AtREG504

Summary of AtREG504 (All List)

Organism Arabidopsis thaliana
ID AtREG504
Sequence CATGGGCC
Annotation
PPDB Motif GCCCA Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression
CCATGG function unknown
PLACE Motif GGGCC one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);
TGGGCY "Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);)
Total Entry Count 187

Organism	Arabidopsis thaliana
ID	AtREG504
Sequence	`CATGGGCC`
Annotation
PPDB Motif	`GCCCA`	`Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression`
`CCATGG`	`function unknown`
PLACE Motif	`GGGCC`	`one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);`
`TGGGCY`	`"Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);)`
Total Entry Count	`187`

Entry Sequences (187 entries)

Locus Gene model Sequence Description
AT1G01160 AT1G01160.1 CCATGGGCCTTAG Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA

AT1G01160.2 CCATGGGCCTTAG Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA

AT1G01710 AT1G01710.1 CATGGGCCAT acyl-CoA thioesterase family protein; FUNCTIONS IN: cyclic nucleotide binding, acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT4G00520.2); Has 2588 Blast hits to 2566 proteins in 602 species: Archae - 0; Bacteria - 1102; Metazoa - 404; Fungi - 233; Plants - 38; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink).

AT1G01820 AT1G01820.1 ACAGGCCCATG member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.

AT1G02290 AT1G02290.1 CATGGGCCTATA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45830.1); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 43; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT1G02816 AT1G02816.1 TTAAAGCCCATGGGCCTTAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT1G04260 AT1G04260.1 CATGGGCCTTTG Encodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors.

AT1G07700 AT1G07700.1 CATGGGCCCATCT thioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).

AT1G07700.2 CATGGGCCCATCT thioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).

AT1G07700.3 CATGGGCCCATCT thioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).

AT1G10840 AT1G10840.1 TAATGGGCCCATG Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1).

AT1G10840.2 TAATGGGCCCATG Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1).

AT1G11870 AT1G11870.1 TGGGCTCACATGGGCCATA Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.

AT1G11870.2 TGGGCTCACATGGGCCATA Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.

AT1G11870.3 TGGGCTCACATGGGCCATA Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.

AT1G12800 AT1G12800.1 CTATTGGGCCAATTTTAGGCCCATG S1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink).

AT1G13350 AT1G13350.1 ATGGCCCATG protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G53640.1); Has 80312 Blast hits to 71745 proteins in 1717 species: Archae - 65; Bacteria - 5105; Metazoa - 38133; Fungi - 9588; Plants - 8768; Viruses - 394; Other Eukaryotes - 18259 (source: NCBI BLink).

AT1G14140 AT1G14140.1 CATGGGCCCATAA mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink).

AT1G15210 AT1G15210.1 CATGGGCCAT PLEIOTROPIC DRUG RESISTANCE 7 (PDR7); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: multidrug transport; LOCATED IN: plasma membrane, chloroplast, membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 (InterPro:IPR000412), Plant PDR ABC transporter associated (InterPro:IPR013581), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: PEN3 (PENETRATION 3); ATPase, coupled to transmembrane movement of substances / cadmium ion transmembrane transporter (TAIR:AT1G59870.1); Has 219007 Blast hits to 166393 proteins in 2528 species: Archae - 4373; Bacteria - 156456; Metazoa - 8068; Fungi - 4637; Plants - 3146; Viruses - 4; Other Eukaryotes - 42323 (source: NCBI BLink).

AT1G15220 AT1G15220.1 CAAGGCCCATG Encodes a protein with oxidoreductase activity present in the inner membrane of mitochondria. CCMH is postulated to play a central role in mitochondrial cytochrome c maturation, probably as part of a heme lyase complex that also holds activity of reducing apocytochrome c. CCMH interacts with apocytochrome AtCYTc-a and is shown to be present in a 500 kDa-complex along with CcmFN2.

AT1G15220.2 CAAGGCCCATG Encodes a protein with oxidoreductase activity present in the inner membrane of mitochondria. CCMH is postulated to play a central role in mitochondrial cytochrome c maturation, probably as part of a heme lyase complex that also holds activity of reducing apocytochrome c. CCMH interacts with apocytochrome AtCYTc-a and is shown to be present in a 500 kDa-complex along with CcmFN2.

AT1G15250 AT1G15250.1 CCAGGCCCATGAAGCCCATTAAGAAGCCCATAT 60S ribosomal protein L37 (RPL37A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331), Ribosomal protein L37e (InterPro:IPR001569); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37C) (TAIR:AT3G16080.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).

AT1G15260 AT1G15260.1 CATGGGCCTGG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16070.1); Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G16570 AT1G16570.1 CATGGGCCTAAC glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).

AT1G16570.2 CATGGGCCTAAC glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).

AT1G16590 AT1G16590.1 GTTAGGCCCATG putative translesion synthesis polymerase zeta subunit, homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS).

AT1G17890 AT1G17890.1 TTTAGGCCCATGGGCCA GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).

AT1G17890.2 TTTAGGCCCATGGGCCA GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).

AT1G17890.3 TTTAGGCCCATGGGCCA GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).

AT1G24510 AT1G24510.1 GTTAGGCCCATG T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).

AT1G24510.2 GTTAGGCCCATG T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).

AT1G26800 AT1G26800.1 TTTAGGCCCATGGG zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14200.1); Has 6695 Blast hits to 6676 proteins in 207 species: Archae - 0; Bacteria - 0; Metazoa - 2341; Fungi - 548; Plants - 2751; Viruses - 14; Other Eukaryotes - 1041 (source: NCBI BLink).

AT1G26880 AT1G26880.1 CATGGGCCTTTAA 60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).

AT1G26880.2 CATGGGCCTTTAA 60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).

AT1G31817 AT1G31817.1 GAGGCCCATG NUCLEAR FUSION DEFECTIVE 3 (NFD3); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00750.1); Has 5242 Blast hits to 5242 proteins in 1532 species: Archae - 8; Bacteria - 2826; Metazoa - 58; Fungi - 4; Plants - 484; Viruses - 0; Other Eukaryotes - 1862 (source: NCBI BLink).

AT1G52300 AT1G52300.1 TTAAGGCCCATGGGCCTGA 60S ribosomal protein L37 (RPL37B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331), Ribosomal protein L37e (InterPro:IPR001569); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37C) (TAIR:AT3G16080.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).

AT1G53850 AT1G53850.1 GTTAGGCCCATGAAAGCCCATTAT Encodes alpha5 subunit of 20s proteosome involved in protein degradation.

AT1G53850.2 GTTAGGCCCATGAAAGCCCATTAT Encodes alpha5 subunit of 20s proteosome involved in protein degradation.

AT1G56590 AT1G56590.1 AAGGCCCATG clathrin adaptor complexes medium subunit family protein; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: HAP13 (HAPLESS 13); protein binding (TAIR:AT1G60780.1); Has 1451 Blast hits to 1434 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 782; Fungi - 300; Plants - 105; Viruses - 0; Other Eukaryotes - 264 (source: NCBI BLink).

AT1G64510 AT1G64510.1 AAAAGGCCCATGG ribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: thylakoid, chloroplast thylakoid membrane, ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 978 Blast hits to 978 proteins in 282 species: Archae - 0; Bacteria - 578; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink).

AT1G64520 AT1G64520.1 CCATGGGCCTTTT Regulatory Particle non-ATPase 12a (RPN12a); FUNCTIONS IN: peptidase activity; INVOLVED IN: in 14 processes; LOCATED IN: proteasome complex, nucleus, proteasome regulatory particle, lid subcomplex, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746), SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); BEST Arabidopsis thaliana protein match is: RPN12b (Regulatory Particle Non-ATPase 12b); peptidase (TAIR:AT5G42040.1); Has 353 Blast hits to 353 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 84; Plants - 39; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).

AT1G64880 AT1G64880.1 AATTGGGCCCATG ribosomal protein S5 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, Golgi apparatus, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: ribosomal protein S5 family protein (TAIR:AT2G33800.1); Has 10105 Blast hits to 8747 proteins in 1649 species: Archae - 225; Bacteria - 3046; Metazoa - 1648; Fungi - 368; Plants - 134; Viruses - 59; Other Eukaryotes - 4625 (source: NCBI BLink).

AT1G66530 AT1G66530.1 CATGGGCCTTAT arginyl-tRNA synthetase, putative / arginine--tRNA ligase, putative; FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, arginine-tRNA ligase activity, ATP binding; INVOLVED IN: arginyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), DALR anticodon binding (InterPro:IPR008909), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Arginyl-tRNA synthetase, class Ic, core (InterPro:IPR015945), Arginyl tRNA synthetase, class Ic, N-terminal (InterPro:IPR005148), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Arginyl-tRNA synthetase, class Ic (InterPro:IPR001278); BEST Arabidopsis thaliana protein match is: emb1027 (embryo defective 1027); ATP binding / aminoacyl-tRNA ligase/ arginine-tRNA ligase/ nucleotide binding (TAIR:AT4G26300.1); Has 6538 Blast hits to 6477 proteins in 1602 species: Archae - 156; Bacteria - 2983; Metazoa - 242; Fungi - 116; Plants - 35; Viruses - 3; Other Eukaryotes - 3003 (source: NCBI BLink).

AT1G66730 AT1G66730.1 GGGCTTTAGTGGCCCATG ATP dependent DNA ligase family protein; FUNCTIONS IN: DNA binding, DNA ligase (ATP) activity, ATP binding; INVOLVED IN: DNA repair, DNA replication, DNA recombination; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), DNA ligase, N-terminal (InterPro:IPR012308), ATP dependent DNA ligase, central (InterPro:IPR012310), ATP-dependent DNA ligase, conserved site (InterPro:IPR016059), DNA repair metallo-beta-lactamase (InterPro:IPR011084), ATP dependent DNA ligase, C-terminal (InterPro:IPR012309), ATP-dependent DNA ligase (InterPro:IPR000977); BEST Arabidopsis thaliana protein match is: ATLIG1 (ARABIDOPSIS THALIANA DNA LIGASE 1); ATP binding / DNA binding / DNA ligase (ATP) (TAIR:AT1G08130.1); Has 3133 Blast hits to 3071 proteins in 628 species: Archae - 227; Bacteria - 996; Metazoa - 564; Fungi - 431; Plants - 130; Viruses - 148; Other Eukaryotes - 637 (source: NCBI BLink).

AT1G67660 AT1G67660.1 ATTGGGCTTCATGGGCCTTAA DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative phage-type endonuclease (InterPro:IPR017482), Exonuclease, phage-type/RecB, C-terminal (InterPro:IPR011604), Restriction endonuclease, type II-like, core (InterPro:IPR011335); BEST Arabidopsis thaliana protein match is: DNA binding / nuclease (TAIR:AT1G13810.1); Has 366 Blast hits to 366 proteins in 59 species: Archae - 0; Bacteria - 65; Metazoa - 25; Fungi - 0; Plants - 35; Viruses - 27; Other Eukaryotes - 214 (source: NCBI BLink).

AT1G67660.2 ATTGGGCTTCATGGGCCTTAA DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative phage-type endonuclease (InterPro:IPR017482), Exonuclease, phage-type/RecB, C-terminal (InterPro:IPR011604), Restriction endonuclease, type II-like, core (InterPro:IPR011335); BEST Arabidopsis thaliana protein match is: DNA binding / nuclease (TAIR:AT1G13810.1); Has 366 Blast hits to 366 proteins in 59 species: Archae - 0; Bacteria - 65; Metazoa - 25; Fungi - 0; Plants - 35; Viruses - 27; Other Eukaryotes - 214 (source: NCBI BLink).

AT1G69900 AT1G69900.1 TATAGGCCCATG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF569 (InterPro:IPR007679), Actin_cross-linking (InterPro:IPR008999); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27100.1); Has 142 Blast hits to 77 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 142; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G70900 AT1G70900.1 TTCGGCCCATG unknown protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23110.3); Has 29 Blast hits to 29 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G70980 AT1G70980.1 AAGGCCCATG SYNC3; FUNCTIONS IN: in 6 functions; INVOLVED IN: asparaginyl-tRNA aminoacylation, aspartyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Asparaginyl-tRNA synthetase, class IIb (InterPro:IPR004522), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: SYNC1; ATP binding / aminoacyl-tRNA ligase/ asparagine-tRNA ligase/ aspartate-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT5G56680.1); Has 10794 Blast hits to 8026 proteins in 1494 species: Archae - 413; Bacteria - 7139; Metazoa - 538; Fungi - 533; Plants - 135; Viruses - 0; Other Eukaryotes - 2036 (source: NCBI BLink).

AT1G73230 AT1G73230.1 TAGGGCCCATGG nascent polypeptide-associated complex (NAC) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative (TAIR:AT1G17880.1); Has 618 Blast hits to 618 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 331; Fungi - 126; Plants - 89; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).

AT1G77670 AT1G77670.1 TATGGCCCATG aminotransferase class I and II family protein; FUNCTIONS IN: 1-aminocyclopropane-1-carboxylate synthase activity, transferase activity, transferring nitrogenous groups, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: asparagine catabolic process, biosynthetic process, glutamate catabolic process to oxaloacetate, aspartate transamidation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 1-aminocyclopropane-1-carboxylate synthase (InterPro:IPR001176), Aminotransferase, class I and II (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: aminotransferase class I and II family protein (TAIR:AT2G22250.3); Has 31276 Blast hits to 31274 proteins in 1793 species: Archae - 712; Bacteria - 18280; Metazoa - 666; Fungi - 553; Plants - 905; Viruses - 0; Other Eukaryotes - 10160 (source: NCBI BLink).

AT1G78660 AT1G78660.1 CATGGGCCC The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.

AT1G78660.2 CATGGGCCC The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.

AT1G78660.3 CATGGGCCC The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.

AT1G79790 AT1G79790.1 CATGGGCCAC haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).

AT1G79790.2 CATGGGCCAC haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).

AT2G04378 AT2G04378.1 CAGGCCCATGG beta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G04378.2 CAGGCCCATGG beta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G04390 AT2G04390.1 CCATGGGCCTG 40S ribosomal protein S17 (RPS17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus, plasma membrane; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).

AT2G17870 AT2G17870.1 CCATGGGCCTGA cold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink).

AT2G20580 AT2G20580.1 TGTGGGCCCATG encoding the RPN subunits of the 26S proteasome

AT2G22610 AT2G22610.1 CAAGGCCCATG kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT1G72250.1); Has 61125 Blast hits to 37324 proteins in 1305 species: Archae - 470; Bacteria - 4361; Metazoa - 29529; Fungi - 3969; Plants - 2072; Viruses - 206; Other Eukaryotes - 20518 (source: NCBI BLink).

AT2G23440 AT2G23440.1 CCCATGGGCCTTG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; Has 8 Blast hits to 8 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G32800 AT2G32800.1 CATGGGCCAT AP4.3A; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: lectin protein kinase, putative (TAIR:AT3G53810.1); Has 111168 Blast hits to 73136 proteins in 2997 species: Archae - 51; Bacteria - 9911; Metazoa - 45746; Fungi - 7567; Plants - 30942; Viruses - 390; Other Eukaryotes - 16561 (source: NCBI BLink).

AT2G33370 AT2G33370.1 CATGGGCCTAAAAGGCCTTTT 60S ribosomal protein L23 (RPL23B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14b/L23e (InterPro:IPR000218); BEST Arabidopsis thaliana protein match is: emb2171 (embryo defective 2171); structural constituent of ribosome (TAIR:AT3G04400.1); Has 6297 Blast hits to 6297 proteins in 1833 species: Archae - 236; Bacteria - 2977; Metazoa - 280; Fungi - 176; Plants - 586; Viruses - 0; Other Eukaryotes - 2042 (source: NCBI BLink).

AT2G33655 AT2G33655.1 ACGGCCCATG F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527); BEST Arabidopsis thaliana protein match is: EDA1 (embryo sac development arrest 1) (TAIR:AT1G59680.1); Has 362 Blast hits to 308 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 362; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G36620 AT2G36620.1 CATGGGCCAA RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020).

AT2G43350 AT2G43350.1 TTGGCCCATG Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1.

AT2G46890 AT2G46890.1 TGGGCCAACATGGGCCCATA oxidoreductase, acting on the CH-CH group of donors; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system, integral to membrane, cytoplasm; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104), Protein of unknown function DUF1295 (InterPro:IPR010721); BEST Arabidopsis thaliana protein match is: oxidoreductase, acting on the CH-CH group of donors (TAIR:AT1G18180.1); Has 1542 Blast hits to 1542 proteins in 207 species: Archae - 2; Bacteria - 258; Metazoa - 69; Fungi - 95; Plants - 57; Viruses - 0; Other Eukaryotes - 1061 (source: NCBI BLink).

AT3G02320 AT3G02320.1 CATGGGCCAT RNA binding / tRNA (guanine-N2-)-methyltransferase; FUNCTIONS IN: RNA binding, tRNA (guanine-N2-)-methyltransferase activity; INVOLVED IN: tRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: N2,N2-dimethylguanosine tRNA methyltransferase (InterPro:IPR002905); BEST Arabidopsis thaliana protein match is: N2,N2-dimethylguanosine tRNA methyltransferase family protein (TAIR:AT5G15810.1); Has 751 Blast hits to 711 proteins in 254 species: Archae - 149; Bacteria - 57; Metazoa - 179; Fungi - 100; Plants - 52; Viruses - 0; Other Eukaryotes - 214 (source: NCBI BLink).

AT3G02450 AT3G02450.1 AAAAGGCCCATG cell division protein ftsH, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase M41, FtsH extracellular (InterPro:IPR011546); BEST Arabidopsis thaliana protein match is: FTSH6 (FTSH PROTEASE 6); ATP-dependent peptidase/ ATPase/ metallopeptidase/ peptidase/ zinc ion binding (TAIR:AT5G15250.1); Has 29914 Blast hits to 28201 proteins in 1898 species: Archae - 923; Bacteria - 10733; Metazoa - 4167; Fungi - 2480; Plants - 1767; Viruses - 20; Other Eukaryotes - 9824 (source: NCBI BLink).

AT3G02630 AT3G02630.1 TATGGCCCATGGGCTTG acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT5G16240.1); Has 567 Blast hits to 564 proteins in 126 species: Archae - 0; Bacteria - 200; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).

AT3G05510 AT3G05510.1 TATGGGCCCATG phospholipid/glycerol acyltransferase family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123), Tafazzin (InterPro:IPR000872); BEST Arabidopsis thaliana protein match is: phospholipid/glycerol acyltransferase family protein (TAIR:AT1G78690.1); Has 1693 Blast hits to 1691 proteins in 471 species: Archae - 0; Bacteria - 947; Metazoa - 220; Fungi - 76; Plants - 60; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink).

AT3G05510.2 TATGGGCCCATG phospholipid/glycerol acyltransferase family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123), Tafazzin (InterPro:IPR000872); BEST Arabidopsis thaliana protein match is: phospholipid/glycerol acyltransferase family protein (TAIR:AT1G78690.1); Has 1693 Blast hits to 1691 proteins in 471 species: Archae - 0; Bacteria - 947; Metazoa - 220; Fungi - 76; Plants - 60; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink).

AT3G07200 AT3G07200.1 CAAAGCCCATGGGCCTTG zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G48655.3); Has 4419 Blast hits to 4404 proteins in 583 species: Archae - 0; Bacteria - 0; Metazoa - 3082; Fungi - 473; Plants - 291; Viruses - 27; Other Eukaryotes - 546 (source: NCBI BLink).

AT3G07200.2 CAAAGCCCATGGGCCTTG zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G48655.3); Has 4419 Blast hits to 4404 proteins in 583 species: Archae - 0; Bacteria - 0; Metazoa - 3082; Fungi - 473; Plants - 291; Viruses - 27; Other Eukaryotes - 546 (source: NCBI BLink).

AT3G09970 AT3G09970.1 CAAAGGCCCATG calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT3G09960.1); Has 715 Blast hits to 715 proteins in 245 species: Archae - 8; Bacteria - 389; Metazoa - 26; Fungi - 8; Plants - 74; Viruses - 11; Other Eukaryotes - 199 (source: NCBI BLink).

AT3G11090 AT3G11090.1 AATAGGCCCATG LOB DOMAIN-CONTAINING PROTEIN 21 (LBD21); INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); BEST Arabidopsis thaliana protein match is: LBD25 (LOB DOMAIN-CONTAINING PROTEIN 25) (TAIR:AT3G27650.1); Has 584 Blast hits to 581 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 584; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G15095 AT3G15095.1 CATGGGCCAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9532 Blast hits to 5756 proteins in 534 species: Archae - 60; Bacteria - 889; Metazoa - 3753; Fungi - 648; Plants - 278; Viruses - 137; Other Eukaryotes - 3767 (source: NCBI BLink).

AT3G15095.2 CATGGGCCAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9532 Blast hits to 5756 proteins in 534 species: Archae - 60; Bacteria - 889; Metazoa - 3753; Fungi - 648; Plants - 278; Viruses - 137; Other Eukaryotes - 3767 (source: NCBI BLink).

AT3G15095.3 CATGGGCCAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9532 Blast hits to 5756 proteins in 534 species: Archae - 60; Bacteria - 889; Metazoa - 3753; Fungi - 648; Plants - 278; Viruses - 137; Other Eukaryotes - 3767 (source: NCBI BLink).

AT3G15460 AT3G15460.1 CGTGTCATTAAGGCCCATG brix domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: brix domain-containing protein (TAIR:AT1G52930.1); Has 299 Blast hits to 299 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 88; Plants - 33; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).

AT3G16080 AT3G16080.1 CAAAGGCCCATG 60S ribosomal protein L37 (RPL37C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37e (InterPro:IPR001569), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37B) (TAIR:AT1G52300.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).

AT3G16260 AT3G16260.1 CAAAGGCCCATGGGCTAA Encodes a tRNase Z.

AT3G18500 AT3G18500.1 ATTGGCCCATGGCCCATGG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: endonuclease/exonuclease/phosphatase family protein (TAIR:AT1G73875.1); Has 964 Blast hits to 937 proteins in 164 species: Archae - 0; Bacteria - 37; Metazoa - 442; Fungi - 164; Plants - 170; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink).

AT3G18500.2 ATTGGCCCATGGCCCATGG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: endonuclease/exonuclease/phosphatase family protein (TAIR:AT1G73875.1); Has 964 Blast hits to 937 proteins in 164 species: Archae - 0; Bacteria - 37; Metazoa - 442; Fungi - 164; Plants - 170; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink).

AT3G22230 AT3G22230.1 CATGGGCCTTTT 60S ribosomal protein L27 (RPL27B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27C) (TAIR:AT4G15000.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink).

AT3G26340 AT3G26340.1 ATGGCCCATGAAGCCCAACA 20S proteasome beta subunit E, putative; FUNCTIONS IN: endopeptidase activity, threonine-type endopeptidase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome core complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Proteasome, beta-type subunit, conserved site (InterPro:IPR016050), Peptidase T1A, proteasome beta-subunit (InterPro:IPR000243), 20S proteasome, A and B subunits (InterPro:IPR001353); BEST Arabidopsis thaliana protein match is: PBE1; endopeptidase/ peptidase/ threonine-type endopeptidase (TAIR:AT1G13060.1); Has 4428 Blast hits to 4424 proteins in 409 species: Archae - 476; Bacteria - 181; Metazoa - 1589; Fungi - 914; Plants - 555; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).

AT3G26410 AT3G26410.1 TAAATGGGCTTTATTGGGCCCATG methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).

AT3G26420 AT3G26420.1 CATGGGCCCAATAAAGCCCATTTA Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance.

AT3G27110 AT3G27110.1 CTAAGGCCCATG peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink).

AT3G27110.2 CTAAGGCCCATG peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink).

AT3G43210 AT3G43210.1 TGGCCCATG Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis.

AT3G52940 AT3G52940.1 CCCATGGGCCATA Encodes a sterol C-14 reductase required for cell division and expansion and is involved in proper organization of the embryo.

AT3G52940.2 CCCATGGGCCATA Encodes a sterol C-14 reductase required for cell division and expansion and is involved in proper organization of the embryo.

AT3G55200 AT3G55200.1 AATAGGCCCATG splicing factor, putative; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: WD40 repeat (InterPro:IPR001680), Cleavage and polyadenylation specificity factor, A subunit, C-terminal (InterPro:IPR004871); BEST Arabidopsis thaliana protein match is: splicing factor, putative (TAIR:AT3G55220.1); Has 768 Blast hits to 695 proteins in 165 species: Archae - 0; Bacteria - 2; Metazoa - 341; Fungi - 160; Plants - 119; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).

AT3G57440 AT3G57440.1 CATGGGCCTAATATATGGGCTCA unknown protein; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G62120 AT3G62120.1 CTTATTGGGCTTGGCCCATG tRNA synthetase class II (G, H, P and S) family protein; FUNCTIONS IN: proline-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: prolyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Prolyl-tRNA synthetase, class IIa, prokaryotic-type (InterPro:IPR004499), Prolyl-tRNA synthetase, class II, C-terminal (InterPro:IPR016061), Anticodon-binding (InterPro:IPR004154), Prolyl-tRNA synthetase, class II (InterPro:IPR017449), Prolyl-tRNA synthetase, class IIa, conserved region (InterPro:IPR002316), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA6 (OVULE ABORTION 6); ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / proline-tRNA ligase (TAIR:AT5G52520.1); Has 5872 Blast hits to 5731 proteins in 1483 species: Archae - 181; Bacteria - 3502; Metazoa - 187; Fungi - 122; Plants - 56; Viruses - 0; Other Eukaryotes - 1824 (source: NCBI BLink).

AT3G62120.2 CTTATTGGGCTTGGCCCATG tRNA synthetase class II (G, H, P and S) family protein; FUNCTIONS IN: proline-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: prolyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Prolyl-tRNA synthetase, class IIa, prokaryotic-type (InterPro:IPR004499), Prolyl-tRNA synthetase, class II, C-terminal (InterPro:IPR016061), Anticodon-binding (InterPro:IPR004154), Prolyl-tRNA synthetase, class II (InterPro:IPR017449), Prolyl-tRNA synthetase, class IIa, conserved region (InterPro:IPR002316), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA6 (OVULE ABORTION 6); ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / proline-tRNA ligase (TAIR:AT5G52520.1); Has 5872 Blast hits to 5731 proteins in 1483 species: Archae - 181; Bacteria - 3502; Metazoa - 187; Fungi - 122; Plants - 56; Viruses - 0; Other Eukaryotes - 1824 (source: NCBI BLink).

AT3G62400 AT3G62400.1 TCAGGCCCATG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G62400.2 TCAGGCCCATG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G62790 AT3G62790.1 AGTTGGGCCCATG NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT2G47690.1); Has 85 Blast hits to 85 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 43; Plants - 36; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT4G10710 AT4G10710.1 CATGGGCCTTTA encodes a component of the FAcilitates Chromatin Transcription (FACT) complex, SPT16.

AT4G13010 AT4G13010.1 ATGGCCCATG oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 22117 Blast hits to 22019 proteins in 1513 species: Archae - 254; Bacteria - 11468; Metazoa - 1023; Fungi - 2323; Plants - 851; Viruses - 3; Other Eukaryotes - 6195 (source: NCBI BLink).

AT4G13520 AT4G13520.1 CATGGGCCAC Encodes a small acid protein (SMAP1) that mediates responses Arabidopsis root to the synthetic auxin 2,4-Dichlorophenoxyacetic acid.

AT4G14430 AT4G14430.1 CCGGCCCATGGGCCTTTA Encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation. This enzyme might also be involved in the conversion of indole-3-butyric acid to indole-3-acetic acid via a beta-oxidation-like pathway.

AT4G15910 AT4G15910.1 GTAAGGCCCATGAGCCCAAAT encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants.

AT4G16265 AT4G16265.1 ATATGGGCCGGCCCATGGGCTTTA One of two highly similar, non-catalytic subunits common to nuclear DNA-directed RNA polymerases II, IV and V; homologous to budding yeast RPB9. Appears to be redundant with At3g16980

AT4G17640 AT4G17640.1 CATGGGCCGGG Encodes casein kinase II beta (regulatory) subunit.

AT4G18395 AT4G18395.1 ACGGCCCATG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G21300 AT4G21300.1 AGAGGCCCATG pentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G03580.1); Has 19749 Blast hits to 5268 proteins in 182 species: Archae - 1; Bacteria - 4; Metazoa - 89; Fungi - 126; Plants - 19072; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink).

AT4G26990 AT4G26990.1 CATGGGCCGT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G54920.1); Has 176 Blast hits to 161 proteins in 44 species: Archae - 0; Bacteria - 4; Metazoa - 71; Fungi - 20; Plants - 57; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).

AT4G28910 AT4G28910.1 AATTGGGCCCATG LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink).

AT4G28910.2 AATTGGGCCCATG LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink).

AT4G28910.3 AATTGGGCCCATG LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink).

AT4G30750 AT4G30750.1 TTGGCCCATGG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30730.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G30760 AT4G30760.1 CCATGGGCCAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G30760.2 CCATGGGCCAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G30820 AT4G30820.1 TTGGCCCATG cyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).

AT4G30820.2 TTGGCCCATG cyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).

AT4G30820.3 TTGGCCCATG cyclin-dependent kinase-activating kinase assembly factor-related / CDK-activating kinase assembly factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cdk-activating kinase assembly factor (MAT1) (InterPro:IPR004575), Cdk-activating kinase assembly factor, MAT1 (InterPro:IPR015877); Has 255 Blast hits to 255 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 95; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).

AT4G31010 AT4G31010.1 GTTAGGCCCATG RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G31010.2 GTTAGGCCCATG RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G31985 AT4G31985.1 CATGGGCCTTGGGCCGAA 60S ribosomal protein L39 (RPL39C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39B) (TAIR:AT3G02190.1); Has 591 Blast hits to 591 proteins in 225 species: Archae - 151; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink).

AT4G38790 AT4G38790.1 CATGGGCCTTTT ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT2G21190.1); Has 626 Blast hits to 626 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 114; Plants - 120; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).

AT4G39080 AT4G39080.1 CATGGGCCAATATTGGG Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast.

AT4G39630 AT4G39630.1 TGAGCCCATGGGCCGTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G01260 AT5G01260.1 TTGGCCCATGGGCTTTAA glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).

AT5G01260.2 TTGGCCCATGGGCTTTAA glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).

AT5G01780 AT5G01780.1 GAGGCCCATGGGCCCATG oxidoreductase; FUNCTIONS IN: oxidoreductase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase (TAIR:AT3G14160.1); Has 755 Blast hits to 755 proteins in 354 species: Archae - 0; Bacteria - 517; Metazoa - 77; Fungi - 32; Plants - 43; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).

AT5G03360 AT5G03360.1 TATGGCCCATG DC1 domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, hypocotyl, root, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT4G26380.1); Has 2474 Blast hits to 510 proteins in 22 species: Archae - 2; Bacteria - 7; Metazoa - 3; Fungi - 0; Plants - 2453; Viruses - 4; Other Eukaryotes - 5 (source: NCBI BLink).

AT5G04710 AT5G04710.1 CATGGGCCAT aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G60160.1); Has 1276 Blast hits to 1273 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 40; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink).

AT5G04710.1 CATGGGCCCAAAGCCCATA aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G60160.1); Has 1276 Blast hits to 1273 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 40; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink).

AT5G05230 AT5G05230.1 CCATGGGCCCTA ubiquitin-protein ligase; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40640.1); Has 74 Blast hits to 74 proteins in 19 species: Archae - 0; Bacteria - 4; Metazoa - 14; Fungi - 8; Plants - 46; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT5G05320 AT5G05320.1 CATTGGGCCCATG monooxygenase, putative (MO3); FUNCTIONS IN: monooxygenase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938); BEST Arabidopsis thaliana protein match is: monooxygenase, putative (MO2) (TAIR:AT4G38540.1); Has 3563 Blast hits to 3548 proteins in 650 species: Archae - 42; Bacteria - 1804; Metazoa - 7; Fungi - 839; Plants - 277; Viruses - 0; Other Eukaryotes - 594 (source: NCBI BLink).

AT5G05610 AT5G05610.1 GATGGGCCATGGGCCAGGCCCATTT AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.

AT5G05610.2 GATGGGCCATGGGCCAGGCCCATTT AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.

AT5G06260 AT5G06260.1 CATGGGCCTT nucleolar protein-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571), EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: calcium ion binding (TAIR:AT4G34070.1); Has 925 Blast hits to 924 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 578; Fungi - 44; Plants - 76; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink).

AT5G09450 AT5G09450.1 CATGGGCCCATTAG pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 2335 Blast hits to 1588 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 6; Plants - 2224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).

AT5G11580 AT5G11580.1 TATAGGCCCATG UVB-resistance protein-related / regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: chromatin binding, Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15654 Blast hits to 4338 proteins in 271 species: Archae - 65; Bacteria - 1617; Metazoa - 6245; Fungi - 716; Plants - 1411; Viruses - 0; Other Eukaryotes - 5600 (source: NCBI BLink).

AT5G12430 AT5G12430.1 ACGGCCCATG DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding, binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Tetratricopeptide region (InterPro:IPR013026), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G41520.1); Has 19638 Blast hits to 17041 proteins in 1841 species: Archae - 148; Bacteria - 5474; Metazoa - 5128; Fungi - 2024; Plants - 1768; Viruses - 11; Other Eukaryotes - 5085 (source: NCBI BLink).

AT5G13240 AT5G13240.1 ACGGCCCATG transcription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: negative regulation of transcription from RNA polymerase III promoter; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Maf1 regulator (InterPro:IPR015257), RNA polymerase III transcriptional repressor, MAF1 (InterPro:IPR017152); Has 250 Blast hits to 250 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 84; Plants - 23; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).

AT5G13910 AT5G13910.1 CATGGGCCAC Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (LEAFY PETIOLE). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. Acts as a positive regulator of gibberellic acid-induced germination.

AT5G14040 AT5G14040.1 AAAAAGCCCATGGGCCAA mitochondrial phosphate transporter; FUNCTIONS IN: binding; INVOLVED IN: transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial phosphate transporter, putative (TAIR:AT3G48850.1); Has 12348 Blast hits to 8451 proteins in 336 species: Archae - 0; Bacteria - 0; Metazoa - 6294; Fungi - 3202; Plants - 1869; Viruses - 3; Other Eukaryotes - 980 (source: NCBI BLink).

AT5G14050 AT5G14050.1 TTGGCCCATGGGCTTTTT transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: TAF5 (TBP-ASSOCIATED FACTOR 5); nucleotide binding / transcription regulator (TAIR:AT5G25150.1); Has 4822 Blast hits to 3684 proteins in 283 species: Archae - 24; Bacteria - 1509; Metazoa - 1460; Fungi - 771; Plants - 200; Viruses - 2; Other Eukaryotes - 856 (source: NCBI BLink).

AT5G14610 AT5G14610.1 CATGGGCCCAAAT ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding / protein binding; FUNCTIONS IN: protein binding, helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), WW/Rsp5/WWP (InterPro:IPR001202), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DRH1 (DEAD BOX RNA HELICASE 1); ATP-dependent RNA helicase/ ATPase (TAIR:AT3G01540.4); Has 52477 Blast hits to 39251 proteins in 1971 species: Archae - 612; Bacteria - 22224; Metazoa - 10881; Fungi - 4675; Plants - 4189; Viruses - 260; Other Eukaryotes - 9636 (source: NCBI BLink).

AT5G16220 AT5G16220.1 CATGGGCCCAAAT octicosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT2G01190.1); Has 247 Blast hits to 246 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 12; Plants - 175; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).

AT5G16240 AT5G16240.1 CGGCCCATGGGCCTCT acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT3G02630.1); Has 575 Blast hits to 572 proteins in 129 species: Archae - 0; Bacteria - 208; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).

AT5G16710 AT5G16710.1 TGAGGCCCATG The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.

AT5G17610 AT5G17610.1 TATAGGCCCATGTAAGCCCATAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 44 Blast hits to 44 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G17900 AT5G17900.1 ATAGGCCCATGAAAGCCCAATAG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink).

AT5G18620 AT5G18620.1 GCCCATGGGCCTTTAAAGCCC CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink).

AT5G18620.2 GCCCATGGGCCTTTAAAGCCC CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink).

AT5G18630 AT5G18630.1 GGGCTTTAAAGGCCCATGGGC lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).

AT5G18630.2 GGGCTTTAAAGGCCCATGGGC lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).

AT5G18630.3 GGGCTTTAAAGGCCCATGGGC lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).

AT5G19930 AT5G19930.1 CTATTGGGTCAGCCCATTTGAGGCCCATG integral membrane family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF92, transmembrane (InterPro:IPR002794); Has 682 Blast hits to 682 proteins in 225 species: Archae - 93; Bacteria - 179; Metazoa - 99; Fungi - 48; Plants - 47; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink).

AT5G19940 AT5G19940.1 CATGGGCCTCAAATGGGCTGACCCAATAG plastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT5G19940.2 CATGGGCCTCAAATGGGCTGACCCAATAG plastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT5G20160 AT5G20160.1 CATGGGCCGAA ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).

AT5G20160.2 CATGGGCCGAA ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).

AT5G20160.3 CATGGGCCGAA ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).

AT5G22640 AT5G22640.1 AACGGCCCATG embryo defective 1211 (emb1211); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MORN motif (InterPro:IPR003409); Has 20090 Blast hits to 11448 proteins in 643 species: Archae - 30; Bacteria - 1497; Metazoa - 7184; Fungi - 2271; Plants - 998; Viruses - 319; Other Eukaryotes - 7791 (source: NCBI BLink).

AT5G26680 AT5G26680.1 CATGGGCCTTAA endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink).

AT5G26680.2 CATGGGCCTTAA endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink).

AT5G27700 AT5G27700.1 CATGGGCCTT structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e, conserved site (InterPro:IPR018279), Ribosomal protein S21e (InterPro:IPR001931); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S21 (RPS21B) (TAIR:AT3G53890.2); Has 477 Blast hits to 477 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).

AT5G35360 AT5G35360.1 TGGCCCATG Encodes biotin carboxylase subunit (CAC2).

AT5G35360.2 TGGCCCATG Encodes biotin carboxylase subunit (CAC2).

AT5G38110 AT5G38110.1 TTAGCCCATGGGCCTTAA This gene is predicted to encode a silencing group A protein. Plant lines expressing RNAi constructs directed against SGA1 have reduced levels of agrobacterium-mediated root transformation.

AT5G40810 AT5G40810.1 ATTAGGCCCATG cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrial respiratory chain, mitochondrion, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT3G27240.1); Has 2945 Blast hits to 2945 proteins in 515 species: Archae - 0; Bacteria - 722; Metazoa - 171; Fungi - 166; Plants - 63; Viruses - 0; Other Eukaryotes - 1823 (source: NCBI BLink).

AT5G40810.2 ATTAGGCCCATG cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrial respiratory chain, mitochondrion, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT3G27240.1); Has 2945 Blast hits to 2945 proteins in 515 species: Archae - 0; Bacteria - 722; Metazoa - 171; Fungi - 166; Plants - 63; Viruses - 0; Other Eukaryotes - 1823 (source: NCBI BLink).

AT5G41970 AT5G41970.1 TTAAGGCCCATGGGCCTTTA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metal-dependent protein hydrolase (InterPro:IPR003226); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49320.1); Has 464 Blast hits to 461 proteins in 209 species: Archae - 0; Bacteria - 122; Metazoa - 131; Fungi - 87; Plants - 29; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).

AT5G47580 AT5G47580.1 ATTAGGCCCATG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17250.1); Has 17 Blast hits to 16 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G50960 AT5G50960.1 ATAAGGCCCATG Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal.

AT5G53340 AT5G53340.1 ACGGCCCATGG galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT2G25300.1); Has 473 Blast hits to 472 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 202; Fungi - 0; Plants - 265; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).

AT5G53340.2 ACGGCCCATGG galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT2G25300.1); Has 473 Blast hits to 472 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 202; Fungi - 0; Plants - 265; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).

AT5G53350 AT5G53350.1 CCATGGGCCGT CLP protease regulatory subunit CLPX mRNA, nuclear gene

AT5G55070 AT5G55070.1 CATGGGCCGTTGGGCCTAT 2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: response to oxidative stress, metabolic process; LOCATED IN: cytosolic ribosome, mitochondrion; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT4G26910.2); Has 20861 Blast hits to 17461 proteins in 1458 species: Archae - 93; Bacteria - 9038; Metazoa - 1182; Fungi - 580; Plants - 756; Viruses - 230; Other Eukaryotes - 8982 (source: NCBI BLink).

AT5G56360 AT5G56360.1 ATGGCCCATG calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Low density lipoprotein-receptor, class A, cysteine-rich (InterPro:IPR002172), Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); BEST Arabidopsis thaliana protein match is: protein kinase C substrate, heavy chain-related (TAIR:AT2G42390.1); Has 52492 Blast hits to 29968 proteins in 1344 species: Archae - 253; Bacteria - 7152; Metazoa - 21077; Fungi - 6018; Plants - 1646; Viruses - 404; Other Eukaryotes - 15942 (source: NCBI BLink).

AT5G57440 AT5G57440.1 TACGGCCCATG a member of haloacid dehalogenase-like hydrolase family

AT5G59210 AT5G59210.1 CCATGGGCCTATT myosin heavy chain-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05320.3); Has 52386 Blast hits to 29309 proteins in 1451 species: Archae - 516; Bacteria - 4841; Metazoa - 28674; Fungi - 3719; Plants - 1637; Viruses - 146; Other Eukaryotes - 12853 (source: NCBI BLink).

AT5G59210.2 CCATGGGCCTATT myosin heavy chain-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05320.3); Has 52386 Blast hits to 29309 proteins in 1451 species: Archae - 516; Bacteria - 4841; Metazoa - 28674; Fungi - 3719; Plants - 1637; Viruses - 146; Other Eukaryotes - 12853 (source: NCBI BLink).

AT5G59750 AT5G59750.1 GTGGCCCATG riboflavin biosynthesis protein, putative; FUNCTIONS IN: 3,4-dihydroxy-2-butanone-4-phosphate synthase activity, GTP cyclohydrolase II activity; INVOLVED IN: riboflavin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP cyclohydrolase II (InterPro:IPR000926), DHBP synthase RibB (InterPro:IPR000422), DHBP synthase RibB-like alpha/beta domain (InterPro:IPR017945); BEST Arabidopsis thaliana protein match is: ATGCH; 3,4-dihydroxy-2-butanone-4-phosphate synthase/ GTP cyclohydrolase II (TAIR:AT5G64300.1); Has 8351 Blast hits to 8350 proteins in 1311 species: Archae - 133; Bacteria - 4029; Metazoa - 0; Fungi - 273; Plants - 55; Viruses - 0; Other Eukaryotes - 3861 (source: NCBI BLink).

AT5G59910 AT5G59910.1 CATGGGCCGAT HTB4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT2G28720.1); Has 3079 Blast hits to 2919 proteins in 300 species: Archae - 0; Bacteria - 69; Metazoa - 1920; Fungi - 175; Plants - 374; Viruses - 0; Other Eukaryotes - 541 (source: NCBI BLink).

AT5G60940 AT5G60940.1 ATTGGCCCATG transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink).

AT5G60940.2 ATTGGCCCATG transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink).

AT5G66570 AT5G66570.1 CATGGGCCAC Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type.