| Locus | Gene model | Sequence | Description |
| AT1G01730 | AT1G01730.1 | TGCCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 4; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02000 | AT1G02000.1 | AAAACGGCA | UDP-D-glucuronate 4-epimerase |
| AT1G03310 | AT1G03310.1 | AAAACGGCA | Encodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex. |
| AT1G03310.2 | AAAACGGCA | Encodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex. |
| AT1G06900 | AT1G06900.1 | AAAACGGCA | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding; FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 36095 Blast hits to 16198 proteins in 1364 species: Archae - 66; Bacteria - 4521; Metazoa - 14084; Fungi - 4071; Plants - 1728; Viruses - 678; Other Eukaryotes - 10947 (source: NCBI BLink). |
| AT1G06900.1 | TGCCGTTT | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding; FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 36095 Blast hits to 16198 proteins in 1364 species: Archae - 66; Bacteria - 4521; Metazoa - 14084; Fungi - 4071; Plants - 1728; Viruses - 678; Other Eukaryotes - 10947 (source: NCBI BLink). |
| AT1G10180 | AT1G10180.1 | TGCCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49830.1); Has 70 Blast hits to 70 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G12920 | AT1G12920.1 | TAAACGGCACG | Encodes a eukaryotic release factor one homolog. |
| AT1G14360 | AT1G14360.1 | AAAACGGCA | UDP-GALACTOSE TRANSPORTER 3 (UTR3); FUNCTIONS IN: pyrimidine nucleotide sugar transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: UTR1 (UDP-GALACTOSE TRANSPORTER 1); UDP-galactose transmembrane transporter/ UDP-glucose transmembrane transporter/ pyrimidine nucleotide sugar transmembrane transporter (TAIR:AT2G02810.1); Has 750 Blast hits to 744 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 423; Fungi - 103; Plants - 108; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). |
| AT1G16080 | AT1G16080.1 | TGCCGTTTT | unknown protein; LOCATED IN: apoplast, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 18 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT1G16080.1 | TGCCGTTTT | unknown protein; LOCATED IN: apoplast, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 18 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT1G19710 | AT1G19710.1 | AAACGGCA | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G75420.1); Has 4243 Blast hits to 4240 proteins in 780 species: Archae - 115; Bacteria - 2336; Metazoa - 83; Fungi - 27; Plants - 65; Viruses - 0; Other Eukaryotes - 1617 (source: NCBI BLink). |
| AT1G20960 | AT1G20960.1 | TCAAAACGGCA | embryo defective 1507 (emb1507); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: U5 small nuclear ribonucleoprotein helicase, putative (TAIR:AT2G42270.1); Has 13822 Blast hits to 8453 proteins in 1026 species: Archae - 1055; Bacteria - 3787; Metazoa - 2595; Fungi - 1690; Plants - 529; Viruses - 118; Other Eukaryotes - 4048 (source: NCBI BLink). |
| AT1G21050 | AT1G21050.1 | TGCCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76610.1); Has 134 Blast hits to 134 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 134; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27461 | AT1G27461.1 | AAAACGGCA | unknown protein; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G27680 | AT1G27680.1 | TGCCGTTTT | ADP-glucose pyrophosphorylase catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms of the large subunit (ApL1-4) have been described.Mutational analysis of APS1 suggests that APL1 and APL2 can compensate for loss of APS1 catalytic activity,suggesting both have catalytic as well as regulatory functions. |
| AT1G30130 | AT1G30130.1 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1365 (InterPro:IPR010775); Has 1416 Blast hits to 1416 proteins in 265 species: Archae - 0; Bacteria - 477; Metazoa - 0; Fungi - 4; Plants - 20; Viruses - 0; Other Eukaryotes - 915 (source: NCBI BLink). |
| AT1G30130.2 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1365 (InterPro:IPR010775); Has 1416 Blast hits to 1416 proteins in 265 species: Archae - 0; Bacteria - 477; Metazoa - 0; Fungi - 4; Plants - 20; Viruses - 0; Other Eukaryotes - 915 (source: NCBI BLink). |
| AT1G30500 | AT1G30500.1 | TGCCGTTT | NUCLEAR FACTOR Y, SUBUNIT A7 (NF-YA7); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289); BEST Arabidopsis thaliana protein match is: NF-YA4 (NUCLEAR FACTOR Y, SUBUNIT A4); specific transcriptional repressor/ transcription factor (TAIR:AT2G34720.1); Has 441 Blast hits to 441 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 88; Plants - 215; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G30500.2 | TGCCGTTT | NUCLEAR FACTOR Y, SUBUNIT A7 (NF-YA7); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289); BEST Arabidopsis thaliana protein match is: NF-YA4 (NUCLEAR FACTOR Y, SUBUNIT A4); specific transcriptional repressor/ transcription factor (TAIR:AT2G34720.1); Has 441 Blast hits to 441 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 88; Plants - 215; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G31020 | AT1G31020.1 | TGCCGTTT | Arabidopsis thioredoxin o2 (ATO2); INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATO1 (Arabidopsis thioredoxin O1) (TAIR:AT2G35010.2); Has 8280 Blast hits to 8267 proteins in 1604 species: Archae - 109; Bacteria - 3630; Metazoa - 858; Fungi - 399; Plants - 738; Viruses - 3; Other Eukaryotes - 2543 (source: NCBI BLink). |
| AT1G32730 | AT1G32730.1 | GCCCAAACGGCA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G33260 | AT1G33260.1 | AAAACGGCA | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G10390.1); Has 73899 Blast hits to 73190 proteins in 2186 species: Archae - 51; Bacteria - 6759; Metazoa - 31156; Fungi - 5980; Plants - 17078; Viruses - 326; Other Eukaryotes - 12549 (source: NCBI BLink). |
| AT1G33260.2 | AAAACGGCA | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G10390.1); Has 73899 Blast hits to 73190 proteins in 2186 species: Archae - 51; Bacteria - 6759; Metazoa - 31156; Fungi - 5980; Plants - 17078; Viruses - 326; Other Eukaryotes - 12549 (source: NCBI BLink). |
| AT1G52420 | AT1G52420.1 | TGCCGTTTT | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT3G15940.1); Has 4722 Blast hits to 4718 proteins in 799 species: Archae - 145; Bacteria - 2692; Metazoa - 11; Fungi - 32; Plants - 84; Viruses - 0; Other Eukaryotes - 1758 (source: NCBI BLink). |
| AT1G54070 | AT1G54070.1 | TAAACGGCA | dormancy/auxin associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated family protein (TAIR:AT1G56220.1); Has 105 Blast hits to 105 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G56200 | AT1G56200.1 | CCCACGTGCCGTTT | embryo defective 1303 (emb1303); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G30475.3); Has 46 Blast hits to 46 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 5; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G56200.2 | CCCACGTGCCGTTT | embryo defective 1303 (emb1303); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G30475.3); Has 46 Blast hits to 46 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 5; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G61780 | AT1G61780.1 | AAGGGTATTTGCCGTTTACCGGAAA | postsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G64190 | AT1G64190.1 | AAAACGGCA | 6-phosphogluconate dehydrogenase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to salt stress; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 6-phosphogluconate dehydrogenase, decarboxylating (InterPro:IPR006113), 6-phosphogluconate dehydrogenase, C-terminal (InterPro:IPR006114), 6-phosphogluconate dehydrogenase (InterPro:IPR006183), NAD(P)-binding (InterPro:IPR016040), Fibritin/6-phosphogluconate dehydrogenase, C-terminal extension (InterPro:IPR012284); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase family protein (TAIR:AT5G41670.2); Has 8640 Blast hits to 8571 proteins in 1490 species: Archae - 50; Bacteria - 4787; Metazoa - 524; Fungi - 177; Plants - 212; Viruses - 2; Other Eukaryotes - 2888 (source: NCBI BLink). |
| AT1G67840 | AT1G67840.1 | TGCCGTTTA | Encodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II. |
| AT1G67840.1 | TGCCGTTTA | Encodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II. |
| AT1G67840.2 | TGCCGTTTA | Encodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II. |
| AT1G67840.2 | TGCCGTTTA | Encodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II. |
| AT1G68340 | AT1G68340.1 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25370.1); Has 137 Blast hits to 137 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 135; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G70480 | AT1G70480.1 | AAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT1G70480.2 | AAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT1G70620 | AT1G70620.1 | TGCCGTTT | cyclin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 100267 Blast hits to 50982 proteins in 1689 species: Archae - 87; Bacteria - 8947; Metazoa - 49870; Fungi - 13313; Plants - 8874; Viruses - 1379; Other Eukaryotes - 17797 (source: NCBI BLink). |
| AT1G70620.2 | TGCCGTTT | cyclin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 100267 Blast hits to 50982 proteins in 1689 species: Archae - 87; Bacteria - 8947; Metazoa - 49870; Fungi - 13313; Plants - 8874; Viruses - 1379; Other Eukaryotes - 17797 (source: NCBI BLink). |
| AT1G73650 | AT1G73650.1 | TAAACGGCA | oxidoreductase, acting on the CH-CH group of donors; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104), Protein of unknown function DUF1295 (InterPro:IPR010721); BEST Arabidopsis thaliana protein match is: oxidoreductase, acting on the CH-CH group of donors (TAIR:AT1G18180.1); Has 1671 Blast hits to 1671 proteins in 197 species: Archae - 0; Bacteria - 270; Metazoa - 72; Fungi - 80; Plants - 62; Viruses - 0; Other Eukaryotes - 1187 (source: NCBI BLink). |
| AT1G73650.2 | TAAACGGCA | oxidoreductase, acting on the CH-CH group of donors; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104), Protein of unknown function DUF1295 (InterPro:IPR010721); BEST Arabidopsis thaliana protein match is: oxidoreductase, acting on the CH-CH group of donors (TAIR:AT1G18180.1); Has 1671 Blast hits to 1671 proteins in 197 species: Archae - 0; Bacteria - 270; Metazoa - 72; Fungi - 80; Plants - 62; Viruses - 0; Other Eukaryotes - 1187 (source: NCBI BLink). |
| AT1G73650.3 | TAAACGGCA | oxidoreductase, acting on the CH-CH group of donors; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104), Protein of unknown function DUF1295 (InterPro:IPR010721); BEST Arabidopsis thaliana protein match is: oxidoreductase, acting on the CH-CH group of donors (TAIR:AT1G18180.1); Has 1671 Blast hits to 1671 proteins in 197 species: Archae - 0; Bacteria - 270; Metazoa - 72; Fungi - 80; Plants - 62; Viruses - 0; Other Eukaryotes - 1187 (source: NCBI BLink). |
| AT1G73650.4 | TAAACGGCA | oxidoreductase, acting on the CH-CH group of donors; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104), Protein of unknown function DUF1295 (InterPro:IPR010721); BEST Arabidopsis thaliana protein match is: oxidoreductase, acting on the CH-CH group of donors (TAIR:AT1G18180.1); Has 1671 Blast hits to 1671 proteins in 197 species: Archae - 0; Bacteria - 270; Metazoa - 72; Fungi - 80; Plants - 62; Viruses - 0; Other Eukaryotes - 1187 (source: NCBI BLink). |
| AT1G75180 | AT1G75180.1 | AAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75180.2 | AAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75180.3 | AAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75420 | AT1G75420.1 | AAAACGGCA | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G19710.1); Has 4771 Blast hits to 4769 proteins in 831 species: Archae - 149; Bacteria - 2715; Metazoa - 84; Fungi - 37; Plants - 75; Viruses - 0; Other Eukaryotes - 1711 (source: NCBI BLink). |
| AT1G76050 | AT1G76050.1 | TAAACGGCA | pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink). |
| AT1G76050.2 | TAAACGGCA | pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink). |
| AT2G01090 | AT2G01090.1 | AAACGGCA | ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT1G15120.1); Has 95 Blast hits to 95 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 2; Plants - 49; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT2G01100 | AT2G01100.1 | AAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink). |
| AT2G01100.1 | TAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink). |
| AT2G01100.2 | AAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink). |
| AT2G01100.2 | TAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink). |
| AT2G01100.3 | AAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink). |
| AT2G01100.3 | TAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink). |
| AT2G04780 | AT2G04780.1 | AAAACGGCA | fasciclin-like arabinogalactan-protein 7 (Fla7) |
| AT2G04780.2 | AAAACGGCA | fasciclin-like arabinogalactan-protein 7 (Fla7) |
| AT2G16780 | AT2G16780.1 | AAAACGGCA | Encodes a WD-40 repeat protein similar to yeast MSI1. |
| AT2G17695 | AT2G17695.1 | CGTGCCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 143 Blast hits to 143 proteins in 64 species: Archae - 0; Bacteria - 104; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT2G17695.2 | CGTGCCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 143 Blast hits to 143 proteins in 64 species: Archae - 0; Bacteria - 104; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT2G18250 | AT2G18250.1 | TGCCGTTTT | At2g18250 encodes pantetheine-phosphate adenylyltransferase catalyzing the formation of dephospho-CoA from pantetheine 4'-phosphate. The enzyme is involved in coenzyme A biosynthesis. |
| AT2G18400 | AT2G18400.1 | CGTGCCGTTTT | ribosomal protein L6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: emb2394 (embryo defective 2394); structural constituent of ribosome (TAIR:AT1G05190.1); Has 5053 Blast hits to 5053 proteins in 1481 species: Archae - 1; Bacteria - 2961; Metazoa - 3; Fungi - 77; Plants - 71; Viruses - 0; Other Eukaryotes - 1940 (source: NCBI BLink). |
| AT2G19340 | AT2G19340.1 | AAAACGGCA | membrane protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29870.1); Has 163 Blast hits to 163 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT2G19340.2 | AAAACGGCA | membrane protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29870.1); Has 163 Blast hits to 163 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT2G20360 | AT2G20360.1 | TGCCGTTT | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); Has 3823 Blast hits to 3821 proteins in 711 species: Archae - 40; Bacteria - 1834; Metazoa - 120; Fungi - 89; Plants - 50; Viruses - 0; Other Eukaryotes - 1690 (source: NCBI BLink). |
| AT2G21540 | AT2G21540.1 | AAAACGGCA | SEC14-LIKE 3 (SFH3); FUNCTIONS IN: phosphatidylinositol transporter activity; INVOLVED IN: flower development, transport; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14; phosphatidylinositol transporter (TAIR:AT4G39180.1); Has 2080 Blast hits to 2076 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 815; Fungi - 459; Plants - 466; Viruses - 0; Other Eukaryotes - 340 (source: NCBI BLink). |
| AT2G21540.2 | AAAACGGCA | SEC14-LIKE 3 (SFH3); FUNCTIONS IN: phosphatidylinositol transporter activity; INVOLVED IN: flower development, transport; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14; phosphatidylinositol transporter (TAIR:AT4G39180.1); Has 2080 Blast hits to 2076 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 815; Fungi - 459; Plants - 466; Viruses - 0; Other Eukaryotes - 340 (source: NCBI BLink). |
| AT2G23290 | AT2G23290.1 | AAAACGGCA | Member of the R2R3 factor gene family. |
| AT2G24762 | AT2G24762.1 | TAAACGGCA | Arabidopsis thaliana GLUTAMINE DUMPER 4 (AtGDU4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: GDU1 (GLUTAMINE DUMPER 1) (TAIR:AT4G31730.1); Has 64 Blast hits to 64 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G24970 | AT2G24970.1 | TGCCGTTTAGGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G27250 | AT2G27250.1 | TGCCGTTTT | One of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) is a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline. CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function. |
| AT2G27250.2 | TGCCGTTTT | One of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) is a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline. CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function. |
| AT2G27250.3 | TGCCGTTTT | One of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) is a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline. CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function. |
| AT2G27600 | AT2G27600.1 | AAAACGGCA | Encodes a SKD1 (Suppressor of K+ Transport Growth Defect1) homolog. Localized to the cytoplasm and to multivesicular endosomes. Involved in multivesicular endosome function. |
| AT2G29450 | AT2G29450.1 | AAAACGGCA | Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002) |
| AT2G30840 | AT2G30840.1 | TGCCGTTT | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT2G31710 | AT2G31710.1 | AAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05780.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G36885 | AT2G36885.1 | AAAACGGCAGCGTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT2G36885.2 | AAAACGGCAGCGTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT2G40290 | AT2G40290.1 | TGCCGTTTA | eukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). |
| AT2G40290.2 | TGCCGTTTA | eukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). |
| AT2G40290.3 | TGCCGTTTA | eukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). |
| AT2G40770 | AT2G40770.1 | TGCCGTTTT | ATP binding / DNA binding / helicase/ nucleic acid binding / protein binding / zinc ion binding; FUNCTIONS IN: in 6 functions; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), SNF2-related (InterPro:IPR000330), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: RAD5; ATP binding / ATP-dependent helicase/ DNA binding / helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / protein binding / zinc ion binding (TAIR:AT5G22750.1); Has 13590 Blast hits to 8685 proteins in 812 species: Archae - 59; Bacteria - 2742; Metazoa - 4195; Fungi - 3438; Plants - 951; Viruses - 102; Other Eukaryotes - 2103 (source: NCBI BLink). |
| AT2G40810 | AT2G40810.1 | AAAACGGCACG | AtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT2G40810.2 | AAAACGGCACG | AtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT2G43560 | AT2G43560.1 | TGCCGTTT | immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: FK506-binding protein 1 (FKBP13) (TAIR:AT5G45680.1); Has 6015 Blast hits to 5817 proteins in 1052 species: Archae - 33; Bacteria - 2800; Metazoa - 1234; Fungi - 332; Plants - 391; Viruses - 0; Other Eukaryotes - 1225 (source: NCBI BLink). |
| AT2G43790 | AT2G43790.1 | TGCCGTTT | Encodes a MAP kinase induced by pathogens, ethylene biosynthesis, oxidative stress and osmotic stress.Also involved in ovule development. Homozygous mutants in a MPK3 heterozygous background are female sterile due to defects in integument development. |
| AT2G44270 | AT2G44270.1 | TGCCGTTT | ATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: tRNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Uncharacterised protein family UPF0021 (InterPro:IPR000541), PP-loop (InterPro:IPR011063), 2-thiocytidine tRNA biosynthesis protein, TtcA (InterPro:IPR012089); BEST Arabidopsis thaliana protein match is: ATP binding (TAIR:AT1G76170.1); Has 3072 Blast hits to 3023 proteins in 1040 species: Archae - 205; Bacteria - 2091; Metazoa - 125; Fungi - 122; Plants - 38; Viruses - 0; Other Eukaryotes - 491 (source: NCBI BLink). |
| AT2G44270.1 | TGCCGTTTA | ATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: tRNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Uncharacterised protein family UPF0021 (InterPro:IPR000541), PP-loop (InterPro:IPR011063), 2-thiocytidine tRNA biosynthesis protein, TtcA (InterPro:IPR012089); BEST Arabidopsis thaliana protein match is: ATP binding (TAIR:AT1G76170.1); Has 3072 Blast hits to 3023 proteins in 1040 species: Archae - 205; Bacteria - 2091; Metazoa - 125; Fungi - 122; Plants - 38; Viruses - 0; Other Eukaryotes - 491 (source: NCBI BLink). |
| AT2G46550 | AT2G46550.1 | TGCCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01240.3); Has 47 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G47840 | AT2G47840.1 | AAAACGGCAGCGTTT | tic20 protein-related; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55710.1); Has 272 Blast hits to 272 proteins in 73 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT3G01410 | AT3G01410.1 | TAAACGGCA | RNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink). |
| AT3G01410.2 | TAAACGGCA | RNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink). |
| AT3G01435 | AT3G01435.1 | CGTGCCGTTTTACGTGACA | Expressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 36 Blast hits to 36 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G01440 | AT3G01440.1 | TGTCACGTAAAACGGCACG | oxygen evolving enhancer 3 (PsbQ) family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis, light reaction; LOCATED IN: chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast, oxygen evolving complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbQ (InterPro:IPR008797); BEST Arabidopsis thaliana protein match is: oxygen-evolving enhancer protein 3, chloroplast, putative (PSBQ1) (PSBQ) (TAIR:AT4G21280.2); Has 110 Blast hits to 110 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G02620 | AT3G02620.1 | AAACGGCA | acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-[acyl-carrier-protein] desaturase/ oxidoreductase/ transition metal ion binding (TAIR:AT3G02610.1); Has 576 Blast hits to 573 proteins in 126 species: Archae - 0; Bacteria - 209; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT3G03150 | AT3G03150.1 | AAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03160 | AT3G03160.1 | TGCCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G05710 | AT3G05710.1 | TGCCGTTTT | member of SYP4 Gene Family |
| AT3G05710.2 | TGCCGTTTT | member of SYP4 Gene Family |
| AT3G06050 | AT3G06050.1 | AAAACGGCA | Encodes a mitochondrial matrix localized peroxiredoxin involved in redox homeostasis. Knockout mutants have reduced root growth under certain oxidative stress conditions. |
| AT3G06960 | AT3G06960.1 | AAAACGGCA | PIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06960.2 | AAAACGGCA | PIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G07500 | AT3G07500.1 | CGTGCCGTTT | far-red impaired responsive family protein / FAR1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Transcription factor, FAR1-related (InterPro:IPR004330); BEST Arabidopsis thaliana protein match is: far-red impaired responsive family protein / FAR1 family protein (TAIR:AT2G43280.1); Has 470 Blast hits to 432 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 470; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G07720 | AT3G07720.1 | TGCCGTTTT | kelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: NSP5 (NITRILE SPECIFIER PROTEIN 5) (TAIR:AT5G48180.1); Has 8161 Blast hits to 4457 proteins in 239 species: Archae - 8; Bacteria - 208; Metazoa - 4770; Fungi - 730; Plants - 968; Viruses - 16; Other Eukaryotes - 1461 (source: NCBI BLink). |
| AT3G08590 | AT3G08590.1 | AAACGGCA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G08590.2 | AAACGGCA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G08680 | AT3G08680.1 | TGCCGTTTA | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G58300.2); Has 86665 Blast hits to 68248 proteins in 2030 species: Archae - 34; Bacteria - 5383; Metazoa - 28963; Fungi - 4621; Plants - 36049; Viruses - 327; Other Eukaryotes - 11288 (source: NCBI BLink). |
| AT3G08680.2 | TGCCGTTTA | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G58300.2); Has 86665 Blast hits to 68248 proteins in 2030 species: Archae - 34; Bacteria - 5383; Metazoa - 28963; Fungi - 4621; Plants - 36049; Viruses - 327; Other Eukaryotes - 11288 (source: NCBI BLink). |
| AT3G08950 | AT3G08950.1 | TGCCGTTTT | electron transport SCO1/SenC family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: copper ion transport, respiratory chain complex IV assembly, cellular copper ion homeostasis, cell redox homeostasis; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Synthesis of cytochrome c oxidase, Sco1/Sco2 (InterPro:IPR017276), Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT4G39740.1); Has 3037 Blast hits to 3037 proteins in 688 species: Archae - 11; Bacteria - 1550; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 1204 (source: NCBI BLink). |
| AT3G09090 | AT3G09090.1 | TCAAAACGGCA | Encodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development. |
| AT3G09090.2 | TCAAAACGGCA | Encodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development. |
| AT3G09800 | AT3G09800.1 | AAAACGGCA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT4G08520.1); Has 539 Blast hits to 539 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 100; Plants - 101; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). |
| AT3G09800.1 | AAACGGCA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT4G08520.1); Has 539 Blast hits to 539 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 100; Plants - 101; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). |
| AT3G09800.2 | AAAACGGCA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT4G08520.1); Has 539 Blast hits to 539 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 100; Plants - 101; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). |
| AT3G09800.2 | AAACGGCA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT4G08520.1); Has 539 Blast hits to 539 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 100; Plants - 101; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). |
| AT3G10970 | AT3G10970.1 | AAAACGGCA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G10970.2 | AAAACGGCA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G10970.3 | AAAACGGCA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G12280 | AT3G12280.1 | AAACGGCA | Encodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA. |
| AT3G12290 | AT3G12290.1 | TGCCGTTT | tetrahydrofolate dehydrogenase/cyclohydrolase, putative; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetrahydrofolate dehydrogenase/cyclohydrolase (InterPro:IPR000672), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: tetrahydrofolate dehydrogenase/cyclohydrolase, putative (TAIR:AT4G00620.1); Has 7113 Blast hits to 7108 proteins in 1554 species: Archae - 77; Bacteria - 3117; Metazoa - 345; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 3287 (source: NCBI BLink). |
| AT3G12570 | AT3G12570.1 | AAACGGCA | FYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G12570.2 | AAACGGCA | FYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G12570.3 | AAACGGCA | FYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G12570.4 | AAACGGCA | FYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13845 | AT3G13845.1 | TAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 11 Blast hits to 11 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15040 | AT3G15040.1 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 2804 Blast hits to 412 proteins in 66 species: Archae - 0; Bacteria - 22; Metazoa - 419; Fungi - 51; Plants - 212; Viruses - 0; Other Eukaryotes - 2100 (source: NCBI BLink). |
| AT3G15080 | AT3G15080.1 | AAACGGCAGCGTTTTG | exonuclease family protein; FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1314 Blast hits to 1314 proteins in 179 species: Archae - 0; Bacteria - 14; Metazoa - 651; Fungi - 418; Plants - 111; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). |
| AT3G18830 | AT3G18830.1 | TGCCGTTT | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The AtPLT5 symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (<i>myo</i>-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
| AT3G19150 | AT3G19150.1 | AAAACGGCA | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
| AT3G19150.2 | AAAACGGCA | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
| AT3G20898 | AT3G20898.1 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G51355.1). |
| AT3G22420 | AT3G22420.1 | TGCCGTTTT | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT3G22420.2 | TGCCGTTTT | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT3G27100 | AT3G27100.1 | AAAACGGCACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G27100.1 | AAACGGCACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G27100.1 | TAAACGGCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G27100.2 | AAAACGGCACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G27100.2 | AAACGGCACG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G27100.2 | TAAACGGCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G28100 | AT3G28100.1 | TGCCGTTTT | nodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT3G28070.1); Has 1662 Blast hits to 1653 proteins in 290 species: Archae - 24; Bacteria - 733; Metazoa - 11; Fungi - 3; Plants - 622; Viruses - 0; Other Eukaryotes - 269 (source: NCBI BLink). |
| AT3G44560 | AT3G44560.1 | TGCCGTTTT | FATTY ACID REDUCTASE 8 (FAR8); FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, fatty acyl-CoA reductase (alcohol-forming) activity; INVOLVED IN: microsporogenesis, metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Male sterility (InterPro:IPR004262), NAD(P)-binding (InterPro:IPR016040), Male sterility, NAD-binding (InterPro:IPR013120); BEST Arabidopsis thaliana protein match is: FAR5 (FATTY ACID REDUCTASE 5); binding / catalytic/ oxidoreductase, acting on the CH-CH group of donors (TAIR:AT3G44550.1); Has 1765 Blast hits to 1740 proteins in 316 species: Archae - 0; Bacteria - 436; Metazoa - 870; Fungi - 157; Plants - 137; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink). |
| AT3G46230 | AT3G46230.1 | AAACGGCA | member of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds |
| AT3G48830 | AT3G48830.1 | AAACGGCA | polynucleotide adenylyltransferase family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: polynucleotide adenylyltransferase activity, RNA binding, nucleotide binding, nucleic acid binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Polynucleotide adenylyltransferase region (InterPro:IPR002646), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 8005 Blast hits to 7486 proteins in 1487 species: Archae - 2; Bacteria - 3572; Metazoa - 1145; Fungi - 573; Plants - 347; Viruses - 8; Other Eukaryotes - 2358 (source: NCBI BLink). |
| AT3G49720 | AT3G49720.1 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G49720.2 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G51800 | AT3G51800.1 | AAAACGGCA | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
| AT3G51800.2 | AAAACGGCA | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
| AT3G57780 | AT3G57780.1 | TGCCGTTTT | EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: nucleolar protein gar2-related (TAIR:AT2G42320.2); Has 3024 Blast hits to 2177 proteins in 255 species: Archae - 2; Bacteria - 181; Metazoa - 988; Fungi - 289; Plants - 172; Viruses - 72; Other Eukaryotes - 1320 (source: NCBI BLink). |
| AT3G57800 | AT3G57800.1 | TGCCGTTTT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G57800.2 | TGCCGTTTT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G58270 | AT3G58270.1 | CGTGCCGTTTA | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT3G58270.1 | TGCCGTTT | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT3G58270.2 | CGTGCCGTTTA | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT3G58270.2 | TGCCGTTT | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT3G58570 | AT3G58570.1 | AAAACGGCA | DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 67728 Blast hits to 42681 proteins in 2188 species: Archae - 551; Bacteria - 21719; Metazoa - 21903; Fungi - 5394; Plants - 6790; Viruses - 334; Other Eukaryotes - 11037 (source: NCBI BLink). |
| AT3G60180 | AT3G60180.1 | AACCGCGTGCCGTTTA | uridylate kinase, putative / uridine monophosphate kinase, putative / UMP kinase, putative; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, uridylate kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UMP-CMP kinase (InterPro:IPR006266), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: PYR6; cytidylate kinase/ uridylate kinase (TAIR:AT5G26667.3); Has 8541 Blast hits to 8413 proteins in 1842 species: Archae - 61; Bacteria - 4370; Metazoa - 994; Fungi - 303; Plants - 243; Viruses - 0; Other Eukaryotes - 2570 (source: NCBI BLink). |
| AT3G60180.2 | AACCGCGTGCCGTTTA | uridylate kinase, putative / uridine monophosphate kinase, putative / UMP kinase, putative; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, uridylate kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UMP-CMP kinase (InterPro:IPR006266), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: PYR6; cytidylate kinase/ uridylate kinase (TAIR:AT5G26667.3); Has 8541 Blast hits to 8413 proteins in 1842 species: Archae - 61; Bacteria - 4370; Metazoa - 994; Fungi - 303; Plants - 243; Viruses - 0; Other Eukaryotes - 2570 (source: NCBI BLink). |
| AT3G62080 | AT3G62080.1 | AAACGGCA | SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink). |
| AT4G00530 | AT4G00530.1 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00530.1 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00550 | AT4G00550.1 | AAACGGCA | encodes a UDP-galactose-dependent digalactosyldiacylglycerol(DGDG) synthase. Located in chloroplast outer membrane. |
| AT4G00830 | AT4G00830.1 | AAAACGGCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink). |
| AT4G00830.2 | AAAACGGCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink). |
| AT4G01570 | AT4G01570.1 | AAAACGGCA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62910.1); Has 25223 Blast hits to 5430 proteins in 165 species: Archae - 8; Bacteria - 10; Metazoa - 231; Fungi - 283; Plants - 23698; Viruses - 0; Other Eukaryotes - 993 (source: NCBI BLink). |
| AT4G01710 | AT4G01710.1 | AAACGGCA | belongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome. |
| AT4G01710.1 | CGTGCCGTTTAAGGCC | belongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome. |
| AT4G02080 | AT4G02080.1 | TGCCGTTTT | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT4G09680 | AT4G09680.1 | TAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G09680.2 | TAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G13590 | AT4G13590.1 | TGCCGTTT | unknown protein; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0016 (InterPro:IPR001727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64150.1); Has 1187 Blast hits to 1119 proteins in 441 species: Archae - 10; Bacteria - 644; Metazoa - 134; Fungi - 113; Plants - 109; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT4G14240 | AT4G14240.1 | TGCCGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein-related (TAIR:AT4G14230.1); Has 6770 Blast hits to 6657 proteins in 1347 species: Archae - 62; Bacteria - 4461; Metazoa - 254; Fungi - 179; Plants - 121; Viruses - 0; Other Eukaryotes - 1693 (source: NCBI BLink). |
| AT4G14240.2 | TGCCGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein-related (TAIR:AT4G14230.1); Has 6770 Blast hits to 6657 proteins in 1347 species: Archae - 62; Bacteria - 4461; Metazoa - 254; Fungi - 179; Plants - 121; Viruses - 0; Other Eukaryotes - 1693 (source: NCBI BLink). |
| AT4G16210 | AT4G16210.1 | TGCCGTTTT | ENOYL-COA HYDRATASE/ISOMERASE A (ECHIA); FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Crotonase, core (InterPro:IPR001753); BEST Arabidopsis thaliana protein match is: ECHID (ENOYL-COA HYDRATASE/ISOMERASE D); catalytic/ naphthoate synthase (TAIR:AT1G60550.1); Has 25757 Blast hits to 25754 proteins in 1304 species: Archae - 201; Bacteria - 14217; Metazoa - 1423; Fungi - 585; Plants - 340; Viruses - 0; Other Eukaryotes - 8991 (source: NCBI BLink). |
| AT4G22080 | AT4G22080.1 | TGCCGTTTT | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT4G22090.1); Has 936 Blast hits to 933 proteins in 167 species: Archae - 0; Bacteria - 401; Metazoa - 0; Fungi - 129; Plants - 398; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT4G24050 | AT4G24050.1 | AAAACGGCA | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT1G64590.1); Has 39207 Blast hits to 39168 proteins in 1814 species: Archae - 246; Bacteria - 22794; Metazoa - 3354; Fungi - 2329; Plants - 968; Viruses - 0; Other Eukaryotes - 9516 (source: NCBI BLink). |
| AT4G24090 | AT4G24090.1 | TGCCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 95 Blast hits to 93 proteins in 48 species: Archae - 3; Bacteria - 45; Metazoa - 6; Fungi - 11; Plants - 20; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G25150 | AT4G25150.1 | TAAACGGCA | acid phosphatase, putative; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase (Class B) (InterPro:IPR005519), Vegetative storage protein/acid phosphatase (InterPro:IPR014403), Acid phosphatase, plant (InterPro:IPR010028); BEST Arabidopsis thaliana protein match is: acid phosphatase, putative (TAIR:AT5G51260.1); Has 559 Blast hits to 559 proteins in 162 species: Archae - 0; Bacteria - 269; Metazoa - 2; Fungi - 0; Plants - 241; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT4G25580 | AT4G25580.1 | AAACGGCA | stress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT4G27630 | AT4G27630.2 | AAACGGCA | Encodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG2 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG2 and may act to down-regulate GTG2 binding to ABA. GTG2 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG2 transcript levels do not appear to change in response to ABA or abiotic stresses. |
| AT4G27750 | AT4G27750.1 | TGCCGTTTA | A genetic locus involved in sugar sensing and coordinating carbohydrate synthesis and utilization by the whole plant. Lines carrying mutations in this gene shows restricted carbohydrate allocation to plant growth and seed set, elevated chlorophyll levels, and reduced sugar induction of starch biosynthesis. |
| AT4G29850 | AT4G29850.1 | TGCCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0414 (InterPro:IPR008590); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19350.1); Has 188 Blast hits to 188 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G29860 | AT4G29860.1 | TGCCGTTTT | Encodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development. |
| AT4G29870 | AT4G29870.1 | AAAACGGCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: membrane protein, putative (TAIR:AT2G19340.2); Has 163 Blast hits to 163 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G30580 | AT4G30580.1 | AAAACGGCA | Encodes a plastidic lysophosphatidic acid acyltransferase (LPAAT). Is critical for chloroplasts phosphatidic acid biosynthesis. The null allele is embryo lethal. |
| AT4G33920 | AT4G33920.1 | AAACGGCA | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: mitochondrion, protein serine/threonine phosphatase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51370.1); Has 3521 Blast hits to 3519 proteins in 216 species: Archae - 0; Bacteria - 7; Metazoa - 1157; Fungi - 386; Plants - 1254; Viruses - 3; Other Eukaryotes - 714 (source: NCBI BLink). |
| AT4G35000 | AT4G35000.1 | TGCCGTTTT | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
| AT4G35060 | AT4G35060.1 | TGCCGTTT | heavy-metal-associated domain-containing protein / copper chaperone (CCH)-related; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: ATFP6 (FARNESYLATED PROTEIN 6); metal ion binding (TAIR:AT4G38580.1); Has 574 Blast hits to 548 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 574; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G35530 | AT4G35530.1 | AAAACGGCA | phosphatidylinositolglycan-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 63 Blast hits to 63 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT4G38170 | AT4G38170.1 | AAAACGGCA | FAR1-related sequence 9 (FRS9); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PMZ-type (InterPro:IPR006564), MULE transposase, conserved domain (InterPro:IPR018289), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS5 (FAR1-related sequence 5); zinc ion binding (TAIR:AT4G38180.1); Has 575 Blast hits to 561 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 571; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38170.1 | TGCCGTTTT | FAR1-related sequence 9 (FRS9); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PMZ-type (InterPro:IPR006564), MULE transposase, conserved domain (InterPro:IPR018289), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS5 (FAR1-related sequence 5); zinc ion binding (TAIR:AT4G38180.1); Has 575 Blast hits to 561 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 571; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38260 | AT4G38260.1 | TGCCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF833 (InterPro:IPR008551); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20740.1); Has 805 Blast hits to 805 proteins in 317 species: Archae - 6; Bacteria - 384; Metazoa - 99; Fungi - 74; Plants - 34; Viruses - 4; Other Eukaryotes - 204 (source: NCBI BLink). |
| AT4G38270 | AT4G38270.1 | AAACGGCA | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G38350 | AT4G38350.1 | AAAACGGCA | hedgehog receptor; FUNCTIONS IN: hedgehog receptor activity; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Niemann-Pick C type protein (InterPro:IPR004765), Patched (InterPro:IPR003392), Sterol-sensing 5TM box (InterPro:IPR000731); BEST Arabidopsis thaliana protein match is: patched family protein (TAIR:AT1G42470.1); Has 2232 Blast hits to 1562 proteins in 209 species: Archae - 21; Bacteria - 61; Metazoa - 1525; Fungi - 170; Plants - 105; Viruses - 0; Other Eukaryotes - 350 (source: NCBI BLink). |
| AT4G38350.1 | AAAACGGCA | hedgehog receptor; FUNCTIONS IN: hedgehog receptor activity; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Niemann-Pick C type protein (InterPro:IPR004765), Patched (InterPro:IPR003392), Sterol-sensing 5TM box (InterPro:IPR000731); BEST Arabidopsis thaliana protein match is: patched family protein (TAIR:AT1G42470.1); Has 2232 Blast hits to 1562 proteins in 209 species: Archae - 21; Bacteria - 61; Metazoa - 1525; Fungi - 170; Plants - 105; Viruses - 0; Other Eukaryotes - 350 (source: NCBI BLink). |
| AT4G38360 | AT4G38360.1 | TGCCGTTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G77220.1); Has 605 Blast hits to 598 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 258; Fungi - 128; Plants - 129; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT4G38360.1 | TGCCGTTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G77220.1); Has 605 Blast hits to 598 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 258; Fungi - 128; Plants - 129; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT4G38360.2 | TGCCGTTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G77220.1); Has 605 Blast hits to 598 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 258; Fungi - 128; Plants - 129; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT4G38360.2 | TGCCGTTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G77220.1); Has 605 Blast hits to 598 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 258; Fungi - 128; Plants - 129; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT4G38980 | AT4G38980.1 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 6; Plants - 11; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT4G39300 | AT4G39300.1 | TGCCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G13674.1); Has 64 Blast hits to 64 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G39300.2 | TGCCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G13674.1); Has 64 Blast hits to 64 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G01590 | AT5G01590.1 | AAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 32 proteins in 18 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G03290 | AT5G03290.1 | CGTGCCGTTTA | isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink). |
| AT5G03345 | AT5G03345.1 | TGCCGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Magnesium transporter (InterPro:IPR018937); Has 130 Blast hits to 130 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 98; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G03345.2 | TGCCGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Magnesium transporter (InterPro:IPR018937); Has 130 Blast hits to 130 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 98; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G03560 | AT5G03560.1 | AAAACGGCA | nucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). |
| AT5G03560.1 | TAAACGGCACG | nucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). |
| AT5G03560.2 | AAAACGGCA | nucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). |
| AT5G03560.2 | TAAACGGCACG | nucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). |
| AT5G05370 | AT5G05370.1 | TAAACGGCAGCGTTTTG | ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT3G10860.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G05380 | AT5G05380.1 | CAAAACGCTGCCGTTTA | PRENYLATED RAB ACCEPTOR 1.B3 (PRA1.B3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 371 Blast hits to 371 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 59; Plants - 178; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT5G05750 | AT5G05750.1 | AAAACGGCA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Tetratricopeptide region (InterPro:IPR013026), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT3G57340.2); Has 16636 Blast hits to 16631 proteins in 1960 species: Archae - 118; Bacteria - 5128; Metazoa - 3676; Fungi - 1518; Plants - 1246; Viruses - 21; Other Eukaryotes - 4929 (source: NCBI BLink). |
| AT5G05980 | AT5G05980.2 | CGTGCCGTTT | A. THALIANA DHFS-FPGS HOMOLOG B (ATDFB); FUNCTIONS IN: tetrahydrofolylpolyglutamate synthase activity; INVOLVED IN: one-carbon compound metabolic process; LOCATED IN: chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folylpolyglutamate synthetase, conserved site (InterPro:IPR018109), Mur ligase, central (InterPro:IPR013221), Mur ligase, C-terminal (InterPro:IPR004101), Folylpolyglutamate synthetase (InterPro:IPR001645); BEST Arabidopsis thaliana protein match is: ATDFD (A. THALIANA DHFS-FPGS HOMOLOG D); tetrahydrofolylpolyglutamate synthase (TAIR:AT3G55630.3); Has 5065 Blast hits to 5063 proteins in 1340 species: Archae - 23; Bacteria - 2465; Metazoa - 145; Fungi - 231; Plants - 66; Viruses - 0; Other Eukaryotes - 2135 (source: NCBI BLink). |
| AT5G06660 | AT5G06660.1 | TGCCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF841, eukaryotic (InterPro:IPR008559); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12030.1); Has 193 Blast hits to 193 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT5G08620 | AT5G08620.1 | TGCCGTTTT | Similar in sequence to DEAD-box RNA helicases. Binds RNA. Involved in drought, salt and cold stress responses. |
| AT5G09660 | AT5G09660.1 | TAAACGGCA | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G09660.2 | TAAACGGCA | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G09660.3 | TAAACGGCA | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G09660.4 | TAAACGGCA | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G10700 | AT5G10700.1 | TGCCGTTTA | aminoacyl-tRNA hydrolase/ protein tyrosine phosphatase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity, protein tyrosine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, translation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833), Protein-tyrosine phosphatase, low molecular weight (InterPro:IPR017867); Has 128 Blast hits to 128 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 81; Fungi - 6; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT5G10710 | AT5G10710.1 | TAAACGGCA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10710.2 | TAAACGGCA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G11090 | AT5G11090.1 | AAACGGCA | serine-rich protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G25280.2); Has 1617 Blast hits to 241 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 631; Fungi - 53; Plants - 88; Viruses - 0; Other Eukaryotes - 841 (source: NCBI BLink). |
| AT5G11350 | AT5G11350.1 | AAAACGGCACG | endonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: endonuclease/exonuclease/phosphatase family protein (TAIR:AT1G73875.1); Has 1756 Blast hits to 1474 proteins in 207 species: Archae - 0; Bacteria - 54; Metazoa - 565; Fungi - 336; Plants - 532; Viruses - 4; Other Eukaryotes - 265 (source: NCBI BLink). |
| AT5G11630 | AT5G11630.1 | TGCCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.1); Has 60 Blast hits to 60 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G11630.2 | TGCCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17310.1); Has 60 Blast hits to 60 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G13240 | AT5G13240.1 | AAACGGCACG | transcription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: negative regulation of transcription from RNA polymerase III promoter; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Maf1 regulator (InterPro:IPR015257), RNA polymerase III transcriptional repressor, MAF1 (InterPro:IPR017152); Has 250 Blast hits to 250 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 84; Plants - 23; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT5G13300 | AT5G13300.1 | AAAACGGCA | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. |
| AT5G13610 | AT5G13610.1 | AAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF155 (InterPro:IPR003734); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69380.1); Has 361 Blast hits to 361 proteins in 152 species: Archae - 0; Bacteria - 121; Metazoa - 21; Fungi - 154; Plants - 33; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT5G13610.1 | TGCCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF155 (InterPro:IPR003734); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69380.1); Has 361 Blast hits to 361 proteins in 152 species: Archae - 0; Bacteria - 121; Metazoa - 21; Fungi - 154; Plants - 33; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT5G14270 | AT5G14270.1 | AAAACGGCA | Arabidopsis thaliana Bromodomain and Extraterminal Domain protein 9 (ATBET9); FUNCTIONS IN: DNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: ATBET10 (Arabidopsis thaliana BROMODOMAIN AND EXTRATERMINAL DOMAIN PROTEIN 10); DNA binding (TAIR:AT3G01770.1); Has 11908 Blast hits to 8459 proteins in 740 species: Archae - 12; Bacteria - 1993; Metazoa - 4437; Fungi - 1386; Plants - 593; Viruses - 35; Other Eukaryotes - 3452 (source: NCBI BLink). |
| AT5G14440 | AT5G14440.1 | AAAACGGCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). |
| AT5G14440.2 | AAAACGGCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). |
| AT5G17280 | AT5G17280.1 | CGTGCCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 223 Blast hits to 223 proteins in 123 species: Archae - 0; Bacteria - 72; Metazoa - 36; Fungi - 80; Plants - 15; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G17280.1 | CGTGCCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 223 Blast hits to 223 proteins in 123 species: Archae - 0; Bacteria - 72; Metazoa - 36; Fungi - 80; Plants - 15; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G18040 | AT5G18040.1 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18065.1); Has 34 Blast hits to 34 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G23690 | AT5G23690.1 | AAAACGGCA | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G48830.1); Has 6038 Blast hits to 6036 proteins in 1422 species: Archae - 2; Bacteria - 3565; Metazoa - 113; Fungi - 169; Plants - 55; Viruses - 8; Other Eukaryotes - 2126 (source: NCBI BLink). |
| AT5G24870 | AT5G24870.1 | TGCCGTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G10650.2); Has 11110 Blast hits to 7088 proteins in 293 species: Archae - 2; Bacteria - 535; Metazoa - 3276; Fungi - 754; Plants - 2441; Viruses - 55; Other Eukaryotes - 4047 (source: NCBI BLink). |
| AT5G24870.2 | TGCCGTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G10650.2); Has 11110 Blast hits to 7088 proteins in 293 species: Archae - 2; Bacteria - 535; Metazoa - 3276; Fungi - 754; Plants - 2441; Viruses - 55; Other Eukaryotes - 4047 (source: NCBI BLink). |
| AT5G26160 | AT5G26160.1 | TGCCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20610.1); Has 138 Blast hits to 117 proteins in 36 species: Archae - 0; Bacteria - 14; Metazoa - 25; Fungi - 15; Plants - 62; Viruses - 2; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G26980 | AT5G26980.1 | TGCCGTTTA | member of SYP4 Gene Family |
| AT5G26980.2 | TGCCGTTTA | member of SYP4 Gene Family |
| AT5G30510 | AT5G30510.1 | AAAACGGCA | RIBOSOMAL PROTEIN S1 (RPS1); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S1 (InterPro:IPR000110), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT1G71720.1); Has 17303 Blast hits to 11893 proteins in 1518 species: Archae - 42; Bacteria - 10843; Metazoa - 147; Fungi - 116; Plants - 199; Viruses - 0; Other Eukaryotes - 5956 (source: NCBI BLink). |
| AT5G39950 | AT5G39950.1 | AAACGGCACG | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
| AT5G40670 | AT5G40670.1 | TCAAAACGGCA | PQ-loop repeat family protein / transmembrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Lysosomal cystine transporter (InterPro:IPR005282); Has 261 Blast hits to 261 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 89; Plants - 21; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT5G41210 | AT5G41210.1 | AAAACGGCACG | Encodes glutathione transferase belonging to the theta class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G42080 | AT5G42080.1 | TGCCGTTT | Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. |
| AT5G42080.2 | TGCCGTTT | Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. |
| AT5G42130 | AT5G42130.1 | TAAACGGCA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SAMC1 (S-ADENOSYLMETHIONINE CARRIER 1); S-adenosylmethionine transmembrane transporter/ binding (TAIR:AT4G39460.1); Has 17455 Blast hits to 9853 proteins in 357 species: Archae - 0; Bacteria - 0; Metazoa - 8573; Fungi - 4742; Plants - 2529; Viruses - 0; Other Eukaryotes - 1611 (source: NCBI BLink). |
| AT5G42130.1 | TGCCGTTTA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SAMC1 (S-ADENOSYLMETHIONINE CARRIER 1); S-adenosylmethionine transmembrane transporter/ binding (TAIR:AT4G39460.1); Has 17455 Blast hits to 9853 proteins in 357 species: Archae - 0; Bacteria - 0; Metazoa - 8573; Fungi - 4742; Plants - 2529; Viruses - 0; Other Eukaryotes - 1611 (source: NCBI BLink). |
| AT5G42130.1 | TGCCGTTTA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SAMC1 (S-ADENOSYLMETHIONINE CARRIER 1); S-adenosylmethionine transmembrane transporter/ binding (TAIR:AT4G39460.1); Has 17455 Blast hits to 9853 proteins in 357 species: Archae - 0; Bacteria - 0; Metazoa - 8573; Fungi - 4742; Plants - 2529; Viruses - 0; Other Eukaryotes - 1611 (source: NCBI BLink). |
| AT5G44240 | AT5G44240.1 | AAAACGGCA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism; INVOLVED IN: metabolic process, phospholipid transport, ATP biosynthetic process; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, phospholipid-translocating, flippase (InterPro:IPR006539), ATPase, P-type, ATPase-associated region (InterPro:IPR008250), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type phosphorylation site (InterPro:IPR018303); BEST Arabidopsis thaliana protein match is: ALA1 (aminophospholipid ATPase1); ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT5G04930.1); Has 9949 Blast hits to 8972 proteins in 1138 species: Archae - 116; Bacteria - 2826; Metazoa - 3155; Fungi - 1606; Plants - 562; Viruses - 3; Other Eukaryotes - 1681 (source: NCBI BLink). |
| AT5G45410 | AT5G45410.1 | TAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G45410.2 | TAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G45410.3 | TAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G49830 | AT5G49830.1 | TGCCGTTTA | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10385.1). |
| AT5G49830.2 | TGCCGTTTA | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10385.1). |
| AT5G49830.3 | TGCCGTTTA | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10385.1). |
| AT5G56210 | AT5G56210.1 | AAAACGGCA | WPP-domain Interacting Protein 2 (WIP2); FUNCTIONS IN: protein heterodimerization activity, protein homodimerization activity; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope, cell plate; EXPRESSED IN: root; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 2090 Blast hits to 1631 proteins in 257 species: Archae - 16; Bacteria - 128; Metazoa - 915; Fungi - 176; Plants - 118; Viruses - 11; Other Eukaryotes - 726 (source: NCBI BLink). |
| AT5G57330 | AT5G57330.1 | AAAACGGCA | aldose 1-epimerase family protein; FUNCTIONS IN: isomerase activity, carbohydrate binding, aldose 1-epimerase activity, catalytic activity; INVOLVED IN: galactose metabolic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Aldose 1-epimerase (InterPro:IPR008183), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718); BEST Arabidopsis thaliana protein match is: aldose 1-epimerase family protein (TAIR:AT3G61610.1); Has 1232 Blast hits to 1231 proteins in 480 species: Archae - 0; Bacteria - 793; Metazoa - 38; Fungi - 84; Plants - 141; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink). |
| AT5G57685 | AT5G57685.1 | AAACGGCA | Arabidopsis thaliana GLUTAMINE DUMPER 3 (AtGDU3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: secretion by cell; LOCATED IN: integral to membrane; BEST Arabidopsis thaliana protein match is: AtGDU2 (Arabidopsis thaliana GLUTAMINE DUMPER 2) (TAIR:AT4G25760.1); Has 63 Blast hits to 63 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G58490 | AT5G58490.1 | CGTGCCGTTT | cinnamoyl-CoA reductase family; FUNCTIONS IN: 3-beta-hydroxy-delta5-steroid dehydrogenase activity, binding, cinnamoyl-CoA reductase activity, catalytic activity; INVOLVED IN: lignin biosynthetic process, steroid biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-beta hydroxysteroid dehydrogenase/isomerase (InterPro:IPR002225), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: cinnamoyl-CoA reductase family (TAIR:AT2G02400.1); Has 8253 Blast hits to 8243 proteins in 1158 species: Archae - 140; Bacteria - 2986; Metazoa - 418; Fungi - 574; Plants - 1442; Viruses - 7; Other Eukaryotes - 2686 (source: NCBI BLink). |
| AT5G58510 | AT5G58510.1 | AAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55060.1); Has 187 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 2; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT5G58510.1 | TGCCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55060.1); Has 187 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 2; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT5G58740 | AT5G58740.1 | AAAACGGCA | nuclear movement family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: nuclear movement family protein (TAIR:AT4G27890.1); Has 486 Blast hits to 486 proteins in 134 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 46; Plants - 71; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink). |
| AT5G58920 | AT5G58920.1 | TAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G61580 | AT5G61580.1 | TAAACGGCACG | PHOSPHOFRUCTOKINASE 4 (PFK4); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: 6-phosphofructokinase complex, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK3 (PHOSPHOFRUCTOKINASE 3); 6-phosphofructokinase (TAIR:AT4G26270.1); Has 4811 Blast hits to 4479 proteins in 1155 species: Archae - 20; Bacteria - 2585; Metazoa - 536; Fungi - 204; Plants - 225; Viruses - 2; Other Eukaryotes - 1239 (source: NCBI BLink). |
| AT5G61580.2 | TAAACGGCACG | PHOSPHOFRUCTOKINASE 4 (PFK4); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: 6-phosphofructokinase complex, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK3 (PHOSPHOFRUCTOKINASE 3); 6-phosphofructokinase (TAIR:AT4G26270.1); Has 4811 Blast hits to 4479 proteins in 1155 species: Archae - 20; Bacteria - 2585; Metazoa - 536; Fungi - 204; Plants - 225; Viruses - 2; Other Eukaryotes - 1239 (source: NCBI BLink). |
| AT5G62190 | AT5G62190.1 | TAAACGGCA | DEAD/DEAH box RNA helicase PRH75 |
| AT5G63630 | AT5G63630.1 | AAAACGACATGCCGTTTT | DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase (RH26) (TAIR:AT5G08610.1); Has 27043 Blast hits to 26460 proteins in 1692 species: Archae - 431; Bacteria - 10802; Metazoa - 5031; Fungi - 3249; Plants - 1370; Viruses - 10; Other Eukaryotes - 6150 (source: NCBI BLink). |
| AT5G65810 | AT5G65810.1 | AAAACGGCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49720.2); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G66030 | AT5G66030.1 | AAAACGGCA | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization. |
| AT5G66030.2 | AAAACGGCA | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization. |
| AT5G66040 | AT5G66040.2 | TGCCGTTTT | SULFURTRANSFERASE PROTEIN 16 (STR16); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: aging; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: SEN1 (SENESCENCE 1) (TAIR:AT4G35770.1); Has 2229 Blast hits to 2226 proteins in 583 species: Archae - 32; Bacteria - 1489; Metazoa - 53; Fungi - 31; Plants - 139; Viruses - 0; Other Eukaryotes - 485 (source: NCBI BLink). |
| AT5G66120 | AT5G66120.1 | AAACGGCA | 3-dehydroquinate synthase, putative; FUNCTIONS IN: 3-dehydroquinate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 3-dehydroquinate synthase AroB, subgroup (InterPro:IPR016037), 3-dehydroquinate synthase AroB (InterPro:IPR002658); Has 5882 Blast hits to 5880 proteins in 1401 species: Archae - 124; Bacteria - 2775; Metazoa - 7; Fungi - 133; Plants - 27; Viruses - 2; Other Eukaryotes - 2814 (source: NCBI BLink). |
| AT5G66120.2 | AAACGGCA | 3-dehydroquinate synthase, putative; FUNCTIONS IN: 3-dehydroquinate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 3-dehydroquinate synthase AroB, subgroup (InterPro:IPR016037), 3-dehydroquinate synthase AroB (InterPro:IPR002658); Has 5882 Blast hits to 5880 proteins in 1401 species: Archae - 124; Bacteria - 2775; Metazoa - 7; Fungi - 133; Plants - 27; Viruses - 2; Other Eukaryotes - 2814 (source: NCBI BLink). |
| AT5G66130 | AT5G66130.1 | TGCCGTTT | Encodes a homolog to yeast RAD17. Involved in the regulation of DNA damage repair and homologous recombination. Mutant has increased sensitivity to MMS and increased telomere lengths. |
| AT5G66290 | AT5G66290.1 | AAAACGGCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G66320 | AT5G66320.1 | TGCCGTTTT | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
| AT5G66320.2 | TGCCGTTTT | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
| AT5G66510 | AT5G66510.1 | TGCCGTTT | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
| AT5G66510.2 | TGCCGTTT | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
| AT5G66520 | AT5G66520.1 | AAACGGCA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G06540.1); Has 14737 Blast hits to 5344 proteins in 184 species: Archae - 1; Bacteria - 4; Metazoa - 109; Fungi - 73; Plants - 14158; Viruses - 0; Other Eukaryotes - 392 (source: NCBI BLink). |
| AT5G67510 | AT5G67510.1 | AAACGGCAGCGTTT | 60S ribosomal protein L26 (RPL26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26A) (TAIR:AT3G49910.1); Has 893 Blast hits to 893 proteins in 319 species: Archae - 233; Bacteria - 15; Metazoa - 308; Fungi - 91; Plants - 68; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). |