| Locus | Gene model | Sequence | Description |
| AT1G02680 | AT1G02680.1 | CCGGTTTG | TBP-ASSOCIATED FACTOR 13 (TAF13); FUNCTIONS IN: RNA polymerase II transcription factor activity, DNA binding; INVOLVED IN: transcription initiation, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IID, 18 kDa subunit (InterPro:IPR003195), Histone-fold (InterPro:IPR009072); Has 401 Blast hits to 401 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 182; Fungi - 191; Plants - 19; Viruses - 2; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G04130 | AT1G04130.1 | CAAACCGG | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase-related (TAIR:AT1G56440.1); Has 3930 Blast hits to 3426 proteins in 259 species: Archae - 8; Bacteria - 133; Metazoa - 1878; Fungi - 572; Plants - 573; Viruses - 0; Other Eukaryotes - 766 (source: NCBI BLink). |
| AT1G04690 | AT1G04690.1 | CCAAACCGGT | POTASSIUM CHANNEL BETA SUBUNIT (KAB1); FUNCTIONS IN: oxidoreductase activity, potassium channel activity; INVOLVED IN: oxidation reduction, potassium ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Potassium channel, voltage-dependent, beta subunit, KCNAB-related (InterPro:IPR005399); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G60690.1); Has 17446 Blast hits to 17422 proteins in 1383 species: Archae - 314; Bacteria - 9995; Metazoa - 800; Fungi - 1248; Plants - 507; Viruses - 0; Other Eukaryotes - 4582 (source: NCBI BLink). |
| AT1G04910 | AT1G04910.1 | CCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22460.1); Has 440 Blast hits to 425 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 440; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G05205 | AT1G05205.1 | CAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G05620 | AT1G05620.1 | TTTCCGGTTTGG | URIDINE-RIBOHYDROLASE 2 (URH2); FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Inosine/uridine-preferring nucleoside hydrolase (InterPro:IPR001910); BEST Arabidopsis thaliana protein match is: URH1 (URIDINE-RIBOHYDROLASE 1); adenosine nucleosidase/ hydrolase/ inosine nucleosidase/ uridine nucleosidase (TAIR:AT2G36310.1); Has 3510 Blast hits to 3474 proteins in 706 species: Archae - 26; Bacteria - 2065; Metazoa - 165; Fungi - 155; Plants - 94; Viruses - 0; Other Eukaryotes - 1005 (source: NCBI BLink). |
| AT1G05620.2 | TTTCCGGTTTGG | URIDINE-RIBOHYDROLASE 2 (URH2); FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Inosine/uridine-preferring nucleoside hydrolase (InterPro:IPR001910); BEST Arabidopsis thaliana protein match is: URH1 (URIDINE-RIBOHYDROLASE 1); adenosine nucleosidase/ hydrolase/ inosine nucleosidase/ uridine nucleosidase (TAIR:AT2G36310.1); Has 3510 Blast hits to 3474 proteins in 706 species: Archae - 26; Bacteria - 2065; Metazoa - 165; Fungi - 155; Plants - 94; Viruses - 0; Other Eukaryotes - 1005 (source: NCBI BLink). |
| AT1G08110 | AT1G08110.1 | CCAAACCGGAA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.2 | CCAAACCGGAA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.3 | CCAAACCGGAA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.4 | CCAAACCGGAA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08490 | AT1G08490.1 | TTTAACCGGTTTG | Chloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation. |
| AT1G08530 | AT1G08530.1 | CCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09995.3); Has 90 Blast hits to 90 proteins in 36 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G09140 | AT1G09140.1 | TTCCGGTTTG | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. |
| AT1G09140.2 | TTCCGGTTTG | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. |
| AT1G09150 | AT1G09150.1 | CAAACCGGAA | pseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink). |
| AT1G10230 | AT1G10230.1 | CAAACCGGTTC | ARABIDOPSIS SKP1-LIKE 18 (ASK18); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: ASK15 (ARABIDOPSIS SKP1-LIKE 15); protein binding / ubiquitin-protein ligase (TAIR:AT3G25650.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 473; Fungi - 107; Plants - 362; Viruses - 11; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT1G10430 | AT1G10430.1 | ATCCGGTTTGG | Encodes one of two isoforms of the catalytic subunit of protein phosphatase 2A. |
| AT1G10490 | AT1G10490.1 | CAAACCGG | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1726 (InterPro:IPR013562), Protein of unknown function DUF699, ATPase putative (InterPro:IPR007807); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57940.1); Has 887 Blast hits to 850 proteins in 389 species: Archae - 76; Bacteria - 411; Metazoa - 160; Fungi - 89; Plants - 21; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). |
| AT1G10490.1 | CAAACCGGTC | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1726 (InterPro:IPR013562), Protein of unknown function DUF699, ATPase putative (InterPro:IPR007807); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57940.1); Has 887 Blast hits to 850 proteins in 389 species: Archae - 76; Bacteria - 411; Metazoa - 160; Fungi - 89; Plants - 21; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). |
| AT1G11200 | AT1G11200.1 | CCAAACCGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21570.1); Has 593 Blast hits to 589 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 256; Fungi - 128; Plants - 126; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT1G11760 | AT1G11760.1 | GTCCGGTTTG | unknown protein; LOCATED IN: cellular_component unknown; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G12770 | AT1G12770.1 | GTCCGGTTTGG | embryo defective 1586 (EMB1586); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; INVOLVED IN: embryonic development ending in seed dormancy; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative (TAIR:AT3G19760.1); Has 25549 Blast hits to 25020 proteins in 1695 species: Archae - 449; Bacteria - 9955; Metazoa - 4809; Fungi - 3113; Plants - 1343; Viruses - 12; Other Eukaryotes - 5868 (source: NCBI BLink). |
| AT1G12830 | AT1G12830.1 | CAAACCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 39113 Blast hits to 20367 proteins in 821 species: Archae - 97; Bacteria - 5453; Metazoa - 15540; Fungi - 5514; Plants - 1861; Viruses - 608; Other Eukaryotes - 10040 (source: NCBI BLink). |
| AT1G12840 | AT1G12840.1 | ACCGGTTTG | Encodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. |
| AT1G13870 | AT1G13870.1 | CAAACCGGAC | Encodes a homolog of the yeast TOT4/KTI12 protein. Yeast TOT4/KTI12 associates with Elongator, a multisubunit complex that binds the RNA polymerase II transcription elongation complex. Ds insertion mutant has enlarged shoot apical region, 4 to 6 long slender leaves followed by spike-like structures, short roots. |
| AT1G13880 | AT1G13880.1 | GTCCGGTTTG | ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949); BEST Arabidopsis thaliana protein match is: myb family transcription factor / ELM2 domain-containing protein (TAIR:AT2G03470.2); Has 69 Blast hits to 69 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G14620 | AT1G14620.1 | CAAACCGGAT | DECOY (DECOY); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 71; Fungi - 79; Plants - 19; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G14620.1 | CAAACCGGAT | DECOY (DECOY); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 71; Fungi - 79; Plants - 19; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G14620.2 | CAAACCGGAT | DECOY (DECOY); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 71; Fungi - 79; Plants - 19; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G14620.2 | CAAACCGGAT | DECOY (DECOY); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 71; Fungi - 79; Plants - 19; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G14680 | AT1G14680.1 | GACCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09060.1); Has 7013 Blast hits to 5372 proteins in 466 species: Archae - 108; Bacteria - 388; Metazoa - 3676; Fungi - 303; Plants - 203; Viruses - 23; Other Eukaryotes - 2312 (source: NCBI BLink). |
| AT1G16700 | AT1G16700.1 | ATAACCGGTTTG | NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY) (TAIR:AT1G79010.1); Has 7775 Blast hits to 7384 proteins in 1556 species: Archae - 918; Bacteria - 3928; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink). |
| AT1G16850 | AT1G16850.1 | AACCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, leaf apex, male gametophyte, flower, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; Has 9 Blast hits to 9 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G17360 | AT1G17360.1 | CCAAACCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 8834 Blast hits to 6495 proteins in 406 species: Archae - 8; Bacteria - 626; Metazoa - 3389; Fungi - 793; Plants - 257; Viruses - 52; Other Eukaryotes - 3709 (source: NCBI BLink). |
| AT1G17790 | AT1G17790.1 | ACCGGTTTGG | DNA-binding bromodomain-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: GTE3 (GLOBAL TRANSCRIPTION FACTOR GROUP E 3); DNA binding / histone binding (TAIR:AT1G73150.1); Has 10421 Blast hits to 6039 proteins in 444 species: Archae - 16; Bacteria - 924; Metazoa - 4753; Fungi - 937; Plants - 711; Viruses - 164; Other Eukaryotes - 2916 (source: NCBI BLink). |
| AT1G18150 | AT1G18150.1 | CAAACCGGGTCG | ATMPK8, |
| AT1G18150.2 | CAAACCGGGTCG | ATMPK8, |
| AT1G19170 | AT1G19170.1 | ACCGGTTTGG | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT3G42950.1); Has 2514 Blast hits to 2510 proteins in 316 species: Archae - 2; Bacteria - 602; Metazoa - 8; Fungi - 955; Plants - 840; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT1G20770 | AT1G20770.1 | ATAACCGGTTTGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G20780 | AT1G20780.1 | TTCGGGTCAAACCGGTTAT | Encodes a protein containing a U-box and an ARM domain. |
| AT1G21840 | AT1G21840.1 | CAAACCGGTC | Encodes a urease accessory protein which is essential for the activation of plant urease. |
| AT1G22920 | AT1G22920.1 | CAAACCGGTTTAA | AJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. |
| AT1G22920.2 | CAAACCGGTTTAA | AJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. |
| AT1G23180 | AT1G23180.1 | TTTCCGGTTTG | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein / F-box family protein (TAIR:AT2G44900.1); Has 1577 Blast hits to 1070 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 532; Fungi - 257; Plants - 682; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). |
| AT1G26180 | AT1G26180.1 | CCAAACCGGATTTTAACCG | unknown protein; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 229 Blast hits to 229 proteins in 65 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT1G26640 | AT1G26640.1 | AACCCGGTTTG | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/glutamate/uridylate kinase (InterPro:IPR001048); Has 393 Blast hits to 393 proteins in 151 species: Archae - 114; Bacteria - 162; Metazoa - 4; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT1G26650 | AT1G26650.1 | CAAACCGGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69430.1); Has 108 Blast hits to 107 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27650 | AT1G27650.1 | CCAAACCGGAT | U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions. |
| AT1G27650.2 | CCAAACCGGAT | U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions. |
| AT1G29680 | AT1G29680.1 | GTCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1264 (InterPro:IPR010686); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45690.1); Has 188 Blast hits to 188 proteins in 83 species: Archae - 0; Bacteria - 84; Metazoa - 0; Fungi - 43; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G29900 | AT1G29900.1 | CCAAACCGGAA | carbamoyl phosphate synthetase large chain (CARB) mRNA, |
| AT1G30550 | AT1G30550.2 | CCAAACCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: WW domain-containing protein (TAIR:AT1G45231.2); Has 891 Blast hits to 591 proteins in 275 species: Archae - 68; Bacteria - 248; Metazoa - 211; Fungi - 176; Plants - 45; Viruses - 3; Other Eukaryotes - 140 (source: NCBI BLink). |
| AT1G31240 | AT1G31240.1 | TGGGCTCAAACCGGTC | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Bromodomain transcription factor (InterPro:IPR006565); BEST Arabidopsis thaliana protein match is: TAF8 (TBP-ASSOCIATED FACTOR 8); DNA binding (TAIR:AT4G34340.1); Has 104 Blast hits to 104 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G31420 | AT1G31420.1 | CAAACCGGTTCAA | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. |
| AT1G31460 | AT1G31460.1 | CCAAACCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23270.1); Has 1177 Blast hits to 701 proteins in 148 species: Archae - 0; Bacteria - 210; Metazoa - 433; Fungi - 158; Plants - 37; Viruses - 17; Other Eukaryotes - 322 (source: NCBI BLink). |
| AT1G31800 | AT1G31800.1 | GTCCGGTTTG | Encodes a protein with β-ring carotenoid hydroxylase activity. |
| AT1G32370 | AT1G32370.1 | TTCCGGTTTG | Encodes a 122 amino acid basic protein involved in tobamovirus multiplication in planta. |
| AT1G32370.2 | TTCCGGTTTG | Encodes a 122 amino acid basic protein involved in tobamovirus multiplication in planta. |
| AT1G32370.3 | TTCCGGTTTG | Encodes a 122 amino acid basic protein involved in tobamovirus multiplication in planta. |
| AT1G32370.4 | TTCCGGTTTG | Encodes a 122 amino acid basic protein involved in tobamovirus multiplication in planta. |
| AT1G33265 | AT1G33265.1 | TAACCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); Has 119 Blast hits to 119 proteins in 43 species: Archae - 0; Bacteria - 27; Metazoa - 33; Fungi - 2; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G33520 | AT1G33520.1 | GACCCGGTTTGG | Has single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4; |
| AT1G34000 | AT1G34000.1 | TTTCCGGTTTGG | Encodes a novel member of the Lhc family from Arabidopsis with one predicted transmembrane alpha-helix closely related to helix I of Lhc protein from PSI (Lhca4). Gene expression is triggered by light stress and both transcript and protein accumulate in a light intensity-dependent manner. Ohp2 is associated with PSI under low- or high-light conditions. |
| AT1G35516 | AT1G35516.1 | ACCGGTTTG | CONTAINS InterPro DOMAIN/s: Myb transcription factor (InterPro:IPR015495); Has 12 Blast hits to 12 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G43860 | AT1G43860.1 | CAAACCGGAT | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family, Shwachman-Bodian-Diamond syndrome related (InterPro:IPR002140), Uncharacterised protein family UPF0023, conserved site (InterPro:IPR018023); Has 774 Blast hits to 765 proteins in 243 species: Archae - 139; Bacteria - 2; Metazoa - 226; Fungi - 186; Plants - 30; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink). |
| AT1G49590 | AT1G49590.1 | TTTCCGGTTTG | formin-binding protein-related; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 340 Blast hits to 336 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 213; Fungi - 38; Plants - 54; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT1G49590.2 | TTTCCGGTTTG | formin-binding protein-related; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 340 Blast hits to 336 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 213; Fungi - 38; Plants - 54; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT1G49670 | AT1G49670.1 | GACCGGTTTGG | molecular function has not been defined. Was shown involved in oxidative stress tolerance. |
| AT1G50380 | AT1G50380.1 | CCGGTTTATCCAAACCGGAT | prolyl oligopeptidase family protein; FUNCTIONS IN: serine-type peptidase activity, serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S9, prolyl oligopeptidase active site region (InterPro:IPR001375), Peptidase S9A, oligopeptidase, N-terminal beta-propeller (InterPro:IPR004106), Peptidase S9A, prolyl oligopeptidase (InterPro:IPR002470); BEST Arabidopsis thaliana protein match is: prolyl oligopeptidase family protein (TAIR:AT1G69020.1); Has 6063 Blast hits to 6017 proteins in 719 species: Archae - 41; Bacteria - 1884; Metazoa - 253; Fungi - 18; Plants - 99; Viruses - 0; Other Eukaryotes - 3768 (source: NCBI BLink). |
| AT1G50970 | AT1G50970.1 | CAAACCGGT | membrane trafficking VPS53 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Vps53-like, N-terminal (InterPro:IPR007234); BEST Arabidopsis thaliana protein match is: HIT1 (HEAT-INTOLERANT 1); transporter (TAIR:AT1G50500.1); Has 433 Blast hits to 308 proteins in 142 species: Archae - 2; Bacteria - 19; Metazoa - 193; Fungi - 111; Plants - 34; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G53350 | AT1G53350.1 | TTGAACCGGTTTGG | ATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: defense response, apoptosis; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G35450.1); Has 11361 Blast hits to 10470 proteins in 414 species: Archae - 9; Bacteria - 687; Metazoa - 857; Fungi - 33; Plants - 9637; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT1G54100 | AT1G54100.1 | AACCCGGTTTG | Aldehyde dehydrogenase |
| AT1G54100.2 | AACCCGGTTTG | Aldehyde dehydrogenase |
| AT1G54520 | AT1G54520.1 | ATAAACCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1517 (InterPro:IPR010903); Has 198 Blast hits to 197 proteins in 64 species: Archae - 0; Bacteria - 91; Metazoa - 6; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G55890 | AT1G55890.1 | CAAACCGGT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G13160.1); Has 17815 Blast hits to 5592 proteins in 168 species: Archae - 5; Bacteria - 22; Metazoa - 302; Fungi - 235; Plants - 16660; Viruses - 0; Other Eukaryotes - 591 (source: NCBI BLink). |
| AT1G56280 | AT1G56280.1 | CAAACCGG | Encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The increase in transcript level is independent from abscisic acid level. Sequence is not similar to any protein of known function. It appears to be a member of plant-specific gene family. It's phosphorylated by AtCPK11 in a Ca(2+)-dependent manner at Thr105 and Ser107 within the AtDi19 bipartite nuclear localization signal |
| AT1G58030 | AT1G58030.1 | CAAACCGGT | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Localized to the tonoplast. |
| AT1G61150 | AT1G61150.1 | CAAACCGGTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT1G61150.2 | CAAACCGGTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT1G61150.3 | CAAACCGGTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT1G61150.4 | CAAACCGGTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT1G61150.5 | CAAACCGGTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT1G61150.6 | CAAACCGGTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT1G61150.7 | CAAACCGGTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT1G62120 | AT1G62120.1 | ATCCGGTTTG | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G62085.1); Has 415 Blast hits to 372 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 404; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G62150 | AT1G62150.1 | ATAAACCGGTTTGG | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G62085.1); Has 429 Blast hits to 366 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 418; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G62600 | AT1G62600.1 | CCAAACCGGTTTAC | flavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960); BEST Arabidopsis thaliana protein match is: flavin-containing monooxygenase family protein / FMO family protein (TAIR:AT1G62620.1); Has 8846 Blast hits to 8478 proteins in 928 species: Archae - 35; Bacteria - 3635; Metazoa - 1030; Fungi - 886; Plants - 455; Viruses - 0; Other Eukaryotes - 2805 (source: NCBI BLink). |
| AT1G64790 | AT1G64790.1 | CAAACCGGAA | binding; FUNCTIONS IN: binding; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 2692 Blast hits to 1863 proteins in 219 species: Archae - 40; Bacteria - 175; Metazoa - 1167; Fungi - 728; Plants - 256; Viruses - 13; Other Eukaryotes - 313 (source: NCBI BLink). |
| AT1G65220 | AT1G65220.1 | CGAACCGGTTTGG | eIF4-gamma/eIF5/eIF2-epsilon domain-containing protein; FUNCTIONS IN: binding, translation initiation factor activity; INVOLVED IN: regulation of translational initiation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: eIF4-gamma/eIF5/eIF2-epsilon (InterPro:IPR003307), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: eIF4-gamma/eIF5/eIF2-epsilon domain-containing protein (TAIR:AT5G36230.1); Has 618 Blast hits to 616 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 468; Fungi - 26; Plants - 99; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT1G67470 | AT1G67470.1 | CAAACCGGT | protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G65250.1); Has 21178 Blast hits to 20996 proteins in 883 species: Archae - 2; Bacteria - 1636; Metazoa - 5632; Fungi - 603; Plants - 11445; Viruses - 32; Other Eukaryotes - 1828 (source: NCBI BLink). |
| AT1G68720 | AT1G68720.1 | CAAACCGGACCGGTTTAT | TRNA ARGININE ADENOSINE DEAMINASE (TADA); FUNCTIONS IN: hydrolase activity, zinc ion binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CMP/dCMP deaminase, zinc-binding (InterPro:IPR002125), Cytidine deaminase-like (InterPro:IPR016193); BEST Arabidopsis thaliana protein match is: cytidine/deoxycytidylate deaminase family protein (TAIR:AT5G28050.1); Has 19163 Blast hits to 15661 proteins in 1596 species: Archae - 115; Bacteria - 4851; Metazoa - 4895; Fungi - 796; Plants - 406; Viruses - 57; Other Eukaryotes - 8043 (source: NCBI BLink). |
| AT1G69460 | AT1G69460.1 | CCAAACCGGTTTAT | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1075 Blast hits to 1073 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 530; Fungi - 308; Plants - 128; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). |
| AT1G72175 | AT1G72175.1 | CAAACCGGAAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1232 (InterPro:IPR010652), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G22510.1); Has 591 Blast hits to 591 proteins in 84 species: Archae - 0; Bacteria - 8; Metazoa - 474; Fungi - 32; Plants - 29; Viruses - 2; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT1G73020 | AT1G73020.1 | ACCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF590 (InterPro:IPR007632); Has 925 Blast hits to 873 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 662; Fungi - 104; Plants - 12; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). |
| AT1G73030 | AT1G73030.1 | CAAACCGGGT | VPS46.2; INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS46.1 (VACUOLAR PROTEIN SORTING 46.1) (TAIR:AT1G17730.1); Has 975 Blast hits to 974 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 421; Fungi - 187; Plants - 221; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT1G73150 | AT1G73150.1 | CCGGTTTG | Bromodomain and extra terminal domain family protein. Binds to acetyl-histone H3. Binding is reduced when GTE3 is SUMOylated by SIZ1. |
| AT1G76630 | AT1G76630.1 | CAAACCGGGTC | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: SEC (secret agent); transferase, transferring glycosyl groups (TAIR:AT3G04240.1); Has 5924 Blast hits to 3836 proteins in 536 species: Archae - 384; Bacteria - 2298; Metazoa - 901; Fungi - 281; Plants - 131; Viruses - 0; Other Eukaryotes - 1929 (source: NCBI BLink). |
| AT1G78590 | AT1G78590.1 | CAAACCGG | Encodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate. |
| AT1G80380 | AT1G80380.1 | CAAACCGGAC | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
| AT1G80380.2 | CAAACCGGAC | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
| AT1G80380.3 | CAAACCGGAC | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
| AT1G80410 | AT1G80410.1 | TTGAACCGGTTTGG | EMBRYO DEFECTIVE 2753 (EMB2753); FUNCTIONS IN: binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 3255 Blast hits to 2440 proteins in 375 species: Archae - 356; Bacteria - 819; Metazoa - 489; Fungi - 174; Plants - 61; Viruses - 3; Other Eukaryotes - 1353 (source: NCBI BLink). |
| AT2G04540 | AT2G04540.1 | CCAAACCGGAAA | 3-oxoacyl-(acyl-carrier-protein) synthase II, putative; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, fatty-acid synthase activity, catalytic activity; INVOLVED IN: biosynthetic process, fatty acid biosynthetic process, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-ketoacyl synthase (InterPro:IPR000794), Thiolase-like (InterPro:IPR016039), Beta-ketoacyl synthase, C-terminal (InterPro:IPR014031), 3-oxoacyl-[acyl-carrier-protein] synthase 2 (InterPro:IPR017568), Beta-ketoacyl synthase, N-terminal (InterPro:IPR014030), Thiolase-like, subgroup (InterPro:IPR016038), Beta-ketoacyl synthase, active site (InterPro:IPR018201); BEST Arabidopsis thaliana protein match is: FAB1 (FATTY ACID BIOSYNTHESIS 1); 3-oxoacyl-[acyl-carrier-protein] synthase/ fatty-acid synthase (TAIR:AT1G74960.2); Has 19605 Blast hits to 17878 proteins in 2069 species: Archae - 5; Bacteria - 11810; Metazoa - 457; Fungi - 1652; Plants - 223; Viruses - 0; Other Eukaryotes - 5458 (source: NCBI BLink). |
| AT2G04700 | AT2G04700.1 | TTCCGGTTATTTCCGGTTTG | ferredoxin thioredoxin reductase catalytic beta chain family protein; FUNCTIONS IN: ferredoxin:thioredoxin reductase activity, ferredoxin reductase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin thioredoxin reductase, beta subunit (InterPro:IPR004209); Has 204 Blast hits to 204 proteins in 84 species: Archae - 14; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). |
| AT2G05220 | AT2G05220.1 | CAAACCGGAA | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G05220.2 | CAAACCGGAA | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G19680 | AT2G19680.1 | ATAAACCGGTTTGG | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G19680.2 | ATAAACCGGTTTGG | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G20550 | AT2G20550.1 | GTCCGGTTTG | DNAJ chaperone C-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 7698 Blast hits to 7627 proteins in 1649 species: Archae - 68; Bacteria - 3560; Metazoa - 890; Fungi - 429; Plants - 401; Viruses - 2; Other Eukaryotes - 2348 (source: NCBI BLink). |
| AT2G20550.2 | GTCCGGTTTG | DNAJ chaperone C-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 7698 Blast hits to 7627 proteins in 1649 species: Archae - 68; Bacteria - 3560; Metazoa - 890; Fungi - 429; Plants - 401; Viruses - 2; Other Eukaryotes - 2348 (source: NCBI BLink). |
| AT2G21500 | AT2G21500.1 | CAAACCGGTC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT2G21500.2 | CAAACCGGTC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT2G26810 | AT2G26810.1 | CAAACCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT2G26810.2 | CAAACCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT2G26810.3 | CAAACCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT2G28450 | AT2G28450.1 | CAAACCGGAAA | zinc finger (CCCH-type) family protein; FUNCTIONS IN: methyltransferase activity, zinc ion binding, RNA methyltransferase activity, nucleic acid binding; INVOLVED IN: acetate biosynthetic process from carbon monoxide, methanol oxidation, RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Methyltransferase small (InterPro:IPR007848), (Uracil-5)-methyltransferase (InterPro:IPR010280); BEST Arabidopsis thaliana protein match is: RNA methyltransferase family protein (TAIR:AT3G21300.1); Has 4397 Blast hits to 3845 proteins in 1016 species: Archae - 74; Bacteria - 3383; Metazoa - 309; Fungi - 76; Plants - 54; Viruses - 3; Other Eukaryotes - 498 (source: NCBI BLink). |
| AT2G30000 | AT2G30000.1 | CCGGTTTGG | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G07170.2); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G30530 | AT2G30530.1 | CAAACCGGAA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G01970.1); Has 5828 Blast hits to 755 proteins in 128 species: Archae - 0; Bacteria - 29; Metazoa - 881; Fungi - 129; Plants - 81; Viruses - 12; Other Eukaryotes - 4696 (source: NCBI BLink). |
| AT2G32380 | AT2G32380.1 | CAAACCGGAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 102 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 9; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G33450 | AT2G33450.1 | GACCGGTTTG | 50S ribosomal protein L28, chloroplast (CL28); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28 (InterPro:IPR001383); Has 2561 Blast hits to 2561 proteins in 799 species: Archae - 0; Bacteria - 1602; Metazoa - 0; Fungi - 4; Plants - 31; Viruses - 0; Other Eukaryotes - 924 (source: NCBI BLink). |
| AT2G33700 | AT2G33700.1 | TCCGGTTTG | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51470.1); Has 4375 Blast hits to 4330 proteins in 315 species: Archae - 3; Bacteria - 175; Metazoa - 1377; Fungi - 480; Plants - 1317; Viruses - 7; Other Eukaryotes - 1016 (source: NCBI BLink). |
| AT2G34590 | AT2G34590.1 | CAAACCGGAT | transketolase family protein; FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity, transketolase activity; INVOLVED IN: pollen tube development; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transketolase, C-terminal (InterPro:IPR005476), Transketolase C-terminal-like (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: PDH-E1 BETA (PYRUVATE DEHYDROGENASE E1 BETA); pyruvate dehydrogenase (acetyl-transferring) (TAIR:AT1G30120.1); Has 9465 Blast hits to 9457 proteins in 1366 species: Archae - 92; Bacteria - 4722; Metazoa - 387; Fungi - 143; Plants - 155; Viruses - 0; Other Eukaryotes - 3966 (source: NCBI BLink). |
| AT2G35190 | AT2G35190.1 | ACCGGTTTG | plant-specific SNARE located in cell plate of dividing cells. cofractionates with the cytokinesis-specific syntaxin, KNOLLE, which is required for the formation of the cell plate. |
| AT2G35410 | AT2G35410.1 | CCAAACCGGCCCA | 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT4G09040.2); Has 19540 Blast hits to 13531 proteins in 594 species: Archae - 12; Bacteria - 1397; Metazoa - 10397; Fungi - 2454; Plants - 3010; Viruses - 0; Other Eukaryotes - 2270 (source: NCBI BLink). |
| AT2G35795 | AT2G35795.1 | GACCGGTTTG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT3G09700.1); Has 691 Blast hits to 691 proteins in 212 species: Archae - 0; Bacteria - 129; Metazoa - 169; Fungi - 134; Plants - 46; Viruses - 2; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G36230 | AT2G36230.1 | CCAAACCGGAATAAACCGA | Encodes a BBMII isomerase involved in histidine biosynthesis. |
| AT2G36240 | AT2G36240.1 | TCGGTTTATTCCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 18740 Blast hits to 5421 proteins in 159 species: Archae - 3; Bacteria - 12; Metazoa - 272; Fungi - 258; Plants - 17650; Viruses - 2; Other Eukaryotes - 543 (source: NCBI BLink). |
| AT2G36950 | AT2G36950.1 | CAAACCGG | heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT5G03380.1); Has 1894 Blast hits to 1345 proteins in 210 species: Archae - 0; Bacteria - 199; Metazoa - 308; Fungi - 38; Plants - 1023; Viruses - 4; Other Eukaryotes - 322 (source: NCBI BLink). |
| AT2G38670 | AT2G38670.1 | ATCCGGTTTG | Encodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis. |
| AT2G38740 | AT2G38740.1 | CAAACCGG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), Haloacid dehydrogenase/epoxide hydrolase (InterPro:IPR005833), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT1G56500.1); Has 10291 Blast hits to 10291 proteins in 1397 species: Archae - 137; Bacteria - 7267; Metazoa - 142; Fungi - 274; Plants - 203; Viruses - 3; Other Eukaryotes - 2265 (source: NCBI BLink). |
| AT2G38740.1 | TTCCGGTTTG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), Haloacid dehydrogenase/epoxide hydrolase (InterPro:IPR005833), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT1G56500.1); Has 10291 Blast hits to 10291 proteins in 1397 species: Archae - 137; Bacteria - 7267; Metazoa - 142; Fungi - 274; Plants - 203; Viruses - 3; Other Eukaryotes - 2265 (source: NCBI BLink). |
| AT2G39270 | AT2G39270.1 | CCAAACCGGAA | adenylate kinase family protein; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; CONTAINS InterPro DOMAIN/s: Adenylate kinase, subfamily (InterPro:IPR006259), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: ADK (ADENOSINE KINASE); adenylate kinase/ nucleotide kinase (TAIR:AT2G37250.1); Has 8604 Blast hits to 8484 proteins in 1852 species: Archae - 61; Bacteria - 4479; Metazoa - 995; Fungi - 287; Plants - 246; Viruses - 0; Other Eukaryotes - 2536 (source: NCBI BLink). |
| AT2G39710 | AT2G39710.1 | GTAAACCGGAACAAACCGG | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT2G40600 | AT2G40600.1 | CAAACCGGTTCA | appr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT1G69340.1); Has 2324 Blast hits to 2216 proteins in 788 species: Archae - 117; Bacteria - 1020; Metazoa - 576; Fungi - 86; Plants - 56; Viruses - 292; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT2G40900 | AT2G40900.1 | CAAACCGGAA | nodulin MtN21 family protein; LOCATED IN: membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: integral membrane family protein / nodulin MtN21-related (TAIR:AT3G56620.1); Has 2529 Blast hits to 2517 proteins in 413 species: Archae - 29; Bacteria - 1156; Metazoa - 2; Fungi - 0; Plants - 635; Viruses - 0; Other Eukaryotes - 707 (source: NCBI BLink). |
| AT2G44040 | AT2G44040.1 | TTTCCGGTTTG | dihydrodipicolinate reductase family protein; FUNCTIONS IN: dihydrodipicolinate reductase activity; INVOLVED IN: oxidation reduction, lysine biosynthetic process via diaminopimelate, metabolic process, diaminopimelate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Dihydrodipicolinate reductase, plant (InterPro:IPR011859), Dihydrodipicolinate reductase, bacterial and plant (InterPro:IPR011770), Dihydrodipicolinate reductase (InterPro:IPR000846); BEST Arabidopsis thaliana protein match is: dihydrodipicolinate reductase family protein (TAIR:AT3G59890.1); Has 2046 Blast hits to 2045 proteins in 732 species: Archae - 80; Bacteria - 1476; Metazoa - 2; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 440 (source: NCBI BLink). |
| AT2G44050 | AT2G44050.1 | CAAACCGGAAA | 6,7-dimethyl-8-ribityllumazine synthase / DMRL synthase / lumazine synthase / riboflavin synthase [Arabidopsis thaliana]. Acts in the jasmonic acid signaling pathway. |
| AT2G46260 | AT2G46260.1 | CCAAACCGGTTAAA | BTB/POZ domain-containing protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: ATPOB1; protein binding (TAIR:AT3G61600.1); Has 3167 Blast hits to 3141 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 3012; Fungi - 0; Plants - 79; Viruses - 9; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT2G46800 | AT2G46800.1 | ACCGGTTTG | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
| AT2G46800.2 | ACCGGTTTG | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
| AT3G03120 | AT3G03120.1 | CAAACCGGTTATAAACCGGTC | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. |
| AT3G03270 | AT3G03270.1 | CAAACCGGTTAT | universal stress protein (USP) family protein / early nodulin ENOD18 family protein; INVOLVED IN: response to stress; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G53990.1); Has 331 Blast hits to 331 proteins in 36 species: Archae - 0; Bacteria - 4; Metazoa - 8; Fungi - 10; Plants - 307; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G03270.2 | CAAACCGGTTAT | universal stress protein (USP) family protein / early nodulin ENOD18 family protein; INVOLVED IN: response to stress; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G53990.1); Has 331 Blast hits to 331 proteins in 36 species: Archae - 0; Bacteria - 4; Metazoa - 8; Fungi - 10; Plants - 307; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G03580 | AT3G03580.1 | TTCCGGTTTG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DOT4 (DEFECTIVELY ORGANIZED TRIBUTARIES 4) (TAIR:AT4G18750.1); Has 19378 Blast hits to 5309 proteins in 162 species: Archae - 0; Bacteria - 2; Metazoa - 56; Fungi - 84; Plants - 18779; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink). |
| AT3G03600 | AT3G03600.1 | CGACCCGGTTTG | Structural component of the mitochondrial ribosome small subunit |
| AT3G03610 | AT3G03610.1 | CAAACCGGGTCG | phagocytosis and cell motility protein ELMO1-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: phagocytosis; LOCATED IN: cytoskeleton; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Engulfment and cell motility, ELMO (InterPro:IPR006816); BEST Arabidopsis thaliana protein match is: phagocytosis and cell motility protein ELMO1-related (TAIR:AT1G03620.1); Has 636 Blast hits to 636 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 422; Fungi - 25; Plants - 106; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT3G03890 | AT3G03890.1 | CCAAACCGGGTT | FMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT3G03890.2 | CCAAACCGGGTT | FMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT3G03920 | AT3G03920.1 | CCGGTTTG | Gar1 RNA-binding region family protein; FUNCTIONS IN: RNA binding, rRNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast thylakoid membrane, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gar1 protein RNA-binding region (InterPro:IPR007504); BEST Arabidopsis thaliana protein match is: Gar1 RNA-binding region family protein (TAIR:AT5G18180.1); Has 26246 Blast hits to 8264 proteins in 726 species: Archae - 15; Bacteria - 4613; Metazoa - 10704; Fungi - 2027; Plants - 5901; Viruses - 362; Other Eukaryotes - 2624 (source: NCBI BLink). |
| AT3G04680 | AT3G04680.1 | CAAACCGG | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
| AT3G04680.2 | CAAACCGG | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
| AT3G05400 | AT3G05400.1 | CAAACCGGAT | sugar transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: SFP1; carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT5G27350.1); Has 15989 Blast hits to 15662 proteins in 1061 species: Archae - 222; Bacteria - 5080; Metazoa - 4416; Fungi - 4071; Plants - 1288; Viruses - 0; Other Eukaryotes - 912 (source: NCBI BLink). |
| AT3G05935 | AT3G05935.1 | CAAACCGGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06140 | AT3G06140.1 | CCAAACCGGAAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G19080.1); Has 6615 Blast hits to 4433 proteins in 311 species: Archae - 2; Bacteria - 83; Metazoa - 2278; Fungi - 466; Plants - 2616; Viruses - 263; Other Eukaryotes - 907 (source: NCBI BLink). |
| AT3G06240 | AT3G06240.1 | GACCCGGTTTG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G23880.1); Has 1173 Blast hits to 1161 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1171; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06610 | AT3G06610.1 | CCGGTTTGG | DNA-binding enhancer protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 145 Blast hits to 145 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 98; Fungi - 15; Plants - 20; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G07170 | AT3G07170.1 | CAAACCGGTTAT | sterile alpha motif (SAM) domain-containing protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: sterile alpha motif (SAM) domain-containing protein (TAIR:AT5G48680.1); Has 396 Blast hits to 395 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 293; Fungi - 2; Plants - 89; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G07590 | AT3G07590.1 | TTTCCGGTTTG | small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative (TAIR:AT4G02840.1); Has 828 Blast hits to 827 proteins in 166 species: Archae - 0; Bacteria - 2; Metazoa - 337; Fungi - 221; Plants - 121; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). |
| AT3G08590 | AT3G08590.1 | TCCGGTTTG | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G08590.2 | TCCGGTTTG | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G09300 | AT3G09300.1 | TTCCGGTTTGG | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 3B (ORP3B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein, conserved site (InterPro:IPR018494), Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: UNE18 (UNFERTILIZED EMBRYO SAC 18); oxysterol binding / sterol binding (TAIR:AT5G02100.1); Has 1795 Blast hits to 1772 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 940; Fungi - 458; Plants - 154; Viruses - 0; Other Eukaryotes - 243 (source: NCBI BLink). |
| AT3G09300.1 | TTGAACCGGTTTG | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 3B (ORP3B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein, conserved site (InterPro:IPR018494), Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: UNE18 (UNFERTILIZED EMBRYO SAC 18); oxysterol binding / sterol binding (TAIR:AT5G02100.1); Has 1795 Blast hits to 1772 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 940; Fungi - 458; Plants - 154; Viruses - 0; Other Eukaryotes - 243 (source: NCBI BLink). |
| AT3G10050 | AT3G10050.1 | CCAAACCGGTC | first enzyme in the biosynthetic pathway of isoleucine |
| AT3G10060 | AT3G10060.1 | GACCGGTTTGG | immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT1G20810.1); Has 5654 Blast hits to 5251 proteins in 998 species: Archae - 30; Bacteria - 2476; Metazoa - 1330; Fungi - 312; Plants - 488; Viruses - 0; Other Eukaryotes - 1018 (source: NCBI BLink). |
| AT3G10850 | AT3G10850.1 | TCGGTTCGATCCGGTTTG | glyoxalase II cytoplasmic isozyme (Glx2-2) mRNA, complete |
| AT3G10860 | AT3G10860.1 | CAAACCGGATCGAACCGA | ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT5G05370.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G11710 | AT3G11710.1 | CAAACCGGTTCGGTTCG | ARABIDOPSIS THALIANA LYSYL-TRNA SYNTHETASE 1 (ATKRS-1); FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, lysine-tRNA ligase activity, ATP binding, nucleic acid binding; INVOLVED IN: lysyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Lysyl-tRNA synthetase, class II, C-terminal (InterPro:IPR018149), Lysyl-tRNA synthetase, class II (InterPro:IPR002313), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 15525 Blast hits to 13421 proteins in 1696 species: Archae - 251; Bacteria - 8760; Metazoa - 567; Fungi - 510; Plants - 102; Viruses - 0; Other Eukaryotes - 5335 (source: NCBI BLink). |
| AT3G11760 | AT3G11760.1 | CCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04860.1); Has 43 Blast hits to 38 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G11945 | AT3G11945.1 | CAAACCGGAA | Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. |
| AT3G11945.2 | CAAACCGGAA | Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. |
| AT3G12760 | AT3G12760.1 | CAAACCGGTTTGGCGAACCGGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defective in cullin neddylation (InterPro:IPR014764), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Protein of unknown function DUF298 (InterPro:IPR005176), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15860.2); Has 628 Blast hits to 626 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 408; Fungi - 99; Plants - 64; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT3G13070 | AT3G13070.1 | CAAACCGGGTT | CBS domain-containing protein / transporter associated domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Transporter-associated region (InterPro:IPR005170), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein / transporter associated domain-containing protein (TAIR:AT1G55930.1); Has 10211 Blast hits to 10209 proteins in 1421 species: Archae - 94; Bacteria - 6198; Metazoa - 215; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 3506 (source: NCBI BLink). |
| AT3G15480 | AT3G15480.1 | CAAACCGGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52910.1); Has 159 Blast hits to 159 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 159; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G16200 | AT3G16200.1 | CCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 70 Blast hits to 70 proteins in 9 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT3G16200.1 | TAACCGGTTTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 70 Blast hits to 70 proteins in 9 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT3G17365 | AT3G17365.1 | CAAACCGGTGAACCGGTC | catalytic/ methyltransferase; FUNCTIONS IN: methyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: catalytic/ methyltransferase (TAIR:AT3G60910.1); Has 889 Blast hits to 888 proteins in 188 species: Archae - 17; Bacteria - 122; Metazoa - 263; Fungi - 34; Plants - 84; Viruses - 0; Other Eukaryotes - 369 (source: NCBI BLink). |
| AT3G17668 | AT3G17668.1 | GTCCGGTTTGG | ENHANCER OF ATNSI ACTIVITY (ENA); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 103 Blast hits to 95 proteins in 30 species: Archae - 2; Bacteria - 13; Metazoa - 34; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G19640 | AT3G19640.1 | AAAACCGGTTTG | magnesium transporter CorA-like family protein (MRS2-3); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-1) (TAIR:AT1G16010.2); Has 603 Blast hits to 521 proteins in 126 species: Archae - 0; Bacteria - 31; Metazoa - 102; Fungi - 198; Plants - 203; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT3G19640.1 | AAAACCGGTTTGG | magnesium transporter CorA-like family protein (MRS2-3); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-1) (TAIR:AT1G16010.2); Has 603 Blast hits to 521 proteins in 126 species: Archae - 0; Bacteria - 31; Metazoa - 102; Fungi - 198; Plants - 203; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT3G19640.1 | AACCCGGTTTG | magnesium transporter CorA-like family protein (MRS2-3); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-1) (TAIR:AT1G16010.2); Has 603 Blast hits to 521 proteins in 126 species: Archae - 0; Bacteria - 31; Metazoa - 102; Fungi - 198; Plants - 203; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT3G20000 | AT3G20000.1 | CCAAACCGG | Encodes a component of the TOM receptor complex responsible for the recognition and translocation of cytosolically synthesized mitochondrial preproteins. With TOM22, functions as the transit peptide receptor at the surface of the mitochondrial outer membrane and facilitates the movement of preproteins into the translocation pore. |
| AT3G21200 | AT3G21200.1 | TCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 97 Blast hits to 97 proteins in 25 species: Archae - 0; Bacteria - 24; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT3G22845 | AT3G22845.1 | TTTCCGGTTTGG | emp24/gp25L/p24 protein-related; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT3G07680.1); Has 1355 Blast hits to 1355 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 771; Fungi - 319; Plants - 146; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT3G24100 | AT3G24100.1 | CCAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Four F5 protein (InterPro:IPR007513); BEST Arabidopsis thaliana protein match is: four F5 protein-related / 4F5 protein-related (TAIR:AT4G13615.1); Has 195 Blast hits to 195 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 136; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G26630 | AT3G26630.1 | ATCCGGTTTGG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 11770 Blast hits to 4443 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 21; Plants - 11596; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| AT3G26730 | AT3G26730.1 | CAAACCGGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 5616 Blast hits to 1874 proteins in 214 species: Archae - 3; Bacteria - 108; Metazoa - 2179; Fungi - 373; Plants - 239; Viruses - 6; Other Eukaryotes - 2708 (source: NCBI BLink). |
| AT3G26922 | AT3G26922.1 | ATCCGGTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G52680.2). |
| AT3G43520 | AT3G43520.1 | AAAACCGGTTTG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26240.1); Has 432 Blast hits to 415 proteins in 105 species: Archae - 4; Bacteria - 70; Metazoa - 210; Fungi - 11; Plants - 99; Viruses - 7; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT3G46100 | AT3G46100.1 | CCAAACCGGT | histidyl-tRNA synthetase |
| AT3G48730 | AT3G48730.1 | CAAACCGGAT | glutamate-1-semialdehyde 2,1-aminomutase 2 (GSA2); FUNCTIONS IN: glutamate-1-semialdehyde 2,1-aminomutase activity, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase class-III (InterPro:IPR005814), Tetrapyrrole biosynthesis, glutamate-1-semialdehyde aminotransferase (InterPro:IPR004639), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GSA1 (GLUTAMATE-1-SEMIALDEHYDE-2,1-AMINOMUTASE); glutamate-1-semialdehyde 2,1-aminomutase (TAIR:AT5G63570.1); Has 22952 Blast hits to 22949 proteins in 1683 species: Archae - 419; Bacteria - 12643; Metazoa - 453; Fungi - 515; Plants - 232; Viruses - 10; Other Eukaryotes - 8680 (source: NCBI BLink). |
| AT3G49080 | AT3G49080.1 | CAAACCGGAATAAACCGACT | ribosomal protein S9 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: RPS9 (RIBOSOMAL PROTEIN S9); structural constituent of ribosome (TAIR:AT1G74970.1); Has 5624 Blast hits to 5609 proteins in 1600 species: Archae - 138; Bacteria - 2917; Metazoa - 148; Fungi - 89; Plants - 121; Viruses - 18; Other Eukaryotes - 2193 (source: NCBI BLink). |
| AT3G49770 | AT3G49770.1 | TTCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52420 | AT3G52420.1 | GAAGCCCAAACCGGCCCATTT | encodes a 7 kDa chloroplast outer envelope membrane protein. |
| AT3G55140 | AT3G55140.1 | CCAAACCGGTTTGG | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G55140.2 | CCAAACCGGTTTGG | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G55480 | AT3G55480.1 | CAAACCGGTTTAG | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink). |
| AT3G55480.2 | CAAACCGGTTTAG | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink). |
| AT3G56750 | AT3G56750.1 | TCGGTTCGGTTTAATTAAACCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41150.2); Has 71 Blast hits to 71 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT3G57340 | AT3G57340.1 | GACCGGTTTG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink). |
| AT3G57340.2 | GACCGGTTTG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink). |
| AT3G58980 | AT3G58980.1 | ATCCGGTTTGG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58920.1); Has 1321 Blast hits to 1026 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 1320; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G61930 | AT3G61930.1 | AAATACCCAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355 | AT4G00355.1 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.2 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.3 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.4 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00560 | AT4G00560.1 | CCAAACCGGA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.1 | CCAAACCGGAAA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.2 | CCAAACCGGA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.2 | CCAAACCGGAAA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.3 | CCAAACCGGA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.3 | CCAAACCGGAAA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00620 | AT4G00620.1 | CAAACCGGTTT | tetrahydrofolate dehydrogenase/cyclohydrolase, putative; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Tetrahydrofolate dehydrogenase/cyclohydrolase (InterPro:IPR000672), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: tetrahydrofolate dehydrogenase/cyclohydrolase, putative (TAIR:AT4G00600.1); Has 7121 Blast hits to 7116 proteins in 1557 species: Archae - 77; Bacteria - 3120; Metazoa - 345; Fungi - 203; Plants - 87; Viruses - 0; Other Eukaryotes - 3289 (source: NCBI BLink). |
| AT4G03260 | AT4G03260.1 | ACCGGTTTG | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). |
| AT4G03260.2 | ACCGGTTTG | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). |
| AT4G03410 | AT4G03410.1 | CAAACCGGTTTT | peroxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT4G03410.2 | CAAACCGGTTTT | peroxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT4G04910 | AT4G04910.1 | CAAACCGGAT | N-ethylmaleimide sensitive factor |
| AT4G09620 | AT4G09620.1 | CAAACCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); Has 120 Blast hits to 97 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT4G11860 | AT4G11860.1 | ACCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF544 (InterPro:IPR007518), Ubiquitin interacting motif (InterPro:IPR003903); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22960.1); Has 761 Blast hits to 466 proteins in 133 species: Archae - 0; Bacteria - 44; Metazoa - 311; Fungi - 246; Plants - 57; Viruses - 0; Other Eukaryotes - 103 (source: NCBI BLink). |
| AT4G13780 | AT4G13780.1 | CAAACCGGAAA | methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative; FUNCTIONS IN: methionine-tRNA ligase activity, tRNA binding, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, methionyl-tRNA aminoacylation; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Aminoacyl-tRNA synthetase, class I (M) (InterPro:IPR015413), Methionyl-tRNA synthetase, class Ia (InterPro:IPR002304), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Methionyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR014758), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: tRNA-binding region domain-containing protein (TAIR:AT2G40660.1); Has 12421 Blast hits to 12391 proteins in 1665 species: Archae - 324; Bacteria - 5389; Metazoa - 513; Fungi - 358; Plants - 127; Viruses - 3; Other Eukaryotes - 5707 (source: NCBI BLink). |
| AT4G13950 | AT4G13950.1 | CAAACCGGCCGGTTTAA | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G14385 | AT4G14385.1 | CAAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H4 acetyltransferase, NuA4 complex, Eaf6 (InterPro:IPR015418); Has 245 Blast hits to 245 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 60; Plants - 29; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT4G14385.2 | CAAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H4 acetyltransferase, NuA4 complex, Eaf6 (InterPro:IPR015418); Has 245 Blast hits to 245 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 60; Plants - 29; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT4G14385.3 | CAAACCGGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H4 acetyltransferase, NuA4 complex, Eaf6 (InterPro:IPR015418); Has 245 Blast hits to 245 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 60; Plants - 29; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT4G15545 | AT4G15545.1 | CCAAACCGGAA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16520.1); Has 557 Blast hits to 539 proteins in 129 species: Archae - 0; Bacteria - 87; Metazoa - 242; Fungi - 51; Plants - 82; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink). |
| AT4G18060 | AT4G18060.1 | GACCGGTTTGG | clathrin binding; FUNCTIONS IN: clathrin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neutrophil cytosol factor 2 (InterPro:IPR000108), Src homology-3 domain (InterPro:IPR001452); BEST Arabidopsis thaliana protein match is: SH3 domain-containing protein 2 (SH3P2) (TAIR:AT4G34660.1); Has 2031 Blast hits to 1692 proteins in 137 species: Archae - 0; Bacteria - 6; Metazoa - 1668; Fungi - 93; Plants - 91; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink). |
| AT4G18580 | AT4G18580.1 | TTAAACCGAACCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18580.2 | TTAAACCGAACCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18590 | AT4G18590.1 | CAAACCGGTTCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Replication factor A protein 3 (InterPro:IPR013970), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52630.2); Has 58 Blast hits to 58 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G21100 | AT4G21100.1 | CCAAACCGGAA | One of two closely related genes similar to a damaged DNA binding protein originally described in mammals. May form a complex with DET1 to regulate photomorphogenesis. Loss of function mutations are lethal. The DDB1b protein binds with a number of DWD-containing proteins and may form part of a CUL4-based E3 ubiquitin ligase. |
| AT4G21105 | AT4G21105.1 | TTCCGGTTTGG | cytochrome-c oxidase/ electron carrier; FUNCTIONS IN: electron carrier activity, cytochrome-c oxidase activity; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIIa (InterPro:IPR003177); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G21105.2 | TTCCGGTTTGG | cytochrome-c oxidase/ electron carrier; FUNCTIONS IN: electron carrier activity, cytochrome-c oxidase activity; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIIa (InterPro:IPR003177); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G21660 | AT4G21660.1 | CCAAACCGGAAA | proline-rich spliceosome-associated (PSP) family protein; INVOLVED IN: mRNA processing; LOCATED IN: nucleus, chloroplast; CONTAINS InterPro DOMAIN/s: PSP, proline-rich (InterPro:IPR006568), Protein of unknown function DUF382 (InterPro:IPR007180); BEST Arabidopsis thaliana protein match is: pliceosome associated protein-related (TAIR:AT1G11520.1); Has 12288 Blast hits to 5916 proteins in 388 species: Archae - 20; Bacteria - 224; Metazoa - 7139; Fungi - 832; Plants - 388; Viruses - 239; Other Eukaryotes - 3446 (source: NCBI BLink). |
| AT4G21710 | AT4G21710.1 | CAAACCGGTTAT | Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. |
| AT4G21710.1 | CAAACCGGTTAT | Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. |
| AT4G22670 | AT4G22670.1 | CCGGTTTG | Arabidopsis thaliana Hsp70-interacting protein 1 (AtHip1); FUNCTIONS IN: binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: ATTDX (TETRATICOPEPTIDE DOMAIN-CONTAINING THIOREDOXIN); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor / protein binding (TAIR:AT3G17880.2); Has 104992 Blast hits to 32574 proteins in 1569 species: Archae - 323; Bacteria - 31113; Metazoa - 46021; Fungi - 5704; Plants - 7149; Viruses - 884; Other Eukaryotes - 13798 (source: NCBI BLink). |
| AT4G24140 | AT4G24140.1 | CAAACCGGT | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: BDG1 (BODYGUARD1); hydrolase (TAIR:AT1G64670.1); Has 3943 Blast hits to 3942 proteins in 690 species: Archae - 8; Bacteria - 2152; Metazoa - 305; Fungi - 115; Plants - 116; Viruses - 4; Other Eukaryotes - 1243 (source: NCBI BLink). |
| AT4G24840 | AT4G24840.1 | TCCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport, Golgi organization; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: COG complex component, COG2 (InterPro:IPR009316); Has 214 Blast hits to 204 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 56; Plants - 22; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT4G25850 | AT4G25850.1 | CCAAACCGGAT | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4B (ORP4B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: ORP4A (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4A); oxysterol binding (TAIR:AT4G25860.1); Has 1645 Blast hits to 1644 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 908; Fungi - 430; Plants - 143; Viruses - 0; Other Eukaryotes - 164 (source: NCBI BLink). |
| AT4G26555 | AT4G26555.1 | CCGGTTTG | immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT4G19830.1); Has 2159 Blast hits to 2148 proteins in 673 species: Archae - 12; Bacteria - 1209; Metazoa - 160; Fungi - 145; Plants - 239; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). |
| AT4G28590 | AT4G28590.1 | CCAAACCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31840.1); Has 81 Blast hits to 81 proteins in 33 species: Archae - 2; Bacteria - 0; Metazoa - 16; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT4G29510 | AT4G29510.1 | TAACCGGTTTGG | Has arginine N-methyltransferase activity. Modifies AtMBD7. |
| AT4G29810 | AT4G29810.1 | TTAACCGGTTTGTTTCCGGTTAAA | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT4G29810.2 | TTAACCGGTTTGTTTCCGGTTAAA | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT4G29810.3 | TTAACCGGTTTGTTTCCGGTTAAA | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT4G31460 | AT4G31460.1 | CCGGTTTG | ribosomal protein L28 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28 (InterPro:IPR001383); Has 797 Blast hits to 797 proteins in 221 species: Archae - 0; Bacteria - 262; Metazoa - 81; Fungi - 82; Plants - 19; Viruses - 0; Other Eukaryotes - 353 (source: NCBI BLink). |
| AT4G33640 | AT4G33640.1 | CAAACCGGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 141 Blast hits to 141 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT4G33640.1 | CAAACCGGTTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 141 Blast hits to 141 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT4G33680 | AT4G33680.1 | AAACCGAACCGGAACAAACCGGAT | Involved in disease resistance against Pseudomonas syringae. mutants have elevated SA levels, a low level of spontaneous cell death, callose deposition, and enlarged cells in leaves. genetically maps on chr 4 between L23H3 and nga1139. |
| AT4G33690 | AT4G33690.1 | ATCCGGTTTGTTCCGGTTCGGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: pollen tube; Has 499 Blast hits to 464 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 283; Fungi - 48; Plants - 38; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). |
| AT4G34430 | AT4G34430.1 | CCAAACCGGT | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34430.2 | CCAAACCGGT | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34430.3 | CCAAACCGGT | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34430.4 | CCAAACCGGT | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34490 | AT4G34490.1 | ATCCGGTTTGG | CYCLASE ASSOCIATED PROTEIN |
| AT4G35850 | AT4G35850.1 | CAAACCGGTTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G02150.1); Has 6373 Blast hits to 2522 proteins in 127 species: Archae - 1; Bacteria - 4; Metazoa - 104; Fungi - 77; Plants - 5853; Viruses - 0; Other Eukaryotes - 334 (source: NCBI BLink). |
| AT4G38500 | AT4G38500.1 | CAAACCGGTC | unknown protein; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28240.1); Has 167 Blast hits to 167 proteins in 24 species: Archae - 6; Bacteria - 22; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT4G39050 | AT4G39050.1 | CAAACCGGT | kinesin-related protein (MKRP2); FUNCTIONS IN: protein binding, microtubule motor activity, zinc ion binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex, chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT2G21380.1); Has 37077 Blast hits to 25676 proteins in 1021 species: Archae - 260; Bacteria - 2097; Metazoa - 19200; Fungi - 3004; Plants - 2225; Viruses - 313; Other Eukaryotes - 9978 (source: NCBI BLink). |
| AT4G39070 | AT4G39070.1 | CAAACCGGGT | zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: STH2 (SALT TOLERANCE HOMOLOG2); transcription factor/ zinc ion binding (TAIR:AT1G75540.1); Has 1235 Blast hits to 854 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 1150; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT4G39960 | AT4G39960.1 | CAAACCGGAT | DNAJ heat shock family protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G22360.1); Has 21244 Blast hits to 20540 proteins in 2111 species: Archae - 132; Bacteria - 6466; Metazoa - 3849; Fungi - 1680; Plants - 1445; Viruses - 25; Other Eukaryotes - 7647 (source: NCBI BLink). |
| AT4G40020 | AT4G40020.1 | TCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, sepal, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16730.1); Has 132649 Blast hits to 67638 proteins in 2100 species: Archae - 1327; Bacteria - 14625; Metazoa - 60192; Fungi - 9993; Plants - 4794; Viruses - 552; Other Eukaryotes - 41166 (source: NCBI BLink). |
| AT5G02100 | AT5G02100.1 | ATCCGGTTTGGTTCGGTT | Encodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent. |
| AT5G02480 | AT5G02480.1 | CAAACCGGTTTT | LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 60 Blast hits to 60 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G03290 | AT5G03290.1 | AAACCGAATCCGGTTTG | isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink). |
| AT5G04140 | AT5G04140.1 | CAAACCGGTTAA | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. |
| AT5G04140.2 | CAAACCGGTTAA | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. |
| AT5G04910 | AT5G04910.1 | CAAACCGGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G07020 | AT5G07020.1 | TTCCGGTTTG | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 32 Blast hits to 32 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 1; Plants - 28; Viruses - 1; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G07320 | AT5G07320.1 | CAAACCGGAAA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), Mitochondrial substrate carrier (InterPro:IPR001993), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248), Mitochondrial carrier protein (InterPro:IPR002067), EF-HAND 2 (InterPro:IPR018249), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT5G61810.1); Has 25974 Blast hits to 15681 proteins in 989 species: Archae - 0; Bacteria - 9; Metazoa - 12328; Fungi - 6441; Plants - 4249; Viruses - 5; Other Eukaryotes - 2942 (source: NCBI BLink). |
| AT5G07320.1 | CCAAACCGGA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), Mitochondrial substrate carrier (InterPro:IPR001993), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248), Mitochondrial carrier protein (InterPro:IPR002067), EF-HAND 2 (InterPro:IPR018249), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT5G61810.1); Has 25974 Blast hits to 15681 proteins in 989 species: Archae - 0; Bacteria - 9; Metazoa - 12328; Fungi - 6441; Plants - 4249; Viruses - 5; Other Eukaryotes - 2942 (source: NCBI BLink). |
| AT5G09770 | AT5G09770.1 | AAAACCGGTTTG | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G64650.1); Has 5413 Blast hits to 5398 proteins in 1518 species: Archae - 0; Bacteria - 3032; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT5G10270 | AT5G10270.1 | GACCGGTTCAAACCGGAC | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
| AT5G10780 | AT5G10780.1 | ACCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT5G10780.2 | ACCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT5G10840 | AT5G10840.1 | CCAAACCGGAAA | endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G25100.1); Has 1057 Blast hits to 1040 proteins in 178 species: Archae - 0; Bacteria - 38; Metazoa - 446; Fungi - 142; Plants - 235; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT5G12030 | AT5G12030.1 | CCAAACCGGAT | Encodes a cytosolic small heat shock protein with chaperone activity that is induced by heat and osmotic stress and is also expressed late in seed development. |
| AT5G12040 | AT5G12040.1 | ATCCGGTTTGG | carbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT5G12040.2 | ATCCGGTTTGG | carbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT5G13850 | AT5G13850.1 | ACCGGTTTGG | NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 3 (NACA3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT3G12390.1); Has 794 Blast hits to 784 proteins in 197 species: Archae - 0; Bacteria - 0; Metazoa - 341; Fungi - 176; Plants - 104; Viruses - 14; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G14590 | AT5G14590.1 | ATCCGGTTTGG | isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NADP+) activity, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor; INVOLVED IN: isocitrate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NADP-dependent, eukaryotic (InterPro:IPR004790); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative (TAIR:AT1G65930.1); Has 4142 Blast hits to 4125 proteins in 584 species: Archae - 19; Bacteria - 563; Metazoa - 433; Fungi - 160; Plants - 265; Viruses - 0; Other Eukaryotes - 2702 (source: NCBI BLink). |
| AT5G14600 | AT5G14600.1 | CCAAACCGGAT | tRNA (adenine-N1-)-methyltransferase; FUNCTIONS IN: tRNA (adenine-N1-)-methyltransferase activity; INVOLVED IN: tRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: tRNA methyltransferase complex GCD14 subunit (InterPro:IPR014816); Has 1145 Blast hits to 1142 proteins in 382 species: Archae - 132; Bacteria - 313; Metazoa - 135; Fungi - 115; Plants - 30; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink). |
| AT5G16640 | AT5G16640.1 | ATCCGGTTTG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: F mature embryo stage, 4 leaf senescence stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62680.1); Has 27324 Blast hits to 6063 proteins in 188 species: Archae - 4; Bacteria - 18; Metazoa - 819; Fungi - 570; Plants - 24583; Viruses - 0; Other Eukaryotes - 1330 (source: NCBI BLink). |
| AT5G17210 | AT5G17210.1 | CAAACCGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13380.1); Has 229 Blast hits to 225 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 229; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G17210.2 | CAAACCGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13380.1); Has 229 Blast hits to 225 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 229; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G17270 | AT5G17270.1 | CCAAACCGGAT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G37130.1); Has 5379 Blast hits to 3587 proteins in 480 species: Archae - 397; Bacteria - 1752; Metazoa - 604; Fungi - 281; Plants - 148; Viruses - 0; Other Eukaryotes - 2197 (source: NCBI BLink). |
| AT5G18100 | AT5G18100.1 | ATCCGGTTTG | A putative peroxisomal CuZnSOD inducible by a high-light pulse. |
| AT5G18100.1 | ATCCGGTTTGG | A putative peroxisomal CuZnSOD inducible by a high-light pulse. |
| AT5G18100.2 | ATCCGGTTTG | A putative peroxisomal CuZnSOD inducible by a high-light pulse. |
| AT5G18100.2 | ATCCGGTTTGG | A putative peroxisomal CuZnSOD inducible by a high-light pulse. |
| AT5G18400 | AT5G18400.1 | AACCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G18400.2 | AACCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G18400.3 | AACCCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G18440 | AT5G18440.1 | TTAACCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). |
| AT5G18440.2 | TTAACCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). |
| AT5G19690 | AT5G19690.1 | ACCGGTTTG | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions |
| AT5G19890 | AT5G19890.1 | CAAACCGG | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT5G06730.1); Has 2820 Blast hits to 2810 proteins in 191 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 39; Plants - 2752; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT5G20090 | AT5G20090.1 | TCCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G20090.2 | TCCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G20090.3 | TCCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G23300 | AT5G23300.1 | CAAACCGGTTAA | dihydroorotate dehydrogenase, catalyses fourth step of pyrimidine biosynthesis |
| AT5G23930 | AT5G23930.1 | CAAACCGGA | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT3G46950.1); Has 464 Blast hits to 360 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 449; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G24750 | AT5G24750.1 | TAACCGGTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 976 Blast hits to 975 proteins in 299 species: Archae - 0; Bacteria - 617; Metazoa - 1; Fungi - 251; Plants - 63; Viruses - 14; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT5G28350 | AT5G28350.1 | CCGGTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1339 (InterPro:IPR009771), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61480.1); Has 271 Blast hits to 226 proteins in 106 species: Archae - 0; Bacteria - 9; Metazoa - 133; Fungi - 64; Plants - 30; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT5G28350.2 | CCGGTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1339 (InterPro:IPR009771), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61480.1); Has 271 Blast hits to 226 proteins in 106 species: Archae - 0; Bacteria - 9; Metazoa - 133; Fungi - 64; Plants - 30; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT5G28500 | AT5G28500.1 | CCAAACCGGTTTAAATCCGGTTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04550.1); Has 79 Blast hits to 79 proteins in 36 species: Archae - 0; Bacteria - 52; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G35080 | AT5G35080.1 | ATAACCGGTTTG | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); Has 480 Blast hits to 361 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 316; Fungi - 98; Plants - 25; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT5G35320 | AT5G35320.1 | CCAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G37850 | AT5G37850.2 | CGAACCGGTTTG | Encodes a pyridoxal kinase required for root hair development. Mutants are hypersensitive to Na+, K+ and Li+. |
| AT5G43280 | AT5G43280.1 | CCAAACCGGAAA | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. |
| AT5G43280.2 | CCAAACCGGAAA | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. |
| AT5G44070 | AT5G44070.1 | CCAAACCGGAT | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. |
| AT5G45010 | AT5G45010.1 | GACCGGTTTG | Arabidopsis dss1 homolog on chromosome V (ATDSS1(V)); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DSS1/SEM1 (InterPro:IPR007834); BEST Arabidopsis thaliana protein match is: ATDSS1(I) (ARABIDOPSIS THALIANA DELETION OF SUV3 SUPRESSOR 1(I)) (TAIR:AT1G64750.2); Has 233 Blast hits to 233 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 57; Plants - 43; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G45620 | AT5G45620.1 | CCAAACCGGAAA | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G45620.2 | CCAAACCGGAAA | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G50330 | AT5G50330.1 | CCGGTTTG | ATP binding / protein kinase; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G24810.2); Has 6935 Blast hits to 6926 proteins in 1103 species: Archae - 67; Bacteria - 2625; Metazoa - 354; Fungi - 354; Plants - 343; Viruses - 14; Other Eukaryotes - 3178 (source: NCBI BLink). |
| AT5G50330.2 | CCGGTTTG | ATP binding / protein kinase; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G24810.2); Has 6935 Blast hits to 6926 proteins in 1103 species: Archae - 67; Bacteria - 2625; Metazoa - 354; Fungi - 354; Plants - 343; Viruses - 14; Other Eukaryotes - 3178 (source: NCBI BLink). |
| AT5G51740 | AT5G51740.1 | CAAACCGGCCGGTTAA | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 4555 Blast hits to 4524 proteins in 759 species: Archae - 2; Bacteria - 2617; Metazoa - 54; Fungi - 111; Plants - 18; Viruses - 0; Other Eukaryotes - 1753 (source: NCBI BLink). |
| AT5G53620 | AT5G53620.1 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.2 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.3 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G54900 | AT5G54900.1 | CCAAACCGGTC | RNA-binding protein 45A (ATRBP45A); FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 26274 Blast hits to 15473 proteins in 616 species: Archae - 10; Bacteria - 1663; Metazoa - 15334; Fungi - 2743; Plants - 3912; Viruses - 0; Other Eukaryotes - 2612 (source: NCBI BLink). |
| AT5G56730 | AT5G56730.1 | CAAACCGGAT | peptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: mitochondrion, chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: metalloendopeptidase (TAIR:AT5G42390.1); Has 5686 Blast hits to 5644 proteins in 1211 species: Archae - 12; Bacteria - 3644; Metazoa - 517; Fungi - 231; Plants - 159; Viruses - 3; Other Eukaryotes - 1120 (source: NCBI BLink). |
| AT5G60410 | AT5G60410.1 | CAAACCGGTC | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. |
| AT5G60410.2 | CAAACCGGTC | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. |
| AT5G60410.3 | CAAACCGGTC | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. |
| AT5G60410.4 | CAAACCGGTC | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. |
| AT5G60410.5 | CAAACCGGTC | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. |
| AT5G62390 | AT5G62390.1 | CCAAACCGGAT | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G63870 | AT5G63870.1 | CAAACCGGT | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G63870.1 | TTAAACCGGCCGGTTTGG | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G63870.2 | CAAACCGGT | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G63870.2 | TTAAACCGGCCGGTTTGG | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G63870.3 | CAAACCGGT | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G63870.3 | TTAAACCGGCCGGTTTGG | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G64960 | AT5G64960.1 | TTTAACCGGTTTG | Encodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. |
| AT5G64960.2 | TTTAACCGGTTTG | Encodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. |
| ATMG01370 | ATMG01370.1 | CAAACCGG | hypothetical protein |