| Locus | Gene model | Sequence | Description |
| AT1G01160 | AT1G01160.1 | CCATGGGCCTTAG | Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA |
| AT1G01160.2 | CCATGGGCCTTAG | Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA |
| AT1G01560 | AT1G01560.1 | CCATGGGC | member of MAP Kinase |
| AT1G01560.2 | CCATGGGC | member of MAP Kinase |
| AT1G02816 | AT1G02816.1 | TTAAAGCCCATGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G09415 | AT1G09415.1 | CCCATGGGC | encodes a kinase that physically interacts with NPR1/NIM1 |
| AT1G10840 | AT1G10840.1 | CCATGGGC | Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1). |
| AT1G10840.2 | CCATGGGC | Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1). |
| AT1G17890 | AT1G17890.1 | TTTAGGCCCATGGGCCA | GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink). |
| AT1G17890.2 | TTTAGGCCCATGGGCCA | GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink). |
| AT1G17890.3 | TTTAGGCCCATGGGCCA | GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink). |
| AT1G24706 | AT1G24706.1 | TGAGCCCATGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 25479 Blast hits to 15950 proteins in 654 species: Archae - 12; Bacteria - 897; Metazoa - 14432; Fungi - 3233; Plants - 1262; Viruses - 124; Other Eukaryotes - 5519 (source: NCBI BLink). |
| AT1G26800 | AT1G26800.1 | TTTAGGCCCATGGG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14200.1); Has 6695 Blast hits to 6676 proteins in 207 species: Archae - 0; Bacteria - 0; Metazoa - 2341; Fungi - 548; Plants - 2751; Viruses - 14; Other Eukaryotes - 1041 (source: NCBI BLink). |
| AT1G33120 | AT1G33120.1 | TTTAACGGGCCATGGGCTTAT | 60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G34630 | AT1G34630.1 | ATAAGCCCATGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51150.1); Has 221 Blast hits to 214 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT1G34630.2 | ATAAGCCCATGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51150.1); Has 221 Blast hits to 214 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT1G52300 | AT1G52300.1 | TTAAGGCCCATGGGCCTGA | 60S ribosomal protein L37 (RPL37B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331), Ribosomal protein L37e (InterPro:IPR001569); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37C) (TAIR:AT3G16080.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT1G62880 | AT1G62880.1 | CCCATGGGCTTA | cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G12390.1); Has 465 Blast hits to 465 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 110; Plants - 43; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G62880.2 | CCCATGGGCTTA | cornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G12390.1); Has 465 Blast hits to 465 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 110; Plants - 43; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G64510 | AT1G64510.1 | AAAAGGCCCATGG | ribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: thylakoid, chloroplast thylakoid membrane, ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 978 Blast hits to 978 proteins in 282 species: Archae - 0; Bacteria - 578; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink). |
| AT1G64520 | AT1G64520.1 | CCATGGGCCTTTT | Regulatory Particle non-ATPase 12a (RPN12a); FUNCTIONS IN: peptidase activity; INVOLVED IN: in 14 processes; LOCATED IN: proteasome complex, nucleus, proteasome regulatory particle, lid subcomplex, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746), SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); BEST Arabidopsis thaliana protein match is: RPN12b (Regulatory Particle Non-ATPase 12b); peptidase (TAIR:AT5G42040.1); Has 353 Blast hits to 353 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 84; Plants - 39; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT1G73230 | AT1G73230.1 | TAGGGCCCATGG | nascent polypeptide-associated complex (NAC) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative (TAIR:AT1G17880.1); Has 618 Blast hits to 618 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 331; Fungi - 126; Plants - 89; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT2G01090 | AT2G01090.1 | CCATGGGCTTG | ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT1G15120.1); Has 95 Blast hits to 95 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 2; Plants - 49; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT2G01250 | AT2G01250.1 | CCATGGGCTTTTT | 60S ribosomal protein L7 (RPL7B); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7C) (TAIR:AT2G44120.2); Has 979 Blast hits to 977 proteins in 287 species: Archae - 144; Bacteria - 0; Metazoa - 384; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). |
| AT2G01250.2 | CCATGGGCTTTTT | 60S ribosomal protein L7 (RPL7B); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7C) (TAIR:AT2G44120.2); Has 979 Blast hits to 977 proteins in 287 species: Archae - 144; Bacteria - 0; Metazoa - 384; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). |
| AT2G04378 | AT2G04378.1 | CAGGCCCATGG | beta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G04378.2 | CAGGCCCATGG | beta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G04390 | AT2G04390.1 | CCATGGGCCTG | 40S ribosomal protein S17 (RPS17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus, plasma membrane; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT2G17043 | AT2G17043.1 | ATAAGCCCATGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G17070.1). |
| AT2G17870 | AT2G17870.1 | CCATGGGCCTGA | cold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink). |
| AT2G23440 | AT2G23440.1 | CCCATGGGCCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; Has 8 Blast hits to 8 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G25590 | AT2G25590.1 | AAAGCCCATGG | agenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT4G32440.2); Has 66 Blast hits to 64 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 66; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G02630 | AT3G02630.1 | TATGGCCCATGGGCTTG | acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT5G16240.1); Has 567 Blast hits to 564 proteins in 126 species: Archae - 0; Bacteria - 200; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT3G07200 | AT3G07200.1 | CAAAGCCCATGGGCCTTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G48655.3); Has 4419 Blast hits to 4404 proteins in 583 species: Archae - 0; Bacteria - 0; Metazoa - 3082; Fungi - 473; Plants - 291; Viruses - 27; Other Eukaryotes - 546 (source: NCBI BLink). |
| AT3G07200.2 | CAAAGCCCATGGGCCTTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G48655.3); Has 4419 Blast hits to 4404 proteins in 583 species: Archae - 0; Bacteria - 0; Metazoa - 3082; Fungi - 473; Plants - 291; Viruses - 27; Other Eukaryotes - 546 (source: NCBI BLink). |
| AT3G10040 | AT3G10040.1 | CCATGGGC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT1G21200.1); Has 3218 Blast hits to 1770 proteins in 207 species: Archae - 1; Bacteria - 114; Metazoa - 1149; Fungi - 271; Plants - 148; Viruses - 61; Other Eukaryotes - 1474 (source: NCBI BLink). |
| AT3G14150 | AT3G14150.1 | TAAAGCCCATGGGCTGA | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink). |
| AT3G14150.2 | TAAAGCCCATGGGCTGA | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink). |
| AT3G14160 | AT3G14160.1 | TCAGCCCATGGGCTTTA | oxidoreductase; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G14140.1); Has 756 Blast hits to 755 proteins in 353 species: Archae - 0; Bacteria - 523; Metazoa - 76; Fungi - 30; Plants - 41; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT3G16260 | AT3G16260.1 | CAAAGGCCCATGGGCTAA | Encodes a tRNase Z. |
| AT3G18500 | AT3G18500.1 | ATTGGCCCATGGCCCATGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: endonuclease/exonuclease/phosphatase family protein (TAIR:AT1G73875.1); Has 964 Blast hits to 937 proteins in 164 species: Archae - 0; Bacteria - 37; Metazoa - 442; Fungi - 164; Plants - 170; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). |
| AT3G18500.2 | ATTGGCCCATGGCCCATGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: endonuclease/exonuclease/phosphatase family protein (TAIR:AT1G73875.1); Has 964 Blast hits to 937 proteins in 164 species: Archae - 0; Bacteria - 37; Metazoa - 442; Fungi - 164; Plants - 170; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). |
| AT3G19508 | AT3G19508.1 | GCCCATGG | unknown protein; LOCATED IN: mitochondrion; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52940 | AT3G52940.1 | CCCATGGGCCATA | Encodes a sterol C-14 reductase required for cell division and expansion and is involved in proper organization of the embryo. |
| AT3G52940.2 | CCCATGGGCCATA | Encodes a sterol C-14 reductase required for cell division and expansion and is involved in proper organization of the embryo. |
| AT3G63410 | AT3G63410.1 | TGAGCCCATGGGCTCA | Encodes a MPBQ/MSBQ methyltransferase located in the chloroplast inner envelope membrane. Mutant plants lack plastoquinone (PQ), suggesting that the APG1 protein is involved in the methylation step of PQ biosynthesis. The gene product is also involved in tocopherol (vitamin E) biosynthesis. |
| AT4G00350 | AT4G00350.1 | CCATGGGCAGCGCGTGA | MATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT4G25640.1); Has 5603 Blast hits to 5531 proteins in 1072 species: Archae - 100; Bacteria - 3671; Metazoa - 119; Fungi - 210; Plants - 712; Viruses - 0; Other Eukaryotes - 791 (source: NCBI BLink). |
| AT4G14430 | AT4G14430.1 | CCGGCCCATGGGCCTTTA | Encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation. This enzyme might also be involved in the conversion of indole-3-butyric acid to indole-3-acetic acid via a beta-oxidation-like pathway. |
| AT4G16265 | AT4G16265.1 | ATATGGGCCGGCCCATGGGCTTTA | One of two highly similar, non-catalytic subunits common to nuclear DNA-directed RNA polymerases II, IV and V; homologous to budding yeast RPB9. Appears to be redundant with At3g16980 |
| AT4G30750 | AT4G30750.1 | TTGGCCCATGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30730.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G30760 | AT4G30760.1 | CCATGGGCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G30760.2 | CCATGGGCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38220 | AT4G38220.1 | GAAGCCCATGG | aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative; FUNCTIONS IN: hydrolase activity, metallopeptidase activity, aminoacylase activity, protein dimerization activity; INVOLVED IN: amino acid metabolic process, proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ArgE/DapE/ACY1/CPG2/YscS, conserved site (InterPro:IPR001261), Peptidase M20 (InterPro:IPR002933), N-acyl-L-amino-acid amidohydrolase (InterPro:IPR010159), Peptidase M20, dimerisation (InterPro:IPR011650); BEST Arabidopsis thaliana protein match is: aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative (TAIR:AT1G44820.1); Has 4312 Blast hits to 4309 proteins in 975 species: Archae - 99; Bacteria - 2604; Metazoa - 360; Fungi - 186; Plants - 40; Viruses - 2; Other Eukaryotes - 1021 (source: NCBI BLink). |
| AT4G38220.2 | GAAGCCCATGG | aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative; FUNCTIONS IN: hydrolase activity, metallopeptidase activity, aminoacylase activity, protein dimerization activity; INVOLVED IN: amino acid metabolic process, proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ArgE/DapE/ACY1/CPG2/YscS, conserved site (InterPro:IPR001261), Peptidase M20 (InterPro:IPR002933), N-acyl-L-amino-acid amidohydrolase (InterPro:IPR010159), Peptidase M20, dimerisation (InterPro:IPR011650); BEST Arabidopsis thaliana protein match is: aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative (TAIR:AT1G44820.1); Has 4312 Blast hits to 4309 proteins in 975 species: Archae - 99; Bacteria - 2604; Metazoa - 360; Fungi - 186; Plants - 40; Viruses - 2; Other Eukaryotes - 1021 (source: NCBI BLink). |
| AT4G39630 | AT4G39630.1 | TGAGCCCATGGGCCGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G01260 | AT5G01260.1 | TTGGCCCATGGGCTTTAA | glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT5G01260.2 | TTGGCCCATGGGCTTTAA | glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT5G01780 | AT5G01780.1 | GAGGCCCATGGGCCCATG | oxidoreductase; FUNCTIONS IN: oxidoreductase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase (TAIR:AT3G14160.1); Has 755 Blast hits to 755 proteins in 354 species: Archae - 0; Bacteria - 517; Metazoa - 77; Fungi - 32; Plants - 43; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT5G05230 | AT5G05230.1 | CCATGGGCCCTA | ubiquitin-protein ligase; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40640.1); Has 74 Blast hits to 74 proteins in 19 species: Archae - 0; Bacteria - 4; Metazoa - 14; Fungi - 8; Plants - 46; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G05610 | AT5G05610.1 | GATGGGCCATGGGCCAGGCCCATTT | AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. |
| AT5G05610.2 | GATGGGCCATGGGCCAGGCCCATTT | AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. |
| AT5G14040 | AT5G14040.1 | AAAAAGCCCATGGGCCAA | mitochondrial phosphate transporter; FUNCTIONS IN: binding; INVOLVED IN: transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial phosphate transporter, putative (TAIR:AT3G48850.1); Has 12348 Blast hits to 8451 proteins in 336 species: Archae - 0; Bacteria - 0; Metazoa - 6294; Fungi - 3202; Plants - 1869; Viruses - 3; Other Eukaryotes - 980 (source: NCBI BLink). |
| AT5G14050 | AT5G14050.1 | TTGGCCCATGGGCTTTTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: TAF5 (TBP-ASSOCIATED FACTOR 5); nucleotide binding / transcription regulator (TAIR:AT5G25150.1); Has 4822 Blast hits to 3684 proteins in 283 species: Archae - 24; Bacteria - 1509; Metazoa - 1460; Fungi - 771; Plants - 200; Viruses - 2; Other Eukaryotes - 856 (source: NCBI BLink). |
| AT5G16240 | AT5G16240.1 | CGGCCCATGGGCCTCT | acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT3G02630.1); Has 575 Blast hits to 572 proteins in 129 species: Archae - 0; Bacteria - 208; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G18620 | AT5G18620.1 | GCCCATGGGCCTTTAAAGCCC | CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink). |
| AT5G18620.2 | GCCCATGGGCCTTTAAAGCCC | CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink). |
| AT5G18630 | AT5G18630.1 | GGGCTTTAAAGGCCCATGGGC | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT5G18630.2 | GGGCTTTAAAGGCCCATGGGC | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT5G18630.3 | GGGCTTTAAAGGCCCATGGGC | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT5G38110 | AT5G38110.1 | TTAGCCCATGGGCCTTAA | This gene is predicted to encode a silencing group A protein. Plant lines expressing RNAi constructs directed against SGA1 have reduced levels of agrobacterium-mediated root transformation. |
| AT5G41970 | AT5G41970.1 | TTAAGGCCCATGGGCCTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metal-dependent protein hydrolase (InterPro:IPR003226); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49320.1); Has 464 Blast hits to 461 proteins in 209 species: Archae - 0; Bacteria - 122; Metazoa - 131; Fungi - 87; Plants - 29; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). |
| AT5G53340 | AT5G53340.1 | ACGGCCCATGG | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT2G25300.1); Has 473 Blast hits to 472 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 202; Fungi - 0; Plants - 265; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G53340.2 | ACGGCCCATGG | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT2G25300.1); Has 473 Blast hits to 472 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 202; Fungi - 0; Plants - 265; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G53350 | AT5G53350.1 | CCATGGGCCGT | CLP protease regulatory subunit CLPX mRNA, nuclear gene |
| AT5G59210 | AT5G59210.1 | CCATGGGCCTATT | myosin heavy chain-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05320.3); Has 52386 Blast hits to 29309 proteins in 1451 species: Archae - 516; Bacteria - 4841; Metazoa - 28674; Fungi - 3719; Plants - 1637; Viruses - 146; Other Eukaryotes - 12853 (source: NCBI BLink). |
| AT5G59210.2 | CCATGGGCCTATT | myosin heavy chain-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05320.3); Has 52386 Blast hits to 29309 proteins in 1451 species: Archae - 516; Bacteria - 4841; Metazoa - 28674; Fungi - 3719; Plants - 1637; Viruses - 146; Other Eukaryotes - 12853 (source: NCBI BLink). |
| AT5G60360 | AT5G60360.1 | CCATGGGC | Encodes a senescence-associated thiol protease. |
| AT5G60360.2 | CCATGGGC | Encodes a senescence-associated thiol protease. |
| AT5G60360.3 | CCATGGGC | Encodes a senescence-associated thiol protease. |
| AT5G66410 | AT5G66410.1 | TTAGCCCATGG | Encodes a protein that functions in microtubule assembly. Plants with reduced levels of both PLP3a (At3g50960) and PLP3b show defects in cytokinesis, cortical microtubule array formation, oriented cell growth, and maintenance of proper ploidy. |