Organism | Arabidopsis thaliana | |
ID | AtREG510 | |
Sequence | AGCCCACT | |
Annotation | ||
PPDB Motif | GCCCA | Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression |
PLACE Motif | TGGGCY | "Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);) |
Total Entry Count | 165 |
Locus | Gene model | Sequence | Description |
AT1G03040 | AT1G03040.1 | AAAAAGCCCACT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, acetyl-CoA biosynthetic process from pyruvate; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: UNE12 (unfertilized embryo sac 12); DNA binding / transcription factor (TAIR:AT4G02590.2); Has 1617 Blast hits to 1617 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 0; Plants - 1602; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G03040.1 | ATAAAGCCCACT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, acetyl-CoA biosynthetic process from pyruvate; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: UNE12 (unfertilized embryo sac 12); DNA binding / transcription factor (TAIR:AT4G02590.2); Has 1617 Blast hits to 1617 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 0; Plants - 1602; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G09520 | AT1G09520.1 | AGTGGGCTCA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G09520.1 | TCAGCCCACTA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT1G09800 | AT1G09800.1 | AAAGCCCACTA | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT3G06950.1); Has 6844 Blast hits to 5672 proteins in 1445 species: Archae - 71; Bacteria - 3683; Metazoa - 118; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2917 (source: NCBI BLink).  |
AT1G10570 | AT1G10570.1 | GAAGCCCACTA | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation.  |
AT1G10570.2 | GAAGCCCACTA | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation.  | |
AT1G10740 | AT1G10740.1 | AGCCCACT | unknown protein; INVOLVED IN: glycerol biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23330.1); Has 369 Blast hits to 369 proteins in 87 species: Archae - 0; Bacteria - 252; Metazoa - 1; Fungi - 4; Plants - 26; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  |
AT1G10740.2 | AGCCCACT | unknown protein; INVOLVED IN: glycerol biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23330.1); Has 369 Blast hits to 369 proteins in 87 species: Archae - 0; Bacteria - 252; Metazoa - 1; Fungi - 4; Plants - 26; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  | |
AT1G11180 | AT1G11180.1 | TAGTGGGCTTTT | secretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: SC3 (SECRETORY CARRIER 3); transmembrane transporter (TAIR:AT1G61250.1); Has 511 Blast hits to 511 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 333; Fungi - 12; Plants - 121; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
AT1G12780 | AT1G12780.1 | AGCCCACT | Encodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress.  |
AT1G13390 | AT1G13390.1 | AGTGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68490.1); Has 53 Blast hits to 53 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G13390.2 | AGTGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68490.1); Has 53 Blast hits to 53 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G15870 | AT1G15870.1 | AGTGGGCT | mitochondrial glycoprotein family protein / MAM33 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 278 Blast hits to 278 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 81; Plants - 116; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
AT1G16740 | AT1G16740.1 | TAGTGGGCTTTG | ribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).  |
AT1G16870 | AT1G16870.1 | TCAGCCCACT | mitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 30; Plants - 19; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  |
AT1G19530 | AT1G19530.1 | AGTGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, leaf apex, hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G20760 | AT1G20760.1 | AGTGGGCTTATAAAAGCCCATTTA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EPS15 homology (EH) (InterPro:IPR000261), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G21630.1); Has 10692 Blast hits to 4147 proteins in 323 species: Archae - 12; Bacteria - 3271; Metazoa - 3323; Fungi - 1334; Plants - 262; Viruses - 16; Other Eukaryotes - 2474 (source: NCBI BLink).  |
AT1G23530 | AT1G23530.1 | TAAAGCCCACT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70470.1); Has 25 Blast hits to 25 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G26761 | AT1G26761.1 | AGTGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 197 Blast hits to 129 proteins in 53 species: Archae - 0; Bacteria - 148; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT1G33120 | AT1G33120.1 | TAGTGGGCTGA | 60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).  |
AT1G33780 | AT1G33780.1 | TTATGGGCTTAGCCCACTA | unknown protein; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF179 (InterPro:IPR003774); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29240.2); Has 1773 Blast hits to 1773 proteins in 611 species: Archae - 0; Bacteria - 1186; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 522 (source: NCBI BLink).  |
AT1G34570 | AT1G34570.1 | AGTGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15750.1); Has 88 Blast hits to 88 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 44; Fungi - 7; Plants - 32; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT1G36380 | AT1G36380.1 | AAAAGCCCAGTGGGCTATTATAAGCCCATA | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G48920 | AT1G48920.1 | AAAAAGCCCACTA | Encodes the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants.  |
AT1G51510 | AT1G51510.1 | GAGCCCAAAATAAGCCCACTA | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm.  |
AT1G51510.1 | TAAAAGCCCAAAATAAGCCCACT | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm.  | |
AT1G54340 | AT1G54340.1 | AGTGGGCTTG | NADP-specific isocitrate dehydrogenase (ICDH)  |
AT1G62150 | AT1G62150.1 | AGTGGGCTTTT | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G62085.1); Has 429 Blast hits to 366 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 418; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT1G74410 | AT1G74410.1 | CAAAGCCCACT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G66070.1); Has 5472 Blast hits to 5456 proteins in 200 species: Archae - 0; Bacteria - 2; Metazoa - 1838; Fungi - 348; Plants - 2530; Viruses - 21; Other Eukaryotes - 733 (source: NCBI BLink).  |
AT1G74940 | AT1G74940.1 | AGTGGGCTAA | senescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT1G19200.1); Has 261 Blast hits to 261 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G75710 | AT1G75710.1 | AGCCCACTA | zinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT4G27240.1); Has 475 Blast hits to 218 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 74; Fungi - 30; Plants - 106; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink).  |
AT1G75980 | AT1G75980.1 | AGTGGGCT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053); Has 156 Blast hits to 156 proteins in 78 species: Archae - 4; Bacteria - 4; Metazoa - 109; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).  |
AT1G77670 | AT1G77670.1 | TAAAAGCCCACT | aminotransferase class I and II family protein; FUNCTIONS IN: 1-aminocyclopropane-1-carboxylate synthase activity, transferase activity, transferring nitrogenous groups, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: asparagine catabolic process, biosynthetic process, glutamate catabolic process to oxaloacetate, aspartate transamidation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 1-aminocyclopropane-1-carboxylate synthase (InterPro:IPR001176), Aminotransferase, class I and II (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: aminotransferase class I and II family protein (TAIR:AT2G22250.3); Has 31276 Blast hits to 31274 proteins in 1793 species: Archae - 712; Bacteria - 18280; Metazoa - 666; Fungi - 553; Plants - 905; Viruses - 0; Other Eukaryotes - 10160 (source: NCBI BLink).  |
AT1G78670 | AT1G78670.1 | AGTGGGCTCA | gamma-glutamyl hydrolase 3 (ATGGH3); FUNCTIONS IN: hydrolase activity, omega peptidase activity, catalytic activity; INVOLVED IN: glutamine metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C26, gamma-glutamyl hydrolase (InterPro:IPR015527), Peptidase C26 (InterPro:IPR011697); BEST Arabidopsis thaliana protein match is: gamma-glutamyl hydrolase, putative / gamma-Glu-X carboxypeptidase, putative / conjugase, putative (TAIR:AT1G78660.2); Has 274 Blast hits to 271 proteins in 59 species: Archae - 0; Bacteria - 0; Metazoa - 163; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT1G79550 | AT1G79550.1 | TCAGCCCACTA | Encodes cytosolic phosphoglycerate kinase (PGK).  |
AT1G79550.2 | TCAGCCCACTA | Encodes cytosolic phosphoglycerate kinase (PGK).  | |
AT1G79560 | AT1G79560.1 | TAGTGGGCTGA | encodes an FtsH protease that is localized to the chloroplast  |
AT1G79650 | AT1G79650.1 | AGCCCACTA | putative DNA repair protein RAD23  |
AT1G79650.2 | AGCCCACTA | putative DNA repair protein RAD23  | |
AT1G79650.3 | AGCCCACTA | putative DNA repair protein RAD23  | |
AT1G79660 | AT1G79660.1 | TAGTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16170.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G01930 | AT2G01930.1 | AGTGGGCTTTG | BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.  |
AT2G01930.2 | AGTGGGCTTTG | BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.  | |
AT2G02790 | AT2G02790.1 | CCAATAAGCCCACTAATAAAGCCCATTAT | IQ-domain 29 (IQD29); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD28 (IQ67 DOMAIN PROTEIN 28); calmodulin binding (TAIR:AT1G14380.2); Has 7393 Blast hits to 5438 proteins in 475 species: Archae - 15; Bacteria - 609; Metazoa - 3092; Fungi - 719; Plants - 642; Viruses - 17; Other Eukaryotes - 2299 (source: NCBI BLink).  |
AT2G17240 | AT2G17240.1 | TTATGGGCCACCCAATAAAAGCCTTTAAAAGCCCACTATCAAAACGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G24506.1); Has 3052 Blast hits to 987 proteins in 134 species: Archae - 0; Bacteria - 363; Metazoa - 1137; Fungi - 63; Plants - 119; Viruses - 54; Other Eukaryotes - 1316 (source: NCBI BLink).  |
AT2G18400 | AT2G18400.1 | AGCCCACTGGGCTTTG | ribosomal protein L6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: emb2394 (embryo defective 2394); structural constituent of ribosome (TAIR:AT1G05190.1); Has 5053 Blast hits to 5053 proteins in 1481 species: Archae - 1; Bacteria - 2961; Metazoa - 3; Fungi - 77; Plants - 71; Viruses - 0; Other Eukaryotes - 1940 (source: NCBI BLink).  |
AT2G20130 | AT2G20130.1 | AGTGGGCTTAT | LIKE COV 1 (LCV1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, flower, root, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1965 Blast hits to 1965 proteins in 370 species: Archae - 6; Bacteria - 694; Metazoa - 0; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 1180 (source: NCBI BLink).  |
AT2G20140 | AT2G20140.1 | ATAAGCCCACT | 26S protease regulatory complex subunit 4, putative; FUNCTIONS IN: hydrolase activity, nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), 26S proteasome subunit P45 (InterPro:IPR005937); BEST Arabidopsis thaliana protein match is: RPT2a (regulatory particle AAA-ATPase 2a); ATPase (TAIR:AT4G29040.1); Has 21701 Blast hits to 20141 proteins in 1744 species: Archae - 831; Bacteria - 5748; Metazoa - 4078; Fungi - 2440; Plants - 1746; Viruses - 26; Other Eukaryotes - 6832 (source: NCBI BLink).  |
AT2G20450 | AT2G20450.1 | TAGTGGGCTTC | 60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
AT2G23120 | AT2G23120.1 | AAAAGCCCACT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein 18 (InterPro:IPR018930); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23110.1); Has 25 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G23170 | AT2G23170.1 | AGCCCACT | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro.  |
AT2G24395 | AT2G24395.1 | TCAGCCCACTA | chaperone protein dnaJ-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 17 Blast hits to 17 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT2G25610 | AT2G25610.1 | AGTGGGCTATT | H+-transporting two-sector ATPase, C subunit family protein; FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: vacuolar ATP synthase, putative / V-ATPase, putative (TAIR:AT4G32530.1); Has 1596 Blast hits to 1304 proteins in 284 species: Archae - 70; Bacteria - 89; Metazoa - 650; Fungi - 323; Plants - 223; Viruses - 0; Other Eukaryotes - 241 (source: NCBI BLink).  |
AT2G30120 | AT2G30120.1 | AGTGGGCTTA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14750.1).  |
AT2G30120.2 | AGTGGGCTTA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14750.1).  | |
AT2G36060 | AT2G36060.1 | AGCCCACT | MMZ3/UEV1C encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1C can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. It can also rescue an mms2 ubc13 double mutant in yeast in combination with UBC13A. MMZ3/UEV1C transcripts are found at moderate levels in most plant organs, but cannot be detected in the pollen or 2 days after germination. Transcript levels do not appear to be stress-inducible.  |
AT2G36060.2 | AGCCCACT | MMZ3/UEV1C encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1C can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. It can also rescue an mms2 ubc13 double mutant in yeast in combination with UBC13A. MMZ3/UEV1C transcripts are found at moderate levels in most plant organs, but cannot be detected in the pollen or 2 days after germination. Transcript levels do not appear to be stress-inducible.  | |
AT2G36060.3 | AGCCCACT | MMZ3/UEV1C encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1C can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. It can also rescue an mms2 ubc13 double mutant in yeast in combination with UBC13A. MMZ3/UEV1C transcripts are found at moderate levels in most plant organs, but cannot be detected in the pollen or 2 days after germination. Transcript levels do not appear to be stress-inducible.  | |
AT2G38420 | AT2G38420.1 | TAGTGGGCTTTT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G64320.1); Has 11671 Blast hits to 4113 proteins in 157 species: Archae - 3; Bacteria - 20; Metazoa - 337; Fungi - 320; Plants - 10463; Viruses - 0; Other Eukaryotes - 528 (source: NCBI BLink).  |
AT2G40510 | AT2G40510.1 | ATAAAGCCCAAGCCCACTA | 40S ribosomal protein S26 (RPS26A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome, chloroplast; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26B) (TAIR:AT2G40590.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT2G40590 | AT2G40590.1 | ATAAAGCCTAAGCCCACTA | 40S ribosomal protein S26 (RPS26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26A) (TAIR:AT2G40510.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT2G41840 | AT2G41840.1 | TCAGGCCCATTTAAGCCCACT | 40S ribosomal protein S2 (RPS2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 9044 Blast hits to 7622 proteins in 1716 species: Archae - 183; Bacteria - 3055; Metazoa - 2026; Fungi - 746; Plants - 385; Viruses - 17; Other Eukaryotes - 2632 (source: NCBI BLink).  |
AT2G45710 | AT2G45710.1 | AGTGGGCTTT | 40S ribosomal protein S27 (RPS27A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, nucleolus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein S27e (InterPro:IPR000592); BEST Arabidopsis thaliana protein match is: ARS27A (ARABIDOPSIS RIBOSOMAL PROTEIN S27); structural constituent of ribosome (TAIR:AT3G61110.1); Has 690 Blast hits to 690 proteins in 269 species: Archae - 76; Bacteria - 0; Metazoa - 297; Fungi - 98; Plants - 99; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  |
AT2G48020 | AT2G48020.1 | AGTGGGCTCA | sugar transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: plasma membrane, chloroplast, vacuole, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: sugar transporter, putative (TAIR:AT5G18840.1); Has 20918 Blast hits to 20535 proteins in 1301 species: Archae - 281; Bacteria - 8879; Metazoa - 4687; Fungi - 4388; Plants - 1555; Viruses - 2; Other Eukaryotes - 1126 (source: NCBI BLink).  |
AT2G48020.2 | AGTGGGCTCA | sugar transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: plasma membrane, chloroplast, vacuole, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: sugar transporter, putative (TAIR:AT5G18840.1); Has 20918 Blast hits to 20535 proteins in 1301 species: Archae - 281; Bacteria - 8879; Metazoa - 4687; Fungi - 4388; Plants - 1555; Viruses - 2; Other Eukaryotes - 1126 (source: NCBI BLink).  | |
AT3G01980 | AT3G01980.1 | AGTGGGCTTTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink).  |
AT3G01980.2 | AGTGGGCTTTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink).  | |
AT3G01980.3 | AGTGGGCTTTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink).  | |
AT3G01980.4 | AGTGGGCTTTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink).  | |
AT3G03070 | AT3G03070.1 | AGTGGGCTTAT | NADH-ubiquinone oxidoreductase-related; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NADH dehydrogenase [ubiquinone] (complex I), iron-sulphur protein 6, mitochondria (InterPro:IPR016668); Has 203 Blast hits to 203 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 55; Plants - 28; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT3G04920 | AT3G04920.1 | TTTAGGCCCAGTGGGCTTC | 40S ribosomal protein S24 (RPS24A); FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S24e (InterPro:IPR001976), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal S24e conserved site (InterPro:IPR018098); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S24 (RPS24B) (TAIR:AT5G28060.1); Has 643 Blast hits to 643 proteins in 254 species: Archae - 56; Bacteria - 0; Metazoa - 305; Fungi - 103; Plants - 74; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
AT3G06680 | AT3G06680.1 | AGTGGGCTAA | 60S ribosomal protein L29 (RPL29B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29A) (TAIR:AT3G06700.3); Has 566 Blast hits to 566 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
AT3G06680.2 | AGTGGGCTAA | 60S ribosomal protein L29 (RPL29B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29A) (TAIR:AT3G06700.3); Has 566 Blast hits to 566 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  | |
AT3G07140 | AT3G07140.1 | AGCCCACT | GPI transamidase component Gpi16 subunit family protein; FUNCTIONS IN: GPI-anchor transamidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gpi16 subunit, GPI transamidase component (InterPro:IPR007245); Has 252 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 88; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT3G07140.2 | AGCCCACT | GPI transamidase component Gpi16 subunit family protein; FUNCTIONS IN: GPI-anchor transamidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gpi16 subunit, GPI transamidase component (InterPro:IPR007245); Has 252 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 88; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT3G10370 | AT3G10370.1 | AGCCCACT | mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase. possibly involved in storage lipid catabolism and glycerol assimilation, and in glycerol-3-phosphate shuttle which transports reducing power from cytosol to mitochondrion.  |
AT3G10730 | AT3G10730.1 | AGTGGGCTGGGCCAT | sad1/unc-84-like 2 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope, endoplasmic reticulum, spindle, phragmoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sad1/UNC-like, C-terminal (InterPro:IPR012919); BEST Arabidopsis thaliana protein match is: sad1/unc-84 protein-related (TAIR:AT5G04990.1); Has 419 Blast hits to 416 proteins in 105 species: Archae - 4; Bacteria - 31; Metazoa - 294; Fungi - 27; Plants - 31; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT3G10840 | AT3G10840.1 | AGTGGGCTTTTT | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G15490.1); Has 4701 Blast hits to 4652 proteins in 739 species: Archae - 42; Bacteria - 3042; Metazoa - 265; Fungi - 67; Plants - 169; Viruses - 4; Other Eukaryotes - 1112 (source: NCBI BLink).  |
AT3G10970 | AT3G10970.1 | TTAGCCCACTA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  |
AT3G10970.2 | TTAGCCCACTA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  | |
AT3G10970.3 | TTAGCCCACTA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  | |
AT3G11280 | AT3G11280.1 | AGTGGGCTTTG | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay).  |
AT3G11280.2 | AGTGGGCTTTG | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay).  | |
AT3G15352 | AT3G15352.1 | AAATGGGCCTAGCCCACT | Encodes protein similar to yeast COX17, a copper-binding protein that mediates the delivery of Cu to the mitochondria for the assembly of a functional cytochrome oxidase complex.  |
AT3G16050 | AT3G16050.1 | GAAGCCCACT | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation.  |
AT3G17590 | AT3G17590.1 | TGAGCCCATTTAAAGCCCACTA | Encodes the Arabidopsis homologue of yeast SNF5 and represents a conserved subunit of plant SWI/SNF complexes.  |
AT3G19680 | AT3G19680.1 | ATAAAGCCCACT | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1005 (InterPro:IPR010410); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G50040.1); Has 728 Blast hits to 127 proteins in 32 species: Archae - 0; Bacteria - 22; Metazoa - 26; Fungi - 20; Plants - 72; Viruses - 0; Other Eukaryotes - 588 (source: NCBI BLink).  |
AT3G22440 | AT3G22440.1 | AGTGGGCTTGGCCCA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G14900.1); Has 1107 Blast hits to 1058 proteins in 102 species: Archae - 0; Bacteria - 5; Metazoa - 133; Fungi - 62; Plants - 888; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
AT3G27530 | AT3G27530.1 | TAAAAGCCCACT | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC6 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (225 aa) portion of the protein.  |
AT3G45280 | AT3G45280.1 | CAAGCCCACTA | syntaxin of plants 72 (SYP72)  |
AT3G52590 | AT3G52590.1 | AGTGGGCTGGGCCTTTT | Ubiquitin extension protein  |
AT3G52590.1 | TAAAAGCCCACT | Ubiquitin extension protein  | |
AT3G53020 | AT3G53020.1 | TGATGGGCCTATTTAGTGGGCTTA | RPL24B encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B. Mutants showed defects in apical-basal gynoecium patterning similar to previously described ett and mp mutants. Transformation of stv1-1 mutant with a uORF-eliminated ETT construct partially suppressed the stv1 gynoecium phenotype, implying that STV1 could influence ETT translation through its uORFs. Regulated by TCP20.  |
AT3G53030 | AT3G53030.1 | TAAGCCCACTAAATAGGCCCATCA | Encodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31.  |
AT3G56820 | AT3G56820.1 | AAAGCCCACTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT3G57280 | AT3G57280.1 | TGAGCCCACT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G20510.1); Has 95 Blast hits to 95 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 21; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G62360 | AT3G62360.1 | TAGTGGGCTTTATAAAGCCCATTAAGCCCTA | carbohydrate binding; FUNCTIONS IN: carbohydrate binding; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784), Collagen-binding surface protein Cna-like, B region (InterPro:IPR008454); Has 234 Blast hits to 193 proteins in 70 species: Archae - 4; Bacteria - 76; Metazoa - 122; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
AT3G62370 | AT3G62370.1 | TAGGGCTTAATGGGCTTTATAAAGCCCACTA | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G63340 | AT3G63340.1 | TAGTGGGCTGGGCTTTTA | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C-related / PP2C-related (TAIR:AT3G63320.1); Has 3271 Blast hits to 3269 proteins in 215 species: Archae - 0; Bacteria - 0; Metazoa - 1075; Fungi - 380; Plants - 1004; Viruses - 5; Other Eukaryotes - 807 (source: NCBI BLink).  |
AT4G00830 | AT4G00830.1 | AGTGGGCTTA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink).  |
AT4G00830.2 | AGTGGGCTTA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink).  | |
AT4G03330 | AT4G03330.1 | CGGTTAAGTGGGCT | member of SYP12 Gene Family  |
AT4G03430 | AT4G03430.1 | AAAAAGCCCATTAAAAAGCCCACTA | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes.  |
AT4G10040 | AT4G10040.1 | TAAGCCCACT | Encodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers.  |
AT4G11380 | AT4G11380.1 | AGCCCACTA | beta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink).  |
AT4G12730 | AT4G12730.1 | AGCCCACT | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds  |
AT4G14110 | AT4G14110.1 | TAGTGGGCTTGGCCCATTTA | Represses photomorphogenesis and induces skotomorphogenesis in the dark. A component of the COP9 signalosome complex.  |
AT4G17010 | AT4G17010.1 | TAAGCCCACTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 8 growth stages; Has 58 Blast hits to 56 proteins in 16 species: Archae - 3; Bacteria - 2; Metazoa - 8; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
AT4G17085 | AT4G17085.1 | AGTGGGCTGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 6 Blast hits to 6 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G17960 | AT4G17960.1 | AGCCCACTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46620.1); Has 22 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G24920 | AT4G24920.1 | AGCCCACTA | protein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT5G50460.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT4G25580 | AT4G25580.1 | GAATGGGCTAGTGGGCTAA | stress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink).  |
AT4G29850 | AT4G29850.1 | AGCCCACT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0414 (InterPro:IPR008590); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19350.1); Has 188 Blast hits to 188 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G31770 | AT4G31770.1 | TAGTGGGCTTTTGGGCCTAAC | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, protein serine/threonine phosphatase activity; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lariat debranching enzyme, C-terminal (InterPro:IPR007708), Metallophosphoesterase (InterPro:IPR004843); Has 452 Blast hits to 397 proteins in 153 species: Archae - 0; Bacteria - 12; Metazoa - 181; Fungi - 155; Plants - 28; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  |
AT4G33110 | AT4G33110.1 | TAGTGGGCTGA | coclaurine N-methyltransferase, putative; FUNCTIONS IN: cyclopropane-fatty-acyl-phospholipid synthase activity, (S)-coclaurine-N-methyltransferase activity; INVOLVED IN: lipid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Cyclopropane-fatty-acyl-phospholipid synthase (InterPro:IPR003333); BEST Arabidopsis thaliana protein match is: coclaurine N-methyltransferase, putative (TAIR:AT4G33120.1); Has 6032 Blast hits to 6030 proteins in 921 species: Archae - 32; Bacteria - 2504; Metazoa - 56; Fungi - 238; Plants - 239; Viruses - 0; Other Eukaryotes - 2963 (source: NCBI BLink).  |
AT4G33120 | AT4G33120.1 | TAGTGGGCTGA | coclaurine N-methyltransferase, putative; FUNCTIONS IN: cyclopropane-fatty-acyl-phospholipid synthase activity, (S)-coclaurine-N-methyltransferase activity; INVOLVED IN: lipid biosynthetic process; CONTAINS InterPro DOMAIN/s: Cyclopropane-fatty-acyl-phospholipid synthase (InterPro:IPR003333); BEST Arabidopsis thaliana protein match is: coclaurine N-methyltransferase, putative (TAIR:AT4G33110.1); Has 5982 Blast hits to 5978 proteins in 904 species: Archae - 32; Bacteria - 2580; Metazoa - 59; Fungi - 244; Plants - 209; Viruses - 0; Other Eukaryotes - 2858 (source: NCBI BLink).  |
AT4G34270 | AT4G34270.1 | AGTGGGCT | TIP41-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: TIP41-like protein (InterPro:IPR007303); Has 248 Blast hits to 248 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 81; Plants - 27; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT4G36515 | AT4G36515.1 | AGTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G37460 | AT4G37460.1 | AGTGGGCTAGGCCCATATA | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms.Involved in mediating effector-triggered immunity.  |
AT4G38380 | AT4G38380.1 | AGTGGGCTTTAATGGGCTTA | antiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G38330.1); Has 7271 Blast hits to 7248 proteins in 1132 species: Archae - 174; Bacteria - 5061; Metazoa - 70; Fungi - 101; Plants - 194; Viruses - 0; Other Eukaryotes - 1671 (source: NCBI BLink).  |
AT4G38570 | AT4G38570.1 | GAAGCCCACT | PROBABLE CDP-DIACYLGLYCEROL--INOSITOL 3-PHOSPHATIDYLTRANSFERASE 2 (PIS2); FUNCTIONS IN: phosphotransferase activity, for other substituted phosphate groups; INVOLVED IN: phosphatidylinositol biosynthetic process; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CDP-alcohol phosphatidyltransferase (InterPro:IPR000462), CDP-diacylglycerol-inositol 3-phosphatidyltransferase, eukaryote (InterPro:IPR014387); BEST Arabidopsis thaliana protein match is: ATPIS1 (PHOSPHATIDYLINOSITOL SYNTHASE 1); CDP-diacylglycerol-inositol 3-phosphatidyltransferase (TAIR:AT1G68000.1); Has 1789 Blast hits to 1789 proteins in 607 species: Archae - 10; Bacteria - 915; Metazoa - 140; Fungi - 115; Plants - 45; Viruses - 0; Other Eukaryotes - 564 (source: NCBI BLink).  |
AT5G01010 | AT5G01010.1 | AGTGGGCTTG | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038).  |
AT5G01010.1 | AGTGGGCTTG | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038).  | |
AT5G01010.2 | AGTGGGCTTG | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038).  | |
AT5G01010.2 | AGTGGGCTTG | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038).  | |
AT5G01010.3 | AGTGGGCTTG | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038).  | |
AT5G01010.3 | AGTGGGCTTG | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038).  | |
AT5G01500 | AT5G01500.1 | AAGGCCCAACTGAGCCCACTA | encodes an ATP/ADP carrier that is located to the thylakoid membrane involved in providing ATP during thylakoid biogenesis and turnover  |
AT5G03180 | AT5G03180.1 | AGTGGGCT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G09760.1); Has 661 Blast hits to 661 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 261; Fungi - 40; Plants - 298; Viruses - 14; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT5G03830 | AT5G03830.1 | AGTGGGCTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: p21Cip1-binding protein-related (TAIR:AT2G44510.1); Has 225 Blast hits to 225 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 68; Plants - 27; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).  |
AT5G09660 | AT5G09660.1 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.  |
AT5G09660.2 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.  | |
AT5G09660.3 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.  | |
AT5G09660.4 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.  | |
AT5G11190 | AT5G11190.1 | TAGTGGGCTCA | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.  |
AT5G11240 | AT5G11240.1 | ATAAGCCCACTA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Protein of unknown function NUC189, C-terminal (InterPro:IPR012979), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 6246 Blast hits to 3792 proteins in 274 species: Archae - 28; Bacteria - 2331; Metazoa - 1477; Fungi - 1133; Plants - 291; Viruses - 0; Other Eukaryotes - 986 (source: NCBI BLink).  |
AT5G14970 | AT5G14970.1 | TAGTGGGCTCA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14910.1); Has 481 Blast hits to 320 proteins in 77 species: Archae - 0; Bacteria - 238; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink).  |
AT5G16940 | AT5G16940.1 | TAAGCCCACTA | carbon-sulfur lyase; FUNCTIONS IN: carbon-sulfur lyase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione-dependent formaldehyde-activating, GFA (InterPro:IPR006913); Has 1933 Blast hits to 1931 proteins in 352 species: Archae - 0; Bacteria - 664; Metazoa - 60; Fungi - 38; Plants - 18; Viruses - 0; Other Eukaryotes - 1153 (source: NCBI BLink).  |
AT5G16940.2 | TAAGCCCACTA | carbon-sulfur lyase; FUNCTIONS IN: carbon-sulfur lyase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione-dependent formaldehyde-activating, GFA (InterPro:IPR006913); Has 1933 Blast hits to 1931 proteins in 352 species: Archae - 0; Bacteria - 664; Metazoa - 60; Fungi - 38; Plants - 18; Viruses - 0; Other Eukaryotes - 1153 (source: NCBI BLink).  | |
AT5G16950 | AT5G16950.1 | TAGTGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G17910 | AT5G17910.1 | TTAGCCCACT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G29620.1); Has 44105 Blast hits to 19239 proteins in 906 species: Archae - 120; Bacteria - 7658; Metazoa - 18238; Fungi - 4859; Plants - 1612; Viruses - 441; Other Eukaryotes - 11177 (source: NCBI BLink).  |
AT5G19890 | AT5G19890.1 | AATAGCCCACT | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT5G06730.1); Has 2820 Blast hits to 2810 proteins in 191 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 39; Plants - 2752; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
AT5G20570 | AT5G20570.1 | AAAGCCCACTA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein.  |
AT5G20570.2 | AAAGCCCACTA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein.  | |
AT5G20570.3 | AAAGCCCACTA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein.  | |
AT5G20650 | AT5G20650.1 | TAAGCCCACT | encodes a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast  |
AT5G20660 | AT5G20660.1 | AGTGGGCTTA | 24 kDa vacuolar protein, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M28 (InterPro:IPR007484); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT1G67420.1); Has 935 Blast hits to 925 proteins in 208 species: Archae - 6; Bacteria - 236; Metazoa - 415; Fungi - 154; Plants - 39; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).  |
AT5G38160 | AT5G38160.1 | GAAGCCCACT | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein and hydrophobic protein, helical (InterPro:IPR013770); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G38170.1); Has 193 Blast hits to 190 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 193; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G38380 | AT5G38380.1 | TAGTGGGCTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 90 Blast hits to 90 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 66; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT5G38380.2 | TAGTGGGCTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 90 Blast hits to 90 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 66; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT5G40930 | AT5G40930.1 | AAAAGCCCATAAGGCCTTTTAAGCCCACT | Form of TOM20, which is a component of the TOM complex involved in transport of nuclear-encoded mitochondrial proteins  |
AT5G45820 | AT5G45820.1 | AGCCCACT | Encodes a CBL-interacting serine/threonine protein kinase comprised of an N-terminal kinase catalytic domain similar to SNF1/AMPK and a unique C-terminal regulatory domain.  |
AT5G54520 | AT5G54520.1 | TGGCCCAATTAAAGCCCACTA | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G10580.1); Has 17905 Blast hits to 12742 proteins in 467 species: Archae - 38; Bacteria - 2465; Metazoa - 8443; Fungi - 2995; Plants - 1496; Viruses - 0; Other Eukaryotes - 2468 (source: NCBI BLink).  |
AT5G56900 | AT5G56900.1 | GAAGCCCACT | CwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  |
AT5G56900.2 | GAAGCCCACT | CwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  | |
AT5G56910 | AT5G56910.1 | AGTGGGCTTC | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cystatin-related, plant (InterPro:IPR006525); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56920.1); Has 34 Blast hits to 34 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G58590 | AT5G58590.1 | TTAGCCCACTA | Encodes a Ran-binding protein 1 homolog (RanBP1).  |
AT5G58640 | AT5G58640.1 | AGTGGGCTTTAT | selenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT5G58640.2 | AGTGGGCTTTAT | selenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT5G59140 | AT5G59140.1 | TAGTGGGCTAA | SKP1 family protein; FUNCTIONS IN: protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); Has 313 Blast hits to 313 proteins in 108 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 77; Plants - 28; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT5G64900 | AT5G64900.1 | TTAGCCCACTA | Encodes a putative 92-aa protein that is the precursor of AtPep1, a 23-aa peptide which activates transcription of the defensive gene defensin (PDF1.2) and activates the synthesis of H2O2, both being components of the innate immune response.  |
AT5G65950 | AT5G65950.1 | AGTGGGCTTATAATGGGCCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 62; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).  |
AT5G66290 | AT5G66290.1 | AGTGGGCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G67220 | AT5G67220.1 | TAAGCCCACTAAAGCCCAAAA | nitrogen regulation family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, oxidation reduction, tRNA processing, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G49640.1); Has 7771 Blast hits to 7769 proteins in 1423 species: Archae - 42; Bacteria - 4261; Metazoa - 411; Fungi - 347; Plants - 96; Viruses - 0; Other Eukaryotes - 2614 (source: NCBI BLink).  |