV1C encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1C can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. It can also rescue an mms2 ubc13 double mutant in yeast in combination with UBC13A. MMZ3/UEV1C transcripts are found at moderate levels in most plant organs, but cannot be detected in the pollen or 2 days after germination. Transcript levels do not appear to be stress-inducible. 
AT2G36305AT2G36305.1ATTGGCCCAATGEncodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. 
AT2G36620AT2G36620.1CATGGGCCAARPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020). 
AT2G36900AT2G36900.1TTGGCCCAACTmember of Membrin Gene Family 
AT2G36900.2TTGGCCCAACTmember of Membrin Gene Family 
AT2G38560AT2G38560.1TTGGCCCAATAAGGGCCTGGEncodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy. 
AT2G40020AT2G40020.1GATGGGCCAATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink). 
AT2G40020.2GATGGGCCAATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink). 
AT2G40020.3GATGGGCCAATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink). 
AT2G41370AT2G41370.1TTGGCCCAEncodes a cytoplasmic and nuclear-localized NPR1 like protein with BTB/POZ domain and ankyrin repeats. Interacts with BOP1 and appears to be genetically redundant with BOP1.bop1/bop2 double mutants have longer leaves, often with leaflets on the petiole, asymmetric flowers with extra organs and no nectaries. Also defective in floral organ abs cission. 
AT2G43350AT2G43350.1TTGGCCCATGGlutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1. 
AT2G44650AT2G44650.1ATTGGCCCAATGEncodes a chloroplast-localized chaperonin 10 whose mRNA is expressed in leaves and stems but not roots. 
AT2G46890AT2G46890.1TGGGCCAACATGGGCCCATAoxidoreductase, acting on the CH-CH group of donors; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system, integral to membrane, cytoplasm; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104), Protein of unknown function DUF1295 (InterPro:IPR010721); BEST Arabidopsis thaliana protein match is: oxidoreductase, acting on the CH-CH group of donors (TAIR:AT1G18180.1); Has 1542 Blast hits to 1542 proteins in 207 species: Archae - 2; Bacteria - 258; Metazoa - 69; Fungi - 95; Plants - 57; Viruses - 0; Other Eukaryotes - 1061 (source: NCBI BLink). 
AT2G47960AT2G47960.1TTATGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF974 (InterPro:IPR010378); Has 215 Blast hits to 214 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 46; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT3G01820AT3G01820.1TGGGCCAAadenylate kinase family protein; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: ADK (ADENOSINE KINASE); adenylate kinase/ nucleotide kinase (TAIR:AT2G37250.1); Has 6349 Blast hits to 6292 proteins in 1637 species: Archae - 58; Bacteria - 3459; Metazoa - 744; Fungi - 256; Plants - 228; Viruses - 0; Other Eukaryotes - 1604 (source: NCBI BLink). 
AT3G01850AT3G01850.1CAATTGGGCCAAribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). 
AT3G01850.2CAATTGGGCCAAribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). 
AT3G02160AT3G02160.1TGTTGGGCCAADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Bromodomain transcription factor (InterPro:IPR006565); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15570.1); Has 126 Blast hits to 126 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT3G02640AT3G02640.1TTGGCCCATTGGGCTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16250.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G03960AT3G03960.1TTGGCCCACAchaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, theta subunit (InterPro:IPR012721); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 10959 Blast hits to 10902 proteins in 2114 species: Archae - 388; Bacteria - 4701; Metazoa - 1599; Fungi - 906; Plants - 376; Viruses - 0; Other Eukaryotes - 2989 (source: NCBI BLink). 
AT3G04760AT3G04760.1TGTGGGCCAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 26507 Blast hits to 6286 proteins in 193 species: Archae - 4; Bacteria - 28; Metazoa - 952; Fungi - 704; Plants - 23378; Viruses - 0; Other Eukaryotes - 1441 (source: NCBI BLink). 
AT3G05590AT3G05590.1TAAATGGGCCAATEncodes cytoplasmic ribosomal protein L18. 
AT3G06040AT3G06040.1CTTATTGGGCTTGGCCCATAribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). 
AT3G06040.2CTTATTGGGCTTGGCCCATAribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). 
AT3G06040.3CTTATTGGGCTTGGCCCATAribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). 
AT3G07568AT3G07568.1CTAATGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 6 Blast hits to 6 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G09470AT3G09470.1ATTGGCCCAGCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). 
AT3G09470.2ATTGGCCCAGCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). 
AT3G09670AT3G09670.1TGGGCCAAPWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT5G02950.1); Has 722 Blast hits to 638 proteins in 104 species: Archae - 0; Bacteria - 10; Metazoa - 436; Fungi - 38; Plants - 69; Viruses - 0; Other Eukaryotes - 169 (source: NCBI BLink). 
AT3G09670.2TGGGCCAAPWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT5G02950.1); Has 722 Blast hits to 638 proteins in 104 species: Archae - 0; Bacteria - 10; Metazoa - 436; Fungi - 38; Plants - 69; Viruses - 0; Other Eukaryotes - 169 (source: NCBI BLink). 
AT3G10572AT3G10572.1GAAGCCCATTATATTGGCCCAATAG3-phosphoinositide-dependent protein kinase-1, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G12320AT3G12320.1GTACACGTGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06980.1); Has 49 Blast hits to 49 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G13930AT3G13930.1GATGGGCCAAdihydrolipoamide S-acetyltransferase, putative; FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: pyruvate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide acetyltransferase, long form (InterPro:IPR006257), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: dihydrolipoamide S-acetyltransferase, putative (TAIR:AT1G54220.2); Has 15128 Blast hits to 14242 proteins in 1320 species: Archae - 43; Bacteria - 6315; Metazoa - 646; Fungi - 315; Plants - 198; Viruses - 0; Other Eukaryotes - 7611 (source: NCBI BLink). 
AT3G14172AT3G14172.1TTGGCCCATCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 2665 Blast hits to 1956 proteins in 215 species: Archae - 2; Bacteria - 189; Metazoa - 878; Fungi - 141; Plants - 132; Viruses - 5; Other Eukaryotes - 1318 (source: NCBI BLink). 
AT3G14190AT3G14190.1CTGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12360.1); Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G14890AT3G14890.1TTGGCCCAAACphosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink). 
AT3G14890.2TTGGCCCAAACphosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink). 
AT3G15060AT3G15060.1ATTGGCCCAGTArabidopsis Rab GTPase homolog A1g (AtRABA1g); FUNCTIONS IN: GTP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: AtRABA1f (Arabidopsis Rab GTPase homolog A1f); GTP binding (TAIR:AT5G60860.1); Has 22374 Blast hits to 22336 proteins in 611 species: Archae - 21; Bacteria - 95; Metazoa - 12471; Fungi - 2920; Plants - 1850; Viruses - 19; Other Eukaryotes - 4998 (source: NCBI BLink). 
AT3G16310AT3G16310.1TCTGGGCCAAmitotic phosphoprotein N' end (MPPN) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: MPPN (InterPro:IPR007846), Nucleoporin, NUP53 (InterPro:IPR017389); Has 170 Blast hits to 170 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 5; Plants - 32; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT3G16420AT3G16420.1TTAATGGGCCAAThe PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. 
AT3G16420.2TTAATGGGCCAAThe PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. 
AT3G16420.3TTAATGGGCCAAThe PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. 
AT3G16480AT3G16480.1ATTTGGGCCAAmitochondrial processing peptidase alpha subunit (MPPalpha); FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 4301 Blast hits to 4224 proteins in 886 species: Archae - 10; Bacteria - 2091; Metazoa - 526; Fungi - 394; Plants - 137; Viruses - 3; Other Eukaryotes - 1140 (source: NCBI BLink). 
AT3G16700AT3G16700.1TATATGGGCCAATAATGGGCCATAfumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae - 132; Bacteria - 3815; Metazoa - 259; Fungi - 271; Plants - 44; Viruses - 0; Other Eukaryotes - 3026 (source: NCBI BLink). 
AT3G16700.2TATATGGGCCAATAATGGGCCATAfumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae - 132; Bacteria - 3815; Metazoa - 259; Fungi - 271; Plants - 44; Viruses - 0; Other Eukaryotes - 3026 (source: NCBI BLink). 
AT3G16780AT3G16780.1ATAATGGGCCAA60S ribosomal protein L19 (RPL19B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 848 Blast hits to 848 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 265; Fungi - 106; Plants - 93; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). 
AT3G16990AT3G16990.1AATAGGCCTTGGCCCATTAATENA/THI-4 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem oxygenase-like, multi-helical (InterPro:IPR016084), TENA/THI-4 protein/Coenzyme PQQ biosynthesis protein C (InterPro:IPR004305); Has 201 Blast hits to 201 proteins in 61 species: Archae - 21; Bacteria - 69; Metazoa - 0; Fungi - 17; Plants - 26; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). 
AT3G17000AT3G17000.1TTAATGGGCCAAGGCCTATTubiquitin-conjugating enzyme 32 (UBC32); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5810 Blast hits to 5810 proteins in 294 species: Archae - 0; Bacteria - 0; Metazoa - 2855; Fungi - 1053; Plants - 896; Viruses - 16; Other Eukaryotes - 990 (source: NCBI BLink). 
AT3G17890AT3G17890.1TTGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 6 species: Archae - 0; Bacteria - 4; Metazoa - 5; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G17930AT3G17930.1TTGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 195 Blast hits to 195 proteins in 62 species: Archae - 0; Bacteria - 98; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT3G18500AT3G18500.1ATTGGCCCATGGCCCATGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: endonuclease/exonuclease/phosphatase family protein (TAIR:AT1G73875.1); Has 964 Blast hits to 937 proteins in 164 species: Archae - 0; Bacteria - 37; Metazoa - 442; Fungi - 164; Plants - 170; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). 
AT3G18500.2ATTGGCCCATGGCCCATGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: endonuclease/exonuclease/phosphatase family protein (TAIR:AT1G73875.1); Has 964 Blast hits to 937 proteins in 164 species: Archae - 0; Bacteria - 37; Metazoa - 442; Fungi - 164; Plants - 170; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). 
AT3G19520AT3G19520.1CCCGGCCCTTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G19520.2CCCGGCCCTTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G20020AT3G20020.1ATTGGCCCATTAPROTEIN ARGININE METHYLTRANSFERASE 6 (PRMT6); FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: PRMT1A (PROTEIN ARGININE METHYLTRANSFERASE 1A); protein-arginine N-methyltransferase (TAIR:AT2G19670.1); Has 3635 Blast hits to 3579 proteins in 972 species: Archae - 81; Bacteria - 1747; Metazoa - 1005; Fungi - 174; Plants - 198; Viruses - 0; Other Eukaryotes - 430 (source: NCBI BLink). 
AT3G20020.2ATTGGCCCATTAPROTEIN ARGININE METHYLTRANSFERASE 6 (PRMT6); FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: PRMT1A (PROTEIN ARGININE METHYLTRANSFERASE 1A); protein-arginine N-methyltransferase (TAIR:AT2G19670.1); Has 3635 Blast hits to 3579 proteins in 972 species: Archae - 81; Bacteria - 1747; Metazoa - 1005; Fungi - 174; Plants - 198; Viruses - 0; Other Eukaryotes - 430 (source: NCBI BLink). 
AT3G21110AT3G21110.1TTGGCCCATTTA5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone. 
AT3G21110.2TTGGCCCATTTA5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone. 
AT3G21350AT3G21350.1TTTTGGGCCAATRNA polymerase transcriptional regulation mediator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit 6, metazoa/plant (InterPro:IPR016820), MED6 mediator (InterPro:IPR007018). 
AT3G21350.2TTTTGGGCCAATRNA polymerase transcriptional regulation mediator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit 6, metazoa/plant (InterPro:IPR016820), MED6 mediator (InterPro:IPR007018). 
AT3G22440AT3G22440.1AGTGGGCTTGGCCCAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G14900.1); Has 1107 Blast hits to 1058 proteins in 102 species: Archae - 0; Bacteria - 5; Metazoa - 133; Fungi - 62; Plants - 888; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT3G22780AT3G22780.1TAATTGGGCCAAputative DNA binding protein (tso1) mRNA, tso1-3 allele, 
AT3G24490AT3G24490.1TTGGCCCATTAGtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 2488 Blast hits to 1665 proteins in 165 species: Archae - 0; Bacteria - 71; Metazoa - 1163; Fungi - 123; Plants - 222; Viruses - 36; Other Eukaryotes - 873 (source: NCBI BLink). 
AT3G24515AT3G24515.1ATATTGGGCCAAubiquitin-conjugating enzyme 37 (UBC37); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC11 (UBIQUITIN-CONJUGATING ENZYME 11); ubiquitin-protein ligase (TAIR:AT3G08690.1); Has 7488 Blast hits to 7480 proteins in 304 species: Archae - 0; Bacteria - 0; Metazoa - 3738; Fungi - 1409; Plants - 1069; Viruses - 22; Other Eukaryotes - 1250 (source: NCBI BLink). 
AT3G25800AT3G25800.1TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit 
AT3G25800.2TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit 
AT3G25805AT3G25805.1TGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 32 species: Archae - 0; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G27240AT3G27240.1TTGGCCCATTAAGGCCCAAATcytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT5G40810.1); Has 2901 Blast hits to 2901 proteins in 507 species: Archae - 0; Bacteria - 704; Metazoa - 170; Fungi - 165; Plants - 63; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). 
AT3G27820AT3G27820.1TGATGGGCCAAEncodes a peroxisome membrane-bound monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 
AT3G28070AT3G28070.1ATTGGCCCAAAnodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT3G28080.1); Has 1514 Blast hits to 1505 proteins in 240 species: Archae - 12; Bacteria - 594; Metazoa - 6; Fungi - 2; Plants - 619; Viruses - 0; Other Eukaryotes - 281 (source: NCBI BLink). 
AT3G28070.2ATTGGCCCAAAnodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT3G28080.1); Has 1514 Blast hits to 1505 proteins in 240 species: Archae - 12; Bacteria - 594; Metazoa - 6; Fungi - 2; Plants - 619; Viruses - 0; Other Eukaryotes - 281 (source: NCBI BLink). 
AT3G28070.3ATTGGCCCAAAnodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT3G28080.1); Has 1514 Blast hits to 1505 proteins in 240 species: Archae - 12; Bacteria - 594; Metazoa - 6; Fungi - 2; Plants - 619; Viruses - 0; Other Eukaryotes - 281 (source: NCBI BLink). 
AT3G45030AT3G45030.1CAAGGCCCATATTGGCCCAAG40S ribosomal protein S20 (RPS20A); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20C) (TAIR:AT5G62300.2); Has 5001 Blast hits to 5001 proteins in 1494 species: Archae - 173; Bacteria - 2599; Metazoa - 280; Fungi - 90; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). 
AT3G48330AT3G48330.1TTTTGGGCCAAencodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination. 
AT3G48330.2TTTTGGGCCAAencodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination. 
AT3G49500AT3G49500.1TTGGCCCAGEncodes RNA-dependent RNA polymerase. Involved in trans-acting siRNA and other siRNA biogenesis. Required for post-transcriptional gene silencing and natural virus resistance. 
AT3G50080AT3G50080.1ATAAAGCCCATTGGGCCAAEncodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. 
AT3G51520AT3G51520.1TTGGCCCAATATdiacylglycerol acyltransferase family; FUNCTIONS IN: diacylglycerol O-acyltransferase activity, transferase activity, transferring acyl groups other than amino-acyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Diacylglycerol acyltransferase (InterPro:IPR007130); Has 889 Blast hits to 882 proteins in 180 species: Archae - 0; Bacteria - 135; Metazoa - 472; Fungi - 110; Plants - 62; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). 
AT3G52220AT3G52220.1TTGGCCCATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 9607 Blast hits to 4937 proteins in 278 species: Archae - 10; Bacteria - 152; Metazoa - 4787; Fungi - 1223; Plants - 656; Viruses - 23; Other Eukaryotes - 2756 (source: NCBI BLink). 
AT3G52230AT3G52230.1TTATGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast outer membrane, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G55460AT3G55460.1TAAATGGGCCAAencodes an SC35-like splicing factor that is localized to nuclear specks. 
AT3G55750AT3G55750.1ATTTGGGCCAA60S ribosomal protein L35a (RPL35aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aB) (TAIR:AT1G41880.1); Has 539 Blast hits to 539 proteins in 185 species: Archae - 19; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). 
AT3G55750.1GTTTGGGCCAA60S ribosomal protein L35a (RPL35aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aB) (TAIR:AT1G41880.1); Has 539 Blast hits to 539 proteins in 185 species: Archae - 19; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). 
AT3G56160AT3G56160.1TTGGCCCAATGbile acid:sodium symporter; FUNCTIONS IN: bile acid:sodium symporter activity; INVOLVED IN: sodium ion transport; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bile acid:sodium symporter (InterPro:IPR002657); Has 1967 Blast hits to 1962 proteins in 589 species: Archae - 26; Bacteria - 1122; Metazoa - 92; Fungi - 62; Plants - 76; Viruses - 0; Other Eukaryotes - 589 (source: NCBI BLink). 
AT3G56190AT3G56190.1TTGGCCCAEncodes one of two alpha-SNAPs (soluble NSF attachment protein) in Arabidopsis 
AT3G56190.2TTGGCCCAEncodes one of two alpha-SNAPs (soluble NSF attachment protein) in Arabidopsis 
AT3G57930AT3G57930.1CTAATGGGCCAAAGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae - 0; Bacteria - 32; Metazoa - 833; Fungi - 105; Plants - 87; Viruses - 30; Other Eukaryotes - 578 (source: NCBI BLink). 
AT3G57930.2CTAATGGGCCAAAGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae - 0; Bacteria - 32; Metazoa - 833; Fungi - 105; Plants - 87; Viruses - 30; Other Eukaryotes - 578 (source: NCBI BLink). 
AT3G57940AT3G57940.1GTTTGGGCTTTGGCCCATTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1726 (InterPro:IPR013562), Protein of unknown function DUF699, ATPase putative (InterPro:IPR007807); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10490.1); Has 915 Blast hits to 873 proteins in 391 species: Archae - 82; Bacteria - 412; Metazoa - 163; Fungi - 92; Plants - 21; Viruses - 3; Other Eukaryotes - 142 (source: NCBI BLink). 
AT3G58270AT3G58270.1TTGGCCCAACTmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). 
AT3G58270.2TTGGCCCAACTmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). 
AT3G58680AT3G58680.1ATTTGGGCCAAOne of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is developmentally regulated. 
AT3G58700AT3G58700.1TTATTGGGCCAAT60S ribosomal protein L11 (RPL11B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L11 (RPL11D) (TAIR:AT5G45775.2); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink). 
AT3G60810AT3G60810.1CAATGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1499 (InterPro:IPR010865); Has 355 Blast hits to 355 proteins in 103 species: Archae - 0; Bacteria - 211; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). 
AT3G60810.2CAATGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1499 (InterPro:IPR010865); Has 355 Blast hits to 355 proteins in 103 species: Archae - 0; Bacteria - 211; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). 
AT3G62120AT3G62120.1CTTATTGGGCTTGGCCCATGtRNA synthetase class II (G, H, P and S) family protein; FUNCTIONS IN: proline-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: prolyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Prolyl-tRNA synthetase, class IIa, prokaryotic-type (InterPro:IPR004499), Prolyl-tRNA synthetase, class II, C-terminal (InterPro:IPR016061), Anticodon-binding (InterPro:IPR004154), Prolyl-tRNA synthetase, class II (InterPro:IPR017449), Prolyl-tRNA synthetase, class IIa, conserved region (InterPro:IPR002316), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA6 (OVULE ABORTION 6); ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / proline-tRNA ligase (TAIR:AT5G52520.1); Has 5872 Blast hits to 5731 proteins in 1483 species: Archae - 181; Bacteria - 3502; Metazoa - 187; Fungi - 122; Plants - 56; Viruses - 0; Other Eukaryotes - 1824 (source: NCBI BLink). 
AT3G62120.2CTTATTGGGCTTGGCCCATGtRNA synthetase class II (G, H, P and S) family protein; FUNCTIONS IN: proline-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: prolyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Prolyl-tRNA synthetase, class IIa, prokaryotic-type (InterPro:IPR004499), Prolyl-tRNA synthetase, class II, C-terminal (InterPro:IPR016061), Anticodon-binding (InterPro:IPR004154), Prolyl-tRNA synthetase, class II (InterPro:IPR017449), Prolyl-tRNA synthetase, class IIa, conserved region (InterPro:IPR002316), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA6 (OVULE ABORTION 6); ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / proline-tRNA ligase (TAIR:AT5G52520.1); Has 5872 Blast hits to 5731 proteins in 1483 species: Archae - 181; Bacteria - 3502; Metazoa - 187; Fungi - 122; Plants - 56; Viruses - 0; Other Eukaryotes - 1824 (source: NCBI BLink). 
AT3G62290AT3G62290.1ATATGGGCCAAA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. 
AT3G62800AT3G62800.1ATAAGCCCAATTTTGGCCCATTAAEncodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression. 
AT3G62800.2ATAAGCCCAATTTTGGCCCATTAAEncodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression. 
AT3G62800.3ATAAGCCCAATTTTGGCCCATTAAEncodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression. 
AT3G62810AT3G62810.1TTAATGGGCCAAAATTGGGCTTATcomplex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 68 Blast hits to 68 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 22; Plants - 17; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT3G63140AT3G63140.1ATTTGGGCCAATEncodes a protein with ribonuclease activity that is involved in plastid rRNA maturation. 
AT3G63410AT3G63410.1ATTTGGGCCAATEncodes a MPBQ/MSBQ methyltransferase located in the chloroplast inner envelope membrane. Mutant plants lack plastoquinone (PQ), suggesting that the APG1 protein is involved in the methylation step of PQ biosynthesis. The gene product is also involved in tocopherol (vitamin E) biosynthesis. 
AT4G00860AT4G00860.1AGATGGGCCAATputative pathogenesis-related protein whose transcript level is induced in response to ozone and pathogenic Pseudomonas strains. 
AT4G05460AT4G05460.1TTGGCCCAAACF-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT4G08580AT4G08580.1CTTGGGCCAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17900.1); Has 39042 Blast hits to 22601 proteins in 1140 species: Archae - 179; Bacteria - 2955; Metazoa - 18595; Fungi - 3264; Plants - 1100; Viruses - 245; Other Eukaryotes - 12704 (source: NCBI BLink). 
AT4G09730AT4G09730.1CTTAATGGGCCAADEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT3G06980.1); Has 26614 Blast hits to 26065 proteins in 1716 species: Archae - 427; Bacteria - 10484; Metazoa - 4922; Fungi - 3195; Plants - 1331; Viruses - 9; Other Eukaryotes - 6246 (source: NCBI BLink). 
AT4G10250AT4G10250.1ATAATGGGCCAATColumbia endomembrane-localized small heat shock protein 
AT4G14110AT4G14110.1TAGTGGGCTTGGCCCATTTARepresses photomorphogenesis and induces skotomorphogenesis in the dark. A component of the COP9 signalosome complex. 
AT4G14540AT4G14540.1TTGGCCCAAATNUCLEAR FACTOR Y, SUBUNIT B3 (NF-YB3); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB2 (NUCLEAR FACTOR Y, SUBUNIT B2); transcription factor (TAIR:AT5G47640.1); Has 1011 Blast hits to 1011 proteins in 186 species: Archae - 0; Bacteria - 1; Metazoa - 394; Fungi - 233; Plants - 298; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT4G14615AT4G14615.1ATTGGCCCATTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52825.1); Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G16500AT4G16500.1ATTGGCCCAAATcysteine protease inhibitor family protein / cystatin family protein; FUNCTIONS IN: enzyme regulator activity, cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT5G47550.1); Has 461 Blast hits to 440 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 452; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G19120AT4G19120.1TTGGCCCATCAearly-responsive to dehydration 3 (ERD3); INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein, putative (TAIR:AT1G31850.3); Has 578 Blast hits to 564 proteins in 56 species: Archae - 4; Bacteria - 67; Metazoa - 0; Fungi - 3; Plants - 484; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT4G19120.2TTGGCCCATCAearly-responsive to dehydration 3 (ERD3); INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein, putative (TAIR:AT1G31850.3); Has 578 Blast hits to 564 proteins in 56 species: Archae - 4; Bacteria - 67; Metazoa - 0; Fungi - 3; Plants - 484; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT4G19640AT4G19640.1CATTGGGCCAAEncodes Ara7. 
AT4G19710AT4G19710.1TAAATGGGCCAAEncodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. 
AT4G19710.2TAAATGGGCCAAEncodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. 
AT4G20020AT4G20020.1TTGGCCCAGTunknown protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44780.1); Has 26028 Blast hits to 13667 proteins in 803 species: Archae - 4; Bacteria - 3179; Metazoa - 14711; Fungi - 2562; Plants - 2584; Viruses - 195; Other Eukaryotes - 2793 (source: NCBI BLink). 
AT4G20020.2TTGGCCCAGTunknown protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44780.1); Has 26028 Blast hits to 13667 proteins in 803 species: Archae - 4; Bacteria - 3179; Metazoa - 14711; Fungi - 2562; Plants - 2584; Viruses - 195; Other Eukaryotes - 2793 (source: NCBI BLink). 
AT4G20030AT4G20030.1ACTGGGCCAARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G20930.1); Has 12724 Blast hits to 10426 proteins in 537 species: Archae - 10; Bacteria - 848; Metazoa - 7090; Fungi - 1459; Plants - 1985; Viruses - 0; Other Eukaryotes - 1332 (source: NCBI BLink). 
AT4G24370AT4G24370.1CTTATTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT4G24380AT4G24380.1TTGGCCCAATAAGunknown protein; INVOLVED IN: 10-formyltetrahydrofolate biosynthetic process, folic acid and derivative biosynthetic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65400.1); Has 484 Blast hits to 484 proteins in 112 species: Archae - 0; Bacteria - 2; Metazoa - 89; Fungi - 296; Plants - 68; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT4G24380.2TTGGCCCAATAAGunknown protein; INVOLVED IN: 10-formyltetrahydrofolate biosynthetic process, folic acid and derivative biosynthetic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65400.1); Has 484 Blast hits to 484 proteins in 112 species: Archae - 0; Bacteria - 2; Metazoa - 89; Fungi - 296; Plants - 68; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT4G26520AT4G26520.1TGTGGGCCAATfructose-bisphosphate aldolase, cytoplasmic; FUNCTIONS IN: fructose-bisphosphate aldolase activity; INVOLVED IN: pentose-phosphate shunt, response to hypoxia; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G26530.2); Has 4378 Blast hits to 4373 proteins in 736 species: Archae - 0; Bacteria - 421; Metazoa - 1256; Fungi - 2; Plants - 338; Viruses - 0; Other Eukaryotes - 2361 (source: NCBI BLink). 
AT4G27840AT4G27840.1GTTTGGGCCAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: vesicle-associated membrane protein-related (TAIR:AT5G52990.1); Has 165 Blast hits to 165 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G28010AT4G28010.1TTGGCCCATTCpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62670.1); Has 27713 Blast hits to 6108 proteins in 193 species: Archae - 5; Bacteria - 29; Metazoa - 747; Fungi - 685; Plants - 24892; Viruses - 0; Other Eukaryotes - 1355 (source: NCBI BLink). 
AT4G28230AT4G28230.1GGGCTATTTGGCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; Has 385 Blast hits to 299 proteins in 88 species: Archae - 0; Bacteria - 7; Metazoa - 168; Fungi - 23; Plants - 22; Viruses - 2; Other Eukaryotes - 163 (source: NCBI BLink). 
AT4G28450AT4G28450.1TTTTGGGCCAATThis gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase 
AT4G29330AT4G29330.1TTGGCCCAATTDERLIN-1 (DER1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.2 (DERLIN-2.2) (TAIR:AT4G04860.1); Has 666 Blast hits to 665 proteins in 170 species: Archae - 0; Bacteria - 12; Metazoa - 290; Fungi - 127; Plants - 84; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). 
AT4G29520AT4G29520.1TTGGCCCATTTLOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139); Has 120 Blast hits to 120 proteins in 43 species: Archae - 2; Bacteria - 0; Metazoa - 42; Fungi - 10; Plants - 19; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT4G29530AT4G29530.1AAATGGGCCAA2,3-diketo-5-methylthio-1-phosphopentane phosphatase family; FUNCTIONS IN: phosphatase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G17710.1); Has 269 Blast hits to 267 proteins in 80 species: Archae - 0; Bacteria - 19; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT4G30480AT4G30480.1CTTAATGGGCCAATtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). 
AT4G30480.2CTTAATGGGCCAATtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). 
AT4G30480.3CTTAATGGGCCAATtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). 
AT4G30750AT4G30750.1TTGGCCCATGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30730.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G30760AT4G30760.1CCATGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G30760.2CCATGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G30820AT4G30820.1TTGGCCCATGcyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT4G30820.2TTGGCCCATGcyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT4G30820.3TTGGCCCATGcyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT4G31420AT4G31420.1GAATGGGCCAAATGGGCTAzinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: FZF; transcription factor (TAIR:AT2G24500.1); Has 503 Blast hits to 486 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 160; Plants - 53; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). 
AT4G31420.2GAATGGGCCAAATGGGCTAzinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: FZF; transcription factor (TAIR:AT2G24500.1); Has 503 Blast hits to 486 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 160; Plants - 53; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). 
AT4G32050AT4G32050.1TTGGCCCAAAAneurochondrin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Neurochondrin (InterPro:IPR008709); Has 126 Blast hits to 126 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 5; Plants - 20; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G32280AT4G32280.1TTATGGGCCAAAuxin inducible protein. 
AT4G32660AT4G32660.1ATTTGGGCCAAEncodes protein kinase AME3. 
AT4G32660.2ATTTGGGCCAAEncodes protein kinase AME3. 
AT4G32660.3ATTTGGGCCAAEncodes protein kinase AME3. 
AT4G33030AT4G33030.1ATTTGGGCCAACCGGCCCAGTAinvolved in sulfolipid biosynthesis 
AT4G33920AT4G33920.1GTTTGGGCCAAprotein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: mitochondrion, protein serine/threonine phosphatase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51370.1); Has 3521 Blast hits to 3519 proteins in 216 species: Archae - 0; Bacteria - 7; Metazoa - 1157; Fungi - 386; Plants - 1254; Viruses - 3; Other Eukaryotes - 714 (source: NCBI BLink). 
AT4G35140AT4G35140.1TAAATGGGCCAAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G38480.1); Has 7738 Blast hits to 5690 proteins in 350 species: Archae - 10; Bacteria - 1449; Metazoa - 3242; Fungi - 1387; Plants - 483; Viruses - 0; Other Eukaryotes - 1167 (source: NCBI BLink). 
AT4G35440AT4G35440.1ATTGGCCCATATAEnclodes a choride channel protein that is localized to the thlakoid membrane. 
AT4G35450AT4G35450.1TATATGGGCCAATInvolved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. 
AT4G35450.2TATATGGGCCAATInvolved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. 
AT4G35450.3TATATGGGCCAATInvolved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. 
AT4G35450.4TATATGGGCCAATInvolved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. 
AT4G36690AT4G36690.1AATTGGGCCAAATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). 
AT4G36690.2AATTGGGCCAAATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). 
AT4G36690.3AATTGGGCCAAATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). 
AT4G36800AT4G36800.1AAATGGGCCTAACGGGCTTTAATGGGCCAARUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1. 
AT4G36800.2AAATGGGCCTAACGGGCTTTAATGGGCCAARUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1. 
AT4G36900AT4G36900.1TTGGCCCACGTGTTencodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1. 
AT4G37000AT4G37000.1TTGGCCCAATAMutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. 
AT4G37040AT4G37040.1TTGGCCCATTAATAGCCCAATATencodes a methionine aminopeptidase 
AT4G38890AT4G38890.1TTATGGGCCGGTTTTTGGCCCATTAAdihydrouridine synthase family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: oxidation reduction, tRNA processing, metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G49640.1); Has 7322 Blast hits to 7247 proteins in 1396 species: Archae - 11; Bacteria - 4174; Metazoa - 431; Fungi - 362; Plants - 91; Viruses - 0; Other Eukaryotes - 2253 (source: NCBI BLink). 
AT4G38980AT4G38980.1CATTGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 6; Plants - 11; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT4G39080AT4G39080.1CATGGGCCAATATTGGGVacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. 
AT4G39210AT4G39210.1AGTTGGGCCAATEncodes the large subunit of ADP-Glucose Pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL3 is the major large subunit isoform present in inflorescences, fruits and roots. 
AT4G39470AT4G39470.1TTGGCCCAATTAchloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: tetratricopeptide repeat (TPR)-containing protein (TAIR:AT3G18420.1); Has 1025 Blast hits to 856 proteins in 182 species: Archae - 118; Bacteria - 326; Metazoa - 111; Fungi - 9; Plants - 62; Viruses - 0; Other Eukaryotes - 399 (source: NCBI BLink). 
AT5G01260AT5G01260.1TTGGCCCATGGGCTTTAAglycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT5G01260.2TTGGCCCATGGGCTTTAAglycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT5G02960AT5G02960.1TGATGGGCCAA40S ribosomal protein S23 (RPS23B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S23, eukaryotic/archaeal (InterPro:IPR005680), Ribosomal protein S12/S23 (InterPro:IPR006032), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S23 (RPS23A) (TAIR:AT3G09680.1); Has 6124 Blast hits to 6121 proteins in 1817 species: Archae - 180; Bacteria - 2807; Metazoa - 329; Fungi - 198; Plants - 755; Viruses - 0; Other Eukaryotes - 1855 (source: NCBI BLink). 
AT5G04440AT5G04440.1TTGGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G31115.2); Has 213 Blast hits to 213 proteins in 56 species: Archae - 0; Bacteria - 98; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). 
AT5G06780AT5G06780.1GTTTGGGCCAAemsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT3G12140.2); Has 145 Blast hits to 134 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G07010AT5G07010.1TGGGCCAAEncodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). 
AT5G07840AT5G07840.1TCTGGGCCAAankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT5G61230.1); Has 50208 Blast hits to 17627 proteins in 653 species: Archae - 46; Bacteria - 2813; Metazoa - 29912; Fungi - 2863; Plants - 1606; Viruses - 449; Other Eukaryotes - 12519 (source: NCBI BLink). 
AT5G07842AT5G07842.1TCTGGGCCAAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF16 represents a conserved upstream opening reading frame relative to major ORF AT5G07840.1 
AT5G08060AT5G08060.1TTTTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G08415AT5G08415.1TTGGCCCAATATlipoic acid synthase family protein; FUNCTIONS IN: lipoic acid synthase activity, iron-sulfur cluster binding, lipoate synthase activity, catalytic activity; INVOLVED IN: lipoic acid biosynthetic process, lipoate biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Lipoate synthase (InterPro:IPR003698), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Radical SAM (InterPro:IPR007197); BEST Arabidopsis thaliana protein match is: LIP1 (LIPOIC ACID SYNTHASE 1); lipoic acid synthase (TAIR:AT2G20860.1); Has 5746 Blast hits to 5746 proteins in 1192 species: Archae - 36; Bacteria - 2422; Metazoa - 113; Fungi - 91; Plants - 53; Viruses - 0; Other Eukaryotes - 3031 (source: NCBI BLink). 
AT5G08420AT5G08420.1ATATTGGGCCAARNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); Has 2056 Blast hits to 1575 proteins in 229 species: Archae - 85; Bacteria - 30; Metazoa - 600; Fungi - 242; Plants - 75; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink). 
AT5G12150AT5G12150.1ATTGGCCCAATGEncodes a protein with similarity to REN1, a Rho GTPase activating protein. 
AT5G12150.2ATTGGCCCAATGEncodes a protein with similarity to REN1, a Rho GTPase activating protein. 
AT5G13310AT5G13310.1ATATTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13970.1); Has 356 Blast hits to 305 proteins in 95 species: Archae - 0; Bacteria - 44; Metazoa - 138; Fungi - 38; Plants - 34; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). 
AT5G14040AT5G14040.1AAAAAGCCCATGGGCCAAmitochondrial phosphate transporter; FUNCTIONS IN: binding; INVOLVED IN: transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial phosphate transporter, putative (TAIR:AT3G48850.1); Has 12348 Blast hits to 8451 proteins in 336 species: Archae - 0; Bacteria - 0; Metazoa - 6294; Fungi - 3202; Plants - 1869; Viruses - 3; Other Eukaryotes - 980 (source: NCBI BLink). 
AT5G14050AT5G14050.1TTGGCCCATGGGCTTTTTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: TAF5 (TBP-ASSOCIATED FACTOR 5); nucleotide binding / transcription regulator (TAIR:AT5G25150.1); Has 4822 Blast hits to 3684 proteins in 283 species: Archae - 24; Bacteria - 1509; Metazoa - 1460; Fungi - 771; Plants - 200; Viruses - 2; Other Eukaryotes - 856 (source: NCBI BLink). 
AT5G14200AT5G14200.1AAATGGGCCAATThe AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. 
AT5G14200.2AAATGGGCCAATThe AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. 
AT5G14200.3AAATGGGCCAATThe AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. 
AT5G14800AT5G14800.1ATTGGGCCTACTTGGCCCAATGCCCAAACDelta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis. 
AT5G14800.2ATTGGGCCTACTTGGCCCAATGCCCAAACDelta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis. 
AT5G15450AT5G15450.1TAGTGGGCCAATEncodes a chloroplast-targeted Hsp101 homologue. Functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. APG6 expression is upregulated in response to heat shock in various organs, but not in response to other abiotic stresses. Apg6 mutants have a pale-green phenotype. 
AT5G16610AT5G16610.1ATTGGCCCATTAGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT5G16610.2ATTGGCCCATTAGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT5G16750AT5G16750.1TTATGGGCCAATEncodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development. 
AT5G16760AT5G16760.1ATTGGCCCATAAEncodes a inositol 1,3,4-trisphosphate 5/6-kinase. 
AT5G17510AT5G17510.1ATTGGCCCAGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03460.1); Has 22577 Blast hits to 10768 proteins in 507 species: Archae - 4; Bacteria - 485; Metazoa - 8864; Fungi - 2539; Plants - 1455; Viruses - 66; Other Eukaryotes - 9164 (source: NCBI BLink). 
AT5G17620AT5G17620.1AAATGGGCCAATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plant nuclear matrix 1 (InterPro:IPR010604); Has 62 Blast hits to 62 proteins in 32 species: Archae - 0; Bacteria - 19; Metazoa - 8; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT5G17840AT5G17840.1TTGGCCCATAAchaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 67 Blast hits to 67 proteins in 19 species: Archae - 0; Bacteria - 13; Metazoa - 3; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT5G18440AT5G18440.1CCCAATTGGCCCACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). 
AT5G18440.2CCCAATTGGCCCACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). 
AT5G20290AT5G20290.1ATGGGCTTGGCCCAAAGGCC40S ribosomal protein S8 (RPS8A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8e (InterPro:IPR001047), Ribosomal protein S8e, conserved site (InterPro:IPR018283); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S8 (RPS8B) (TAIR:AT5G59240.1); Has 801 Blast hits to 797 proteins in 322 species: Archae - 165; Bacteria - 0; Metazoa - 295; Fungi - 110; Plants - 75; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink). 
AT5G20620AT5G20620.1TTTTGGGCCTTTGGGCCTTTTGGGCCAATencodes a ubiquitin polyprotein. 
AT5G22210AT5G22210.1TTGGCCCAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G22210.2TTGGCCCAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G22640AT5G22640.1TATGGGCCAATembryo defective 1211 (emb1211); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MORN motif (InterPro:IPR003409); Has 20090 Blast hits to 11448 proteins in 643 species: Archae - 30; Bacteria - 1497; Metazoa - 7184; Fungi - 2271; Plants - 998; Viruses - 319; Other Eukaryotes - 7791 (source: NCBI BLink). 
AT5G23230AT5G23230.1ATTGGCCCAATAAGNICOTINAMIDASE 2 (NIC2); FUNCTIONS IN: nicotinamidase activity, catalytic activity; INVOLVED IN: NAD metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Isochorismatase hydrolase (InterPro:IPR000868); BEST Arabidopsis thaliana protein match is: NIC3 (NICOTINAMIDASE 3); catalytic/ nicotinamidase (TAIR:AT5G23220.1); Has 4281 Blast hits to 4279 proteins in 809 species: Archae - 137; Bacteria - 3598; Metazoa - 0; Fungi - 94; Plants - 51; Viruses - 0; Other Eukaryotes - 401 (source: NCBI BLink). 
AT5G23290AT5G23290.1TAAATGGGCCAATATGGGCCTTATPREFOLDIN 5 (PDF5); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin alpha subunit (InterPro:IPR011599); Has 365 Blast hits to 365 proteins in 170 species: Archae - 46; Bacteria - 3; Metazoa - 137; Fungi - 83; Plants - 26; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT5G23740AT5G23740.1TTGGCCCAAAAGGGCCCAACAEncodes a putative ribosomal protein S11 (RPS11-beta). 
AT5G24130AT5G24130.1ATTGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: leaf whorl, petal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 31 Blast hits to 31 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G26760AT5G26760.2ATTGGCCCATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF408 (InterPro:IPR007308); Has 247 Blast hits to 205 proteins in 87 species: Archae - 0; Bacteria - 73; Metazoa - 105; Fungi - 29; Plants - 21; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G27120AT5G27120.1CTAATGGGCCAASAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein 
AT5G38040AT5G38040.1CTAATGGGCCAATUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, stem, embryo, sepal, seed; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT5G38010.1); Has 4566 Blast hits to 4539 proteins in 305 species: Archae - 0; Bacteria - 130; Metazoa - 1639; Fungi - 14; Plants - 2694; Viruses - 70; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G39850AT5G39850.1AAAAAGCCCAATGGGCCAA40S ribosomal protein S9 (RPS9C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9B) (TAIR:AT5G15200.1); Has 5400 Blast hits to 5397 proteins in 2680 species: Archae - 171; Bacteria - 348; Metazoa - 335; Fungi - 191; Plants - 3457; Viruses - 0; Other Eukaryotes - 898 (source: NCBI BLink). 
AT5G40770AT5G40770.1TTGGCCCATTAAprohibitin 3 
AT5G43330AT5G43330.1ATTGGCCCATTATmalate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: cellular carbohydrate metabolic process, glycolysis, malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT1G04410.1); Has 8255 Blast hits to 8253 proteins in 1762 species: Archae - 116; Bacteria - 4254; Metazoa - 1034; Fungi - 184; Plants - 466; Viruses - 0; Other Eukaryotes - 2201 (source: NCBI BLink). 
AT5G45490AT5G45490.1TTGGCCCAATGdisease resistance protein-related; FUNCTIONS IN: ATP binding; INVOLVED IN: apoptosis; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182); BEST Arabidopsis thaliana protein match is: disease resistance protein-related (TAIR:AT5G45440.1); Has 2741 Blast hits to 2735 proteins in 152 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 7; Plants - 2719; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT5G45490.2TTGGCCCAATGdisease resistance protein-related; FUNCTIONS IN: ATP binding; INVOLVED IN: apoptosis; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182); BEST Arabidopsis thaliana protein match is: disease resistance protein-related (TAIR:AT5G45440.1); Has 2741 Blast hits to 2735 proteins in 152 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 7; Plants - 2719; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT5G45775AT5G45775.1ATTGGCCCATTAA60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink). 
AT5G45775.2ATTGGCCCATTAA60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink). 
AT5G45990AT5G45990.1TTTTGGGCCAATcrooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3943 Blast hits to 1642 proteins in 191 species: Archae - 15; Bacteria - 34; Metazoa - 1807; Fungi - 1089; Plants - 496; Viruses - 0; Other Eukaryotes - 502 (source: NCBI BLink). 
AT5G49490AT5G49490.1CATTGGGCCAAAGAMOUS-LIKE 83 (AGL83); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Transcription factor, MADS-box (InterPro:IPR002100); BEST Arabidopsis thaliana protein match is: MADS-box protein (AGL84) (TAIR:AT5G49420.1); Has 309 Blast hits to 309 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 6; Plants - 299; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G49610AT5G49610.1ATTGGCCCATTCF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G33530.1); Has 993 Blast hits to 986 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 981; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT5G50810AT5G50810.1TTGGCCCAATAAGEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. 
AT5G51300AT5G51300.1ATTTGGGCTTATAATGGGCCAAsplicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). 
AT5G51300.2ATTTGGGCTTATAATGGGCCAAsplicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). 
AT5G51300.3ATTTGGGCTTATAATGGGCCAAsplicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). 
AT5G51340AT5G51340.1AACGGGCCTAAATGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 149 Blast hits to 96 proteins in 39 species: Archae - 0; Bacteria - 2; Metazoa - 115; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT5G52300AT5G52300.1TGATGGGCCAATencodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. 
AT5G52300.2TGATGGGCCAATencodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. 
AT5G52470AT5G52470.1TTTGGGCCAATencodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. 
AT5G52470.2TTTGGGCCAATencodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. 
AT5G52920AT5G52920.1TTGGCCCACAencodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. 
AT5G53400AT5G53400.1TTGGCCCAGnuclear movement family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: nuclear movement family protein (TAIR:AT4G27890.1); Has 1930 Blast hits to 1478 proteins in 221 species: Archae - 7; Bacteria - 113; Metazoa - 767; Fungi - 136; Plants - 100; Viruses - 4; Other Eukaryotes - 803 (source: NCBI BLink). 
AT5G58210AT5G58210.1CAATGGGCCAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT3G52170.1); Has 3539 Blast hits to 1589 proteins in 292 species: Archae - 22; Bacteria - 448; Metazoa - 785; Fungi - 532; Plants - 137; Viruses - 42; Other Eukaryotes - 1573 (source: NCBI BLink). 
AT5G58210.2CAATGGGCCAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT3G52170.1); Has 3539 Blast hits to 1589 proteins in 292 species: Archae - 22; Bacteria - 448; Metazoa - 785; Fungi - 532; Plants - 137; Viruses - 42; Other Eukaryotes - 1573 (source: NCBI BLink). 
AT5G58210.3CAATGGGCCAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT3G52170.1); Has 3539 Blast hits to 1589 proteins in 292 species: Archae - 22; Bacteria - 448; Metazoa - 785; Fungi - 532; Plants - 137; Viruses - 42; Other Eukaryotes - 1573 (source: NCBI BLink). 
AT5G58210.4CAATGGGCCAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT3G52170.1); Has 3539 Blast hits to 1589 proteins in 292 species: Archae - 22; Bacteria - 448; Metazoa - 785; Fungi - 532; Plants - 137; Viruses - 42; Other Eukaryotes - 1573 (source: NCBI BLink). 
AT5G58510AT5G58510.1ATAATGGGCCAATATTAGGCCTATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55060.1); Has 187 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 2; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT5G59500AT5G59500.1CTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 491 Blast hits to 491 proteins in 204 species: Archae - 22; Bacteria - 353; Metazoa - 4; Fungi - 21; Plants - 20; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). 
AT5G59570AT5G59570.1TTGGCCCAmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PCL1 (PHYTOCLOCK 1); DNA binding / transcription factor (TAIR:AT3G46640.2); Has 892 Blast hits to 892 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 875; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT5G60030AT5G60030.1TTTTGGGCTTTGTTGGCCCATCTunknown protein; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75335.1); Has 210106 Blast hits to 83883 proteins in 2248 species: Archae - 772; Bacteria - 18533; Metazoa - 91346; Fungi - 18704; Plants - 7840; Viruses - 1079; Other Eukaryotes - 71832 (source: NCBI BLink). 
AT5G60160AT5G60160.1CAATTGGGCTTTGTAATGGGCCAATaspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: response to cadmium ion, proteolysis; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G04710.1); Has 1278 Blast hits to 1277 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 41; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). 
AT5G60940AT5G60940.1ATTGGCCCATGtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). 
AT5G60940.2ATTGGCCCATGtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). 
AT5G61150AT5G61150.1TGTGGGCCAAEncodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. 
AT5G61150.2TGTGGGCCAAEncodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. 
AT5G61228AT5G61228.1AATTGGGCCAATUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF15 represents a conserved upstream opening reading frame relative to major ORF AT5G61230.1 
AT5G62930AT5G62930.1TTGGCCCAGGDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Esterase, SGNH hydrolase-type, subgroup (InterPro:IPR013831), Lipase, GDSL (InterPro:IPR001087), Esterase, SGNH hydrolase-type (InterPro:IPR013830); BEST Arabidopsis thaliana protein match is: carboxylesterase/ hydrolase/ hydrolase, acting on ester bonds (TAIR:AT5G45920.1); Has 362 Blast hits to 361 proteins in 128 species: Archae - 0; Bacteria - 92; Metazoa - 65; Fungi - 98; Plants - 78; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT5G63820AT5G63820.1ATTGGCCCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28920.1); Has 61 Blast hits to 60 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G64400AT5G64400.1GTTTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09570.1); Has 102 Blast hits to 100 proteins in 33 species: Archae - 0; Bacteria - 9; Metazoa - 16; Fungi - 2; Plants - 47; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT5G64400.2GTTTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09570.1); Has 102 Blast hits to 100 proteins in 33 species: Archae - 0; Bacteria - 9; Metazoa - 16; Fungi - 2; Plants - 47; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT5G66010AT5G66010.1TTGGCCCAGARNA binding / nucleic acid binding / nucleotide binding; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G20890.1); Has 2870 Blast hits to 1043 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 2605; Fungi - 10; Plants - 100; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 
AT5G66240AT5G66240.1TTGGCCCACAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink). 
AT5G66240.2TTGGCCCACAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink). 
AT5G66280AT5G66280.1TTAAAGCCCATCTTGGCCCAATAGGDP-D-mannose 4,6-dehydratase 
AT5G66860AT5G66860.1TATGGGCCAATAAAAGCCCAATGINVOLVED IN: translation; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035); BEST Arabidopsis thaliana protein match is: 50S ribosomal protein-related (TAIR:AT4G23620.1); Has 2346 Blast hits to 2345 proteins in 433 species: Archae - 0; Bacteria - 930; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 1375 (source: NCBI BLink). 
AT5G66930AT5G66930.1AAATGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445). 
AT5G66930.2AAATGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445). 
AT5G67400AT5G67400.1TTGGCCCAAAAperoxidase 73 (PER73) (P73) (PRXR11); FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT3G49960.1); Has 2886 Blast hits to 2873 proteins in 211 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 83; Plants - 2764; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). 
AT5G67490AT5G67490.1TACTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1674 (InterPro:IPR012875); Has 340 Blast hits to 340 proteins in 113 species: Archae - 0; Bacteria - 97; Metazoa - 109; Fungi - 4; Plants - 24; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). 
AT5G67500AT5G67500.1TTGGCCCAGTAEncodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.