version

Summary of AtREG513 (All List)

OrganismArabidopsis thaliana  
IDAtREG513  
SequenceACGTGGAC  
AnnotationABA, DREB1Aox  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifACGT  ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;  
ACGTG  ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;  
Total Entry Count206  

Entry Sequences (206 entries)

LocusGene modelSequenceDescription
AT1G01710AT1G01710.1CGAACCGAGTCCACGTacyl-CoA thioesterase family protein; FUNCTIONS IN: cyclic nucleotide binding, acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT4G00520.2); Has 2588 Blast hits to 2566 proteins in 602 species: Archae - 0; Bacteria - 1102; Metazoa - 404; Fungi - 233; Plants - 38; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink). 
AT1G02930AT1G02930.1ATCCACGTGGACEncodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). 
AT1G03400AT1G03400.1GTCCACGTTCGGTTA single copy gene that encodes a protein with sequence similarity to tomato E8 (ACC oxidase, the last step in ethylene biosynthesis) involved in ethylene synthesis and fruit ripening in tomato. This gene is not induced by ethylene in siliques. The transcript is found in siliques, etiolated seedlings, leaves, stems and flowers. 
AT1G04310AT1G04310.1GTCCACGTAGencodes an ethylene receptor related to bacterial two-component histidine kinases. 
AT1G09540AT1G09540.1CGACGTGGACEncodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. 
AT1G14900AT1G14900.1GTCCACGTCAGEncodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA. 
AT1G15180AT1G15180.1GTGACACGTGGACMATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MATE family transporter related protein (InterPro:IPR015521), Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G15170.1); Has 4248 Blast hits to 4206 proteins in 991 species: Archae - 55; Bacteria - 2461; Metazoa - 126; Fungi - 208; Plants - 689; Viruses - 0; Other Eukaryotes - 709 (source: NCBI BLink). 
AT1G15180.2GTGACACGTGGACMATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MATE family transporter related protein (InterPro:IPR015521), Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G15170.1); Has 4248 Blast hits to 4206 proteins in 991 species: Archae - 55; Bacteria - 2461; Metazoa - 126; Fungi - 208; Plants - 689; Viruses - 0; Other Eukaryotes - 709 (source: NCBI BLink). 
AT1G15380AT1G15380.1ACGTGGAClactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). 
AT1G15380.2ACGTGGAClactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). 
AT1G16700AT1G16700.1GTCCACGTNADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY) (TAIR:AT1G79010.1); Has 7775 Blast hits to 7384 proteins in 1556 species: Archae - 918; Bacteria - 3928; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink). 
AT1G17760AT1G17760.1ATCCACGTGGACEncodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. 
AT1G19440AT1G19440.1ACGTGGACEncodes KCS4, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). 
AT1G20340AT1G20340.1ACGTGGACrecombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis. 
AT1G20350AT1G20350.1GTCCACGTmitochondrial inner membrane translocase 
AT1G26270AT1G26270.1GTCCACGTphosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT2G03890.1); Has 429 Blast hits to 418 proteins in 129 species: Archae - 0; Bacteria - 2; Metazoa - 149; Fungi - 63; Plants - 133; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). 
AT1G28960AT1G28960.1AACACGTGGACARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink). 
AT1G28960.2AACACGTGGACARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink). 
AT1G28960.3AACACGTGGACARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink). 
AT1G28960.4AACACGTGGACARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink). 
AT1G28960.5AACACGTGGACARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink). 
AT1G29390AT1G29390.1GTCCACGTAGencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane. 
AT1G29390.2GTCCACGTAGencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane. 
AT1G29395AT1G29395.1GTCCACGTencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. Possibly targeted to thylakoid membrane. 
AT1G35580AT1G35580.1TCGTCGTTTAGTCCACGTAGEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. 
AT1G35580.2TCGTCGTTTAGTCCACGTAGEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. 
AT1G35580.3TCGTCGTTTAGTCCACGTAGEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. 
AT1G44575AT1G44575.1ACGTGGACEncoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. 
AT1G44575.2ACGTGGACEncoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. 
AT1G48920AT1G48920.1TCCACGTGGACEncodes the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants. 
AT1G53140AT1G53140.1GTCCACGTEncodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis. 
AT1G55820AT1G55820.1GTCCACGTGTCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1296 (InterPro:IPR009719); BEST Arabidopsis thaliana protein match is: GIP1 (GBF-INTERACTING PROTEIN 1); unfolded protein binding (TAIR:AT3G13222.1); Has 1009 Blast hits to 462 proteins in 111 species: Archae - 0; Bacteria - 42; Metazoa - 245; Fungi - 90; Plants - 135; Viruses - 12; Other Eukaryotes - 485 (source: NCBI BLink). 
AT1G61520AT1G61520.1ATTGCCACGTGGACPSI type III chlorophyll a/b-binding protein (Lhca3*1) 
AT1G61520.2ATTGCCACGTGGACPSI type III chlorophyll a/b-binding protein (Lhca3*1) 
AT1G62305AT1G62305.1TACACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11940.1); Has 342 Blast hits to 342 proteins in 16 species: Archae - 0; Bacteria - 9; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT1G62305.2TACACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11940.1); Has 342 Blast hits to 342 proteins in 16 species: Archae - 0; Bacteria - 9; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT1G65730AT1G65730.1GTCCACGTGArabidopsis thaliana metal-nicotianamine transporter YSL4 
AT1G67360AT1G67360.1ACGTGGACrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G67360.2ACGTGGACrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G68570AT1G68570.1GTCCACGTproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: PTR1 (PEPTIDE TRANSPORTER 1); dipeptide transporter/ transporter/ tripeptide transporter (TAIR:AT3G54140.1); Has 3536 Blast hits to 3259 proteins in 593 species: Archae - 0; Bacteria - 1199; Metazoa - 646; Fungi - 246; Plants - 1123; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink). 
AT1G72020AT1G72020.1CTACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G73170AT1G73170.1GTCCACGTGGTATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). 
AT1G73170.2GTCCACGTGGTATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). 
AT1G73980AT1G73980.1ACGTGGACphosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: adenylate cyclase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, cAMP biosynthetic process, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764), Adenylate cyclase (InterPro:IPR008172); BEST Arabidopsis thaliana protein match is: phosphoribulokinase/uridine kinase family protein (TAIR:AT1G26190.1); Has 2533 Blast hits to 2522 proteins in 907 species: Archae - 19; Bacteria - 1635; Metazoa - 298; Fungi - 83; Plants - 169; Viruses - 2; Other Eukaryotes - 327 (source: NCBI BLink). 
AT1G73990AT1G73990.1GTCCACGTEncodes a putative protease SppA (SppA). 
AT1G75080AT1G75080.1TACACGTGGACEncodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities. 
AT1G75080.2TACACGTGGACEncodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities. 
AT1G75510AT1G75510.1AGTCGGTCCACGTtranscription initiation factor IIF beta subunit (TFIIF-beta) family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, general RNA polymerase II transcription factor activity, catalytic activity, ATP binding, ATP-dependent helicase activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIF complex, mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039), Transcription initiation factor IIF, beta subunit (InterPro:IPR003196), Transcription initiation factor IIF, beta subunit, subgroup (InterPro:IPR016640); BEST Arabidopsis thaliana protein match is: ATP binding / RNA polymerase II transcription factor (TAIR:AT3G52270.1); Has 230 Blast hits to 230 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 84; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT1G75800AT1G75800.1GTCCACGTpathogenesis-related thaumatin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, conserved site (InterPro:IPR017949), Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G20030.2); Has 1077 Blast hits to 1068 proteins in 152 species: Archae - 2; Bacteria - 22; Metazoa - 59; Fungi - 47; Plants - 930; Viruses - 4; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G77120AT1G77120.1ATGCCACGTGGACCatalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. 
AT1G79270AT1G79270.1ATGACGTGGACevolutionarily conserved C-terminal region 8 (ECT8); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT6 (evolutionarily conserved C-terminal region 6) (TAIR:AT3G17330.1); Has 700 Blast hits to 699 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 84; Plants - 193; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). 
AT1G79790AT1G79790.1CTGACGTGGAChaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). 
AT1G79790.2CTGACGTGGAChaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). 
AT2G01420AT2G01420.1GTCCACGTEncodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452). 
AT2G01420.2GTCCACGTEncodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452). 
AT2G01900AT2G01900.1GTCCACGTCAGendonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: hydrolase activity, inositol or phosphatidylinositol phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: sepal, hypocotyl, root; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Inositol polyphosphate related phosphatase (InterPro:IPR000300), Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: endonuclease/exonuclease/phosphatase family protein (TAIR:AT2G37440.1); Has 1513 Blast hits to 1357 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 597; Fungi - 340; Plants - 368; Viruses - 0; Other Eukaryotes - 208 (source: NCBI BLink). 
AT2G16640AT2G16640.1GTCCACGTCAGCMULTIMERIC TRANSLOCON COMPLEX IN THE OUTER ENVELOPE MEMBRANE 132 (TOC132); FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: protein targeting to chloroplast; LOCATED IN: chloroplast outer membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloroplast protein import component Toc86/159 (InterPro:IPR005690), AIG1 (InterPro:IPR006703); BEST Arabidopsis thaliana protein match is: ATTOC120; GTP binding (TAIR:AT3G16620.1); Has 6352 Blast hits to 4186 proteins in 415 species: Archae - 14; Bacteria - 449; Metazoa - 2396; Fungi - 635; Plants - 342; Viruses - 83; Other Eukaryotes - 2433 (source: NCBI BLink). 
AT2G18680AT2G18680.1ACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18690.1); Has 116 Blast hits to 114 proteins in 17 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT2G20890AT2G20890.1ACGTGGACChloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane–delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. 
AT2G26570AT2G26570.1ACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G33390.1); Has 116898 Blast hits to 58103 proteins in 2191 species: Archae - 1417; Bacteria - 21958; Metazoa - 54071; Fungi - 9153; Plants - 5267; Viruses - 512; Other Eukaryotes - 24520 (source: NCBI BLink). 
AT2G30040AT2G30040.1GTCCACGTCGmember of MEKK subfamily 
AT2G32850AT2G32850.1GTCCACGTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATPK3; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT5G08160.1); Has 67658 Blast hits to 66473 proteins in 1675 species: Archae - 30; Bacteria - 5982; Metazoa - 29177; Fungi - 6997; Plants - 11346; Viruses - 187; Other Eukaryotes - 13939 (source: NCBI BLink). 
AT2G32850.2GTCCACGTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATPK3; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT5G08160.1); Has 67658 Blast hits to 66473 proteins in 1675 species: Archae - 30; Bacteria - 5982; Metazoa - 29177; Fungi - 6997; Plants - 11346; Viruses - 187; Other Eukaryotes - 13939 (source: NCBI BLink). 
AT2G38580AT2G38580.1CTACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65010.1); Has 59428 Blast hits to 34448 proteins in 1513 species: Archae - 407; Bacteria - 6232; Metazoa - 29606; Fungi - 3999; Plants - 1722; Viruses - 205; Other Eukaryotes - 17257 (source: NCBI BLink). 
AT2G39170AT2G39170.1ACGTGGACunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 35 Blast hits to 35 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT2G39170.1GATGACGTGGACunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 35 Blast hits to 35 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT2G39280AT2G39280.1GTGACGTGGACRAB GTPase activator; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RabGAP/TBC domain-containing protein (TAIR:AT3G55020.1); Has 4701 Blast hits to 4645 proteins in 231 species: Archae - 15; Bacteria - 84; Metazoa - 2806; Fungi - 708; Plants - 245; Viruses - 9; Other Eukaryotes - 834 (source: NCBI BLink). 
AT2G39430AT2G39430.1GTCCACGTdisease resistance-responsive protein-related / dirigent protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lignan biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: leaf apex, hypocotyl, root, petiole, leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Plant disease resistance response protein (InterPro:IPR004265); BEST Arabidopsis thaliana protein match is: disease resistance-responsive family protein (TAIR:AT3G55230.1); Has 394 Blast hits to 394 proteins in 31 species: Archae - 2; Bacteria - 2; Metazoa - 0; Fungi - 2; Plants - 387; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G39730AT2G39730.1TTCCACGTGGACRubisco activase, a nuclear-encoded chloroplast protein that consists of two isoforms arising from alternative splicing in most plants. Required for the light activation of rubisco. 
AT2G39730.2TTCCACGTGGACRubisco activase, a nuclear-encoded chloroplast protein that consists of two isoforms arising from alternative splicing in most plants. Required for the light activation of rubisco. 
AT2G39730.3TTCCACGTGGACRubisco activase, a nuclear-encoded chloroplast protein that consists of two isoforms arising from alternative splicing in most plants. Required for the light activation of rubisco. 
AT2G41430AT2G41430.1TACACGTGGACEncodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2. 
AT2G41430.2TACACGTGGACEncodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2. 
AT2G41430.3TACACGTGGACEncodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2. 
AT2G41430.4TACACGTGGACEncodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2. 
AT2G41900AT2G41900.1ATGACGTGGACzinc finger (CCCH-type) family protein; FUNCTIONS IN: transcription factor activity, nucleic acid binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT5G12850.1); Has 4817 Blast hits to 2898 proteins in 270 species: Archae - 2; Bacteria - 179; Metazoa - 2413; Fungi - 222; Plants - 261; Viruses - 8; Other Eukaryotes - 1732 (source: NCBI BLink). 
AT2G45000AT2G45000.1ACGTGGACEMBRYO DEFECTIVE 2766 (EMB2766); FUNCTIONS IN: structural constituent of nuclear pore; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, nuclear pore; CONTAINS InterPro DOMAIN/s: Nucleoporin, Nsp1-like, C-terminal (InterPro:IPR007758); Has 196388 Blast hits to 74057 proteins in 2349 species: Archae - 657; Bacteria - 41194; Metazoa - 62656; Fungi - 37422; Plants - 6443; Viruses - 2462; Other Eukaryotes - 45554 (source: NCBI BLink). 
AT3G01060AT3G01060.1TTAAACCGGTCCACGTGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT3G01060.2TTAAACCGGTCCACGTGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT3G01060.3TTAAACCGGTCCACGTGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT3G01680AT3G01680.1CACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01670.1); Has 49 Blast hits to 46 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G02570AT3G02570.1GTCCACGTGGACEncodes a protein with phosphomannose isomerase activity. 
AT3G04090AT3G04090.1GTCCACGTBelongs to a family of plant aquaporins. Similar to yeast and radish aquaporins. Located on ER. 
AT3G04460AT3G04460.1GATGACGTGGACRING finger protein involved in peroxisome biogenesis. 
AT3G04940AT3G04940.1GTCCACGTGACEncodes cysteine synthase CysD1. 
AT3G05260AT3G05260.1CCCACGTGGACshort-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: binding / catalytic/ oxidoreductase (TAIR:AT1G54870.1); Has 80754 Blast hits to 80610 proteins in 2221 species: Archae - 465; Bacteria - 44840; Metazoa - 4442; Fungi - 3990; Plants - 1473; Viruses - 7; Other Eukaryotes - 25537 (source: NCBI BLink). 
AT3G05380AT3G05380.1ATCCACGTGGACDNA binding / nucleic acid binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding, nucleic acid binding; CONTAINS InterPro DOMAIN/s: Myb, DNA-binding (InterPro:IPR014778), Tudor (InterPro:IPR002999), DIRP (InterPro:IPR010561); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT5G27610.1); Has 3053 Blast hits to 2257 proteins in 222 species: Archae - 0; Bacteria - 292; Metazoa - 1632; Fungi - 288; Plants - 143; Viruses - 7; Other Eukaryotes - 691 (source: NCBI BLink). 
AT3G05380.2ATCCACGTGGACDNA binding / nucleic acid binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding, nucleic acid binding; CONTAINS InterPro DOMAIN/s: Myb, DNA-binding (InterPro:IPR014778), Tudor (InterPro:IPR002999), DIRP (InterPro:IPR010561); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT5G27610.1); Has 3053 Blast hits to 2257 proteins in 222 species: Archae - 0; Bacteria - 292; Metazoa - 1632; Fungi - 288; Plants - 143; Viruses - 7; Other Eukaryotes - 691 (source: NCBI BLink). 
AT3G05858AT3G05858.1GTCCACGTGTCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G26620.1); Has 26 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G06868AT3G06868.1GGACACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49100.1); Has 1032 Blast hits to 474 proteins in 98 species: Archae - 0; Bacteria - 49; Metazoa - 464; Fungi - 149; Plants - 38; Viruses - 14; Other Eukaryotes - 318 (source: NCBI BLink). 
AT3G08890AT3G08890.1GTCCACGTCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37070.1); Has 268 Blast hits to 266 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 268; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G08890.2GTCCACGTCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37070.1); Has 268 Blast hits to 266 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 268; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G09670AT3G09670.1CCGCCACGTGGACPWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT5G02950.1); Has 722 Blast hits to 638 proteins in 104 species: Archae - 0; Bacteria - 10; Metazoa - 436; Fungi - 38; Plants - 69; Viruses - 0; Other Eukaryotes - 169 (source: NCBI BLink). 
AT3G09670.2CCGCCACGTGGACPWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT5G02950.1); Has 722 Blast hits to 638 proteins in 104 species: Archae - 0; Bacteria - 10; Metazoa - 436; Fungi - 38; Plants - 69; Viruses - 0; Other Eukaryotes - 169 (source: NCBI BLink). 
AT3G10330AT3G10330.1AGACACGTGGACtranscription initiation factor IIB-2 / general transcription factor TFIIB-2 (TFIIB2); FUNCTIONS IN: protein binding, RNA polymerase II transcription factor activity, transcription regulator activity, zinc ion binding, translation initiation factor activity; INVOLVED IN: translational initiation, regulation of transcription, DNA-dependent, transcription initiation, regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor TFIIB related (InterPro:IPR000812), Cyclin-like (InterPro:IPR011028), Transcription factor TFIIB, cyclin-related (InterPro:IPR013150), Cyclin-related (InterPro:IPR013763), Zinc finger, TFIIB-type (InterPro:IPR013137), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: TFIIB (TRANSCRIPTION FACTOR II B); RNA polymerase II transcription factor/ protein binding / transcription regulator/ translation initiation factor/ zinc ion binding (TAIR:AT2G41630.1); Has 1521 Blast hits to 1508 proteins in 255 species: Archae - 348; Bacteria - 0; Metazoa - 268; Fungi - 189; Plants - 107; Viruses - 10; Other Eukaryotes - 599 (source: NCBI BLink). 
AT3G11220AT3G11220.1ACGTGGACA subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. 
AT3G11220.2ACGTGGACA subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. 
AT3G11230AT3G11230.1GTCCACGTyippee family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: yippee family protein (TAIR:AT2G40110.1); Has 693 Blast hits to 693 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 400; Fungi - 131; Plants - 110; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). 
AT3G11230.2GTCCACGTyippee family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: yippee family protein (TAIR:AT2G40110.1); Has 693 Blast hits to 693 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 400; Fungi - 131; Plants - 110; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). 
AT3G11590AT3G11590.1ACCACGTGGACunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22310.1); Has 18950 Blast hits to 12386 proteins in 794 species: Archae - 267; Bacteria - 1381; Metazoa - 9845; Fungi - 1311; Plants - 683; Viruses - 61; Other Eukaryotes - 5402 (source: NCBI BLink). 
AT3G15280AT3G15280.1GTCCACGTGTCGunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G15290AT3G15290.1CGACACGTGGAC3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink). 
AT3G18620AT3G18620.1GTCCACGTzinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT4G22750.2); Has 3847 Blast hits to 3845 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1924; Fungi - 480; Plants - 393; Viruses - 0; Other Eukaryotes - 1050 (source: NCBI BLink). 
AT3G19290AT3G19290.1GTCCACGTbZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). Mediate ABA-dependent stress responses. 
AT3G19290.2GTCCACGTbZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). Mediate ABA-dependent stress responses. 
AT3G20910AT3G20910.1CACGTGGACNUCLEAR FACTOR Y, SUBUNIT A9 (NF-YA9); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289), CCAAT-binding factor, conserved site (InterPro:IPR018362); BEST Arabidopsis thaliana protein match is: NF-YA1 (NUCLEAR FACTOR Y, SUBUNIT A1); transcription factor (TAIR:AT5G12840.4); Has 452 Blast hits to 452 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 97; Plants - 214; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). 
AT3G21690AT3G21690.1ACGTGGACMATE efflux family protein; FUNCTIONS IN: drug transporter activity, antiporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G61890.1); Has 6111 Blast hits to 6057 proteins in 1118 species: Archae - 150; Bacteria - 4001; Metazoa - 121; Fungi - 210; Plants - 709; Viruses - 0; Other Eukaryotes - 920 (source: NCBI BLink). 
AT3G22440AT3G22440.1GTCCACGTCAChydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G14900.1); Has 1107 Blast hits to 1058 proteins in 102 species: Archae - 0; Bacteria - 5; Metazoa - 133; Fungi - 62; Plants - 888; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT3G24190AT3G24190.1TTGCCACGTGGACABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Aminoglycoside phosphotransferase (InterPro:IPR002575), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7527 Blast hits to 7489 proteins in 1103 species: Archae - 67; Bacteria - 2650; Metazoa - 374; Fungi - 312; Plants - 357; Viruses - 14; Other Eukaryotes - 3753 (source: NCBI BLink). 
AT3G25500AT3G25500.1GTCCACGTPoly-L-proline-containing (PLP) protein that form part of the signal-transduction cascade that leads to rearrangement of the actin cytoskeleton. AFH1 is a nonprocessive formin that moves from the barbered end to the side of an actin filament after the nucleation event. 
AT3G27690AT3G27690.1ACGTGGACEncodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. 
AT3G53180AT3G53180.1CACGTGGACACGTGcatalytic/ glutamate-ammonia ligase; FUNCTIONS IN: glutamate-ammonia ligase activity, catalytic activity; INVOLVED IN: nitrogen compound metabolic process, N-terminal protein myristoylation, nitrogen fixation, metabolic process, glutamine biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutamine synthetase, catalytic region (InterPro:IPR008146), Glutamine synthetase, beta-Grasp (InterPro:IPR008147), Glutamine synthetase/guanido kinase, catalytic region (InterPro:IPR014746), Amidohydrolase 2 (InterPro:IPR006992); Has 10584 Blast hits to 10580 proteins in 1411 species: Archae - 190; Bacteria - 5115; Metazoa - 86; Fungi - 146; Plants - 34; Viruses - 0; Other Eukaryotes - 5013 (source: NCBI BLink). 
AT3G53620AT3G53620.1ACGTGGACEncodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. 
AT3G55140AT3G55140.1GTCCACGTGACpectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G55140.2GTCCACGTGACpectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G57560AT3G57560.1TCCACGTGGACencodes a N-acetylglutamate kinase, involved in arginine biosynthesis 
AT3G57570AT3G57570.1GTCCACGTGGAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 29 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT3G58990AT3G58990.1GTCCACGTaconitase C-terminal domain-containing protein; FUNCTIONS IN: hydro-lyase activity, 3-isopropylmalate dehydratase activity; INVOLVED IN: leucine biosynthetic process, metabolic process; LOCATED IN: 3-isopropylmalate dehydratase complex, chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: 3-isopropylmalate dehydratase, small subunit (InterPro:IPR012305), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase-like core (InterPro:IPR015937); BEST Arabidopsis thaliana protein match is: aconitase C-terminal domain-containing protein (TAIR:AT2G43090.1); Has 6188 Blast hits to 6188 proteins in 1286 species: Archae - 227; Bacteria - 3055; Metazoa - 1; Fungi - 250; Plants - 45; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink). 
AT4G00020AT4G00020.1GTCCACGTOrtholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development. 
AT4G00020.2GTCCACGTOrtholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development. 
AT4G00570AT4G00570.1GTCCACGTGGCGAmalate oxidoreductase, putative; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor, malic enzyme activity, ATP binding; INVOLVED IN: oxidation reduction, malate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Malic oxidoreductase (InterPro:IPR001891), Malic enzyme, NAD-binding (InterPro:IPR012302), Malic enzyme, conserved site (InterPro:IPR015884), Malic enzyme, N-terminal (InterPro:IPR012301), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: malate oxidoreductase, putative (TAIR:AT2G13560.1); Has 5867 Blast hits to 5857 proteins in 1333 species: Archae - 86; Bacteria - 3255; Metazoa - 553; Fungi - 155; Plants - 271; Viruses - 0; Other Eukaryotes - 1547 (source: NCBI BLink). 
AT4G01050AT4G01050.1GTCCACGTCAGChydroxyproline-rich glycoprotein family protein, contains a rhodanese homology domain. 
AT4G09420AT4G09420.1GTCCACGTCAdisease resistance protein (TIR-NBS class), putative; FUNCTIONS IN: transmembrane receptor activity, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: shoot apex, leaf whorl, cotyledon, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, 4 leaf senescence stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS class), putative (TAIR:AT1G72850.1); Has 5786 Blast hits to 5719 proteins in 204 species: Archae - 0; Bacteria - 43; Metazoa - 6; Fungi - 0; Plants - 5734; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G14030AT4G14030.1ACGTGGACselenium-binding protein 1 (SBP1); FUNCTIONS IN: selenium binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cellular_component unknown; EXPRESSED IN: guard cell, cultured cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), Selenium-binding protein (InterPro:IPR008826); BEST Arabidopsis thaliana protein match is: SBP2 (SELENIUM-BINDING PROTEIN 2); selenium binding (TAIR:AT4G14040.1); Has 766 Blast hits to 759 proteins in 154 species: Archae - 15; Bacteria - 128; Metazoa - 187; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 381 (source: NCBI BLink). 
AT4G16500AT4G16500.1TCGCCACGTGGACcysteine protease inhibitor family protein / cystatin family protein; FUNCTIONS IN: enzyme regulator activity, cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT5G47550.1); Has 461 Blast hits to 440 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 452; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G16770AT4G16770.1AACGACGTGGACiron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G16765.2); Has 6031 Blast hits to 6015 proteins in 680 species: Archae - 0; Bacteria - 734; Metazoa - 132; Fungi - 691; Plants - 2939; Viruses - 0; Other Eukaryotes - 1535 (source: NCBI BLink). 
AT4G21930AT4G21930.1ACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61930.1); Has 196 Blast hits to 196 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G22220AT4G22220.1CTAAACCGTCCACGTGTCCEncodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. 
AT4G24110AT4G24110.1GTCCACGTCAGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; Has 49 Blast hits to 49 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G24740AT4G24740.1TACACGTGGACa LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins. 
AT4G24830AT4G24830.1ACGTGGACarginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink). 
AT4G24830.2ACGTGGACarginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink). 
AT4G25450AT4G25450.1GTCCACGTGGCTTTTTmember of NAP subfamily 
AT4G25450.2GTCCACGTGGCTTTTTmember of NAP subfamily 
AT4G25450.3GTCCACGTGGCTTTTTmember of NAP subfamily 
AT4G28610AT4G28610.1GTCCACGTAGSimilar to phosphate starvation response gene from Chlamydomonas. Weakly responsive to phosphate starvation. Acts upstream of PHO2 in phosphate signaling. 
AT4G28860AT4G28860.1GTCCACGTCACCasein Kinase I-like 4 (ckl4); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl3 (Casein Kinase I-like 3); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28880.1); Has 49581 Blast hits to 49221 proteins in 1441 species: Archae - 25; Bacteria - 6110; Metazoa - 21777; Fungi - 5145; Plants - 5994; Viruses - 336; Other Eukaryotes - 10194 (source: NCBI BLink). 
AT4G28860.2GTCCACGTCACCasein Kinase I-like 4 (ckl4); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl3 (Casein Kinase I-like 3); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28880.1); Has 49581 Blast hits to 49221 proteins in 1441 species: Archae - 25; Bacteria - 6110; Metazoa - 21777; Fungi - 5145; Plants - 5994; Viruses - 336; Other Eukaryotes - 10194 (source: NCBI BLink). 
AT4G30310AT4G30310.1CACGTGGACribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink). 
AT4G30310.2CACGTGGACribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink). 
AT4G30310.3CACGTGGACribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink). 
AT4G33430AT4G33430.1GTCCACGTCATCLeu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. 
AT4G33520AT4G33520.1CACACGTGGACEncodes a putative metal-transporting P-type ATPase. 
AT4G33520.2CACACGTGGACEncodes a putative metal-transporting P-type ATPase. 
AT4G33520.3CACACGTGGACEncodes a putative metal-transporting P-type ATPase. 
AT4G34860AT4G34860.1GTACACGTGGACCCACbeta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: sucrose catabolic process, using beta-fructofuranosidase; LOCATED IN: cytosol; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT4G09510.1); Has 530 Blast hits to 529 proteins in 80 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). 
AT4G34860.2GTACACGTGGACCCACbeta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: sucrose catabolic process, using beta-fructofuranosidase; LOCATED IN: cytosol; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT4G09510.1); Has 530 Blast hits to 529 proteins in 80 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). 
AT4G36230AT4G36230.1ACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf apex, hypocotyl, flower; EXPRESSED DURING: petal differentiation and expansion stage. 
AT4G36515AT4G36515.1GTCCACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G36515.1GTCCACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G37390AT4G37390.1GTCCACGTGGACEncodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. 
AT4G37980AT4G37980.1CACGTGGACELICITOR-ACTIVATED GENE 3-1 (ELI3-1); FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: response to bacterium, plant-type hypersensitive response; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ELI3-2 (ELICITOR-ACTIVATED GENE 3-2); aryl-alcohol dehydrogenase/ mannitol dehydrogenase (TAIR:AT4G37990.1); Has 24573 Blast hits to 24551 proteins in 1866 species: Archae - 389; Bacteria - 13994; Metazoa - 1153; Fungi - 1912; Plants - 2273; Viruses - 3; Other Eukaryotes - 4849 (source: NCBI BLink). 
AT4G37980.2CACGTGGACELICITOR-ACTIVATED GENE 3-1 (ELI3-1); FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: response to bacterium, plant-type hypersensitive response; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ELI3-2 (ELICITOR-ACTIVATED GENE 3-2); aryl-alcohol dehydrogenase/ mannitol dehydrogenase (TAIR:AT4G37990.1); Has 24573 Blast hits to 24551 proteins in 1866 species: Archae - 389; Bacteria - 13994; Metazoa - 1153; Fungi - 1912; Plants - 2273; Viruses - 3; Other Eukaryotes - 4849 (source: NCBI BLink). 
AT5G01260AT5G01260.1ATTGCCACGTGGACglycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT5G01260.2ATTGCCACGTGGACglycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT5G02380AT5G02380.1TGACACGTGGACcysteine-rich protein with copper-binding activity 
AT5G02970AT5G02970.1ACGTGGAChydrolase, alpha/beta fold family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT3G09690.2); Has 537 Blast hits to 531 proteins in 131 species: Archae - 2; Bacteria - 272; Metazoa - 8; Fungi - 13; Plants - 197; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). 
AT5G05290AT5G05290.1GTCCACGTGGCATEncodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) 
AT5G05370AT5G05370.1GTCCACGTGGATubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT3G10860.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G05380AT5G05380.1ATCCACGTGGACPRENYLATED RAB ACCEPTOR 1.B3 (PRA1.B3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 371 Blast hits to 371 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 59; Plants - 178; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). 
AT5G05880AT5G05880.1GTCCACGTUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT5G05890.1); Has 4967 Blast hits to 4944 proteins in 351 species: Archae - 0; Bacteria - 267; Metazoa - 1883; Fungi - 20; Plants - 2678; Viruses - 85; Other Eukaryotes - 34 (source: NCBI BLink). 
AT5G06980AT5G06980.1AACACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12320.1); Has 22 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT5G06980.2AACACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12320.1); Has 22 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT5G07270AT5G07270.1ACGCCACGTGGACankyrin repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: XBAT32; protein binding / zinc ion binding (TAIR:AT5G57740.1); Has 44282 Blast hits to 18491 proteins in 678 species: Archae - 43; Bacteria - 2745; Metazoa - 24300; Fungi - 3186; Plants - 1469; Viruses - 375; Other Eukaryotes - 12164 (source: NCBI BLink). 
AT5G09890AT5G09890.1GTCCACGTprotein kinase, putative; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase, C-terminal (InterPro:IPR017892), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G14350.3); Has 79473 Blast hits to 78508 proteins in 2155 species: Archae - 59; Bacteria - 7379; Metazoa - 33038; Fungi - 7700; Plants - 15325; Viruses - 373; Other Eukaryotes - 15599 (source: NCBI BLink). 
AT5G09890.2GTCCACGTprotein kinase, putative; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase, C-terminal (InterPro:IPR017892), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G14350.3); Has 79473 Blast hits to 78508 proteins in 2155 species: Archae - 59; Bacteria - 7379; Metazoa - 33038; Fungi - 7700; Plants - 15325; Viruses - 373; Other Eukaryotes - 15599 (source: NCBI BLink). 
AT5G10190AT5G10190.1GTCCACGTGTCATtransporter-related; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: UNE2 (unfertilized embryo sac 2); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G78130.1); Has 8728 Blast hits to 8693 proteins in 1166 species: Archae - 209; Bacteria - 6596; Metazoa - 315; Fungi - 290; Plants - 194; Viruses - 2; Other Eukaryotes - 1122 (source: NCBI BLink). 
AT5G10390AT5G10390.1CTACGTGGAChistone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, chloroplast, nucleosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G65360.1); Has 10280 Blast hits to 10277 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7396; Fungi - 1309; Plants - 999; Viruses - 0; Other Eukaryotes - 576 (source: NCBI BLink). 
AT5G11670AT5G11670.1GTCCACGTThe malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME2 is presumably a cytosolic enzyme involved in malate metabolism and possibly assisting the oxidative pentose phosphate pathway. AtNADP-ME2 counts for the major part of NADP-ME activity in mature tissues of Arabidopsis. 
AT5G13400AT5G13400.1GTCCACGTGproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: PTR5 (PEPTIDE TRANSPORTER 5); dipeptide transporter/ transporter (TAIR:AT5G01180.1); Has 3261 Blast hits to 3191 proteins in 658 species: Archae - 0; Bacteria - 1099; Metazoa - 461; Fungi - 209; Plants - 1123; Viruses - 0; Other Eukaryotes - 369 (source: NCBI BLink). 
AT5G13630AT5G13630.1GTCCACGTGTCCEncodes magnesium chelatase involved in plastid-to-nucleus signal transduction. 
AT5G13630.2GTCCACGTGTCCEncodes magnesium chelatase involved in plastid-to-nucleus signal transduction. 
AT5G15170AT5G15170.1GTCCACGTtyrosyl-DNA phosphodiesterase-related; FUNCTIONS IN: phosphoric diester hydrolase activity; INVOLVED IN: DNA repair; LOCATED IN: nucleus; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tyrosyl-DNA phosphodiesterase (InterPro:IPR010347), SMAD/FHA domain (InterPro:IPR008984); Has 311 Blast hits to 309 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 155; Fungi - 88; Plants - 24; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink). 
AT5G15500AT5G15500.1CTGACGTGTCCACGTankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). 
AT5G15500.2CTGACGTGTCCACGTankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). 
AT5G16990AT5G16990.1GTCCACGTGTCACmolecular function has not been defined, was shown involved in oxidative stress tolerance. 
AT5G17520AT5G17520.1GTCCACGTGEncodes a maltose transporter that is expressed in leaves and roots. Mutations at the MEX1 locus cause accumulation of both starch and maltose in leaves, with maltose levels at least 40 times higher than that of wild-type. This gene encodes a protein located in the chloroplast envelope. 
AT5G19855AT5G19855.1GTCCACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 483 Blast hits to 483 proteins in 366 species: Archae - 0; Bacteria - 441; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT5G26290AT5G26290.1GTCCACGTmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT5G26280.1); Has 263 Blast hits to 213 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 250; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT5G27395AT5G27395.1GTCCACGTP-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim44 (InterPro:IPR007379); Has 247 Blast hits to 247 proteins in 89 species: Archae - 0; Bacteria - 90; Metazoa - 76; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT5G27395.2GTCCACGTP-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim44 (InterPro:IPR007379); Has 247 Blast hits to 247 proteins in 89 species: Archae - 0; Bacteria - 90; Metazoa - 76; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT5G27420AT5G27420.1GTCCACGTGGCATzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin, response to abscisic acid stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ATL6; protein binding / zinc ion binding (TAIR:AT3G05200.1); Has 6369 Blast hits to 6350 proteins in 217 species: Archae - 0; Bacteria - 0; Metazoa - 2077; Fungi - 469; Plants - 2661; Viruses - 39; Other Eukaryotes - 1123 (source: NCBI BLink). 
AT5G28540AT5G28540.1GTCCACGTCATCEncodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. BiP is composed of an N-terminal ATP binding domain and a C-terminal domain that binds to hydrophobic patches on improperly/incompletely folded proteins in an ATP-dependent manner. 
AT5G38020AT5G38020.1GTCCACGTencodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus) 
AT5G39530AT5G39530.1ATGCCACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39520.1); Has 172 Blast hits to 172 proteins in 54 species: Archae - 0; Bacteria - 88; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G42020AT5G42020.1GTCCACGTCATCluminal binding protein (BiP) 
AT5G42020.2GTCCACGTCATCluminal binding protein (BiP) 
AT5G42810AT5G42810.1GTCCACGTGGATEncodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. 
AT5G47420AT5G47420.1GTCCACGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF124 (InterPro:IPR002838), Tryptophan RNA-binding attenuator protein-like (InterPro:IPR016031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17420.1); Has 568 Blast hits to 568 proteins in 252 species: Archae - 56; Bacteria - 410; Metazoa - 0; Fungi - 8; Plants - 37; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). 
AT5G50240AT5G50240.3GTCCACGTGGCAAL-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced. 
AT5G51220AT5G51220.1ACGTGGACubiquinol-cytochrome C chaperone family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C chaperone (InterPro:IPR007129); Has 361 Blast hits to 361 proteins in 132 species: Archae - 0; Bacteria - 99; Metazoa - 154; Fungi - 36; Plants - 23; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). 
AT5G51760AT5G51760.1TCCACGTGGACEncodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination. 
AT5G52300AT5G52300.1ACGTGGACCGACTencodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. 
AT5G52300.2ACGTGGACCGACTencodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. 
AT5G53560AT5G53560.1ACGTGGACEncodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase. 
AT5G54585AT5G54585.1GTCCACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 9 Blast hits to 9 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G61380AT5G61380.1GTCCACGTCATCPseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. 
AT5G61600AT5G61600.1GTCCACGTAGencodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. 
AT5G64040AT5G64040.1GTCCACGTCATCEncodes the only subunit of photosystem I located entirely in the thylakoid lumen. May be involved in the interaction between plastocyanin and the photosystem I complex. 
AT5G64040.2GTCCACGTCATCEncodes the only subunit of photosystem I located entirely in the thylakoid lumen. May be involved in the interaction between plastocyanin and the photosystem I complex. 
AT5G64050AT5G64050.1GTCCACGTGTCTGlutamate-tRNA ligase. Targeted to mitochondria and chloroplast. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. 
AT5G65110AT5G65110.1AACGACGTGTCCACGTCATCEncodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. 
AT5G65110.2AACGACGTGTCCACGTCATCEncodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. 
AT5G65730AT5G65730.1GTCCACGTCAGCxyloglucan:xyloglucosyl transferase, putative / xyloglucan endotransglycosylase, putative / endo-xyloglucan transferase, putative; FUNCTIONS IN: hydrolase activity, acting on glycosyl bonds, hydrolase activity, hydrolyzing O-glycosyl compounds, xyloglucan:xyloglucosyl transferase activity; INVOLVED IN: response to water deprivation; LOCATED IN: endomembrane system, cell wall, apoplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Xyloglucan endotransglucosylase/hydrolase (InterPro:IPR016455), Xyloglucan endo-transglycosylase, C-terminal (InterPro:IPR010713), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Glycoside hydrolase, family 16 (InterPro:IPR000757), Glycoside hydrolase, family 16, active site (InterPro:IPR008263); BEST Arabidopsis thaliana protein match is: xyloglucan:xyloglucosyl transferase, putative / xyloglucan endotransglycosylase, putative / endo-xyloglucan transferase, putative (TAIR:AT4G37800.1); Has 1348 Blast hits to 1342 proteins in 196 species: Archae - 0; Bacteria - 152; Metazoa - 0; Fungi - 301; Plants - 805; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). 
AT5G66500AT5G66500.1GTCCACGTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, cauline leaf, flower, seed; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G13600.1); Has 10819 Blast hits to 4139 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 15; Plants - 10655; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). 
AT5G66580AT5G66580.1CTACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50800.1); Has 132 Blast hits to 132 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 132; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.