| Locus | Gene model | Sequence | Description |
| AT1G02290 | AT1G02290.1 | CATGGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45830.1); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 43; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G02290.1 | TATAGGCCCATTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45830.1); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 43; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G02816 | AT1G02816.1 | TATAGGCCTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G03140 | AT1G03140.1 | ATTTGGGCCTATA | splicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is: splicing factor Prp18 family protein (TAIR:AT1G54590.1); Has 509 Blast hits to 499 proteins in 150 species: Archae - 0; Bacteria - 4; Metazoa - 224; Fungi - 121; Plants - 35; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). |
| AT1G03150 | AT1G03150.1 | TATAGGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase, putative (TAIR:AT5G13780.1); Has 1587 Blast hits to 1587 proteins in 440 species: Archae - 135; Bacteria - 362; Metazoa - 485; Fungi - 260; Plants - 84; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT1G07070 | AT1G07070.1 | TATAGGCCCATTAA | 60S ribosomal protein L35a (RPL35aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aC) (TAIR:AT1G74270.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT1G07810 | AT1G07810.1 | TATAGGCCCAAA | Encodes an ER-type Ca2+-pumping ATPase. |
| AT1G10170 | AT1G10170.1 | TATAGGCCCATTGTTAGCCCATTAG | Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response. |
| AT1G14270 | AT1G14270.1 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14270.2 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14270.3 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14270.4 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14980 | AT1G14980.1 | TATAGGCCCAAAC | Encodes mitochondrial-localized chaperonin 10 that complements the E.coli groES mutant. Its mRNA is upregulated in response to heat shock treatment and is expressed uniformly in various organs. |
| AT1G15020 | AT1G15020.1 | TAATGGGCCTATA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT1G15020.2 | TAATGGGCCTATA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT1G15380 | AT1G15380.1 | TATAGGCC | lactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). |
| AT1G15380.2 | TATAGGCC | lactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). |
| AT1G20575 | AT1G20575.1 | TTTTGGGCTTTATATAGGCCCATAT | dolichyl-phosphate beta-D-mannosyltransferase, putative / dolichol-phosphate mannosyltransferase, putative / mannose-P-dolichol synthase, putative; FUNCTIONS IN: elongation factor-2 kinase activity, dolichyl-phosphate beta-D-mannosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 2 (InterPro:IPR001173); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 2 protein (TAIR:AT2G39630.1); Has 14265 Blast hits to 14249 proteins in 1426 species: Archae - 553; Bacteria - 8256; Metazoa - 255; Fungi - 173; Plants - 49; Viruses - 21; Other Eukaryotes - 4958 (source: NCBI BLink). |
| AT1G20580 | AT1G20580.1 | ATATGGGCCTATATAAAGCCCAAAA | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SmD3 (snRNP core protein SmD3) (TAIR:AT1G76300.1); Has 893 Blast hits to 893 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 219; Plants - 128; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| AT1G20760 | AT1G20760.1 | ATTAGGCCTATAAAGGCCCATTTA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EPS15 homology (EH) (InterPro:IPR000261), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G21630.1); Has 10692 Blast hits to 4147 proteins in 323 species: Archae - 12; Bacteria - 3271; Metazoa - 3323; Fungi - 1334; Plants - 262; Viruses - 16; Other Eukaryotes - 2474 (source: NCBI BLink). |
| AT1G23780 | AT1G23780.1 | TATAGGCCCAAATACGGCCCATAA | F-box family protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G23770.1); Has 177 Blast hits to 177 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G27070 | AT1G27070.1 | AAATGGGCCTATA | 5'-AMP-activated protein kinase-related; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03420.1); Has 573 Blast hits to 552 proteins in 161 species: Archae - 1; Bacteria - 66; Metazoa - 210; Fungi - 126; Plants - 98; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT1G30230 | AT1G30230.1 | TATAGGCCCACTA | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G30230.2 | TATAGGCCCACTA | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G30520 | AT1G30520.1 | TAATTGGGCCTGGCCTATA | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT1G36990 | AT1G36990.1 | AGTTGGGCCTATA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08510.1); Has 4597 Blast hits to 1552 proteins in 255 species: Archae - 0; Bacteria - 986; Metazoa - 1160; Fungi - 777; Plants - 63; Viruses - 27; Other Eukaryotes - 1584 (source: NCBI BLink). |
| AT1G54050 | AT1G54050.1 | TAAACGGCCTATA | 17.4 kDa class III heat shock protein (HSP17.4-CIII); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 2777 Blast hits to 2777 proteins in 704 species: Archae - 100; Bacteria - 1361; Metazoa - 1; Fungi - 104; Plants - 843; Viruses - 0; Other Eukaryotes - 368 (source: NCBI BLink). |
| AT1G61570 | AT1G61570.1 | GGCCTATA | Encodes a putative small zinc finger-like protein (TIM13); nucleus-encoded gene whose product is found in the mitochondrial inner membrane space. |
| AT1G66500 | AT1G66500.1 | ACTGGGCCTATAAACCGTGGCCCAAAACACGTGACA | zinc finger (C2H2-type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: S-locus protein-related (TAIR:AT5G43620.1); Has 275 Blast hits to 273 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 85; Plants - 35; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT1G69900 | AT1G69900.1 | TATAGGCCCATG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF569 (InterPro:IPR007679), Actin_cross-linking (InterPro:IPR008999); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27100.1); Has 142 Blast hits to 77 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 142; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G73350 | AT1G73350.1 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G73350.2 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G73350.3 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G76120 | AT1G76120.1 | TATAGGCCCAGT | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink). |
| AT1G76120.2 | TATAGGCCCAGT | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink). |
| AT1G76570 | AT1G76570.1 | TAATTGGGCCTATA | chlorophyll A-B binding family protein; FUNCTIONS IN: chlorophyll binding; INVOLVED IN: response to blue light, response to far red light, photosynthesis; LOCATED IN: light-harvesting complex, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chlorophyll A-B binding protein (InterPro:IPR001344); BEST Arabidopsis thaliana protein match is: LHCB2.3; chlorophyll binding (TAIR:AT3G27690.1); Has 1746 Blast hits to 1686 proteins in 190 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 1525; Viruses - 0; Other Eukaryotes - 219 (source: NCBI BLink). |
| AT1G77030 | AT1G77030.1 | TATAGGCCCAAGTAAAGCCC | ATP binding / ATP-dependent helicase/ RNA binding / helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding; FUNCTIONS IN: in 6 functions; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DBP10CT (InterPro:IPR012541), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 46457 Blast hits to 14119 proteins in 1029 species: Archae - 31; Bacteria - 19714; Metazoa - 12532; Fungi - 2798; Plants - 5760; Viruses - 615; Other Eukaryotes - 5007 (source: NCBI BLink). |
| AT2G01060 | AT2G01060.1 | GTTTGGGCCTATA | myb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G13040.2); Has 911 Blast hits to 902 proteins in 37 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 902; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G01060.2 | GTTTGGGCCTATA | myb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G13040.2); Has 911 Blast hits to 902 proteins in 37 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 902; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G01400 | AT2G01400.1 | AGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G01470 | AT2G01470.1 | TGATGGGCCTATA | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER. |
| AT2G03150 | AT2G03150.1 | AACGGGCCTATA | embryo defective 1579 (emb1579); FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); Has 125920 Blast hits to 56296 proteins in 2267 species: Archae - 286; Bacteria - 11325; Metazoa - 58503; Fungi - 14640; Plants - 5579; Viruses - 940; Other Eukaryotes - 34647 (source: NCBI BLink). |
| AT2G04030 | AT2G04030.1 | TATAGGCCCATTAT | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
| AT2G04030.2 | TATAGGCCCATTAT | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
| AT2G05220 | AT2G05220.1 | TATAGGCCT | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G05220.2 | TATAGGCCT | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G17350 | AT2G17350.1 | ACAGGCCCAATATAGGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 93 Blast hits to 67 proteins in 31 species: Archae - 0; Bacteria - 1; Metazoa - 16; Fungi - 13; Plants - 21; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G17360 | AT2G17360.1 | CTTATTGGGCCTATATTGGGCCTGT | 40S ribosomal protein S4 (RPS4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). |
| AT2G18510 | AT2G18510.1 | CTTAATGGGCTTATAGGCCCATTAG | embryo defective 2444 (emb2444); FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: PAB8 (POLY(A) BINDING PROTEIN 8); RNA binding / translation initiation factor (TAIR:AT1G49760.1); Has 56184 Blast hits to 33244 proteins in 1255 species: Archae - 48; Bacteria - 4095; Metazoa - 27429; Fungi - 7959; Plants - 8932; Viruses - 890; Other Eukaryotes - 6831 (source: NCBI BLink). |
| AT2G22230 | AT2G22230.1 | GGCCTATA | beta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: 3-hydroxybutyryl-[acyl-carrier-protein] dehydratase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT5G10160.1); Has 4906 Blast hits to 4902 proteins in 1230 species: Archae - 0; Bacteria - 2979; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1883 (source: NCBI BLink). |
| AT2G22370 | AT2G22370.1 | GGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 87 Blast hits to 87 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G25610 | AT2G25610.1 | AGGCCTATA | H+-transporting two-sector ATPase, C subunit family protein; FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: vacuolar ATP synthase, putative / V-ATPase, putative (TAIR:AT4G32530.1); Has 1596 Blast hits to 1304 proteins in 284 species: Archae - 70; Bacteria - 89; Metazoa - 650; Fungi - 323; Plants - 223; Viruses - 0; Other Eukaryotes - 241 (source: NCBI BLink). |
| AT2G27430 | AT2G27430.1 | ATTAGGCCTATA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT4G31890.1); Has 303 Blast hits to 301 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 4; Plants - 288; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G30060 | AT2G30060.1 | GGCCTATAGGCCT | Ran-binding protein 1b (RanBP1b); FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: intracellular transport, protein import into nucleus, translocation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ran Binding Protein 1 (InterPro:IPR000156), Pleckstrin homology-type (InterPro:IPR011993); BEST Arabidopsis thaliana protein match is: SIRANBP; Ran GTPase binding (TAIR:AT1G07140.1); Has 1190 Blast hits to 924 proteins in 176 species: Archae - 0; Bacteria - 3; Metazoa - 728; Fungi - 225; Plants - 88; Viruses - 2; Other Eukaryotes - 144 (source: NCBI BLink). |
| AT2G36660 | AT2G36660.1 | GGCCTATA | polyadenylate-binding protein, putative / PABP, putative. Member of the class III family of PABP proteins. |
| AT2G37160 | AT2G37160.1 | TAATGGGCCTATA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G53390.2); Has 13878 Blast hits to 7458 proteins in 380 species: Archae - 36; Bacteria - 3543; Metazoa - 4573; Fungi - 2572; Plants - 1053; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink). |
| AT2G37160.2 | TAATGGGCCTATA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G53390.2); Has 13878 Blast hits to 7458 proteins in 380 species: Archae - 36; Bacteria - 3543; Metazoa - 4573; Fungi - 2572; Plants - 1053; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink). |
| AT2G40370 | AT2G40370.1 | TATAGGCCC | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT2G40380 | AT2G40380.1 | TATAGGCCCATAA | PRENYLATED RAB ACCEPTOR 1.B2 (PRA1.B2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 382 Blast hits to 382 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 64; Plants - 187; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT2G40940 | AT2G40940.1 | AGGCCTATAACACGTGA | Ethylene receptor, subfamily 1. Has histidine kinase activity. |
| AT2G45500 | AT2G45500.1 | TATAGGCCT | ATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink). |
| AT2G45500.2 | TATAGGCCT | ATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink). |
| AT2G45510 | AT2G45510.1 | AGGCCTATA | member of CYP704A |
| AT2G46470 | AT2G46470.1 | ACCGTTAGGCCTATA | INNER MEMBRANE PROTEIN OXA1-LIKE (OXA1L); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein import into mitochondrial inner membrane; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 60 kDa inner membrane insertion protein (InterPro:IPR001708); BEST Arabidopsis thaliana protein match is: OXA1; P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT5G62050.1); Has 4383 Blast hits to 4383 proteins in 1328 species: Archae - 0; Bacteria - 2560; Metazoa - 212; Fungi - 138; Plants - 111; Viruses - 0; Other Eukaryotes - 1362 (source: NCBI BLink). |
| AT2G47840 | AT2G47840.1 | TATAGGCCCATTTA | tic20 protein-related; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55710.1); Has 272 Blast hits to 272 proteins in 73 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT3G01150 | AT3G01150.1 | TATAGGCCCAAAA | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT3G01150.2 | TATAGGCCCAAAA | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT3G01680 | AT3G01680.1 | AGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01670.1); Has 49 Blast hits to 46 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G07860 | AT3G07860.1 | TAATTGGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25340.1); Has 107 Blast hits to 107 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 67; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G08650 | AT3G08650.1 | CTACGTGGCCTATA | metal transporter family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc/iron permease (InterPro:IPR003689); BEST Arabidopsis thaliana protein match is: metal transporter family protein (TAIR:AT3G20870.1); Has 2522 Blast hits to 2122 proteins in 582 species: Archae - 80; Bacteria - 1400; Metazoa - 567; Fungi - 4; Plants - 77; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). |
| AT3G08650.2 | CTACGTGGCCTATA | metal transporter family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc/iron permease (InterPro:IPR003689); BEST Arabidopsis thaliana protein match is: metal transporter family protein (TAIR:AT3G20870.1); Has 2522 Blast hits to 2122 proteins in 582 species: Archae - 80; Bacteria - 1400; Metazoa - 567; Fungi - 4; Plants - 77; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). |
| AT3G08960 | AT3G08960.1 | TATAGGCCCAATAA | binding / protein transporter; FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, cytoplasm; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT1G26170.1); Has 1034 Blast hits to 933 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 468; Fungi - 402; Plants - 81; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT3G09250 | AT3G09250.1 | TATAGGCCTAAA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: nucleotide-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UvrB/UvrC protein (InterPro:IPR001943); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G10925.2); Has 169 Blast hits to 169 proteins in 54 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT3G09580 | AT3G09580.1 | GGCCTATA | amine oxidase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Amine oxidase (InterPro:IPR002937); Has 2076 Blast hits to 2076 proteins in 439 species: Archae - 18; Bacteria - 842; Metazoa - 222; Fungi - 27; Plants - 205; Viruses - 0; Other Eukaryotes - 762 (source: NCBI BLink). |
| AT3G12180 | AT3G12180.1 | TATAGGCCTAAA | cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G12390.1); Has 450 Blast hits to 450 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 110; Plants - 41; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT3G12180.1 | TATAGGCCTAAA | cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G12390.1); Has 450 Blast hits to 450 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 110; Plants - 41; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT3G14010 | AT3G14010.1 | AGGCCTATA | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
| AT3G14010.2 | AGGCCTATA | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
| AT3G14010.3 | AGGCCTATA | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
| AT3G17430 | AT3G17430.1 | TATAGGCCCATAAAGCCCAAT | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT1G48230.1); Has 1446 Blast hits to 1445 proteins in 173 species: Archae - 0; Bacteria - 5; Metazoa - 374; Fungi - 259; Plants - 650; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). |
| AT3G18740 | AT3G18740.1 | TATAGGCCTTTT | 60S ribosomal protein L30 (RPL30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L30e (InterPro:IPR000231); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L30 (RPL30B) (TAIR:AT1G77940.1); Has 768 Blast hits to 768 proteins in 281 species: Archae - 141; Bacteria - 3; Metazoa - 274; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink). |
| AT3G20910 | AT3G20910.1 | CCCATTATAGGCCCAG | NUCLEAR FACTOR Y, SUBUNIT A9 (NF-YA9); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289), CCAAT-binding factor, conserved site (InterPro:IPR018362); BEST Arabidopsis thaliana protein match is: NF-YA1 (NUCLEAR FACTOR Y, SUBUNIT A1); transcription factor (TAIR:AT5G12840.4); Has 452 Blast hits to 452 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 97; Plants - 214; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT3G46060 | AT3G46060.1 | TATAGGCCC | small GTP-binding protein (ara-3) |
| AT3G46060.2 | TATAGGCCC | small GTP-binding protein (ara-3) |
| AT3G46060.3 | TATAGGCCC | small GTP-binding protein (ara-3) |
| AT3G46100 | AT3G46100.1 | GGGCCTATA | histidyl-tRNA synthetase |
| AT3G47390 | AT3G47390.1 | CTTATTGGGCCTATATGGGCTTC | cytidine/deoxycytidylate deaminase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: riboflavin biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP02464 (InterPro:IPR012816), CMP/dCMP deaminase, zinc-binding (InterPro:IPR002125), Cytidine deaminase-like (InterPro:IPR016193), Riboflavin-specific deaminase, C-terminal (InterPro:IPR011549), Bacterial bifunctional deaminase-reductase, C-terminal (InterPro:IPR002734), Riboflavin biosynthesis protein RibD (InterPro:IPR004794); BEST Arabidopsis thaliana protein match is: cytidine/deoxycytidylate deaminase family protein (TAIR:AT4G20960.1); Has 5155 Blast hits to 5155 proteins in 1224 species: Archae - 129; Bacteria - 2674; Metazoa - 23; Fungi - 93; Plants - 54; Viruses - 14; Other Eukaryotes - 2168 (source: NCBI BLink). |
| AT3G49470 | AT3G49470.1 | GGCCTATA | NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 2 (NACA2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT4G10480.1); Has 1168 Blast hits to 1151 proteins in 231 species: Archae - 23; Bacteria - 6; Metazoa - 522; Fungi - 246; Plants - 124; Viruses - 7; Other Eukaryotes - 240 (source: NCBI BLink). |
| AT3G50110 | AT3G50110.1 | TATAGGCCCAATG | ARABIDOPSIS THALIANA PTEN 3 (ATPEN3); FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Phosphatase tensin type (InterPro:IPR014019), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340), Tensin phosphatase, C2 domain (InterPro:IPR014020); BEST Arabidopsis thaliana protein match is: ATPEN2 (ARABIDOPSIS THALIANA PTEN 2); phosphatase/ protein tyrosine phosphatase (TAIR:AT3G19420.1); Has 4300 Blast hits to 1958 proteins in 193 species: Archae - 2; Bacteria - 2161; Metazoa - 1223; Fungi - 404; Plants - 85; Viruses - 3; Other Eukaryotes - 422 (source: NCBI BLink). |
| AT3G51010 | AT3G51010.1 | TATAGGCCCATAAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52150 | AT3G52150.1 | CTAGGCCCAAATTATAGGCCTTAATAAGGCCCAATTA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 25844 Blast hits to 15833 proteins in 627 species: Archae - 20; Bacteria - 2067; Metazoa - 14187; Fungi - 2805; Plants - 3913; Viruses - 0; Other Eukaryotes - 2852 (source: NCBI BLink). |
| AT3G52150.2 | CTAGGCCCAAATTATAGGCCTTAATAAGGCCCAATTA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 25844 Blast hits to 15833 proteins in 627 species: Archae - 20; Bacteria - 2067; Metazoa - 14187; Fungi - 2805; Plants - 3913; Viruses - 0; Other Eukaryotes - 2852 (source: NCBI BLink). |
| AT3G52750 | AT3G52750.1 | TATAGGCCCATTTA | Nuclear gene that encodes a plastidial division protein (FtsZ2-2). |
| AT3G54210 | AT3G54210.1 | TATAGGCCCATTAAGGCCCATCA | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 5385 Blast hits to 5385 proteins in 1530 species: Archae - 0; Bacteria - 3017; Metazoa - 102; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2110 (source: NCBI BLink). |
| AT3G58970 | AT3G58970.1 | AGTTGGGCCTATA | magnesium transporter CorA-like family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-6) (TAIR:AT4G28580.1); Has 487 Blast hits to 476 proteins in 123 species: Archae - 2; Bacteria - 17; Metazoa - 63; Fungi - 134; Plants - 201; Viruses - 2; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT3G59340 | AT3G59340.1 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF914, eukaryotic (InterPro:IPR009262); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59310.1); Has 715 Blast hits to 712 proteins in 169 species: Archae - 7; Bacteria - 146; Metazoa - 153; Fungi - 87; Plants - 74; Viruses - 0; Other Eukaryotes - 248 (source: NCBI BLink). |
| AT4G00500 | AT4G00500.1 | TTAATGGGCCTATA | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT4G00500.2 | TTAATGGGCCTATA | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT4G00520 | AT4G00520.2 | TATAGGCCCATTAA | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink). |
| AT4G00520.3 | TATAGGCCCATTAA | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink). |
| AT4G01690 | AT4G01690.1 | CTATTGGGCCTATA | Encodes protoporphyrinogen oxidase (PPOX). |
| AT4G01690.2 | CTATTGGGCCTATA | Encodes protoporphyrinogen oxidase (PPOX). |
| AT4G02210 | AT4G02210.1 | ATAGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 475 Blast hits to 288 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 463; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02220 | AT4G02220.1 | TATAGGCCTAT | zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320), Zinc finger, MYND-type (InterPro:IPR002893); BEST Arabidopsis thaliana protein match is: programmed cell death 2 C-terminal domain-containing protein (TAIR:AT5G64830.1); Has 702 Blast hits to 666 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 368; Fungi - 111; Plants - 110; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink). |
| AT4G02230 | AT4G02230.1 | AGGCCTATAATGGGCTTAG | 60S ribosomal protein L19 (RPL19C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: emb2386 (embryo defective 2386); structural constituent of ribosome (TAIR:AT1G02780.1); Has 848 Blast hits to 848 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 265; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink). |
| AT4G03510 | AT4G03510.1 | GGCCTATA | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. |
| AT4G03510.2 | GGCCTATA | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. |
| AT4G05460 | AT4G05460.1 | TATAGGCCAAGGCCCAATAT | F-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT4G14905 | AT4G14905.1 | AAATGGGCTTTATAGGCCCATTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT4G14905.2 | AAATGGGCTTTATAGGCCCATTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT4G19130 | AT4G19130.1 | AAATGGGCCTATA | DNA binding / nucleic acid binding / zinc ion binding; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Replication factor-A, C-terminal (InterPro:IPR013955), Replication factor-a protein 1 Rpa1 (InterPro:IPR004591), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Zinc finger, CCHC-type (InterPro:IPR001878), Replication factor-A protein 1, N-terminal (InterPro:IPR007199); BEST Arabidopsis thaliana protein match is: replication protein, putative (TAIR:AT5G45400.1); Has 609 Blast hits to 584 proteins in 169 species: Archae - 16; Bacteria - 0; Metazoa - 189; Fungi - 98; Plants - 176; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). |
| AT4G19140 | AT4G19140.1 | TATAGGCCCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G19350 | AT4G19350.1 | ACTGGGCCTATA | embryo defective 3006 (EMB3006); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G24880 | AT4G24880.1 | TATAGGCCT | unknown protein; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; Has 140 Blast hits to 140 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink). |
| AT4G25500 | AT4G25500.1 | TATAGGCCCAATA | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. |
| AT4G25890 | AT4G25890.1 | AGGCCTATA | 60S acidic ribosomal protein P3 (RPP3A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3B) (TAIR:AT5G57290.2); Has 578 Blast hits to 577 proteins in 136 species: Archae - 0; Bacteria - 6; Metazoa - 262; Fungi - 76; Plants - 177; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT4G26370 | AT4G26370.1 | TATAGGCC | antitermination NusB domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NusB/RsmB/TIM44 (InterPro:IPR006027); Has 299 Blast hits to 299 proteins in 120 species: Archae - 0; Bacteria - 232; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT4G26370.2 | TATAGGCC | antitermination NusB domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NusB/RsmB/TIM44 (InterPro:IPR006027); Has 299 Blast hits to 299 proteins in 120 species: Archae - 0; Bacteria - 232; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT4G26740 | AT4G26740.1 | GTTGGGCCTATATAAAAGCCCATAGAGGCCC | Gene is expressed preferentially in the embryo, has similarity to a rice ABA-responsive gene, EFA27. |
| AT4G28100 | AT4G28100.1 | AGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18050.1); Has 35 Blast hits to 35 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G28730 | AT4G28730.1 | TATAGGCCCATTAAG | glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT2G20270.1); Has 3146 Blast hits to 3143 proteins in 777 species: Archae - 0; Bacteria - 1253; Metazoa - 362; Fungi - 221; Plants - 386; Viruses - 107; Other Eukaryotes - 817 (source: NCBI BLink). |
| AT4G29390 | AT4G29390.1 | TATAGGCCCATTAAG | 40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT4G29400 | AT4G29400.1 | CTTAATGGGCCTATA | unknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink). |
| AT4G30200 | AT4G30200.2 | TATAGGCCT | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
| AT4G30200.3 | TATAGGCCT | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
| AT4G32390 | AT4G32390.1 | TAGTGGGCCTATA | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT2G25520.1); Has 1575 Blast hits to 1573 proteins in 180 species: Archae - 0; Bacteria - 6; Metazoa - 425; Fungi - 287; Plants - 687; Viruses - 0; Other Eukaryotes - 170 (source: NCBI BLink). |
| AT4G35220 | AT4G35220.1 | ATTTGGGCCTATA | cyclase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Putative cyclase (InterPro:IPR007325); BEST Arabidopsis thaliana protein match is: cyclase family protein (TAIR:AT4G34180.1); Has 778 Blast hits to 778 proteins in 304 species: Archae - 55; Bacteria - 578; Metazoa - 30; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). |
| AT4G35300 | AT4G35300.1 | TATAGGCCCGT | TONOPLAST MONOSACCHARIDE TRANSPORTER2 (TMT2); FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity, nucleoside transmembrane transporter activity; INVOLVED IN: in 6 processes; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: TMT1 (TONOPLAST MONOSACCHARIDE TRANSPORTER1); carbohydrate transmembrane transporter/ nucleoside transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G20840.1); Has 31955 Blast hits to 24066 proteins in 1440 species: Archae - 414; Bacteria - 13999; Metazoa - 6075; Fungi - 7762; Plants - 2061; Viruses - 0; Other Eukaryotes - 1644 (source: NCBI BLink). |
| AT4G35300.2 | TATAGGCCCGT | TONOPLAST MONOSACCHARIDE TRANSPORTER2 (TMT2); FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity, nucleoside transmembrane transporter activity; INVOLVED IN: in 6 processes; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: TMT1 (TONOPLAST MONOSACCHARIDE TRANSPORTER1); carbohydrate transmembrane transporter/ nucleoside transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G20840.1); Has 31955 Blast hits to 24066 proteins in 1440 species: Archae - 414; Bacteria - 13999; Metazoa - 6075; Fungi - 7762; Plants - 2061; Viruses - 0; Other Eukaryotes - 1644 (source: NCBI BLink). |
| AT4G35300.3 | TATAGGCCCGT | TONOPLAST MONOSACCHARIDE TRANSPORTER2 (TMT2); FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity, nucleoside transmembrane transporter activity; INVOLVED IN: in 6 processes; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: TMT1 (TONOPLAST MONOSACCHARIDE TRANSPORTER1); carbohydrate transmembrane transporter/ nucleoside transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G20840.1); Has 31955 Blast hits to 24066 proteins in 1440 species: Archae - 414; Bacteria - 13999; Metazoa - 6075; Fungi - 7762; Plants - 2061; Viruses - 0; Other Eukaryotes - 1644 (source: NCBI BLink). |
| AT4G36280 | AT4G36280.1 | AAATGGGCCTATA | ATP-binding region, ATPase-like domain-containing protein; FUNCTIONS IN: ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATP-binding region, ATPase-like (InterPro:IPR003594); BEST Arabidopsis thaliana protein match is: ATP-binding region, ATPase-like domain-containing protein (TAIR:AT4G36290.1); Has 306 Blast hits to 292 proteins in 51 species: Archae - 0; Bacteria - 16; Metazoa - 167; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT4G39460 | AT4G39460.1 | TATAGGCCCATTAG | Encodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway. |
| AT5G03850 | AT5G03850.1 | AGGCCTATA | 40S ribosomal protein S28 (RPS28B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome, cell wall, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S28e (InterPro:IPR000289); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S28 (RPS28A) (TAIR:AT3G10090.1); Has 804 Blast hits to 804 proteins in 280 species: Archae - 145; Bacteria - 0; Metazoa - 262; Fungi - 104; Plants - 121; Viruses - 0; Other Eukaryotes - 172 (source: NCBI BLink). |
| AT5G09740 | AT5G09740.1 | TATAGGCCCAATTA | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. |
| AT5G09740.2 | TATAGGCCCAATTA | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. |
| AT5G10630 | AT5G10630.1 | TATAGGCCCGTTAAAAGCCCAACA | elongation factor 1-alpha, putative / EF-1-alpha, putative; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Zinc finger, RanBP2-type (InterPro:IPR001876), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: EF-1-alpha-related GTP-binding protein, putative (TAIR:AT1G18070.2); Has 58110 Blast hits to 58057 proteins in 13368 species: Archae - 652; Bacteria - 20622; Metazoa - 14216; Fungi - 8620; Plants - 1274; Viruses - 3; Other Eukaryotes - 12723 (source: NCBI BLink). |
| AT5G11150 | AT5G11150.1 | TATAGGCCCAAAA | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family. |
| AT5G11330 | AT5G11330.1 | CTATTGGGCCTATA | monooxygenase family protein; FUNCTIONS IN: oxidoreductase activity, monooxygenase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938); BEST Arabidopsis thaliana protein match is: CTF2B; monooxygenase/ oxidoreductase (TAIR:AT2G29720.1); Has 2280 Blast hits to 2280 proteins in 460 species: Archae - 2; Bacteria - 1124; Metazoa - 4; Fungi - 594; Plants - 114; Viruses - 0; Other Eukaryotes - 442 (source: NCBI BLink). |
| AT5G11340 | AT5G11340.1 | TATAGGCCCAATAG | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT5G16800.2); Has 2784 Blast hits to 2784 proteins in 681 species: Archae - 121; Bacteria - 1284; Metazoa - 435; Fungi - 175; Plants - 77; Viruses - 0; Other Eukaryotes - 692 (source: NCBI BLink). |
| AT5G11580 | AT5G11580.1 | TATAGGCCCATG | UVB-resistance protein-related / regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: chromatin binding, Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15654 Blast hits to 4338 proteins in 271 species: Archae - 65; Bacteria - 1617; Metazoa - 6245; Fungi - 716; Plants - 1411; Viruses - 0; Other Eukaryotes - 5600 (source: NCBI BLink). |
| AT5G15802 | AT5G15802.1 | GGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 21 Blast hits to 21 proteins in 9 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G17610 | AT5G17610.1 | TATAGGCCCATGTAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 44 Blast hits to 44 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G22040 | AT5G22040.1 | AGGCCTATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G62330.1); Has 34 Blast hits to 34 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G22040.2 | AGGCCTATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G62330.1); Has 34 Blast hits to 34 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G22440 | AT5G22440.1 | ATAAGGCCTATA | 60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink). |
| AT5G22440.2 | ATAAGGCCTATA | 60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink). |
| AT5G23830 | AT5G23830.1 | TATAGGCC | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G23840.1); Has 35 Blast hits to 35 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G23830.2 | TATAGGCC | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G23840.1); Has 35 Blast hits to 35 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G27400 | AT5G27400.1 | TATAGGCCCATTAGGCCCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 806 Blast hits to 806 proteins in 171 species: Archae - 0; Bacteria - 62; Metazoa - 389; Fungi - 161; Plants - 105; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). |
| AT5G39740 | AT5G39740.1 | TTAAAGGCCCAAATATAAAGCCCATTAGGCCTATA | 60S ribosomal protein L5 (RPL5B); FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5, eukaryotic (InterPro:IPR005485), Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5); 5S rRNA binding / structural constituent of ribosome (TAIR:AT3G25520.1); Has 941 Blast hits to 940 proteins in 333 species: Archae - 245; Bacteria - 6; Metazoa - 326; Fungi - 108; Plants - 79; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT5G42220 | AT5G42220.1 | AGGCCTATA | ubiquitin family protein; INVOLVED IN: protein modification process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25270.1); Has 9149 Blast hits to 5042 proteins in 638 species: Archae - 2; Bacteria - 184; Metazoa - 4041; Fungi - 1003; Plants - 1687; Viruses - 163; Other Eukaryotes - 2069 (source: NCBI BLink). |
| AT5G46020 | AT5G46020.1 | GGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 13940 Blast hits to 6570 proteins in 620 species: Archae - 22; Bacteria - 1473; Metazoa - 5121; Fungi - 1286; Plants - 303; Viruses - 130; Other Eukaryotes - 5605 (source: NCBI BLink). |
| AT5G47930 | AT5G47930.1 | CAATGGGCTGGGCCTATAAGGCCCAATG | 40S ribosomal protein S27 (RPS27D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein S27e (InterPro:IPR000592); BEST Arabidopsis thaliana protein match is: ARS27A (ARABIDOPSIS RIBOSOMAL PROTEIN S27); structural constituent of ribosome (TAIR:AT3G61110.1); Has 707 Blast hits to 707 proteins in 276 species: Archae - 87; Bacteria - 0; Metazoa - 301; Fungi - 98; Plants - 99; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink). |
| AT5G49930 | AT5G49930.1 | ATATTGGGCTTATAGGCCC | embryo defective 1441 (emb1441); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Fibronectin-binding A, N-terminal (InterPro:IPR008616), Zinc finger, CCHC-type (InterPro:IPR001878), Protein of unknown function DUF814 (InterPro:IPR008532); Has 2906 Blast hits to 2454 proteins in 381 species: Archae - 144; Bacteria - 336; Metazoa - 995; Fungi - 294; Plants - 92; Viruses - 7; Other Eukaryotes - 1038 (source: NCBI BLink). |
| AT5G50240 | AT5G50240.3 | TTATTGGGCCTATAAAAGCCCATTTA | L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced. |
| AT5G54900 | AT5G54900.1 | AATTGGGCCTATAAAAAAGCC | RNA-binding protein 45A (ATRBP45A); FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 26274 Blast hits to 15473 proteins in 616 species: Archae - 10; Bacteria - 1663; Metazoa - 15334; Fungi - 2743; Plants - 3912; Viruses - 0; Other Eukaryotes - 2612 (source: NCBI BLink). |
| AT5G55510 | AT5G55510.1 | TATAGGCCCAAG | P-P-bond-hydrolysis-driven protein transmembrane transporter/ protein transporter; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT4G26670.1); Has 385 Blast hits to 385 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 135; Plants - 78; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G56360 | AT5G56360.1 | TATAGGCCCATTAG | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Low density lipoprotein-receptor, class A, cysteine-rich (InterPro:IPR002172), Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); BEST Arabidopsis thaliana protein match is: protein kinase C substrate, heavy chain-related (TAIR:AT2G42390.1); Has 52492 Blast hits to 29968 proteins in 1344 species: Archae - 253; Bacteria - 7152; Metazoa - 21077; Fungi - 6018; Plants - 1646; Viruses - 404; Other Eukaryotes - 15942 (source: NCBI BLink). |
| AT5G56700 | AT5G56700.1 | TGATGGGCCTATA | F-box protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G60610.1); Has 668 Blast hits to 656 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 666; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G57700 | AT5G57700.1 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT5G57700.2 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT5G57700.3 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT5G57700.4 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT5G58920 | AT5G58920.1 | TATAGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G58950 | AT5G58950.1 | GGCCTATA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G46930.1); Has 97287 Blast hits to 95864 proteins in 3755 species: Archae - 57; Bacteria - 8154; Metazoa - 43395; Fungi - 8207; Plants - 19435; Viruses - 506; Other Eukaryotes - 17533 (source: NCBI BLink). |
| AT5G59750 | AT5G59750.1 | TATAGGCCACGTCAGC | riboflavin biosynthesis protein, putative; FUNCTIONS IN: 3,4-dihydroxy-2-butanone-4-phosphate synthase activity, GTP cyclohydrolase II activity; INVOLVED IN: riboflavin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP cyclohydrolase II (InterPro:IPR000926), DHBP synthase RibB (InterPro:IPR000422), DHBP synthase RibB-like alpha/beta domain (InterPro:IPR017945); BEST Arabidopsis thaliana protein match is: ATGCH; 3,4-dihydroxy-2-butanone-4-phosphate synthase/ GTP cyclohydrolase II (TAIR:AT5G64300.1); Has 8351 Blast hits to 8350 proteins in 1311 species: Archae - 133; Bacteria - 4029; Metazoa - 0; Fungi - 273; Plants - 55; Viruses - 0; Other Eukaryotes - 3861 (source: NCBI BLink). |
| AT5G60790 | AT5G60790.1 | GGCCTATA | member of GCN subfamily |
| AT5G60870 | AT5G60870.1 | TATAGGCCC | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15979 Blast hits to 4615 proteins in 300 species: Archae - 95; Bacteria - 1703; Metazoa - 6193; Fungi - 797; Plants - 1473; Viruses - 2; Other Eukaryotes - 5716 (source: NCBI BLink). |
| AT5G60870.2 | TATAGGCCC | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15979 Blast hits to 4615 proteins in 300 species: Archae - 95; Bacteria - 1703; Metazoa - 6193; Fungi - 797; Plants - 1473; Viruses - 2; Other Eukaryotes - 5716 (source: NCBI BLink). |
| AT5G60870.3 | TATAGGCCC | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15979 Blast hits to 4615 proteins in 300 species: Archae - 95; Bacteria - 1703; Metazoa - 6193; Fungi - 797; Plants - 1473; Viruses - 2; Other Eukaryotes - 5716 (source: NCBI BLink). |
| AT5G63080 | AT5G63080.1 | ATAATGGGCCTATAAATGGGCCGTA | transcription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT1G78280.1); Has 1321 Blast hits to 1316 proteins in 215 species: Archae - 0; Bacteria - 213; Metazoa - 766; Fungi - 131; Plants - 81; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). |
| AT5G63460 | AT5G63460.1 | ATAAGGCCTATA | SAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034), Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 67 Blast hits to 67 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT5G63460.2 | ATAAGGCCTATA | SAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034), Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 67 Blast hits to 67 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT5G65400 | AT5G65400.1 | TTATGGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G24380.1); Has 479 Blast hits to 479 proteins in 121 species: Archae - 0; Bacteria - 2; Metazoa - 88; Fungi - 285; Plants - 66; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT5G65650 | AT5G65650.1 | TTATTGGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G36660.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G65720 | AT5G65720.1 | TATAGGCCCATTAT | cysteine desulfurase whose activity is dependent on AtSufE activation. |
| AT5G65720.2 | TATAGGCCCATTAT | cysteine desulfurase whose activity is dependent on AtSufE activation. |
| AT5G66500 | AT5G66500.1 | AGGCCTATA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, cauline leaf, flower, seed; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G13600.1); Has 10819 Blast hits to 4139 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 15; Plants - 10655; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |