| Locus | Gene model | Sequence | Description |
| AT1G04130 | AT1G04130.1 | ATAACCGGT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase-related (TAIR:AT1G56440.1); Has 3930 Blast hits to 3426 proteins in 259 species: Archae - 8; Bacteria - 133; Metazoa - 1878; Fungi - 572; Plants - 573; Viruses - 0; Other Eukaryotes - 766 (source: NCBI BLink). |
| AT1G05360 | AT1G05360.1 | ATAACCGGTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT1G05430 | AT1G05430.1 | ACCGGTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G06690 | AT1G06690.1 | ACCGGTTAT | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity, ATPase activity, ATP binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT5G53580.1); Has 18029 Blast hits to 18016 proteins in 1454 species: Archae - 258; Bacteria - 9842; Metazoa - 1647; Fungi - 1390; Plants - 743; Viruses - 0; Other Eukaryotes - 4149 (source: NCBI BLink). |
| AT1G07510 | AT1G07510.1 | ATAACCGGT | encodes an FtsH protease that is localized to the mitochondrion |
| AT1G08030 | AT1G08030.1 | ATAACCGGTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 11 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G08490 | AT1G08490.1 | TTTAACCGGTTTG | Chloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation. |
| AT1G09190 | AT1G09190.1 | TTTAACCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: shoot apex, sperm cell, embryo, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G56310.1); Has 12606 Blast hits to 4809 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 33; Plants - 12368; Viruses - 0; Other Eukaryotes - 192 (source: NCBI BLink). |
| AT1G11710 | AT1G11710.1 | CTTAACCGGTC | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G01110.1); Has 19625 Blast hits to 5674 proteins in 176 species: Archae - 2; Bacteria - 23; Metazoa - 403; Fungi - 262; Plants - 18143; Viruses - 0; Other Eukaryotes - 792 (source: NCBI BLink). |
| AT1G13670 | AT1G13670.1 | TTAACCGGTTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: petal, inflorescence meristem, hypocotyl, flower, root; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G16010 | AT1G16010.1 | ATAACCGGT | magnesium transporter CorA-like family protein (MRS2-1); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MGT1) (MRS2) (TAIR:AT1G80900.1); Has 465 Blast hits to 459 proteins in 113 species: Archae - 2; Bacteria - 12; Metazoa - 57; Fungi - 136; Plants - 199; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT1G16010.2 | ATAACCGGT | magnesium transporter CorA-like family protein (MRS2-1); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MGT1) (MRS2) (TAIR:AT1G80900.1); Has 465 Blast hits to 459 proteins in 113 species: Archae - 2; Bacteria - 12; Metazoa - 57; Fungi - 136; Plants - 199; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT1G16020 | AT1G16020.1 | CTTAACCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G16020.2 | CTTAACCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G16700 | AT1G16700.1 | ATAACCGGTTTG | NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY) (TAIR:AT1G79010.1); Has 7775 Blast hits to 7384 proteins in 1556 species: Archae - 918; Bacteria - 3928; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink). |
| AT1G18150 | AT1G18150.1 | TTAACCGGTATA | ATMPK8, |
| AT1G18150.2 | TTAACCGGTATA | ATMPK8, |
| AT1G19990 | AT1G19990.1 | TTTAACCGGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11600.1); Has 10416 Blast hits to 6328 proteins in 368 species: Archae - 4; Bacteria - 381; Metazoa - 4559; Fungi - 839; Plants - 384; Viruses - 34; Other Eukaryotes - 4215 (source: NCBI BLink). |
| AT1G20220 | AT1G20220.1 | TTTAACCGGTTTAA | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G76010.1); Has 42345 Blast hits to 16680 proteins in 1015 species: Archae - 19; Bacteria - 12355; Metazoa - 15425; Fungi - 3233; Plants - 4676; Viruses - 581; Other Eukaryotes - 6056 (source: NCBI BLink). |
| AT1G20770 | AT1G20770.1 | ATAACCGGTTTGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G20780 | AT1G20780.1 | TTCGGGTCAAACCGGTTAT | Encodes a protein containing a U-box and an ARM domain. |
| AT1G21010 | AT1G21010.1 | TTAAACCGTAACCGGTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76600.1); Has 113 Blast hits to 113 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 113; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G22310 | AT1G22310.1 | ATAACCGGTTTAA | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT1G22310.2 | ATAACCGGTTTAA | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT1G22960 | AT1G22960.1 | TTTAACCGGTC | pentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 24639 Blast hits to 6022 proteins in 188 species: Archae - 4; Bacteria - 28; Metazoa - 847; Fungi - 689; Plants - 21875; Viruses - 0; Other Eukaryotes - 1196 (source: NCBI BLink). |
| AT1G27650 | AT1G27650.1 | TTAACCGGTTCAA | U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions. |
| AT1G27650.2 | TTAACCGGTTCAA | U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions. |
| AT1G30230 | AT1G30230.1 | CTTAACCGGTTTAT | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G30230.2 | CTTAACCGGTTTAT | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G31180 | AT1G31180.1 | ATAACCGGTC | The AtIMD3 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. |
| AT1G31190 | AT1G31190.1 | GACCGGTTAT | Encodes a myo-inositol monophosphatase IMPL1 (myo-Inositol monophosphatase like 1). |
| AT1G33265 | AT1G33265.1 | TAACCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); Has 119 Blast hits to 119 proteins in 43 species: Archae - 0; Bacteria - 27; Metazoa - 33; Fungi - 2; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G33400 | AT1G33400.1 | ACCGGTTAAA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), SET (InterPro:IPR001214), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 5453 Blast hits to 4652 proteins in 333 species: Archae - 109; Bacteria - 690; Metazoa - 2585; Fungi - 539; Plants - 720; Viruses - 0; Other Eukaryotes - 810 (source: NCBI BLink). |
| AT1G35580 | AT1G35580.1 | ACCGGTTATAACCGGT | Encodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. |
| AT1G35580.2 | ACCGGTTATAACCGGT | Encodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. |
| AT1G35580.3 | ACCGGTTATAACCGGT | Encodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. |
| AT1G48450 | AT1G48450.1 | TAACCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G48450.2 | TAACCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G48460 | AT1G48460.1 | TTAAACCGGTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63040.2); Has 36 Blast hits to 36 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G48860 | AT1G48860.1 | ATAACCGGTATGGCCCAAG | 3-phosphoshikimate 1-carboxyvinyltransferase, putative / 5-enolpyruvylshikimate-3-phosphate, putative / EPSP synthase, putative; FUNCTIONS IN: 3-phosphoshikimate 1-carboxyvinyltransferase activity, catalytic activity, transferase activity, transferring alkyl or aryl (other than methyl) groups; INVOLVED IN: glyphosate metabolic process, aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: 3-phosphoshikimate 1-carboxyvinyltransferase, core (InterPro:IPR001986), 3-phosphoshikimate 1-carboxyvinyltransferase, subgroup (InterPro:IPR006264), RNA 3'-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta (InterPro:IPR013792); BEST Arabidopsis thaliana protein match is: 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase (TAIR:AT2G45300.1); Has 9038 Blast hits to 9035 proteins in 1558 species: Archae - 140; Bacteria - 5092; Metazoa - 4; Fungi - 108; Plants - 172; Viruses - 0; Other Eukaryotes - 3522 (source: NCBI BLink). |
| AT1G48860.2 | ATAACCGGTATGGCCCAAG | 3-phosphoshikimate 1-carboxyvinyltransferase, putative / 5-enolpyruvylshikimate-3-phosphate, putative / EPSP synthase, putative; FUNCTIONS IN: 3-phosphoshikimate 1-carboxyvinyltransferase activity, catalytic activity, transferase activity, transferring alkyl or aryl (other than methyl) groups; INVOLVED IN: glyphosate metabolic process, aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: 3-phosphoshikimate 1-carboxyvinyltransferase, core (InterPro:IPR001986), 3-phosphoshikimate 1-carboxyvinyltransferase, subgroup (InterPro:IPR006264), RNA 3'-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta (InterPro:IPR013792); BEST Arabidopsis thaliana protein match is: 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase (TAIR:AT2G45300.1); Has 9038 Blast hits to 9035 proteins in 1558 species: Archae - 140; Bacteria - 5092; Metazoa - 4; Fungi - 108; Plants - 172; Viruses - 0; Other Eukaryotes - 3522 (source: NCBI BLink). |
| AT1G48900 | AT1G48900.1 | TAACCGGTACCGGTTT | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink). |
| AT1G48900.2 | TAACCGGTACCGGTTT | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink). |
| AT1G49340 | AT1G49340.1 | GACCGGTTAT | Encodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots. |
| AT1G49340.2 | GACCGGTTAT | Encodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots. |
| AT1G56280 | AT1G56280.1 | TTAACCGGTC | Encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The increase in transcript level is independent from abscisic acid level. Sequence is not similar to any protein of known function. It appears to be a member of plant-specific gene family. It's phosphorylated by AtCPK11 in a Ca(2+)-dependent manner at Thr105 and Ser107 within the AtDi19 bipartite nuclear localization signal |
| AT1G56290 | AT1G56290.1 | GACCGGTTAA | CwfJ-like family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein / zinc finger (CCCH-type) family protein (TAIR:AT5G56900.2); Has 2202 Blast hits to 1747 proteins in 222 species: Archae - 2; Bacteria - 25; Metazoa - 988; Fungi - 216; Plants - 103; Viruses - 2; Other Eukaryotes - 866 (source: NCBI BLink). |
| AT1G56290.1 | GACCGGTTAT | CwfJ-like family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein / zinc finger (CCCH-type) family protein (TAIR:AT5G56900.2); Has 2202 Blast hits to 1747 proteins in 222 species: Archae - 2; Bacteria - 25; Metazoa - 988; Fungi - 216; Plants - 103; Viruses - 2; Other Eukaryotes - 866 (source: NCBI BLink). |
| AT1G60380 | AT1G60380.1 | ACCGGTTA | apical meristem formation protein-related; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac024 (Arabidopsis NAC domain containing protein 24); transcription factor (TAIR:AT1G60350.1); Has 227 Blast hits to 222 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 227; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G65020 | AT1G65020.1 | AAAACCGGTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NERD (InterPro:IPR011528); Has 53 Blast hits to 53 proteins in 19 species: Archae - 0; Bacteria - 18; Metazoa - 9; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G65030 | AT1G65030.1 | TAACCGGTTTT | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT1G67790 | AT1G67790.1 | ATAACCGGTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf apex, hypocotyl, flower; EXPRESSED DURING: petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01670.1); Has 98 Blast hits to 57 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G70700 | AT1G70700.1 | TTAACCGGTTTAA | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT1G70700.2 | TTAACCGGTTTAA | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT1G70710 | AT1G70710.1 | ACCGGTTAT | endo-1,4-beta-glucanase. Involved in cell elongation. |
| AT1G73090 | AT1G73090.1 | ACCGGTTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75670 | AT1G75670.1 | GACCGGTTA | DNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G75670.2 | GACCGGTTA | DNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G80910 | AT1G80910.1 | ATAACCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16020.2); Has 140 Blast hits to 140 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT2G03000 | AT2G03000.1 | ATAACCGGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14200.1); Has 26327 Blast hits to 13071 proteins in 591 species: Archae - 30; Bacteria - 2310; Metazoa - 9727; Fungi - 4737; Plants - 2646; Viruses - 535; Other Eukaryotes - 6342 (source: NCBI BLink). |
| AT2G03440 | AT2G03440.1 | GACCGGTTAT | Induced at the transcriptional level by Pseudomonas syringae pv. tomato infection. |
| AT2G03470 | AT2G03470.1 | TTCGGTTTATAAACCGGTTAA | myb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink). |
| AT2G03470.2 | TTCGGTTTATAAACCGGTTAA | myb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink). |
| AT2G04230 | AT2G04230.1 | TTAACCGGTC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G49030.1); Has 1566 Blast hits to 1530 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 1562; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G13560 | AT2G13560.1 | ACGGTTTACTTAACCGGTTC | malate oxidoreductase, putative; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor, malic enzyme activity, ATP binding; INVOLVED IN: response to salt stress, malate metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Malic oxidoreductase (InterPro:IPR001891), Malic enzyme, NAD-binding (InterPro:IPR012302), Malic enzyme, conserved site (InterPro:IPR015884), Malic enzyme, N-terminal (InterPro:IPR012301), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: malate oxidoreductase, putative (TAIR:AT4G00570.1); Has 5981 Blast hits to 5971 proteins in 1332 species: Archae - 86; Bacteria - 3249; Metazoa - 553; Fungi - 152; Plants - 269; Viruses - 0; Other Eukaryotes - 1672 (source: NCBI BLink). |
| AT2G14910 | AT2G14910.1 | ATAACCGGTC | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14970.1); Has 495 Blast hits to 336 proteins in 81 species: Archae - 0; Bacteria - 243; Metazoa - 19; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink). |
| AT2G14910.2 | ATAACCGGTC | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14970.1); Has 495 Blast hits to 336 proteins in 81 species: Archae - 0; Bacteria - 243; Metazoa - 19; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink). |
| AT2G21340 | AT2G21340.1 | TAACCGGTTA | antiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: EDS5 (ENHANCED DISEASE SUSCEPTIBILITY 5); antiporter/ multidrug efflux pump/ transporter (TAIR:AT4G39030.1); Has 4153 Blast hits to 4145 proteins in 897 species: Archae - 89; Bacteria - 3108; Metazoa - 25; Fungi - 26; Plants - 225; Viruses - 0; Other Eukaryotes - 680 (source: NCBI BLink). |
| AT2G21340.2 | TAACCGGTTA | antiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: EDS5 (ENHANCED DISEASE SUSCEPTIBILITY 5); antiporter/ multidrug efflux pump/ transporter (TAIR:AT4G39030.1); Has 4153 Blast hits to 4145 proteins in 897 species: Archae - 89; Bacteria - 3108; Metazoa - 25; Fungi - 26; Plants - 225; Viruses - 0; Other Eukaryotes - 680 (source: NCBI BLink). |
| AT2G21500 | AT2G21500.1 | TTTAACCGGT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT2G21500.2 | TTTAACCGGT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT2G21510 | AT2G21510.1 | TTAACCGGT | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT4G39150.1); Has 16200 Blast hits to 16136 proteins in 1943 species: Archae - 111; Bacteria - 5305; Metazoa - 3371; Fungi - 1470; Plants - 1201; Viruses - 18; Other Eukaryotes - 4724 (source: NCBI BLink). |
| AT2G26810 | AT2G26810.1 | CAAACCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT2G26810.2 | CAAACCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT2G26810.3 | CAAACCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT2G27830 | AT2G27830.1 | ACCGGTTAAA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G22760.1); Has 68 Blast hits to 68 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G27960 | AT2G27960.1 | TAACCGGTTTAT | catalytic subunit of cyclin dependent kinase 1. physically interact with cyclin-dependent kinases (CDKs) and play an essential, but yet not entirely resolved, role in the regulation of the cell cycle |
| AT2G31725 | AT2G31725.1 | TTAACCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05730.1); Has 199 Blast hits to 199 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT2G32690 | AT2G32690.1 | AAAACCGGTTAT | Glycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. |
| AT2G32690.2 | AAAACCGGTTAT | Glycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. |
| AT2G32690.3 | AAAACCGGTTAT | Glycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. |
| AT2G32690.4 | AAAACCGGTTAT | Glycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid. |
| AT2G36000 | AT2G36000.1 | ATAAACCGGTTAAA | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT2G36000.2 | ATAAACCGGTTAAA | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT2G36830 | AT2G36830.1 | TAACCGGTC | encodes a tonoplast intrinsic protein, which functions as water channel. highly expressed in root, stem, cauline leaves and flowers. Complete knock out mutants have no detectable phenotype from the wild type. |
| AT2G42070 | AT2G42070.1 | TGAACCGGTTAA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 23 (ATNUDX23); FUNCTIONS IN: hydrolase activity, FAD diphosphatase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 4344 Blast hits to 4344 proteins in 924 species: Archae - 91; Bacteria - 3112; Metazoa - 94; Fungi - 31; Plants - 36; Viruses - 0; Other Eukaryotes - 980 (source: NCBI BLink). |
| AT2G42370 | AT2G42370.1 | ACCGGTTAT | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58110.1); Has 174 Blast hits to 159 proteins in 47 species: Archae - 3; Bacteria - 17; Metazoa - 67; Fungi - 5; Plants - 22; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G44870 | AT2G44870.1 | TTAACCGGTTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G46260 | AT2G46260.1 | CCAAACCGGTTAAA | BTB/POZ domain-containing protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: ATPOB1; protein binding (TAIR:AT3G61600.1); Has 3167 Blast hits to 3141 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 3012; Fungi - 0; Plants - 79; Viruses - 9; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT2G46330 | AT2G46330.1 | ATAACCGGT | Encodes arabinogalactan protein (AGP16). |
| AT2G46330.1 | TTTAACCGGTC | Encodes arabinogalactan protein (AGP16). |
| AT2G46330.2 | ATAACCGGT | Encodes arabinogalactan protein (AGP16). |
| AT2G46330.2 | TTTAACCGGTC | Encodes arabinogalactan protein (AGP16). |
| AT2G46900 | AT2G46900.1 | ACCGGTTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix, Nulp1-type (InterPro:IPR006994); Has 3014 Blast hits to 2357 proteins in 239 species: Archae - 2; Bacteria - 96; Metazoa - 1166; Fungi - 321; Plants - 100; Viruses - 47; Other Eukaryotes - 1282 (source: NCBI BLink). |
| AT3G01800 | AT3G01800.1 | ACCGGTTA | ribosome recycling factor family protein / ribosome releasing factor family protein; INVOLVED IN: translation; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosome recycling factor, bacterial-like (InterPro:IPR015998), Ribosome recycling factor (InterPro:IPR002661); BEST Arabidopsis thaliana protein match is: RRF (RIBOSOME RECYCLING FACTOR, CHLOROPLAST PRECURSOR) (TAIR:AT3G63190.1); Has 5299 Blast hits to 5299 proteins in 1469 species: Archae - 0; Bacteria - 2911; Metazoa - 102; Fungi - 44; Plants - 57; Viruses - 0; Other Eukaryotes - 2185 (source: NCBI BLink). |
| AT3G02660 | AT3G02660.1 | ACCGGTTAT | EMBRYO DEFECTIVE 2768 (emb2768); FUNCTIONS IN: RNA binding, tyrosine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), RNA-binding S4 (InterPro:IPR002942), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 6358 Blast hits to 6354 proteins in 1524 species: Archae - 11; Bacteria - 2982; Metazoa - 99; Fungi - 101; Plants - 19; Viruses - 0; Other Eukaryotes - 3146 (source: NCBI BLink). |
| AT3G03120 | AT3G03120.1 | CAAACCGGTTATAAACCGGTC | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. |
| AT3G03270 | AT3G03270.1 | CAAACCGGTTAT | universal stress protein (USP) family protein / early nodulin ENOD18 family protein; INVOLVED IN: response to stress; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G53990.1); Has 331 Blast hits to 331 proteins in 36 species: Archae - 0; Bacteria - 4; Metazoa - 8; Fungi - 10; Plants - 307; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G03270.2 | CAAACCGGTTAT | universal stress protein (USP) family protein / early nodulin ENOD18 family protein; INVOLVED IN: response to stress; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G53990.1); Has 331 Blast hits to 331 proteins in 36 species: Archae - 0; Bacteria - 4; Metazoa - 8; Fungi - 10; Plants - 307; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G04130 | AT3G04130.1 | TAACCGGTTTT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink). |
| AT3G04130.2 | TAACCGGTTTT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink). |
| AT3G07170 | AT3G07170.1 | CAAACCGGTTAT | sterile alpha motif (SAM) domain-containing protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: sterile alpha motif (SAM) domain-containing protein (TAIR:AT5G48680.1); Has 396 Blast hits to 395 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 293; Fungi - 2; Plants - 89; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G11100 | AT3G11100.1 | ATAACCGGTTTT | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT5G05550.1); Has 522 Blast hits to 488 proteins in 92 species: Archae - 2; Bacteria - 29; Metazoa - 76; Fungi - 65; Plants - 221; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). |
| AT3G12650 | AT3G12650.1 | GAACCGGTTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13410 | AT3G13410.1 | AAACCGGTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55546.1); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13410.1 | GACCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55546.1); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15090 | AT3G15090.1 | GTAAACCGGTTAA | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 20659 Blast hits to 20565 proteins in 1484 species: Archae - 253; Bacteria - 11042; Metazoa - 1064; Fungi - 2188; Plants - 463; Viruses - 0; Other Eukaryotes - 5649 (source: NCBI BLink). |
| AT3G15640 | AT3G15640.1 | TCACACGTACCGGTTAA | cytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity, metal ion binding; LOCATED IN: mitochondrial envelope, mitochondrion, chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT1G80230.1); Has 343 Blast hits to 343 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 63; Plants - 56; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G15640.2 | TCACACGTACCGGTTAA | cytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity, metal ion binding; LOCATED IN: mitochondrial envelope, mitochondrion, chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT1G80230.1); Has 343 Blast hits to 343 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 63; Plants - 56; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G16200 | AT3G16200.1 | TAACCGGTTTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 70 Blast hits to 70 proteins in 9 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT3G16840 | AT3G16840.1 | TAACCGGTTTAA | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 47629 Blast hits to 37227 proteins in 1876 species: Archae - 406; Bacteria - 10857; Metazoa - 14354; Fungi - 5782; Plants - 2214; Viruses - 278; Other Eukaryotes - 13738 (source: NCBI BLink). |
| AT3G18100 | AT3G18100.1 | TAACCGGTTTAT | Member of the R2R3 transcription factor gene family. |
| AT3G18210 | AT3G18210.1 | ATAACCGGTTCG | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G18210.2 | ATAACCGGTTCG | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G18215 | AT3G18215.1 | CGAACCGGTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24600.1); Has 180 Blast hits to 180 proteins in 49 species: Archae - 0; Bacteria - 72; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G19190 | AT3G19190.1 | TAACCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATG2, C-terminal (InterPro:IPR015412); Has 603 Blast hits to 514 proteins in 156 species: Archae - 0; Bacteria - 19; Metazoa - 326; Fungi - 168; Plants - 38; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT3G19508 | AT3G19508.1 | TTTAACCGGTC | unknown protein; LOCATED IN: mitochondrion; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G20920 | AT3G20920.1 | TTAACCGGTC | translocation protein-related; FUNCTIONS IN: protein transporter activity; INVOLVED IN: protein transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocation protein Sec62 (InterPro:IPR004728); Has 185 Blast hits to 185 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 46; Plants - 26; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G20920.2 | TTAACCGGTC | translocation protein-related; FUNCTIONS IN: protein transporter activity; INVOLVED IN: protein transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocation protein Sec62 (InterPro:IPR004728); Has 185 Blast hits to 185 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 46; Plants - 26; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G22425 | AT3G22425.1 | GACCGGTTAT | Encodes imidazoleglycerolphosphate dehydratase. |
| AT3G22425.2 | GACCGGTTAT | Encodes imidazoleglycerolphosphate dehydratase. |
| AT3G23940 | AT3G23940.1 | ATAACCGGTTAT | dehydratase family; FUNCTIONS IN: catalytic activity, dihydroxy-acid dehydratase activity; INVOLVED IN: branched chain family amino acid biosynthetic process, isoleucine biosynthetic process, metabolic process, valine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dihydroxy-acid dehydratase (InterPro:IPR004404), Dihydroxy-acid and 6-phosphogluconate dehydratase (InterPro:IPR000581); Has 10437 Blast hits to 10433 proteins in 1298 species: Archae - 138; Bacteria - 4265; Metazoa - 2; Fungi - 197; Plants - 21; Viruses - 0; Other Eukaryotes - 5814 (source: NCBI BLink). |
| AT3G46510 | AT3G46510.1 | TAACCGGTC | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G47000 | AT3G47000.1 | ACCGGTTAA | glycosyl hydrolase family 3 protein; FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT3G47010.1); Has 6353 Blast hits to 5926 proteins in 906 species: Archae - 20; Bacteria - 3224; Metazoa - 6; Fungi - 919; Plants - 287; Viruses - 0; Other Eukaryotes - 1897 (source: NCBI BLink). |
| AT3G47650 | AT3G47650.1 | AAAACCGGTTAA | bundle-sheath defective protein 2 family / bsd2 family; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 47 Blast hits to 47 proteins in 18 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G57800 | AT3G57800.1 | ACCGGTTAAAGCCCAAAAGGCCCAAG | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G57800.2 | ACCGGTTAAAGCCCAAAAGGCCCAAG | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G58900 | AT3G58900.1 | ATAACCGGTC | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58860.1); Has 1272 Blast hits to 1243 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 1261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G58900.2 | ATAACCGGTC | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58860.1); Has 1272 Blast hits to 1243 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 1261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G58900.3 | ATAACCGGTC | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58860.1); Has 1272 Blast hits to 1243 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 1261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G59070 | AT3G59070.1 | GACCGGTTAT | auxin-responsive protein, putative; INVOLVED IN: multicellular organismal development; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT5G48750.1); Has 350 Blast hits to 350 proteins in 61 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 13; Plants - 243; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT3G59970 | AT3G59970.1 | ACCGGTTA | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
| AT3G59970.2 | ACCGGTTA | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
| AT3G59970.3 | ACCGGTTA | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
| AT3G62260 | AT3G62260.1 | ACCGGTTA | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink). |
| AT3G62260.2 | ACCGGTTA | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink). |
| AT4G00990 | AT4G00990.1 | TTTAACCGGT | transcription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: protein binding, transcription factor activity, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Zinc finger, RING-type (InterPro:IPR001841), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transcription factor jumonji (jmjC) domain-containing protein (TAIR:AT1G62310.1); Has 700 Blast hits to 466 proteins in 80 species: Archae - 0; Bacteria - 8; Metazoa - 459; Fungi - 31; Plants - 147; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT4G01400 | AT4G01400.2 | ATAACCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COG4 transport (InterPro:IPR013167), Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 11639 Blast hits to 3936 proteins in 180 species: Archae - 0; Bacteria - 2; Metazoa - 206; Fungi - 141; Plants - 11004; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink). |
| AT4G02195 | AT4G02195.1 | TAACCGGTC | member of SYP4 Gene Family |
| AT4G02200 | AT4G02200.1 | GACCGGTTA | drought-responsive family protein; INVOLVED IN: response to water deprivation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G02750.1). |
| AT4G02200.2 | GACCGGTTA | drought-responsive family protein; INVOLVED IN: response to water deprivation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G02750.1). |
| AT4G02200.3 | GACCGGTTA | drought-responsive family protein; INVOLVED IN: response to water deprivation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G02750.1). |
| AT4G03410 | AT4G03410.1 | ACCGGTTAT | peroxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT4G03410.2 | ACCGGTTAT | peroxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT4G04850 | AT4G04850.1 | ATAACCGGTTAACGGTTTAA | member of Putative potassium transporter family |
| AT4G09200 | AT4G09200.1 | ACCGGTTAA | SPla/RYanodine receptor (SPRY) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: B302 (SPRY)-like (InterPro:IPR001870), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144), SPla/RYanodine receptor SPRY (InterPro:IPR003877); BEST Arabidopsis thaliana protein match is: SPla/RYanodine receptor (SPRY) domain-containing protein (TAIR:AT4G09310.1); Has 620 Blast hits to 608 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 119; Plants - 93; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink). |
| AT4G09510 | AT4G09510.1 | ACCGGTTAA | beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: CINV1 (cytosolic invertase 1); beta-fructofuranosidase (TAIR:AT1G35580.2); Has 527 Blast hits to 526 proteins in 78 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 174; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT4G09510.1 | CTTAACCGGT | beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: CINV1 (cytosolic invertase 1); beta-fructofuranosidase (TAIR:AT1G35580.2); Has 527 Blast hits to 526 proteins in 78 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 174; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT4G09510.2 | ACCGGTTAA | beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: CINV1 (cytosolic invertase 1); beta-fructofuranosidase (TAIR:AT1G35580.2); Has 527 Blast hits to 526 proteins in 78 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 174; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT4G09510.2 | CTTAACCGGT | beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: CINV1 (cytosolic invertase 1); beta-fructofuranosidase (TAIR:AT1G35580.2); Has 527 Blast hits to 526 proteins in 78 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 174; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT4G14540 | AT4G14540.1 | GAACCGGTTAT | NUCLEAR FACTOR Y, SUBUNIT B3 (NF-YB3); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB2 (NUCLEAR FACTOR Y, SUBUNIT B2); transcription factor (TAIR:AT5G47640.1); Has 1011 Blast hits to 1011 proteins in 186 species: Archae - 0; Bacteria - 1; Metazoa - 394; Fungi - 233; Plants - 298; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT4G15520 | AT4G15520.1 | ACCGGTTAT | tRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); Has 4370 Blast hits to 4370 proteins in 1038 species: Archae - 9; Bacteria - 2930; Metazoa - 62; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 1322 (source: NCBI BLink). |
| AT4G15520.1 | TGAACCGGTTAA | tRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); Has 4370 Blast hits to 4370 proteins in 1038 species: Archae - 9; Bacteria - 2930; Metazoa - 62; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 1322 (source: NCBI BLink). |
| AT4G15955 | AT4G15955.1 | ACCGGTTA | epoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1). |
| AT4G15955.2 | ACCGGTTA | epoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1). |
| AT4G15955.3 | ACCGGTTA | epoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1). |
| AT4G17060 | AT4G17060.1 | CTTAACCGGT | Encodes one of the FRI interacting proteins: FRIGIDA INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI (At4G00650) is a major determinant of natural variation in Arabidopsis flowering time. |
| AT4G17140 | AT4G17140.1 | ACCGGTTAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: phosphoinositide binding (TAIR:AT1G48090.2). |
| AT4G17140.2 | ACCGGTTAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: phosphoinositide binding (TAIR:AT1G48090.2). |
| AT4G18810 | AT4G18810.1 | ACCGGTTAATTAAACCGGAAA | binding / catalytic/ transcription repressor; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NADH:ubiquinone oxidoreductase complex I intermediate-associated protein 30 (InterPro:IPR013857), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: HCF173 (high chlorophyll fluorescence phenotype 173); binding / catalytic/ transcription repressor (TAIR:AT1G16720.1); Has 1715 Blast hits to 1540 proteins in 261 species: Archae - 12; Bacteria - 728; Metazoa - 8; Fungi - 25; Plants - 255; Viruses - 0; Other Eukaryotes - 687 (source: NCBI BLink). |
| AT4G19070 | AT4G19070.1 | ACCGGTTAT | cadmium-responsive protein / cadmium induced protein (AS8); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 110 Blast hits to 61 proteins in 24 species: Archae - 2; Bacteria - 7; Metazoa - 10; Fungi - 0; Plants - 32; Viruses - 47; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT4G21710 | AT4G21710.1 | CAAACCGGTTAT | Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. |
| AT4G21710.1 | CAAACCGGTTAT | Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. |
| AT4G23890 | AT4G23890.1 | ACCGGTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 252 Blast hits to 252 proteins in 67 species: Archae - 0; Bacteria - 101; Metazoa - 15; Fungi - 4; Plants - 21; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). |
| AT4G23890.1 | TTAACCGGTTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 252 Blast hits to 252 proteins in 67 species: Archae - 0; Bacteria - 101; Metazoa - 15; Fungi - 4; Plants - 21; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). |
| AT4G23910 | AT4G23910.1 | TAACCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10970.4); Has 29 Blast hits to 29 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G24830 | AT4G24830.1 | TTTAACCGGTTT | arginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink). |
| AT4G24830.2 | TTTAACCGGTTT | arginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink). |
| AT4G25650 | AT4G25650.1 | TTAACCGGTTTAG | Similar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment. |
| AT4G25650.2 | TTAACCGGTTTAG | Similar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment. |
| AT4G25660 | AT4G25660.1 | CTAAACCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25680.1); Has 499 Blast hits to 499 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 37; Plants - 181; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT4G25740 | AT4G25740.1 | GAACCGGTTAA | 40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). |
| AT4G25740.2 | GAACCGGTTAA | 40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). |
| AT4G26910 | AT4G26910.1 | ACCGGTTAA | 2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT5G55070.1); Has 18235 Blast hits to 15642 proteins in 1359 species: Archae - 63; Bacteria - 8371; Metazoa - 692; Fungi - 350; Plants - 255; Viruses - 3; Other Eukaryotes - 8501 (source: NCBI BLink). |
| AT4G26910.2 | ACCGGTTAA | 2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT5G55070.1); Has 18235 Blast hits to 15642 proteins in 1359 species: Archae - 63; Bacteria - 8371; Metazoa - 692; Fungi - 350; Plants - 255; Viruses - 3; Other Eukaryotes - 8501 (source: NCBI BLink). |
| AT4G28630 | AT4G28630.1 | AAAACCGGTTAT | half-molecule ABC transporter ATM1 |
| AT4G28630.1 | ACCGGTTAT | half-molecule ABC transporter ATM1 |
| AT4G29160 | AT4G29160.1 | TAACCGGTTC | SNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT4G29160.3 | TAACCGGTTC | SNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT4G29510 | AT4G29510.1 | TAACCGGTTTGG | Has arginine N-methyltransferase activity. Modifies AtMBD7. |
| AT4G29810 | AT4G29810.1 | TTAACCGGTTTGTTTCCGGTTAAA | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT4G29810.2 | TTAACCGGTTTGTTTCCGGTTAAA | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT4G29810.3 | TTAACCGGTTTGTTTCCGGTTAAA | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT4G32915 | AT4G32915.1 | GACCGGTTAAAACCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of translational fidelity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glu-tRNAGln amidotransferase, C subunit (InterPro:IPR003837); Has 1227 Blast hits to 1227 proteins in 425 species: Archae - 17; Bacteria - 884; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink). |
| AT4G33640 | AT4G33640.1 | CAAACCGGTTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 141 Blast hits to 141 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT4G33760 | AT4G33760.1 | CTTAACCGGTTCG | tRNA synthetase class II (D, K and N) family protein; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: aspartyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast, membrane, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aspartyl-tRNA synthetase, class IIb, bacterial/mitochondrial type (InterPro:IPR004524), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Aspartyl-tRNA synthetase, class IIb, bacterial/mitochondrial type, C-terminal (InterPro:IPR018153), GAD (InterPro:IPR004115); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 20510 Blast hits to 15912 proteins in 1700 species: Archae - 534; Bacteria - 11175; Metazoa - 763; Fungi - 675; Plants - 169; Viruses - 0; Other Eukaryotes - 7194 (source: NCBI BLink). |
| AT4G35090 | AT4G35090.1 | TAACCGGT | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. |
| AT4G35090.2 | TAACCGGT | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. |
| AT4G35850 | AT4G35850.1 | CAAACCGGTTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G02150.1); Has 6373 Blast hits to 2522 proteins in 127 species: Archae - 1; Bacteria - 4; Metazoa - 104; Fungi - 77; Plants - 5853; Viruses - 0; Other Eukaryotes - 334 (source: NCBI BLink). |
| AT4G37870 | AT4G37870.1 | ACCGGTTAT | Encodes a putative phosphoenolpyruvate carboxykinase (ATP-dependent). |
| AT4G38740 | AT4G38740.1 | CTTAACCGGT | Encodes cytosolic cyclophilin ROC1. |
| AT4G39940 | AT4G39940.1 | ATAACCGGT | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete |
| AT4G39940.1 | TTAACCGGT | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete |
| AT5G03970 | AT5G03970.1 | ATAACCGGTTCA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G03970.2 | ATAACCGGTTCA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G04140 | AT5G04140.1 | CAAACCGGTTAA | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. |
| AT5G04140.2 | CAAACCGGTTAA | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. |
| AT5G04910 | AT5G04910.1 | CTAAACCGGTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G05520 | AT5G05520.1 | ACCGGTTAA | outer membrane OMP85 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial surface antigen (D15) (InterPro:IPR000184), Surface antigen variable number (InterPro:IPR010827); BEST Arabidopsis thaliana protein match is: outer membrane OMP85 family protein (TAIR:AT3G11070.1); Has 1168 Blast hits to 1166 proteins in 370 species: Archae - 0; Bacteria - 488; Metazoa - 132; Fungi - 88; Plants - 38; Viruses - 4; Other Eukaryotes - 418 (source: NCBI BLink). |
| AT5G05520.1 | ATAACCGGTTCA | outer membrane OMP85 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial surface antigen (D15) (InterPro:IPR000184), Surface antigen variable number (InterPro:IPR010827); BEST Arabidopsis thaliana protein match is: outer membrane OMP85 family protein (TAIR:AT3G11070.1); Has 1168 Blast hits to 1166 proteins in 370 species: Archae - 0; Bacteria - 488; Metazoa - 132; Fungi - 88; Plants - 38; Viruses - 4; Other Eukaryotes - 418 (source: NCBI BLink). |
| AT5G06860 | AT5G06860.1 | ACCGGTTAT | Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. |
| AT5G08040 | AT5G08040.1 | ACCGGTTAT | MITOCHONDRIAL IMPORT RECEPTOR SUBUNIT TOM5 HOMOLOG (TOM5); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G08050 | AT5G08050.1 | ATAACCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1118 (InterPro:IPR009500), Uncharacterised conserved protein UCP022207 (InterPro:IPR016801); Has 41 Blast hits to 41 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G09400 | AT5G09400.1 | TAACCGGTTCA | potassium transporter |
| AT5G10920 | AT5G10920.1 | GACCGGTTAAA | argininosuccinate lyase, putative / arginosuccinase, putative; FUNCTIONS IN: argininosuccinate lyase activity, catalytic activity; INVOLVED IN: arginine biosynthetic process via ornithine, arginine biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Argininosuccinate lyase (InterPro:IPR009049), L-Aspartase-like (InterPro:IPR008948), Delta crystallin (InterPro:IPR003031), Fumarate lyase (InterPro:IPR000362); Has 10040 Blast hits to 10035 proteins in 1495 species: Archae - 255; Bacteria - 5320; Metazoa - 254; Fungi - 173; Plants - 41; Viruses - 0; Other Eukaryotes - 3997 (source: NCBI BLink). |
| AT5G12230 | AT5G12230.1 | ACCGGTTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19480.2); Has 22700 Blast hits to 10061 proteins in 421 species: Archae - 37; Bacteria - 1646; Metazoa - 10568; Fungi - 2003; Plants - 1402; Viruses - 41; Other Eukaryotes - 7003 (source: NCBI BLink). |
| AT5G13680 | AT5G13680.1 | ATAACCGGT | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. |
| AT5G13690 | AT5G13690.1 | ACCGGTTAT | alpha-N-acetylglucosaminidase family / NAGLU family; FUNCTIONS IN: alpha-N-acetylglucosaminidase activity; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-N-acetylglucosaminidase (InterPro:IPR007781); Has 254 Blast hits to 246 proteins in 93 species: Archae - 0; Bacteria - 100; Metazoa - 87; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT5G13890 | AT5G13890.1 | TAACCGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF716 (InterPro:IPR006904); Has 120 Blast hits to 118 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G13890.2 | TAACCGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF716 (InterPro:IPR006904); Has 120 Blast hits to 118 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G13890.3 | TAACCGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF716 (InterPro:IPR006904); Has 120 Blast hits to 118 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G16780 | AT5G16780.1 | ATAACCGGTC | Encodes a protein belonging to SART-1 family. The gene is expressed in the basal region of the developing embryo during heart stage. Phenotypic analyses of dot2 mutants suggest that this protein plays a role in root, shoot, and flower development. dot2 mutants are dwarved plants that display an aberrant spurred leaf venation pattern and fail to flower. In the roots DOT2 appears to be require for normal meristem organization and maintenance and the proper expression of PIN and PLT genes. |
| AT5G17270 | AT5G17270.1 | TTTAACCGGTTCG | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G37130.1); Has 5379 Blast hits to 3587 proteins in 480 species: Archae - 397; Bacteria - 1752; Metazoa - 604; Fungi - 281; Plants - 148; Viruses - 0; Other Eukaryotes - 2197 (source: NCBI BLink). |
| AT5G17290 | AT5G17290.1 | GACCGGTTAA | Autophagy protein ATG5. Forms a conjugate with ATG12 with an essential role in plant nutrient recycling. Mutants missing ATG5 display early senescence and are hypersensitive to nitrogen or carbon starvation, accompanied by a more rapid loss of organellar and cytoplasmic proteins. |
| AT5G18440 | AT5G18440.1 | TTAACCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). |
| AT5G18440.2 | TTAACCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). |
| AT5G23300 | AT5G23300.1 | CAAACCGGTTAA | dihydroorotate dehydrogenase, catalyses fourth step of pyrimidine biosynthesis |
| AT5G24020 | AT5G24020.1 | TTAAACCGGTTAAG | Encodes a Ca2+ dependent ATPase required for correct positioning of the chloroplast division apparatus. Its ATPase activity is stimulated by AtMinE1, a topological specificity factor. |
| AT5G24450 | AT5G24450.1 | CGAACCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49410.1); Has 598 Blast hits to 569 proteins in 160 species: Archae - 0; Bacteria - 19; Metazoa - 191; Fungi - 117; Plants - 57; Viruses - 10; Other Eukaryotes - 204 (source: NCBI BLink). |
| AT5G24750 | AT5G24750.1 | TAACCGGTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 976 Blast hits to 975 proteins in 299 species: Archae - 0; Bacteria - 617; Metazoa - 1; Fungi - 251; Plants - 63; Viruses - 14; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT5G25800 | AT5G25800.1 | TAACCGGTTA | exonuclease family protein; FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: SDN1 (SMALL RNA DEGRADING NUCLEASE 1); 3'-5' exonuclease/ exonuclease (TAIR:AT3G50100.1); Has 1347 Blast hits to 1319 proteins in 179 species: Archae - 0; Bacteria - 4; Metazoa - 658; Fungi - 453; Plants - 109; Viruses - 2; Other Eukaryotes - 121 (source: NCBI BLink). |
| AT5G27440 | AT5G27440.1 | ATAACCGGTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: shoot, shoot apex, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; Has 3 Blast hits to 3 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G27450 | AT5G27450.1 | GAACCGGTTAT | Encodes a protein with mevalonate kinase activity involved in the mevalonate pathway. |
| AT5G27450.2 | GAACCGGTTAT | Encodes a protein with mevalonate kinase activity involved in the mevalonate pathway. |
| AT5G35080 | AT5G35080.1 | ATAACCGGTTTG | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); Has 480 Blast hits to 361 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 316; Fungi - 98; Plants - 25; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT5G38110 | AT5G38110.1 | ACCGGTTAAA | This gene is predicted to encode a silencing group A protein. Plant lines expressing RNAi constructs directed against SGA1 have reduced levels of agrobacterium-mediated root transformation. |
| AT5G38110.1 | ACCGGTTAT | This gene is predicted to encode a silencing group A protein. Plant lines expressing RNAi constructs directed against SGA1 have reduced levels of agrobacterium-mediated root transformation. |
| AT5G41150 | AT5G41150.1 | CTAAACCGGTTAAG | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G41150.2 | CTAAACCGGTTAAG | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G41170 | AT5G41170.1 | TTAACCGGTC | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: stem, sperm cell, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16710.1); Has 27867 Blast hits to 6121 proteins in 185 species: Archae - 5; Bacteria - 18; Metazoa - 886; Fungi - 644; Plants - 24943; Viruses - 0; Other Eukaryotes - 1371 (source: NCBI BLink). |
| AT5G41330 | AT5G41330.1 | ACCGGTTTATACCGGTTAT | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT3G09030.1); Has 474 Blast hits to 473 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 378; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT5G42390 | AT5G42390.1 | ACCGGTTAAA | metalloendopeptidase; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: mitochondrion, chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT5G56730.1); Has 6181 Blast hits to 5988 proteins in 1271 species: Archae - 12; Bacteria - 4040; Metazoa - 465; Fungi - 284; Plants - 136; Viruses - 3; Other Eukaryotes - 1241 (source: NCBI BLink). |
| AT5G45620 | AT5G45620.1 | TTAACCGGTC | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G45620.2 | TTAACCGGTC | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G48470 | AT5G48470.1 | ATAACCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G49510 | AT5G49510.1 | ATAAACCGGTTA | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G49510.2 | ATAAACCGGTTA | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G49930 | AT5G49930.1 | TAACCGGTTTT | embryo defective 1441 (emb1441); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Fibronectin-binding A, N-terminal (InterPro:IPR008616), Zinc finger, CCHC-type (InterPro:IPR001878), Protein of unknown function DUF814 (InterPro:IPR008532); Has 2906 Blast hits to 2454 proteins in 381 species: Archae - 144; Bacteria - 336; Metazoa - 995; Fungi - 294; Plants - 92; Viruses - 7; Other Eukaryotes - 1038 (source: NCBI BLink). |
| AT5G50380 | AT5G50380.1 | TTAAACCGGAAAATAACCGGT | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G51480 | AT5G51480.1 | CGAACCGGTTAA | SKU5 SIMILAR 2 (SKS2); FUNCTIONS IN: oxidoreductase activity, copper ion binding; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Multicopper oxidase, type 3 (InterPro:IPR011707), Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type 2 (InterPro:IPR011706), Multicopper oxidase, type 1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein match is: SKS1 (SKU5 SIMILAR 1); copper ion binding / oxidoreductase (TAIR:AT4G25240.1); Has 3767 Blast hits to 3753 proteins in 669 species: Archae - 2; Bacteria - 1101; Metazoa - 259; Fungi - 1458; Plants - 790; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT5G55720 | AT5G55720.1 | GACCGGTTA | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G27400.1); Has 998 Blast hits to 993 proteins in 171 species: Archae - 0; Bacteria - 429; Metazoa - 0; Fungi - 164; Plants - 395; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G62000 | AT5G62000.1 | TAACCGGT | Encodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. |
| AT5G62000.2 | TAACCGGT | Encodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. |
| AT5G62000.3 | TAACCGGT | Encodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. |
| AT5G63000 | AT5G63000.1 | GACCGGTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G63000.1 | TTTAACCGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G64830 | AT5G64830.1 | AAAACCGGTTAGGGCTTTAT | programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT5G64830.2 | AAAACCGGTTAGGGCTTTAT | programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT5G64960 | AT5G64960.1 | ATAACCGGTTTAA | Encodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. |
| AT5G64960.1 | TTTAACCGGTTTG | Encodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. |
| AT5G64960.2 | ATAACCGGTTTAA | Encodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. |
| AT5G64960.2 | TTTAACCGGTTTG | Encodes CDKC;2, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. Co-localizes with spliceosomal components in a manner dependent on the transcriptional status of the cells and on CDKC2-kinase activity. Expression of CDKC2 modifies the location of spliceosomal components. |
| AT5G67300 | AT5G67300.1 | CTTAACCGGTTTCCGGTTAT | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. |