| Locus | Gene model | Sequence | Description |
| AT1G01010 | AT1G01010.1 | TCGGTTTAC | Arabidopsis NAC domain containing protein 1 (ANAC001); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac069 (Arabidopsis NAC domain containing protein 69); transcription factor (TAIR:AT4G01550.1); Has 1331 Blast hits to 1329 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1331; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G04340 | AT1G04340.1 | CGGTTCAATTCGGTTTAG | lesion inducing protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HR-like lesion-inducer (InterPro:IPR008637); BEST Arabidopsis thaliana protein match is: lesion inducing protein-related (TAIR:AT5G43460.1); Has 99 Blast hits to 99 proteins in 21 species: Archae - 0; Bacteria - 13; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT1G04340.1 | TTCGGTTTAA | lesion inducing protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HR-like lesion-inducer (InterPro:IPR008637); BEST Arabidopsis thaliana protein match is: lesion inducing protein-related (TAIR:AT5G43460.1); Has 99 Blast hits to 99 proteins in 21 species: Archae - 0; Bacteria - 13; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT1G04350 | AT1G04350.1 | TTAAACCGAA | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase  |
| AT1G04530 | AT1G04530.1 | TTAAACCGAA | binding; FUNCTIONS IN: binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G17940.1); Has 445 Blast hits to 236 proteins in 47 species: Archae - 10; Bacteria - 76; Metazoa - 30; Fungi - 6; Plants - 278; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
| AT1G04590 | AT1G04590.1 | TTAAACCGATCCGGTTTAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT1G04590.2 | TTAAACCGATCCGGTTTAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT1G04820 | AT1G04820.1 | TTCGGTTTAC | Encodes an alpha tubulin isoform that is expressed in roots, leaves and flowers.  |
| AT1G04850 | AT1G04850.1 | CTAAACCGA | ubiquitin-associated (UBA)/TS-N domain-containing protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), PUG (InterPro:IPR006567), Zinc finger, C2H2-type (InterPro:IPR007087), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48690.1); Has 17438 Blast hits to 9965 proteins in 571 species: Archae - 30; Bacteria - 1031; Metazoa - 7907; Fungi - 1971; Plants - 445; Viruses - 50; Other Eukaryotes - 6004 (source: NCBI BLink).  |
| AT1G05270 | AT1G05270.1 | GTAAACCGAA | TraB family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pheromone shutdown-related, TraB (InterPro:IPR002816); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32340.1); Has 515 Blast hits to 497 proteins in 174 species: Archae - 89; Bacteria - 148; Metazoa - 111; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  |
| AT1G05340 | AT1G05340.1 | ATAAACCGACT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32210.1); Has 122 Blast hits to 122 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 16; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G05360 | AT1G05360.1 | ATAACCGGTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
| AT1G05430 | AT1G05430.1 | GTTCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G05805 | AT1G05805.1 | TTCGGTTTAA | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT2G43140.1); Has 2445 Blast hits to 1444 proteins in 113 species: Archae - 2; Bacteria - 55; Metazoa - 778; Fungi - 140; Plants - 840; Viruses - 0; Other Eukaryotes - 630 (source: NCBI BLink).  |
| AT1G05830 | AT1G05830.1 | ATAAACCGAA | Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1.  |
| AT1G05830.2 | ATAAACCGAA | Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1.  |
| AT1G06130 | AT1G06130.1 | TCGGTTTAT | glyoxalase 2-4 (GLX2-4); FUNCTIONS IN: hydrolase activity, hydroxyacylglutathione hydrolase activity, zinc ion binding; INVOLVED IN: methylglyoxal catabolic process to D-lactate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279), Hydroxyacylglutathione hydrolase (InterPro:IPR017782); BEST Arabidopsis thaliana protein match is: GLX2-5 (GLYOXALASE 2-5); hydroxyacylglutathione hydrolase/ iron ion binding / zinc ion binding (TAIR:AT2G31350.1); Has 10413 Blast hits to 10412 proteins in 1392 species: Archae - 227; Bacteria - 5412; Metazoa - 429; Fungi - 200; Plants - 123; Viruses - 0; Other Eukaryotes - 4022 (source: NCBI BLink).  |
| AT1G06130.1 | TTCGGTTTAG | glyoxalase 2-4 (GLX2-4); FUNCTIONS IN: hydrolase activity, hydroxyacylglutathione hydrolase activity, zinc ion binding; INVOLVED IN: methylglyoxal catabolic process to D-lactate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279), Hydroxyacylglutathione hydrolase (InterPro:IPR017782); BEST Arabidopsis thaliana protein match is: GLX2-5 (GLYOXALASE 2-5); hydroxyacylglutathione hydrolase/ iron ion binding / zinc ion binding (TAIR:AT2G31350.1); Has 10413 Blast hits to 10412 proteins in 1392 species: Archae - 227; Bacteria - 5412; Metazoa - 429; Fungi - 200; Plants - 123; Viruses - 0; Other Eukaryotes - 4022 (source: NCBI BLink).  |
| AT1G06130.2 | TCGGTTTAT | glyoxalase 2-4 (GLX2-4); FUNCTIONS IN: hydrolase activity, hydroxyacylglutathione hydrolase activity, zinc ion binding; INVOLVED IN: methylglyoxal catabolic process to D-lactate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279), Hydroxyacylglutathione hydrolase (InterPro:IPR017782); BEST Arabidopsis thaliana protein match is: GLX2-5 (GLYOXALASE 2-5); hydroxyacylglutathione hydrolase/ iron ion binding / zinc ion binding (TAIR:AT2G31350.1); Has 10413 Blast hits to 10412 proteins in 1392 species: Archae - 227; Bacteria - 5412; Metazoa - 429; Fungi - 200; Plants - 123; Viruses - 0; Other Eukaryotes - 4022 (source: NCBI BLink).  |
| AT1G06130.2 | TTCGGTTTAG | glyoxalase 2-4 (GLX2-4); FUNCTIONS IN: hydrolase activity, hydroxyacylglutathione hydrolase activity, zinc ion binding; INVOLVED IN: methylglyoxal catabolic process to D-lactate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279), Hydroxyacylglutathione hydrolase (InterPro:IPR017782); BEST Arabidopsis thaliana protein match is: GLX2-5 (GLYOXALASE 2-5); hydroxyacylglutathione hydrolase/ iron ion binding / zinc ion binding (TAIR:AT2G31350.1); Has 10413 Blast hits to 10412 proteins in 1392 species: Archae - 227; Bacteria - 5412; Metazoa - 429; Fungi - 200; Plants - 123; Viruses - 0; Other Eukaryotes - 4022 (source: NCBI BLink).  |
| AT1G06190 | AT1G06190.1 | TTAAACCGAACCGG | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).  |
| AT1G06190.2 | TTAAACCGAACCGG | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).  |
| AT1G06650 | AT1G06650.1 | TTCGGTTTAG | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase  |
| AT1G06650.2 | TTCGGTTTAG | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase  |
| AT1G06790 | AT1G06790.1 | GTTCGGTTCGGTTTAT | RNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
| AT1G06790.2 | GTTCGGTTCGGTTTAT | RNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
| AT1G07745 | AT1G07745.1 | TCGGTTTAA | Is a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination.  |
| AT1G07745.2 | TCGGTTTAA | Is a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination.  |
| AT1G07770 | AT1G07770.1 | TTCGGTTTAC | Encodes cytoplasmic ribosomal protein S15a.  |
| AT1G07770.2 | TTCGGTTTAC | Encodes cytoplasmic ribosomal protein S15a.  |
| AT1G08250 | AT1G08250.1 | TCGGTTTAT | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].  |
| AT1G08610 | AT1G08610.1 | TTAAACCGA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 19965 Blast hits to 5457 proteins in 167 species: Archae - 5; Bacteria - 16; Metazoa - 328; Fungi - 289; Plants - 18418; Viruses - 0; Other Eukaryotes - 909 (source: NCBI BLink).  |
| AT1G09070 | AT1G09070.1 | TTAAACCGACT | SRC2 specifically binds the peptide PIEPPPHH, and moves from ER to a vacuole fraction where it gets internalized. Involved in Protein Storage Vacuole targeting.  |
| AT1G09190 | AT1G09190.1 | TTAAACCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: shoot apex, sperm cell, embryo, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G56310.1); Has 12606 Blast hits to 4809 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 33; Plants - 12368; Viruses - 0; Other Eukaryotes - 192 (source: NCBI BLink).  |
| AT1G09280 | AT1G09280.1 | TCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763), Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT2G40760.1); Has 4342 Blast hits to 4339 proteins in 940 species: Archae - 0; Bacteria - 1695; Metazoa - 138; Fungi - 282; Plants - 108; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink).  |
| AT1G09420 | AT1G09420.1 | CGGTTCGGTTTAG | Encodes a protein similar to glucose-6-phosphate dehydrogenase but, based on amino acid differences in the active site and lack of activity, does not encode a functional G6PDH. The amino acid sequence for the consensus sequence of the G6PDH active site (DHYLGKE) differs in three places in this protein. gc exon splice site at 20574 is based on protein alignment, and is not confirmed experimentally.  |
| AT1G09430 | AT1G09430.1 | CTAAACCGAACCG | Encodes subunit A of the heteromeric enzyme ATP citrate lyase (ACL). In animals, ACL is encoded by a single gene; ACL in Arabidopsis is composed of two polypeptides, ACLA (encoded by 3 genes) and ACLB (encoded by 2 genes). The holoenzyme has an A(4)B(4)stoichiometry. Expression of both ACLA and ACLB but not of either of the subunits alone results in ACL activity.  |
| AT1G09800 | AT1G09800.1 | CTAAACCGAA | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT3G06950.1); Has 6844 Blast hits to 5672 proteins in 1445 species: Archae - 71; Bacteria - 3683; Metazoa - 118; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2917 (source: NCBI BLink).  |
| AT1G10700 | AT1G10700.1 | CTAAACCGA | ribose-phosphate pyrophosphokinase 3 / phosphoribosyl diphosphate synthetase 3 (PRS3); FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 4 / phosphoribosyl diphosphate synthetase 4 (PRS4) (TAIR:AT2G42910.1); Has 6424 Blast hits to 6423 proteins in 1522 species: Archae - 142; Bacteria - 3196; Metazoa - 415; Fungi - 221; Plants - 120; Viruses - 5; Other Eukaryotes - 2325 (source: NCBI BLink).  |
| AT1G10700.1 | TTAAACCGAA | ribose-phosphate pyrophosphokinase 3 / phosphoribosyl diphosphate synthetase 3 (PRS3); FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 4 / phosphoribosyl diphosphate synthetase 4 (PRS4) (TAIR:AT2G42910.1); Has 6424 Blast hits to 6423 proteins in 1522 species: Archae - 142; Bacteria - 3196; Metazoa - 415; Fungi - 221; Plants - 120; Viruses - 5; Other Eukaryotes - 2325 (source: NCBI BLink).  |
| AT1G10865 | AT1G10865.1 | TTAAACCGAACCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT1G10865.2 | TTAAACCGAACCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT1G11110 | AT1G11110.1 | AACCGCGTCGGTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61150.6); Has 344 Blast hits to 344 proteins in 111 species: Archae - 0; Bacteria - 13; Metazoa - 162; Fungi - 58; Plants - 53; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  |
| AT1G11280 | AT1G11280.1 | TTCGGTTTAT | S-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Apple-like (InterPro:IPR003609), PAN-like, type 2 (InterPro:IPR013227), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus protein kinase, putative (TAIR:AT1G61480.1); Has 86509 Blast hits to 85214 proteins in 3061 species: Archae - 49; Bacteria - 7411; Metazoa - 37923; Fungi - 6582; Plants - 19583; Viruses - 392; Other Eukaryotes - 14569 (source: NCBI BLink).  |
| AT1G11280.2 | TTCGGTTTAT | S-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Apple-like (InterPro:IPR003609), PAN-like, type 2 (InterPro:IPR013227), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus protein kinase, putative (TAIR:AT1G61480.1); Has 86509 Blast hits to 85214 proteins in 3061 species: Archae - 49; Bacteria - 7411; Metazoa - 37923; Fungi - 6582; Plants - 19583; Viruses - 392; Other Eukaryotes - 14569 (source: NCBI BLink).  |
| AT1G11280.3 | TTCGGTTTAT | S-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Apple-like (InterPro:IPR003609), PAN-like, type 2 (InterPro:IPR013227), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus protein kinase, putative (TAIR:AT1G61480.1); Has 86509 Blast hits to 85214 proteins in 3061 species: Archae - 49; Bacteria - 7411; Metazoa - 37923; Fungi - 6582; Plants - 19583; Viruses - 392; Other Eukaryotes - 14569 (source: NCBI BLink).  |
| AT1G11280.4 | TTCGGTTTAT | S-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Apple-like (InterPro:IPR003609), PAN-like, type 2 (InterPro:IPR013227), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus protein kinase, putative (TAIR:AT1G61480.1); Has 86509 Blast hits to 85214 proteins in 3061 species: Archae - 49; Bacteria - 7411; Metazoa - 37923; Fungi - 6582; Plants - 19583; Viruses - 392; Other Eukaryotes - 14569 (source: NCBI BLink).  |
| AT1G11750 | AT1G11750.1 | GGTTCGGTTTAA | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).  |
| AT1G13120 | AT1G13120.1 | TTAAACCGACT | embryo defective 1745 (emb1745); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nuclear pore; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GLE1-like (InterPro:IPR012476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G05523.1); Has 32122 Blast hits to 20275 proteins in 1392 species: Archae - 166; Bacteria - 5743; Metazoa - 12337; Fungi - 2633; Plants - 1041; Viruses - 221; Other Eukaryotes - 9981 (source: NCBI BLink).  |
| AT1G16020 | AT1G16020.1 | TTCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT1G16020.2 | TTCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT1G16610 | AT1G16610.1 | TTCGGTTTAA | SR spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP.  |
| AT1G16610.2 | TTCGGTTTAA | SR spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP.  |
| AT1G17280 | AT1G17280.1 | GTTCGGTTTAG | ubiquitin-conjugating enzyme 34 (UBC34); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC33 (ubiquitin-conjugating enzyme 33); ubiquitin-protein ligase (TAIR:AT5G50430.2); Has 5548 Blast hits to 5545 proteins in 288 species: Archae - 0; Bacteria - 0; Metazoa - 2617; Fungi - 1060; Plants - 889; Viruses - 16; Other Eukaryotes - 966 (source: NCBI BLink).  |
| AT1G17280.2 | GTTCGGTTTAG | ubiquitin-conjugating enzyme 34 (UBC34); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC33 (ubiquitin-conjugating enzyme 33); ubiquitin-protein ligase (TAIR:AT5G50430.2); Has 5548 Blast hits to 5545 proteins in 288 species: Archae - 0; Bacteria - 0; Metazoa - 2617; Fungi - 1060; Plants - 889; Viruses - 16; Other Eukaryotes - 966 (source: NCBI BLink).  |
| AT1G17650 | AT1G17650.1 | TTAAACCGAA | Glyoxylate reductase located in chloroplasts.  |
| AT1G17650.1 | TTCGGTTTAT | Glyoxylate reductase located in chloroplasts.  |
| AT1G17690 | AT1G17690.1 | ATAAACCGACGTGTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1253 (InterPro:IPR010678); Has 24487 Blast hits to 12385 proteins in 666 species: Archae - 70; Bacteria - 4843; Metazoa - 8327; Fungi - 2833; Plants - 863; Viruses - 487; Other Eukaryotes - 7064 (source: NCBI BLink).  |
| AT1G18260 | AT1G18260.1 | TTAAACCGAA | suppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G73570.1); Has 15581 Blast hits to 5419 proteins in 820 species: Archae - 0; Bacteria - 9844; Metazoa - 747; Fungi - 658; Plants - 84; Viruses - 27; Other Eukaryotes - 4221 (source: NCBI BLink).  |
| AT1G18450 | AT1G18450.1 | TGGTTCGGTTTAG | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes.  |
| AT1G19170 | AT1G19170.1 | TCGGTTTAT | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT3G42950.1); Has 2514 Blast hits to 2510 proteins in 316 species: Archae - 2; Bacteria - 602; Metazoa - 8; Fungi - 955; Plants - 840; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
| AT1G19190 | AT1G19190.1 | TTAAACCGA | hydrolase; FUNCTIONS IN: hydrolase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Lipase, GDXG, active site (InterPro:IPR002168), Alpha/beta hydrolase fold-3 (InterPro:IPR013094); BEST Arabidopsis thaliana protein match is: hydrolase (TAIR:AT2G03550.1); Has 5587 Blast hits to 5577 proteins in 861 species: Archae - 47; Bacteria - 2876; Metazoa - 576; Fungi - 522; Plants - 655; Viruses - 3; Other Eukaryotes - 908 (source: NCBI BLink).  |
| AT1G19570 | AT1G19570.1 | TTAAACCGA | Encodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.  |
| AT1G19570.2 | TTAAACCGA | Encodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.  |
| AT1G19580 | AT1G19580.1 | TCGGTTTAA | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex.  |
| AT1G20140 | AT1G20140.1 | ATAAACCGACT | ARABIDOPSIS SKP1-LIKE 4 (ASK4); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: SCF ubiquitin ligase complex, nucleolus, nucleus, cytoplasm; EXPRESSED IN: inflorescence meristem, male gametophyte, valve, septum, seed; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: ASK3 (ARABIDOPSIS SKP1-LIKE 3); protein binding / ubiquitin-protein ligase (TAIR:AT2G25700.1); Has 1096 Blast hits to 1094 proteins in 198 species: Archae - 0; Bacteria - 0; Metazoa - 499; Fungi - 112; Plants - 354; Viruses - 11; Other Eukaryotes - 120 (source: NCBI BLink).  |
| AT1G22770 | AT1G22770.1 | TTAAACCGA | Together with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering under long days in a circadian clock-controlled flowering pathway. GI acts earlier than CO and FT in the pathway by increasing CO and FT mRNA abundance. Located in the nucleus. Regulates several developmental processes, including photoperiod-mediated flowering, phytochrome B signaling, circadian clock, carbohydrate metabolism, and cold stress response. The gene's transcription is controlled by the circadian clock and it is post-transcriptionally regulated by light and dark. Forms a complex with FKF1 on the CO promoter to regulate CO expression.  |
| AT1G25350 | AT1G25350.1 | TTCGGTTTAA | ovule abortion 9 (OVA9); FUNCTIONS IN: glutamine-tRNA ligase activity; INVOLVED IN: glutamyl-tRNA aminoacylation, translation, ovule development; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Glutamyl/glutaminyl-tRNA synthetase, class Ic (InterPro:IPR000924), Glutaminyl-tRNA synthetase, class Ic, non-specific RNA-binding region part 1 (InterPro:IPR007639), Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035), Glutaminyl-tRNA synthetase, class Ic, non-specific RNA-binding region part 2 (InterPro:IPR007638), Glutaminyl-tRNA synthetase, class Ic (InterPro:IPR004514); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (E and Q) family protein (TAIR:AT5G19720.1); Has 8783 Blast hits to 8778 proteins in 1656 species: Archae - 170; Bacteria - 4659; Metazoa - 349; Fungi - 257; Plants - 97; Viruses - 0; Other Eukaryotes - 3251 (source: NCBI BLink).  |
| AT1G27760 | AT1G27760.1 | TTAAACCGA | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress.  |
| AT1G27760.2 | TTAAACCGA | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress.  |
| AT1G27760.3 | TTAAACCGA | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress.  |
| AT1G29350 | AT1G29350.1 | TGGTTCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1296 (InterPro:IPR009719); BEST Arabidopsis thaliana protein match is: kinase-related (TAIR:AT1G29370.1); Has 13611 Blast hits to 7582 proteins in 387 species: Archae - 0; Bacteria - 354; Metazoa - 5683; Fungi - 1538; Plants - 892; Viruses - 68; Other Eukaryotes - 5076 (source: NCBI BLink).  |
| AT1G29630 | AT1G29630.1 | TTAAACCGAAAACCGG | DNA binding / catalytic/ nuclease; FUNCTIONS IN: DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: exonuclease, putative (TAIR:AT1G18090.2); Has 1812 Blast hits to 1629 proteins in 272 species: Archae - 190; Bacteria - 0; Metazoa - 554; Fungi - 461; Plants - 125; Viruses - 28; Other Eukaryotes - 454 (source: NCBI BLink).  |
| AT1G29630.2 | TTAAACCGAAAACCGG | DNA binding / catalytic/ nuclease; FUNCTIONS IN: DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: exonuclease, putative (TAIR:AT1G18090.2); Has 1812 Blast hits to 1629 proteins in 272 species: Archae - 190; Bacteria - 0; Metazoa - 554; Fungi - 461; Plants - 125; Viruses - 28; Other Eukaryotes - 454 (source: NCBI BLink).  |
| AT1G30240 | AT1G30240.1 | ATAAACCGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 120 Blast hits to 120 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 49; Fungi - 41; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT1G30240.1 | ATCCGGTTTAATAAACCGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 120 Blast hits to 120 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 49; Fungi - 41; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT1G30240.2 | ATAAACCGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 120 Blast hits to 120 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 49; Fungi - 41; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT1G30240.2 | ATCCGGTTTAATAAACCGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 120 Blast hits to 120 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 49; Fungi - 41; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT1G30580 | AT1G30580.1 | TCGGTTTAG | GTP binding; FUNCTIONS IN: GTP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF933 (InterPro:IPR013029), TGS-like (InterPro:IPR012676), GTP1/OBG (InterPro:IPR006073), Conserved hypothetical protein CHP00092 (InterPro:IPR004396), GTP-binding protein, HSR1-related (InterPro:IPR002917), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G56050.1); Has 12592 Blast hits to 12588 proteins in 1581 species: Archae - 216; Bacteria - 5420; Metazoa - 582; Fungi - 410; Plants - 148; Viruses - 0; Other Eukaryotes - 5816 (source: NCBI BLink).  |
| AT1G30580.1 | TTCGGTTTAA | GTP binding; FUNCTIONS IN: GTP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF933 (InterPro:IPR013029), TGS-like (InterPro:IPR012676), GTP1/OBG (InterPro:IPR006073), Conserved hypothetical protein CHP00092 (InterPro:IPR004396), GTP-binding protein, HSR1-related (InterPro:IPR002917), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G56050.1); Has 12592 Blast hits to 12588 proteins in 1581 species: Archae - 216; Bacteria - 5420; Metazoa - 582; Fungi - 410; Plants - 148; Viruses - 0; Other Eukaryotes - 5816 (source: NCBI BLink).  |
| AT1G31750 | AT1G31750.1 | TTCGGTTTAA | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 28504 Blast hits to 13839 proteins in 758 species: Archae - 8; Bacteria - 3021; Metazoa - 12889; Fungi - 3156; Plants - 5337; Viruses - 840; Other Eukaryotes - 3253 (source: NCBI BLink).  |
| AT1G31920 | AT1G31920.1 | TCGGTTTAG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 13708 Blast hits to 5114 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 82; Fungi - 70; Plants - 13274; Viruses - 0; Other Eukaryotes - 282 (source: NCBI BLink).  |
| AT1G32310 | AT1G32310.1 | TTCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G32928 | AT1G32928.1 | ATAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32920.1); Has 14 Blast hits to 14 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G34030 | AT1G34030.1 | TCGGTTTAA | 40S ribosomal protein S18 (RPS18B); FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: RPS18C (S18 RIBOSOMAL PROTEIN); RNA binding / nucleic acid binding / structural constituent of ribosome (TAIR:AT4G09800.1); Has 5326 Blast hits to 5326 proteins in 1715 species: Archae - 163; Bacteria - 2773; Metazoa - 291; Fungi - 107; Plants - 309; Viruses - 0; Other Eukaryotes - 1683 (source: NCBI BLink).  |
| AT1G34580 | AT1G34580.1 | TCGGTTTAA | monosaccharide transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: STP1 (SUGAR TRANSPORTER 1); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G11260.1); Has 17271 Blast hits to 16944 proteins in 1138 species: Archae - 239; Bacteria - 6622; Metazoa - 3446; Fungi - 4520; Plants - 1408; Viruses - 0; Other Eukaryotes - 1036 (source: NCBI BLink).  |
| AT1G34770 | AT1G34770.1 | CTAAACCGAA | MAGE-8 antigen-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MAGE protein (InterPro:IPR002190); Has 1021 Blast hits to 1019 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 886; Fungi - 33; Plants - 28; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
| AT1G34770.2 | CTAAACCGAA | MAGE-8 antigen-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MAGE protein (InterPro:IPR002190); Has 1021 Blast hits to 1019 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 886; Fungi - 33; Plants - 28; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
| AT1G35220 | AT1G35220.1 | GGTTCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 247 Blast hits to 143 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
| AT1G35680 | AT1G35680.1 | ATAAACCGGTAAACCGAA | 50S ribosomal protein L21, chloroplast / CL21 (RPL21); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: response to cold, translation; LOCATED IN: ribosome, chloroplast stroma, nucleus, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L21, conserved site (InterPro:IPR018258), Ribosomal protein L21 (InterPro:IPR001787); BEST Arabidopsis thaliana protein match is: NFD1 (NUCLEAR FUSION DEFECTIVE 1); RNA binding / structural constituent of ribosome (TAIR:AT4G30930.1); Has 4670 Blast hits to 4670 proteins in 1425 species: Archae - 0; Bacteria - 2792; Metazoa - 89; Fungi - 4; Plants - 92; Viruses - 0; Other Eukaryotes - 1693 (source: NCBI BLink).  |
| AT1G43700 | AT1G43700.1 | GTAAACCGAA | Encodes a VirE2-interacting protein. VIP1 mediates nuclear translocation of VirE2 via its amino half, and interacts with histone H2A via it carboxyl half.  |
| AT1G47710 | AT1G47710.1 | TCGGTTTAA | serpin, putative / serine protease inhibitor, putative; FUNCTIONS IN: serine-type endopeptidase inhibitor activity, cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease inhibitor I4, serpin, plant (InterPro:IPR015554), Protease inhibitor I4, serpin (InterPro:IPR000215); BEST Arabidopsis thaliana protein match is: serpin, putative / serine protease inhibitor, putative (TAIR:AT3G45220.1); Has 4823 Blast hits to 4760 proteins in 347 species: Archae - 52; Bacteria - 220; Metazoa - 3736; Fungi - 1; Plants - 230; Viruses - 419; Other Eukaryotes - 165 (source: NCBI BLink).  |
| AT1G48430 | AT1G48430.1 | TCGGTTTAT | dihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT3G17770.1); Has 2623 Blast hits to 2620 proteins in 533 species: Archae - 8; Bacteria - 1792; Metazoa - 85; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 555 (source: NCBI BLink).  |
| AT1G48440 | AT1G48440.1 | ATAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17780.1); Has 61 Blast hits to 61 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G48790 | AT1G48790.1 | TCGGTTTAA | mov34 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 807 Blast hits to 679 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 425; Fungi - 178; Plants - 110; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  |
| AT1G49340 | AT1G49340.1 | ATAAACCGAA | Encodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots.  |
| AT1G49340.2 | ATAAACCGAA | Encodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots.  |
| AT1G49820 | AT1G49820.1 | TTAAACCGAA | encodes 5-methylthioribose kinase, involved in methionine cycle  |
| AT1G50250 | AT1G50250.1 | TTAAACCGAAC | encodes an FTSH protease that is localized to the chloroplast. Involved in the D1 repair cycle of Photosystem II. FtsH1 and FtsH5 are interchangeable in thylakoid membranes.  |
| AT1G51310 | AT1G51310.1 | ATAAACCGAA | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase; FUNCTIONS IN: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase activity; INVOLVED IN: tRNA processing, RNA processing; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (InterPro:IPR004506), tRNA methyl transferase-like (InterPro:IPR018318); Has 5934 Blast hits to 5930 proteins in 1456 species: Archae - 0; Bacteria - 3103; Metazoa - 118; Fungi - 45; Plants - 26; Viruses - 0; Other Eukaryotes - 2642 (source: NCBI BLink).  |
| AT1G52825 | AT1G52825.1 | TGGTTCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14615.1); Has 30 Blast hits to 28 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G54520 | AT1G54520.1 | ATAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1517 (InterPro:IPR010903); Has 198 Blast hits to 197 proteins in 64 species: Archae - 0; Bacteria - 91; Metazoa - 6; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  |
| AT1G54690 | AT1G54690.1 | CTAAACCGAA | Encodes HTA3, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 1020 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin.  |
| AT1G56070 | AT1G56070.1 | TCGGTTTAC | encodes a translation elongation factor 2-like protein that is involved in cold-induced translation. Mutations in this gene specifically blocks low temperature-induced transcription of cold-responsive genes but induces the expression of CBF genes and mutants carrying the recessive mutations fail to acclimate to cold and is freezing sensitive.  |
| AT1G56330 | AT1G56330.1 | ATAAACCGAA | Encodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol.  |
| AT1G56330.1 | TCGGTTTAA | Encodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol.  |
| AT1G57660 | AT1G57660.1 | CTAAACCGAACCA | 60S ribosomal protein L21 (RPL21E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (TAIR:AT1G57860.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  |
| AT1G57720 | AT1G57720.1 | CTAAACCGAA | elongation factor 1B-gamma, putative / eEF-1B gamma, putative; FUNCTIONS IN: copper ion binding, translation elongation factor activity; INVOLVED IN: response to cadmium ion; LOCATED IN: cell wall, plasma membrane, vacuole, membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, gamma chain, conserved (InterPro:IPR001662), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: elongation factor 1B-gamma, putative / eEF-1B gamma, putative (TAIR:AT1G09640.1); Has 7768 Blast hits to 7335 proteins in 985 species: Archae - 0; Bacteria - 3423; Metazoa - 1547; Fungi - 368; Plants - 575; Viruses - 5; Other Eukaryotes - 1850 (source: NCBI BLink).  |
| AT1G57720.2 | CTAAACCGAA | elongation factor 1B-gamma, putative / eEF-1B gamma, putative; FUNCTIONS IN: copper ion binding, translation elongation factor activity; INVOLVED IN: response to cadmium ion; LOCATED IN: cell wall, plasma membrane, vacuole, membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, gamma chain, conserved (InterPro:IPR001662), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: elongation factor 1B-gamma, putative / eEF-1B gamma, putative (TAIR:AT1G09640.1); Has 7768 Blast hits to 7335 proteins in 985 species: Archae - 0; Bacteria - 3423; Metazoa - 1547; Fungi - 368; Plants - 575; Viruses - 5; Other Eukaryotes - 1850 (source: NCBI BLink).  |
| AT1G59835 | AT1G59835.1 | AACCGGAATAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50610.1); Has 25 Blast hits to 11 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G60690 | AT1G60690.1 | TTCGGTTTAA | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: ATB2; oxidoreductase (TAIR:AT1G60710.1); Has 18262 Blast hits to 18242 proteins in 1448 species: Archae - 333; Bacteria - 10168; Metazoa - 1431; Fungi - 1444; Plants - 723; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink).  |
| AT1G60690.1 | TTCGGTTTAA | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: ATB2; oxidoreductase (TAIR:AT1G60710.1); Has 18262 Blast hits to 18242 proteins in 1448 species: Archae - 333; Bacteria - 10168; Metazoa - 1431; Fungi - 1444; Plants - 723; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink).  |
| AT1G62120 | AT1G62120.1 | CTAAACCGAA | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G62085.1); Has 415 Blast hits to 372 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 404; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT1G63170 | AT1G63170.1 | TTCGGTTTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT1G12760.1); Has 6437 Blast hits to 6421 proteins in 214 species: Archae - 0; Bacteria - 6; Metazoa - 2231; Fungi - 482; Plants - 2717; Viruses - 23; Other Eukaryotes - 978 (source: NCBI BLink).  |
| AT1G67700 | AT1G67700.1 | TGGTTCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G67700.2 | TGGTTCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G67960 | AT1G67960.1 | CTAAACCGAACCGAACCGACT | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).  |
| AT1G70600 | AT1G70600.1 | ATAAACCGA | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15 (InterPro:IPR001196); BEST Arabidopsis thaliana protein match is: RPL27AB; structural constituent of ribosome (TAIR:AT1G23290.1); Has 825 Blast hits to 825 proteins in 317 species: Archae - 121; Bacteria - 11; Metazoa - 289; Fungi - 107; Plants - 96; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).  |
| AT1G70610 | AT1G70610.1 | TCGGTTTAT | member of TAP subfamily  |
| AT1G71430 | AT1G71430.1 | TCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT1G72370 | AT1G72370.1 | TTCGGTTTAA | acidic protein associated to 40S ribosomal subunit of ribosomes. Involved in polysome formation during active protein synthesis. Expressed in actively growing tissue.  |
| AT1G72370.2 | TTCGGTTTAA | acidic protein associated to 40S ribosomal subunit of ribosomes. Involved in polysome formation during active protein synthesis. Expressed in actively growing tissue.  |
| AT1G72390 | AT1G72390.1 | TTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 7899 Blast hits to 6384 proteins in 374 species: Archae - 6; Bacteria - 210; Metazoa - 3913; Fungi - 1320; Plants - 701; Viruses - 22; Other Eukaryotes - 1727 (source: NCBI BLink).  |
| AT1G73880 | AT1G73880.1 | CTAAACCGA | UDP-GLUCOSYL TRANSFERASE 89B1 (UGT89B1); FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G51210.1); Has 3550 Blast hits to 3501 proteins in 241 species: Archae - 0; Bacteria - 40; Metazoa - 762; Fungi - 14; Plants - 2648; Viruses - 58; Other Eukaryotes - 28 (source: NCBI BLink).  |
| AT1G76010 | AT1G76010.1 | GTAAACCGA | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G20220.1); Has 75246 Blast hits to 26916 proteins in 1384 species: Archae - 54; Bacteria - 14987; Metazoa - 38865; Fungi - 4655; Plants - 6135; Viruses - 798; Other Eukaryotes - 9752 (source: NCBI BLink).  |
| AT1G76010.1 | TGGTTCGGTTTAA | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G20220.1); Has 75246 Blast hits to 26916 proteins in 1384 species: Archae - 54; Bacteria - 14987; Metazoa - 38865; Fungi - 4655; Plants - 6135; Viruses - 798; Other Eukaryotes - 9752 (source: NCBI BLink).  |
| AT1G76040 | AT1G76040.2 | CTAAACCGA | member of Calcium Dependent Protein Kinase  |
| AT1G76630 | AT1G76630.1 | ATAAACCGA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: SEC (secret agent); transferase, transferring glycosyl groups (TAIR:AT3G04240.1); Has 5924 Blast hits to 3836 proteins in 536 species: Archae - 384; Bacteria - 2298; Metazoa - 901; Fungi - 281; Plants - 131; Viruses - 0; Other Eukaryotes - 1929 (source: NCBI BLink).  |
| AT1G76630.1 | GTAAACCGA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: SEC (secret agent); transferase, transferring glycosyl groups (TAIR:AT3G04240.1); Has 5924 Blast hits to 3836 proteins in 536 species: Archae - 384; Bacteria - 2298; Metazoa - 901; Fungi - 281; Plants - 131; Viruses - 0; Other Eukaryotes - 1929 (source: NCBI BLink).  |
| AT1G77180 | AT1G77180.1 | TTAAACCGACTTA | Encodes a protein with a putative role in mRNA splicing.  |
| AT1G77180.2 | TTAAACCGACTTA | Encodes a protein with a putative role in mRNA splicing.  |
| AT1G77600 | AT1G77600.1 | ATAAACCGACGACGT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G47690.3); Has 420 Blast hits to 371 proteins in 114 species: Archae - 0; Bacteria - 2; Metazoa - 153; Fungi - 83; Plants - 153; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
| AT1G77690 | AT1G77690.1 | ATAAACCGA | Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia.  |
| AT1G79190 | AT1G79190.1 | TTAAACCGA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 138 Blast hits to 128 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 61; Fungi - 55; Plants - 18; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT1G79730 | AT1G79730.1 | GTAAACCGAA | Encodes a PAF1 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast PAF1 is a component of a five-member complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin.  |
| AT2G01150 | AT2G01150.1 | ATAAACCGAA | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils.  |
| AT2G02160 | AT2G02160.1 | ATAAACCGAAC | zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Has 10894 Blast hits to 6834 proteins in 394 species: Archae - 15; Bacteria - 298; Metazoa - 5860; Fungi - 845; Plants - 435; Viruses - 183; Other Eukaryotes - 3258 (source: NCBI BLink).  |
| AT2G02160.1 | GTTCGGTTTAA | zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Has 10894 Blast hits to 6834 proteins in 394 species: Archae - 15; Bacteria - 298; Metazoa - 5860; Fungi - 845; Plants - 435; Viruses - 183; Other Eukaryotes - 3258 (source: NCBI BLink).  |
| AT2G02160.1 | TCGGTTTAC | zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Has 10894 Blast hits to 6834 proteins in 394 species: Archae - 15; Bacteria - 298; Metazoa - 5860; Fungi - 845; Plants - 435; Viruses - 183; Other Eukaryotes - 3258 (source: NCBI BLink).  |
| AT2G02390 | AT2G02390.1 | ATAAACCGAA | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide.  |
| AT2G02390.2 | ATAAACCGAA | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide.  |
| AT2G02390.3 | ATAAACCGAA | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide.  |
| AT2G03470 | AT2G03470.1 | TTCGGTTTATAAACCGGTTAA | myb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink).  |
| AT2G03470.2 | TTCGGTTTATAAACCGGTTAA | myb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink).  |
| AT2G03870 | AT2G03870.1 | TCGGTTTAT | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U6 snRNA-associated Sm-like protein LSm7 (InterPro:IPR017132), Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SNRNP-G (PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G) (TAIR:AT2G23930.1); Has 1044 Blast hits to 1044 proteins in 205 species: Archae - 177; Bacteria - 0; Metazoa - 383; Fungi - 213; Plants - 121; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).  |
| AT2G03870.2 | TCGGTTTAT | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U6 snRNA-associated Sm-like protein LSm7 (InterPro:IPR017132), Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SNRNP-G (PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G) (TAIR:AT2G23930.1); Has 1044 Blast hits to 1044 proteins in 205 species: Archae - 177; Bacteria - 0; Metazoa - 383; Fungi - 213; Plants - 121; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).  |
| AT2G04700 | AT2G04700.1 | CTAAACCGAATTGAACCG | ferredoxin thioredoxin reductase catalytic beta chain family protein; FUNCTIONS IN: ferredoxin:thioredoxin reductase activity, ferredoxin reductase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin thioredoxin reductase, beta subunit (InterPro:IPR004209); Has 204 Blast hits to 204 proteins in 84 species: Archae - 14; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  |
| AT2G04890 | AT2G04890.1 | TTCGGTTTAA | Encodes a scarecrow-like protein (SCL21). Member of GRAS gene family.  |
| AT2G05220 | AT2G05220.1 | CTAAACCGA | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
| AT2G05220.2 | CTAAACCGA | 40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
| AT2G05310 | AT2G05310.1 | TTCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G13500.1); Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G05620 | AT2G05620.1 | ATAAACCGAA | Involved in electron flow in Photosystem I. Essential for photoprotection.  |
| AT2G05910 | AT2G05910.1 | TTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20640.1); Has 150 Blast hits to 150 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G06010 | AT2G06010.1 | TTAAACCGAA | encodes a novel protein whose expression level is induced in lines overexpressing salicylic-acid (SA)-inducible Arabidopsis DNA binding with one finger (Dof) transcription factor, called OBF-binding protein 3.  |
| AT2G14460 | AT2G14460.1 | GTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G14460.1 | GTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G14460.1 | TCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G16640 | AT2G16640.1 | TTAAACCGAA | MULTIMERIC TRANSLOCON COMPLEX IN THE OUTER ENVELOPE MEMBRANE 132 (TOC132); FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: protein targeting to chloroplast; LOCATED IN: chloroplast outer membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloroplast protein import component Toc86/159 (InterPro:IPR005690), AIG1 (InterPro:IPR006703); BEST Arabidopsis thaliana protein match is: ATTOC120; GTP binding (TAIR:AT3G16620.1); Has 6352 Blast hits to 4186 proteins in 415 species: Archae - 14; Bacteria - 449; Metazoa - 2396; Fungi - 635; Plants - 342; Viruses - 83; Other Eukaryotes - 2433 (source: NCBI BLink).  |
| AT2G17510 | AT2G17510.1 | TTCGGTTTAA | EMBRYO DEFECTIVE 2763 (EMB2763); FUNCTIONS IN: ribonuclease activity, RNA binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide binding protein, PINc (InterPro:IPR006596), Ribonuclease II and R (InterPro:IPR001900); BEST Arabidopsis thaliana protein match is: ribonuclease II family protein (TAIR:AT1G77680.1); Has 5395 Blast hits to 5320 proteins in 1284 species: Archae - 25; Bacteria - 2941; Metazoa - 370; Fungi - 272; Plants - 61; Viruses - 2; Other Eukaryotes - 1724 (source: NCBI BLink).  |
| AT2G18390 | AT2G18390.1 | GTTCGGTTTAT | Encodes a member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Mutant has abnormal mitosis and cell cycle control during seed development.  |
| AT2G18800 | AT2G18800.1 | TTCGGTTTAG | XYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE 21 (XTH21); FUNCTIONS IN: hydrolase activity, acting on glycosyl bonds, xyloglucan endotransglucosylase activity; INVOLVED IN: primary root development, cell wall modification; LOCATED IN: endomembrane system, apoplast, cell wall; EXPRESSED IN: stem, flower, root, leaf; CONTAINS InterPro DOMAIN/s: Xyloglucan endotransglucosylase/hydrolase (InterPro:IPR016455), Xyloglucan endo-transglycosylase, C-terminal (InterPro:IPR010713), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Glycoside hydrolase, family 16 (InterPro:IPR000757), Glycoside hydrolase, family 16, active site (InterPro:IPR008263); BEST Arabidopsis thaliana protein match is: TCH4 (Touch 4); hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucosyl transferase (TAIR:AT5G57560.1); Has 1424 Blast hits to 1415 proteins in 222 species: Archae - 0; Bacteria - 205; Metazoa - 0; Fungi - 298; Plants - 809; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink).  |
| AT2G18940 | AT2G18940.1 | TCGGTTCGGTTCGGTTTAG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G02860.1); Has 28771 Blast hits to 6230 proteins in 192 species: Archae - 4; Bacteria - 37; Metazoa - 1100; Fungi - 676; Plants - 25361; Viruses - 0; Other Eukaryotes - 1593 (source: NCBI BLink).  |
| AT2G19385 | AT2G19385.1 | TGGTTCGGTTTAT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2, LYAR-type (InterPro:IPR014898); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G19380.1); Has 443 Blast hits to 397 proteins in 133 species: Archae - 0; Bacteria - 6; Metazoa - 196; Fungi - 75; Plants - 41; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).  |
| AT2G19570 | AT2G19570.1 | GTAAACCGAA | Encodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds.  |
| AT2G19700 | AT2G19700.1 | CTAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G20130 | AT2G20130.1 | TCGGTTTAA | LIKE COV 1 (LCV1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, flower, root, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1965 Blast hits to 1965 proteins in 370 species: Archae - 6; Bacteria - 694; Metazoa - 0; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 1180 (source: NCBI BLink).  |
| AT2G20130.1 | TTCGGTTTAA | LIKE COV 1 (LCV1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, flower, root, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1965 Blast hits to 1965 proteins in 370 species: Archae - 6; Bacteria - 694; Metazoa - 0; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 1180 (source: NCBI BLink).  |
| AT2G20140 | AT2G20140.1 | TTAAACCGA | 26S protease regulatory complex subunit 4, putative; FUNCTIONS IN: hydrolase activity, nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), 26S proteasome subunit P45 (InterPro:IPR005937); BEST Arabidopsis thaliana protein match is: RPT2a (regulatory particle AAA-ATPase 2a); ATPase (TAIR:AT4G29040.1); Has 21701 Blast hits to 20141 proteins in 1744 species: Archae - 831; Bacteria - 5748; Metazoa - 4078; Fungi - 2440; Plants - 1746; Viruses - 26; Other Eukaryotes - 6832 (source: NCBI BLink).  |
| AT2G20140.1 | TTAAACCGAA | 26S protease regulatory complex subunit 4, putative; FUNCTIONS IN: hydrolase activity, nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), 26S proteasome subunit P45 (InterPro:IPR005937); BEST Arabidopsis thaliana protein match is: RPT2a (regulatory particle AAA-ATPase 2a); ATPase (TAIR:AT4G29040.1); Has 21701 Blast hits to 20141 proteins in 1744 species: Archae - 831; Bacteria - 5748; Metazoa - 4078; Fungi - 2440; Plants - 1746; Viruses - 26; Other Eukaryotes - 6832 (source: NCBI BLink).  |
| AT2G20450 | AT2G20450.1 | TTAAACCGA | 60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
| AT2G21440 | AT2G21440.1 | CTAAACCGAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: SCL28; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT5G18810.1); Has 29840 Blast hits to 16953 proteins in 878 species: Archae - 28; Bacteria - 2817; Metazoa - 13587; Fungi - 3327; Plants - 3239; Viruses - 21; Other Eukaryotes - 6821 (source: NCBI BLink).  |
| AT2G21500 | AT2G21500.1 | TTAAACCGAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
| AT2G21500.2 | TTAAACCGAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
| AT2G21660 | AT2G21660.1 | GTAAACCGACT | Encodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase).  |
| AT2G21660.2 | GTAAACCGACT | Encodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase).  |
| AT2G21960 | AT2G21960.1 | TTAAACCGA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56180.1); Has 140 Blast hits to 140 proteins in 40 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT2G22425 | AT2G22425.1 | TTAAACCGA | peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, signal peptidase complex, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT4G40042.1); Has 209 Blast hits to 209 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT2G22425.2 | TTAAACCGA | peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, signal peptidase complex, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT4G40042.1); Has 209 Blast hits to 209 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT2G22810 | AT2G22810.1 | TCGGTTTAT | key regulatory enzyme in the biosynthesis of the plant hormone ethylene. ACS4 is specifically induced by indoleacetic acid (IAA).  |
| AT2G23310 | AT2G23310.1 | GTAAACCGA | Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B.  |
| AT2G23310.2 | GTAAACCGA | Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B.  |
| AT2G24090 | AT2G24090.1 | TAACCGGAATAAACCGAAGTAAACCGGAT | ribosomal protein L35 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35, conserved site (InterPro:IPR018265), Ribosomal protein L35 (InterPro:IPR001706); Has 3401 Blast hits to 3401 proteins in 1037 species: Archae - 0; Bacteria - 2119; Metazoa - 6; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1232 (source: NCBI BLink).  |
| AT2G24650 | AT2G24650.2 | GTAAACCGACCCGAA | DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: apoplast; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: MEE45 (maternal effect embryo arrest 45); DNA binding / transcription factor (TAIR:AT4G00260.1); Has 527 Blast hits to 125 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 525; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G25355 | AT2G25355.1 | CTAAACCGAA | exonuclease-related; FUNCTIONS IN: RNA binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT4G32175.1); Has 294 Blast hits to 294 proteins in 141 species: Archae - 16; Bacteria - 0; Metazoa - 101; Fungi - 85; Plants - 32; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
| AT2G25355.2 | CTAAACCGAA | exonuclease-related; FUNCTIONS IN: RNA binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT4G32175.1); Has 294 Blast hits to 294 proteins in 141 species: Archae - 16; Bacteria - 0; Metazoa - 101; Fungi - 85; Plants - 32; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
| AT2G25870 | AT2G25870.1 | TTCGGTTTAG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cof protein (InterPro:IPR000150), HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), HAD superfamily hydrolase-like, type 3 (InterPro:IPR013200), Uncharacterised protein family UPF0054 (InterPro:IPR002036); Has 11617 Blast hits to 11603 proteins in 1525 species: Archae - 144; Bacteria - 9370; Metazoa - 28; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 2020 (source: NCBI BLink).  |
| AT2G26460 | AT2G26460.1 | TCGGTTTAA | RED family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RED-like, N-terminal (InterPro:IPR012916), RED-like, C-terminal (InterPro:IPR012492); Has 352 Blast hits to 259 proteins in 108 species: Archae - 0; Bacteria - 2; Metazoa - 220; Fungi - 53; Plants - 31; Viruses - 3; Other Eukaryotes - 43 (source: NCBI BLink).  |
| AT2G27010 | AT2G27010.1 | CTAAACCGA | member of CYP705A  |
| AT2G27260 | AT2G27260.1 | GGTTCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); Has 584 Blast hits to 584 proteins in 25 species: Archae - 2; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 578; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT2G27590 | AT2G27590.1 | CTAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 78 Blast hits to 78 proteins in 13 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
| AT2G27775 | AT2G27775.1 | CTAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27800.1); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G27775.2 | CTAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27800.1); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G28410 | AT2G28410.1 | TCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G60650.1); Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G28450 | AT2G28450.1 | CTAAACCGAA | zinc finger (CCCH-type) family protein; FUNCTIONS IN: methyltransferase activity, zinc ion binding, RNA methyltransferase activity, nucleic acid binding; INVOLVED IN: acetate biosynthetic process from carbon monoxide, methanol oxidation, RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Methyltransferase small (InterPro:IPR007848), (Uracil-5)-methyltransferase (InterPro:IPR010280); BEST Arabidopsis thaliana protein match is: RNA methyltransferase family protein (TAIR:AT3G21300.1); Has 4397 Blast hits to 3845 proteins in 1016 species: Archae - 74; Bacteria - 3383; Metazoa - 309; Fungi - 76; Plants - 54; Viruses - 3; Other Eukaryotes - 498 (source: NCBI BLink).  |
| AT2G28520 | AT2G28520.1 | CTAAACCGA | Vacuolar proton ATPase subunit VHA-a isoform 1. Localized in the trans-Golgi network.  |
| AT2G29700 | AT2G29700.1 | TCGGTTTAA | Encodes a protein containing one PH (pleckstrin homology) domain with a short N-terminal extension  |
| AT2G31170 | AT2G31170.1 | TTAAACCGAACCGGAAA | SYCO ARATH; FUNCTIONS IN: cysteine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: cysteinyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cysteinyl-tRNA synthetase, class Ia (InterPro:IPR002308), Cysteinyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015803), Cysteinyl-tRNA synthetase, class Ia, C-terminal (InterPro:IPR015804), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (C) family protein (TAIR:AT5G38830.1); Has 8663 Blast hits to 8413 proteins in 1630 species: Archae - 200; Bacteria - 3464; Metazoa - 434; Fungi - 181; Plants - 82; Viruses - 3; Other Eukaryotes - 4299 (source: NCBI BLink).  |
| AT2G31740 | AT2G31740.1 | TTAAACCGA | methyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: spermidine synthase-related / putrescine aminopropyltransferase-related (TAIR:AT5G04610.1); Has 1448 Blast hits to 1421 proteins in 339 species: Archae - 18; Bacteria - 478; Metazoa - 298; Fungi - 34; Plants - 123; Viruses - 0; Other Eukaryotes - 497 (source: NCBI BLink).  |
| AT2G31970 | AT2G31970.1 | TTCGGTTTAA | RAD50; FUNCTIONS IN: zinc ion binding, ATP binding, nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: chromosome, Mre11 complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc hook, Rad50 (InterPro:IPR013134), Rad50 zinc hook (InterPro:IPR007517), RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395), Recombination/repair protein Rad50 (InterPro:IPR004584); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27595.1); Has 83241 Blast hits to 43267 proteins in 1813 species: Archae - 1109; Bacteria - 10221; Metazoa - 39962; Fungi - 5795; Plants - 2652; Viruses - 436; Other Eukaryotes - 23066 (source: NCBI BLink).  |
| AT2G32190 | AT2G32190.1 | CTAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32210.1); Has 138 Blast hits to 138 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 126; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G32190.2 | CTAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32210.1); Has 138 Blast hits to 138 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 126; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G32680 | AT2G32680.1 | GTTCGGTTTAG | Receptor Like Protein 23 (AtRLP23); FUNCTIONS IN: protein binding, kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP24 (Receptor Like Protein 24); kinase/ protein binding (TAIR:AT2G33020.1); Has 79005 Blast hits to 22425 proteins in 849 species: Archae - 56; Bacteria - 5890; Metazoa - 27312; Fungi - 979; Plants - 38797; Viruses - 48; Other Eukaryotes - 5923 (source: NCBI BLink).  |
| AT2G34400 | AT2G34400.1 | CTAAACCGA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G22410.1); Has 14623 Blast hits to 5296 proteins in 169 species: Archae - 0; Bacteria - 4; Metazoa - 195; Fungi - 114; Plants - 13938; Viruses - 0; Other Eukaryotes - 372 (source: NCBI BLink).  |
| AT2G34710 | AT2G34710.1 | ATAAACCGAA | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA.  |
| AT2G34740 | AT2G34740.1 | ACGGTTTAGATAAACCGAA | catalytic/ protein serine/threonine phosphatase; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 5333 Blast hits to 5320 proteins in 675 species: Archae - 7; Bacteria - 1029; Metazoa - 1363; Fungi - 524; Plants - 1327; Viruses - 11; Other Eukaryotes - 1072 (source: NCBI BLink).  |
| AT2G36230 | AT2G36230.1 | CCAAACCGGAATAAACCGA | Encodes a BBMII isomerase involved in histidine biosynthesis.  |
| AT2G36240 | AT2G36240.1 | TCGGTTTATTCCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 18740 Blast hits to 5421 proteins in 159 species: Archae - 3; Bacteria - 12; Metazoa - 272; Fungi - 258; Plants - 17650; Viruses - 2; Other Eukaryotes - 543 (source: NCBI BLink).  |
| AT2G36410 | AT2G36410.1 | TTAAACCGA | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52920.1); Has 2189 Blast hits to 1955 proteins in 271 species: Archae - 54; Bacteria - 194; Metazoa - 967; Fungi - 110; Plants - 133; Viruses - 22; Other Eukaryotes - 709 (source: NCBI BLink).  |
| AT2G36410.2 | TTAAACCGA | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52920.1); Has 2189 Blast hits to 1955 proteins in 271 species: Archae - 54; Bacteria - 194; Metazoa - 967; Fungi - 110; Plants - 133; Viruses - 22; Other Eukaryotes - 709 (source: NCBI BLink).  |
| AT2G36410.3 | TTAAACCGA | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52920.1); Has 2189 Blast hits to 1955 proteins in 271 species: Archae - 54; Bacteria - 194; Metazoa - 967; Fungi - 110; Plants - 133; Viruses - 22; Other Eukaryotes - 709 (source: NCBI BLink).  |
| AT2G36580 | AT2G36580.1 | TTAAACCGA | pyruvate kinase, putative; FUNCTIONS IN: pyruvate kinase activity, potassium ion binding, magnesium ion binding, catalytic activity; INVOLVED IN: glycolysis; LOCATED IN: plasma membrane; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Pyruvate kinase, alpha/beta (InterPro:IPR015794), Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), Pyruvate kinase (InterPro:IPR001697), Pyruvate kinase, C-terminal-like (InterPro:IPR015795), Pyruvate kinase, barrel (InterPro:IPR015793); BEST Arabidopsis thaliana protein match is: pyruvate kinase, putative (TAIR:AT3G52990.1); Has 6484 Blast hits to 6462 proteins in 1513 species: Archae - 99; Bacteria - 3169; Metazoa - 478; Fungi - 168; Plants - 284; Viruses - 0; Other Eukaryotes - 2286 (source: NCBI BLink).  |
| AT2G37190 | AT2G37190.1 | GTAAACCGAAC | 60S ribosomal protein L12 (RPL12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cold, ribosome biogenesis; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L12 (RPL12B) (TAIR:AT3G53430.1); Has 1152 Blast hits to 1152 proteins in 433 species: Archae - 208; Bacteria - 278; Metazoa - 292; Fungi - 109; Plants - 81; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  |
| AT2G38646 | AT2G38646.1 | TTAAACCGAA | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).  |
| AT2G38670 | AT2G38670.1 | AAACCGGTTTTGGTTCGGTTTAG | Encodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis.  |
| AT2G38670.1 | TGGTTCGGTTTAG | Encodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis.  |
| AT2G38740 | AT2G38740.1 | CTAAACCGAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), Haloacid dehydrogenase/epoxide hydrolase (InterPro:IPR005833), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT1G56500.1); Has 10291 Blast hits to 10291 proteins in 1397 species: Archae - 137; Bacteria - 7267; Metazoa - 142; Fungi - 274; Plants - 203; Viruses - 3; Other Eukaryotes - 2265 (source: NCBI BLink).  |
| AT2G38780 | AT2G38780.1 | CTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 1; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT2G38780.1 | GTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 1; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT2G40550 | AT2G40550.1 | TCGGTTTAG | Encodes a nuclear localized target of E2Fa-DPa, transcription factors controlling cell cycle progression.  |
| AT2G41600 | AT2G41600.1 | ATAAACCGAATTAAACCGAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT2G41600.1 | TTCGGTTTAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT2G41600.2 | ATAAACCGAATTAAACCGAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT2G41600.2 | TTCGGTTTAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT2G41600.3 | ATAAACCGAATTAAACCGAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT2G41600.3 | TTCGGTTTAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT2G41600.4 | ATAAACCGAATTAAACCGAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT2G41600.4 | TTCGGTTTAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT2G41600.5 | ATAAACCGAATTAAACCGAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT2G41600.5 | TTCGGTTTAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT2G43210 | AT2G43210.1 | TTAAACCGAAC | UBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); Has 1155 Blast hits to 742 proteins in 155 species: Archae - 0; Bacteria - 70; Metazoa - 347; Fungi - 206; Plants - 87; Viruses - 16; Other Eukaryotes - 429 (source: NCBI BLink).  |
| AT2G43210.2 | TTAAACCGAAC | UBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); Has 1155 Blast hits to 742 proteins in 155 species: Archae - 0; Bacteria - 70; Metazoa - 347; Fungi - 206; Plants - 87; Viruses - 16; Other Eukaryotes - 429 (source: NCBI BLink).  |
| AT2G43610 | AT2G43610.1 | TTAAACCGA | glycoside hydrolase family 19 protein; FUNCTIONS IN: chitin binding, chitinase activity; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Chitin-binding, type 1, conserved site (InterPro:IPR018371), Glycoside hydrolase, family 19 (InterPro:IPR016283), Chitin-binding, type 1 (InterPro:IPR001002), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: chitinase, putative (TAIR:AT2G43620.1); Has 2179 Blast hits to 1930 proteins in 437 species: Archae - 0; Bacteria - 469; Metazoa - 33; Fungi - 217; Plants - 1249; Viruses - 45; Other Eukaryotes - 166 (source: NCBI BLink).  |
| AT2G44530 | AT2G44530.1 | ATAAACCGAA | ribose-phosphate pyrophosphokinase, putative / phosphoribosyl diphosphate synthetase, putative; FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 2 / phosphoribosyl diphosphate synthetase 2 (PRS2) (TAIR:AT1G32380.1); Has 7996 Blast hits to 7829 proteins in 1556 species: Archae - 171; Bacteria - 3334; Metazoa - 500; Fungi - 457; Plants - 129; Viruses - 7; Other Eukaryotes - 3398 (source: NCBI BLink).  |
| AT2G44530.2 | ATAAACCGAA | ribose-phosphate pyrophosphokinase, putative / phosphoribosyl diphosphate synthetase, putative; FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 2 / phosphoribosyl diphosphate synthetase 2 (PRS2) (TAIR:AT1G32380.1); Has 7996 Blast hits to 7829 proteins in 1556 species: Archae - 171; Bacteria - 3334; Metazoa - 500; Fungi - 457; Plants - 129; Viruses - 7; Other Eukaryotes - 3398 (source: NCBI BLink).  |
| AT3G02570 | AT3G02570.1 | TCGGTTTAG | Encodes a protein with phosphomannose isomerase activity.  |
| AT3G02910 | AT3G02910.1 | TCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Butirosin biosynthesis, BtrG-like (InterPro:IPR013024), AIG2-like (InterPro:IPR009288); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46720.1); Has 210 Blast hits to 210 proteins in 66 species: Archae - 2; Bacteria - 27; Metazoa - 122; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
| AT3G03120 | AT3G03120.1 | GTAAACCGAA | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins.  |
| AT3G03220 | AT3G03220.1 | ATAAACCGA | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)  |
| AT3G03370 | AT3G03370.1 | TTCGGTTTAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT5G06050.1); Has 26 Blast hits to 26 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G03580 | AT3G03580.1 | TCGGTTTAAACCGGGTT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DOT4 (DEFECTIVELY ORGANIZED TRIBUTARIES 4) (TAIR:AT4G18750.1); Has 19378 Blast hits to 5309 proteins in 162 species: Archae - 0; Bacteria - 2; Metazoa - 56; Fungi - 84; Plants - 18779; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink).  |
| AT3G03890 | AT3G03890.1 | GTAAACCGAA | FMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).  |
| AT3G03890.2 | GTAAACCGAA | FMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).  |
| AT3G04080 | AT3G04080.1 | TTCGGTTTAG | Encodes an enzyme with ATPase and ADPase activity (an apyrase) that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.  |
| AT3G04630 | AT3G04630.1 | GTAAACCGA | Member of a small gene family which have a KLEEK domain which may be involved in protein- protein interactions. Over expression of WDL1 results in abnormal root development.  |
| AT3G04630.2 | GTAAACCGA | Member of a small gene family which have a KLEEK domain which may be involved in protein- protein interactions. Over expression of WDL1 results in abnormal root development.  |
| AT3G04630.3 | GTAAACCGA | Member of a small gene family which have a KLEEK domain which may be involved in protein- protein interactions. Over expression of WDL1 results in abnormal root development.  |
| AT3G04830 | AT3G04830.1 | TTAAACCGAACCGGTTCA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
| AT3G04830.2 | TTAAACCGAACCGGTTCA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
| AT3G05230 | AT3G05230.1 | TTAAACCGAA | signal peptidase subunit family protein; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endoplasmic reticulum, cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Signal peptidase 22 kDa subunit (InterPro:IPR007653); BEST Arabidopsis thaliana protein match is: signal peptidase subunit family protein (TAIR:AT5G27430.1); Has 300 Blast hits to 300 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).  |
| AT3G05230.2 | TTAAACCGAA | signal peptidase subunit family protein; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endoplasmic reticulum, cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Signal peptidase 22 kDa subunit (InterPro:IPR007653); BEST Arabidopsis thaliana protein match is: signal peptidase subunit family protein (TAIR:AT5G27430.1); Has 300 Blast hits to 300 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).  |
| AT3G05570 | AT3G05570.1 | TTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G39235.1); Has 39 Blast hits to 39 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G05570.1 | TTCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G39235.1); Has 39 Blast hits to 39 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G05625 | AT3G05625.1 | GTAAACCGA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 209 Blast hits to 207 proteins in 91 species: Archae - 14; Bacteria - 152; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
| AT3G05625.1 | TCGGTTTAT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 209 Blast hits to 207 proteins in 91 species: Archae - 14; Bacteria - 152; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
| AT3G05700 | AT3G05700.1 | ATAAACCGA | INVOLVED IN: response to water deprivation; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT5G26990.1); Has 167 Blast hits to 167 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 38; Fungi - 0; Plants - 128; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G06140 | AT3G06140.1 | TCGGTTTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G19080.1); Has 6615 Blast hits to 4433 proteins in 311 species: Archae - 2; Bacteria - 83; Metazoa - 2278; Fungi - 466; Plants - 2616; Viruses - 263; Other Eukaryotes - 907 (source: NCBI BLink).  |
| AT3G06140.1 | TTAAACCGAAC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G19080.1); Has 6615 Blast hits to 4433 proteins in 311 species: Archae - 2; Bacteria - 83; Metazoa - 2278; Fungi - 466; Plants - 2616; Viruses - 263; Other Eukaryotes - 907 (source: NCBI BLink).  |
| AT3G09300 | AT3G09300.1 | GTAAACCGA | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 3B (ORP3B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein, conserved site (InterPro:IPR018494), Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: UNE18 (UNFERTILIZED EMBRYO SAC 18); oxysterol binding / sterol binding (TAIR:AT5G02100.1); Has 1795 Blast hits to 1772 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 940; Fungi - 458; Plants - 154; Viruses - 0; Other Eukaryotes - 243 (source: NCBI BLink).  |
| AT3G09360 | AT3G09360.1 | TTCGGTTTAG | RNA polymerase II transcription factor/ protein binding / transcription activator/ transcription regulator/ translation initiation factor/ zinc ion binding; FUNCTIONS IN: in 6 functions; INVOLVED IN: translational initiation, positive regulation of transcription, regulation of transcription, DNA-dependent, transcription initiation; LOCATED IN: transcription factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor TFIIB related (InterPro:IPR000812), Cyclin-like (InterPro:IPR011028), Transcription factor TFIIB, cyclin-related (InterPro:IPR013150), Cyclin-related (InterPro:IPR013763), Brf1-like TBP-binding (InterPro:IPR011665), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: MEE65 (maternal effect embryo arrest 65); RNA polymerase II transcription factor/ cation:chloride symporter (TAIR:AT2G01280.1); Has 20399 Blast hits to 12051 proteins in 760 species: Archae - 341; Bacteria - 837; Metazoa - 8420; Fungi - 1909; Plants - 698; Viruses - 262; Other Eukaryotes - 7932 (source: NCBI BLink).  |
| AT3G09470 | AT3G09470.1 | ATAAACCGAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
| AT3G09470.2 | ATAAACCGAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
| AT3G10070 | AT3G10070.1 | TTCGGTTTAA | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12.  |
| AT3G10140 | AT3G10140.1 | TCGGTTTAA | recA homolog 3 (RECA3); FUNCTIONS IN: nucleoside-triphosphatase activity, DNA-dependent ATPase activity, DNA binding, nucleotide binding, ATP binding; INVOLVED IN: DNA repair, SOS response, DNA recombination, DNA metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), RecA (InterPro:IPR013765), RecA bacterial DNA recombination (InterPro:IPR001553); BEST Arabidopsis thaliana protein match is: recA family protein (TAIR:AT2G19490.1); Has 13670 Blast hits to 13583 proteins in 3361 species: Archae - 216; Bacteria - 8994; Metazoa - 140; Fungi - 177; Plants - 138; Viruses - 71; Other Eukaryotes - 3934 (source: NCBI BLink).  |
| AT3G10610 | AT3G10610.1 | TTAAACCGA | 40S ribosomal protein S17 (RPS17C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17B) (TAIR:AT2G05220.2); Has 727 Blast hits to 727 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).  |
| AT3G10860 | AT3G10860.1 | TTCGGTTTAC | ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT5G05370.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G11590 | AT3G11590.1 | TTCGGTTTAAGTCGGTTTAC | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22310.1); Has 18950 Blast hits to 12386 proteins in 794 species: Archae - 267; Bacteria - 1381; Metazoa - 9845; Fungi - 1311; Plants - 683; Viruses - 61; Other Eukaryotes - 5402 (source: NCBI BLink).  |
| AT3G11710 | AT3G11710.1 | ATAAACCGAA | ARABIDOPSIS THALIANA LYSYL-TRNA SYNTHETASE 1 (ATKRS-1); FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, lysine-tRNA ligase activity, ATP binding, nucleic acid binding; INVOLVED IN: lysyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Lysyl-tRNA synthetase, class II, C-terminal (InterPro:IPR018149), Lysyl-tRNA synthetase, class II (InterPro:IPR002313), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 15525 Blast hits to 13421 proteins in 1696 species: Archae - 251; Bacteria - 8760; Metazoa - 567; Fungi - 510; Plants - 102; Viruses - 0; Other Eukaryotes - 5335 (source: NCBI BLink).  |
| AT3G11710.1 | GTAAACCGAATAAGCCCTA | ARABIDOPSIS THALIANA LYSYL-TRNA SYNTHETASE 1 (ATKRS-1); FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, lysine-tRNA ligase activity, ATP binding, nucleic acid binding; INVOLVED IN: lysyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Lysyl-tRNA synthetase, class II, C-terminal (InterPro:IPR018149), Lysyl-tRNA synthetase, class II (InterPro:IPR002313), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 15525 Blast hits to 13421 proteins in 1696 species: Archae - 251; Bacteria - 8760; Metazoa - 567; Fungi - 510; Plants - 102; Viruses - 0; Other Eukaryotes - 5335 (source: NCBI BLink).  |
| AT3G12070 | AT3G12070.1 | TTCGGTTTAG | geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Prenyltransferase/squalene oxidase (InterPro:IPR001330); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative (TAIR:AT5G12210.1); Has 1147 Blast hits to 1009 proteins in 184 species: Archae - 0; Bacteria - 22; Metazoa - 467; Fungi - 295; Plants - 126; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).  |
| AT3G12070.2 | TTCGGTTTAG | geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Prenyltransferase/squalene oxidase (InterPro:IPR001330); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative (TAIR:AT5G12210.1); Has 1147 Blast hits to 1009 proteins in 184 species: Archae - 0; Bacteria - 22; Metazoa - 467; Fungi - 295; Plants - 126; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).  |
| AT3G12080 | AT3G12080.1 | CTAAACCGAA | embryo defective 2738 (emb2738); FUNCTIONS IN: GTP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), Small GTP-binding protein (InterPro:IPR005225), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT5G39960.1); Has 29827 Blast hits to 16895 proteins in 1667 species: Archae - 139; Bacteria - 20018; Metazoa - 342; Fungi - 286; Plants - 215; Viruses - 0; Other Eukaryotes - 8827 (source: NCBI BLink).  |
| AT3G12080.2 | CTAAACCGAA | embryo defective 2738 (emb2738); FUNCTIONS IN: GTP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), Small GTP-binding protein (InterPro:IPR005225), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT5G39960.1); Has 29827 Blast hits to 16895 proteins in 1667 species: Archae - 139; Bacteria - 20018; Metazoa - 342; Fungi - 286; Plants - 215; Viruses - 0; Other Eukaryotes - 8827 (source: NCBI BLink).  |
| AT3G12130 | AT3G12130.1 | TTCGGTTTAC | KH domain-containing protein / zinc finger (CCCH type) family protein; FUNCTIONS IN: transcription factor activity, nucleic acid binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein / zinc finger (CCCH type) family protein (TAIR:AT5G06770.1); Has 951 Blast hits to 736 proteins in 106 species: Archae - 0; Bacteria - 4; Metazoa - 647; Fungi - 21; Plants - 174; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
| AT3G12170 | AT3G12170.1 | GTTCGGTTTAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: ATJ6 (Arabidopsis J-domain protein 6); heat shock protein binding / unfolded protein binding (TAIR:AT5G06910.1); Has 16438 Blast hits to 16435 proteins in 1943 species: Archae - 109; Bacteria - 5179; Metazoa - 3539; Fungi - 1500; Plants - 1231; Viruses - 45; Other Eukaryotes - 4835 (source: NCBI BLink).  |
| AT3G12260 | AT3G12260.1 | GTAAACCGAA | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
| AT3G12550 | AT3G12550.1 | CTAAACCGAACCGA | XH/XS domain-containing protein / XS zinc finger domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function XS (InterPro:IPR005380), Region of unknown function XH (InterPro:IPR005379), Region of unknown function, putative Zinc finger, XS and XH (InterPro:IPR005381); BEST Arabidopsis thaliana protein match is: XH/XS domain-containing protein / XS zinc finger domain-containing protein (TAIR:AT3G48670.2); Has 23408 Blast hits to 15451 proteins in 943 species: Archae - 218; Bacteria - 2032; Metazoa - 11697; Fungi - 1231; Plants - 587; Viruses - 80; Other Eukaryotes - 7563 (source: NCBI BLink).  |
| AT3G12600 | AT3G12600.1 | TGGGCCCATTAAACCGAA | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
| AT3G12600.2 | TGGGCCCATTAAACCGAA | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
| AT3G13230 | AT3G13230.1 | TTCGGTTTAC | RNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087); Has 526 Blast hits to 526 proteins in 226 species: Archae - 118; Bacteria - 0; Metazoa - 138; Fungi - 131; Plants - 49; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
| AT3G14050 | AT3G14050.1 | TCGGTTTAG | RELA-SPOT HOMOLOG 2 (RSH2); FUNCTIONS IN: GTP diphosphokinase activity; INVOLVED IN: response to abscisic acid stimulus, response to wounding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674), Metal-dependent phosphohydrolase, HD region (InterPro:IPR003607), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH3 (RELA/SPOT HOMOLOG 3); GTP diphosphokinase (TAIR:AT1G54130.1); Has 8188 Blast hits to 8061 proteins in 1323 species: Archae - 2; Bacteria - 4464; Metazoa - 186; Fungi - 38; Plants - 129; Viruses - 2; Other Eukaryotes - 3367 (source: NCBI BLink).  |
| AT3G14180 | AT3G14180.1 | TTACCCCTAAACCGA | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT3G15140 | AT3G15140.1 | TCGGTTTAT | exonuclease family protein; FUNCTIONS IN: exonuclease activity; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); Has 439 Blast hits to 439 proteins in 90 species: Archae - 0; Bacteria - 29; Metazoa - 281; Fungi - 11; Plants - 34; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
| AT3G15660 | AT3G15660.1 | CTAAACCGA | GLUTAREDOXIN 4 (GRX4); FUNCTIONS IN: metal ion binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336), Glutaredoxin-related protein (InterPro:IPR004480); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT4G04950.1); Has 4103 Blast hits to 3965 proteins in 839 species: Archae - 12; Bacteria - 1387; Metazoa - 395; Fungi - 212; Plants - 231; Viruses - 0; Other Eukaryotes - 1866 (source: NCBI BLink).  |
| AT3G15660.2 | CTAAACCGA | GLUTAREDOXIN 4 (GRX4); FUNCTIONS IN: metal ion binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336), Glutaredoxin-related protein (InterPro:IPR004480); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT4G04950.1); Has 4103 Blast hits to 3965 proteins in 839 species: Archae - 12; Bacteria - 1387; Metazoa - 395; Fungi - 212; Plants - 231; Viruses - 0; Other Eukaryotes - 1866 (source: NCBI BLink).  |
| AT3G16190 | AT3G16190.1 | AGTCGGTTTAG | isochorismatase hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isochorismatase hydrolase (InterPro:IPR000868); Has 3706 Blast hits to 3703 proteins in 851 species: Archae - 95; Bacteria - 2998; Metazoa - 0; Fungi - 127; Plants - 43; Viruses - 0; Other Eukaryotes - 443 (source: NCBI BLink).  |
| AT3G18510 | AT3G18510.1 | CTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G18570 | AT3G18570.1 | CTAAACCGAA | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: glycine-rich protein / oleosin (TAIR:AT1G48990.1); Has 235 Blast hits to 235 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 235; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G18780 | AT3G18780.1 | TCGGTTTAA | Encodes an actin that is constitutively expressed in vegetative structures but not pollen. ACT2 is involved in tip growth of root hairs.  |
| AT3G18780.2 | TCGGTTTAA | Encodes an actin that is constitutively expressed in vegetative structures but not pollen. ACT2 is involved in tip growth of root hairs.  |
| AT3G20680 | AT3G20680.1 | ATAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G20870 | AT3G20870.1 | ACCGGGTTAAACCGACCCGA | metal transporter family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc/iron permease (InterPro:IPR003689); BEST Arabidopsis thaliana protein match is: metal transporter family protein (TAIR:AT3G08650.2); Has 2198 Blast hits to 2183 proteins in 642 species: Archae - 78; Bacteria - 1120; Metazoa - 489; Fungi - 73; Plants - 72; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink).  |
| AT3G21865 | AT3G21865.1 | TTCGGTTTAT | Interacts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes.  |
| AT3G22420 | AT3G22420.1 | AAAACCGGTTTAGTAAACCGA | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.  |
| AT3G22420.2 | AAAACCGGTTTAGTAAACCGA | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.  |
| AT3G23805 | AT3G23805.1 | TTAAACCGACCGGTTTAA | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.  |
| AT3G24100 | AT3G24100.1 | GTAAACCGAACC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Four F5 protein (InterPro:IPR007513); BEST Arabidopsis thaliana protein match is: four F5 protein-related / 4F5 protein-related (TAIR:AT4G13615.1); Has 195 Blast hits to 195 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 136; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT3G24503 | AT3G24503.1 | TCGGTTTAA | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively  |
| AT3G25110 | AT3G25110.1 | TTAAACCGA | Encodes a FatA acyl-ACP thioesterase  |
| AT3G25860 | AT3G25860.1 | CTAAACCGAA | Nuclear encoded dihydrolipoamide S-acetyltransferase (LTA2) that encodes teh Pyruvate Decarboxylase E2 subunit. Mutant has embryo defect.  |
| AT3G26030 | AT3G26030.1 | TCGGTTTAG | protein phosphatase 2A regulatory subunit isoform B' delta  |
| AT3G26630 | AT3G26630.1 | ATAAACCGAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 11770 Blast hits to 4443 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 21; Plants - 11596; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).  |
| AT3G26630.1 | TTCGGTTTAG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 11770 Blast hits to 4443 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 21; Plants - 11596; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).  |
| AT3G26730 | AT3G26730.1 | TTAAACCGAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 5616 Blast hits to 1874 proteins in 214 species: Archae - 3; Bacteria - 108; Metazoa - 2179; Fungi - 373; Plants - 239; Viruses - 6; Other Eukaryotes - 2708 (source: NCBI BLink).  |
| AT3G28710 | AT3G28710.1 | TTCGGTTTAA | H+-transporting two-sector ATPase, putative; FUNCTIONS IN: hydrogen ion transmembrane transporter activity, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: vacuolar membrane, plasma membrane, vacuole, plant-type vacuole; EXPRESSED IN: cultured cell, callus; CONTAINS InterPro DOMAIN/s: ATPase, V0/A0 complex, subunit C/D (InterPro:IPR002843), ATPase, V0 complex, subunit D (InterPro:IPR016727); BEST Arabidopsis thaliana protein match is: H+-transporting two-sector ATPase, putative (TAIR:AT3G28715.1); Has 443 Blast hits to 442 proteins in 188 species: Archae - 14; Bacteria - 1; Metazoa - 206; Fungi - 98; Plants - 47; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
| AT3G29185 | AT3G29185.1 | ATCCGGTTCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 38 Blast hits to 38 proteins in 17 species: Archae - 0; Bacteria - 23; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G29185.2 | ATCCGGTTCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 38 Blast hits to 38 proteins in 17 species: Archae - 0; Bacteria - 23; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G44340 | AT3G44340.1 | AACCGAACTTAAACCGAAC | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions.  |
| AT3G44340.2 | AACCGAACTTAAACCGAAC | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions.  |
| AT3G45170 | AT3G45170.1 | TCGGTTTAA | zinc finger (GATA type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, NHR/GATA-type (InterPro:IPR013088), Zinc finger, GATA-type (InterPro:IPR000679); BEST Arabidopsis thaliana protein match is: zinc finger (GATA type) family protein (TAIR:AT5G66320.2); Has 969 Blast hits to 928 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 66; Fungi - 446; Plants - 411; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).  |
| AT3G46460 | AT3G46460.1 | TTAAACCGA | ubiquitin-conjugating enzyme 13 (UBC13); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC14 (ubiquitin-conjugating enzyme 14); ubiquitin-protein ligase (TAIR:AT3G55380.1); Has 7555 Blast hits to 7535 proteins in 307 species: Archae - 0; Bacteria - 0; Metazoa - 3565; Fungi - 1492; Plants - 1176; Viruses - 19; Other Eukaryotes - 1303 (source: NCBI BLink).  |
| AT3G47470 | AT3G47470.1 | ATAAACCGA | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins.  |
| AT3G47580 | AT3G47580.1 | GTAAACCGA | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT3G47090.1); Has 141138 Blast hits to 91962 proteins in 3377 species: Archae - 90; Bacteria - 11267; Metazoa - 57018; Fungi - 6584; Plants - 47754; Viruses - 283; Other Eukaryotes - 18142 (source: NCBI BLink).  |
| AT3G47836 | AT3G47836.1 | ATAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G47836.2 | ATAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G48420 | AT3G48420.1 | TCGGTTTAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G39970.1); Has 7388 Blast hits to 7387 proteins in 1159 species: Archae - 34; Bacteria - 5445; Metazoa - 112; Fungi - 80; Plants - 209; Viruses - 3; Other Eukaryotes - 1505 (source: NCBI BLink).  |
| AT3G49080 | AT3G49080.1 | CAAACCGGAATAAACCGACT | ribosomal protein S9 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: RPS9 (RIBOSOMAL PROTEIN S9); structural constituent of ribosome (TAIR:AT1G74970.1); Has 5624 Blast hits to 5609 proteins in 1600 species: Archae - 138; Bacteria - 2917; Metazoa - 148; Fungi - 89; Plants - 121; Viruses - 18; Other Eukaryotes - 2193 (source: NCBI BLink).  |
| AT3G50340 | AT3G50340.1 | CTAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G67020.1); Has 59 Blast hits to 59 proteins in 21 species: Archae - 0; Bacteria - 23; Metazoa - 0; Fungi - 3; Plants - 32; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G52860 | AT3G52860.1 | TTCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 68 Blast hits to 68 proteins in 28 species: Archae - 0; Bacteria - 2; Metazoa - 36; Fungi - 13; Plants - 13; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT3G53110 | AT3G53110.1 | AGTCGGTTTAATCACGTGTA | Encodes a putative DEAD-Box RNA Helicase and has RNA-dependent ATPase activity. Mutant is Sensitive to chilling stress and heat stress. Germination of the mutant is inhibited by ABA. LOS4 may be involved in temperature sensing. Is enriched in the nuclear envelope and also located in the cytoplasm. LOS4 is involved in export of poly A RNA.  |
| AT3G53110.1 | ATAAACCGAA | Encodes a putative DEAD-Box RNA Helicase and has RNA-dependent ATPase activity. Mutant is Sensitive to chilling stress and heat stress. Germination of the mutant is inhibited by ABA. LOS4 may be involved in temperature sensing. Is enriched in the nuclear envelope and also located in the cytoplasm. LOS4 is involved in export of poly A RNA.  |
| AT3G53210 | AT3G53210.1 | TCGGTTTAG | nodulin MtN21 family protein; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT1G75500.1); Has 2469 Blast hits to 2459 proteins in 336 species: Archae - 6; Bacteria - 855; Metazoa - 4; Fungi - 0; Plants - 649; Viruses - 0; Other Eukaryotes - 955 (source: NCBI BLink).  |
| AT3G54050 | AT3G54050.1 | TTCGGTTTAG | fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative; FUNCTIONS IN: fructose 1,6-bisphosphate 1-phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: response to cold, fructose metabolic process; LOCATED IN: apoplast, stromule, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase/Fructose-1,6-bisphosphatase (InterPro:IPR017955), Fructose-1,6-bisphosphatase (InterPro:IPR000146); BEST Arabidopsis thaliana protein match is: fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative (TAIR:AT1G43670.1); Has 2353 Blast hits to 2350 proteins in 800 species: Archae - 24; Bacteria - 1225; Metazoa - 332; Fungi - 108; Plants - 224; Viruses - 0; Other Eukaryotes - 440 (source: NCBI BLink).  |
| AT3G54300 | AT3G54300.1 | ATAAACCGA | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal.  |
| AT3G54300.2 | ATAAACCGA | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal.  |
| AT3G54900 | AT3G54900.1 | TTAAACCGAA | A.thaliana PICOT protein.It activates CAX1 gene Calcium transport activity.In other organisms, PICOT proteins appear to play a negative regulatory role in cellular stress responses.  |
| AT3G55360 | AT3G55360.1 | ATAAACCGAA | Enoyl-CoA reductase is involved in all very long chain fatty acids (VLCFA) elongation reactions that are required for cuticular wax, storage lipid and sphingolipid metabolism. The protein is located in the ER, but in contrast to its yeast homolog TSC13 is not particularly enriched in the nuclear envelope-vacuole junction. Mutants in this gene show abnormal organ morphology and stem glossiness. Cells in all tissues are only about 1/3 of the size of wild type cells. The morphological changes are most likely to result from the reduction in the VLCFA content of sphingolipids. Mutants also show abnormalities in the endocytic membrane organization and transport.  |
| AT3G55600 | AT3G55600.1 | TCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: cation exchanger, putative (CAX10) (TAIR:AT1G54110.1); Has 167 Blast hits to 167 proteins in 56 species: Archae - 0; Bacteria - 8; Metazoa - 84; Fungi - 28; Plants - 42; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT3G55665 | AT3G55665.1 | ATAAACCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55672.1); Has 70 Blast hits to 67 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G55830 | AT3G55830.1 | TCGGTTTAT | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.  |
| AT3G56750 | AT3G56750.1 | TCGGTTCGGTTTAATTAAACCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41150.2); Has 71 Blast hits to 71 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT3G57050 | AT3G57050.1 | ATAAACCGAA | Encodes second enzyme in the methionine biosynthetic pathway  |
| AT3G57050.2 | ATAAACCGAA | Encodes second enzyme in the methionine biosynthetic pathway  |
| AT3G57050.3 | ATAAACCGAA | Encodes second enzyme in the methionine biosynthetic pathway  |
| AT3G57280 | AT3G57280.1 | CTAAACCGAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G20510.1); Has 95 Blast hits to 95 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 21; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G57280.1 | CTAAACCGAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G20510.1); Has 95 Blast hits to 95 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 21; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G60190 | AT3G60190.1 | GTAAACCGACCGAACCA | At3g60190 encodes Arabidopsis dynamin-related protein 1E, DRP1E, also known as EDR3, ADL4 and ADL1E, which is 624 amino acid residues long, has a predicted mass of 69.8 kDa and a pI of 7.5. Dynamin-related protein 1E belongs to a plant-specific subclass of dynamin-related proteins (DRP1), consisting of five members in Arabidopsis (A, B, C, D, E). This class is characterized by having an N-terminal GTPase domain, a central dynamin 2 domain and a C-terminal GTPase effector domain (GED), a typical structure for plant dynamin-related proteins. However, this class lacks a PH domain and a proline-rich domain, which are found in classical animal dynamin-like proteins. Based on work on animal dynamins, the plant DRP1 proteins should be able to form polymeric structures that wrap around membranes to facilitate membrane tubulation and pinching off of vesicles, processes that are essential to vesicle trafficking and membrane compartmentalization. The edr3 mutation causes a P77L substitution in the G2 motif of the GTPase domain of DRP1E. edr3 mutant Arabidopsis plants display enhanced cell death in response to powdery mildew infection.  |
| AT3G61360 | AT3G61360.1 | ATAAACCGA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02420.1); Has 11229 Blast hits to 4504 proteins in 162 species: Archae - 1; Bacteria - 22; Metazoa - 203; Fungi - 245; Plants - 10371; Viruses - 0; Other Eukaryotes - 387 (source: NCBI BLink).  |
| AT3G61530 | AT3G61530.1 | GTAAACCGA | Encodes a ketopentoate hydroxymethyltransferase that appears to localize to the mitochondria. This protein is expected to play a role in pantothenate (vitamin B5) biosynthesis.  |
| AT3G61530.2 | GTAAACCGA | Encodes a ketopentoate hydroxymethyltransferase that appears to localize to the mitochondria. This protein is expected to play a role in pantothenate (vitamin B5) biosynthesis.  |
| AT3G62450 | AT3G62450.1 | CTAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 11 Blast hits to 11 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G63220 | AT3G63220.1 | TCGGTTTAG | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G16250.1); Has 4947 Blast hits to 3281 proteins in 155 species: Archae - 4; Bacteria - 274; Metazoa - 3818; Fungi - 8; Plants - 628; Viruses - 20; Other Eukaryotes - 195 (source: NCBI BLink).  |
| AT3G63220.2 | TCGGTTTAG | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G16250.1); Has 4947 Blast hits to 3281 proteins in 155 species: Archae - 4; Bacteria - 274; Metazoa - 3818; Fungi - 8; Plants - 628; Viruses - 20; Other Eukaryotes - 195 (source: NCBI BLink).  |
| AT4G01350 | AT4G01350.1 | TCGGTTTAT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; CONTAINS InterPro DOMAIN/s: Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), DC1 (InterPro:IPR004146), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: ULI3; diacylglycerol binding / heme binding (TAIR:AT5G59920.1); Has 1540 Blast hits to 570 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 31; Fungi - 4; Plants - 1455; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink).  |
| AT4G01400 | AT4G01400.2 | TCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COG4 transport (InterPro:IPR013167), Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 11639 Blast hits to 3936 proteins in 180 species: Archae - 0; Bacteria - 2; Metazoa - 206; Fungi - 141; Plants - 11004; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink).  |
| AT4G01900 | AT4G01900.1 | CTAAACCGA | encodes a PII protein that may function as part of a signal transduction network involved in perceiving the status of carbon and organic nitrogen. Forms a protein complex with N-acetylglutamate kinase and regulates the kinase activity by relieving the feedback inhibition of the kinase by arginine.  |
| AT4G01900.1 | CTAAACCGACT | encodes a PII protein that may function as part of a signal transduction network involved in perceiving the status of carbon and organic nitrogen. Forms a protein complex with N-acetylglutamate kinase and regulates the kinase activity by relieving the feedback inhibition of the kinase by arginine.  |
| AT4G04630 | AT4G04630.1 | GTTCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 212 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G04630.1 | TCGGTTCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 212 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G04830 | AT4G04830.1 | GTAAACCGAACCGG | methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04810.1); Has 5914 Blast hits to 5905 proteins in 1230 species: Archae - 53; Bacteria - 2684; Metazoa - 224; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2759 (source: NCBI BLink).  |
| AT4G05330 | AT4G05330.1 | TTAAACCGA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  |
| AT4G05400 | AT4G05400.1 | TCGGTTTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21140.1); Has 31 Blast hits to 31 proteins in 12 species: Archae - 5; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G05400.2 | TCGGTTTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21140.1); Has 31 Blast hits to 31 proteins in 12 species: Archae - 5; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G05410 | AT4G05410.1 | TTCGGTTTAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: mitochondrial fission; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, anaphase-promoting complex, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: EMB2271 (EMBRYO DEFECTIVE 2271); nucleotide binding (TAIR:AT4G21130.1); Has 36165 Blast hits to 19140 proteins in 585 species: Archae - 40; Bacteria - 4252; Metazoa - 16125; Fungi - 6813; Plants - 3147; Viruses - 96; Other Eukaryotes - 5692 (source: NCBI BLink).  |
| AT4G05420 | AT4G05420.1 | GTAAACCGAA | Structurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis.  |
| AT4G05420.1 | GTTCGGTTTAG | Structurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis.  |
| AT4G05420.2 | GTAAACCGAA | Structurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis.  |
| AT4G05420.2 | GTTCGGTTTAG | Structurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis.  |
| AT4G05450 | AT4G05450.1 | ATCCGGTTCGGTTTAA | adrenodoxin-like ferredoxin 2; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: pollen tube development; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Adrenodoxin (InterPro:IPR001055), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Adrenodoxin, iron-sulphur binding site (InterPro:IPR018298); BEST Arabidopsis thaliana protein match is: adrenodoxin-like ferredoxin 1 (TAIR:AT4G21090.3); Has 3455 Blast hits to 3455 proteins in 760 species: Archae - 0; Bacteria - 1368; Metazoa - 220; Fungi - 90; Plants - 51; Viruses - 0; Other Eukaryotes - 1726 (source: NCBI BLink).  |
| AT4G05460 | AT4G05460.1 | TCGGTTCGGTTTAT | F-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
| AT4G08280 | AT4G08280.1 | ATAAACCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin 2 (InterPro:IPR008554), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); Has 214 Blast hits to 214 proteins in 65 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
| AT4G09150 | AT4G09150.1 | TCGGTTTAT | T-complex protein 11; FUNCTIONS IN: phosphopantetheine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862), Phosphopantetheine attachment site (InterPro:IPR006162); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT1G22930.1); Has 12960 Blast hits to 8305 proteins in 753 species: Archae - 49; Bacteria - 1704; Metazoa - 5727; Fungi - 995; Plants - 381; Viruses - 20; Other Eukaryotes - 4084 (source: NCBI BLink).  |
| AT4G10040 | AT4G10040.1 | CTAAACCGA | Encodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers.  |
| AT4G10710 | AT4G10710.1 | TCGGTTTAA | encodes a component of the FAcilitates Chromatin Transcription (FACT) complex, SPT16.  |
| AT4G10790 | AT4G10790.1 | CTAAACCGAA | UBX domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UAS (InterPro:IPR006577), UBX (InterPro:IPR001012); BEST Arabidopsis thaliana protein match is: SAY1 (TAIR:AT4G11740.1); Has 16384 Blast hits to 7928 proteins in 781 species: Archae - 7; Bacteria - 2234; Metazoa - 5947; Fungi - 1696; Plants - 733; Viruses - 184; Other Eukaryotes - 5583 (source: NCBI BLink).  |
| AT4G10800 | AT4G10800.1 | TTCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT3G05675.2); Has 114 Blast hits to 114 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G11910 | AT4G11910.1 | GTAAACCGAA | INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: NYE1 (NON-YELLOWING 1) (TAIR:AT4G22920.1); Has 130 Blast hits to 128 proteins in 45 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT4G13615 | AT4G13615.1 | CTAAACCGA | four F5 protein-related / 4F5 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Four F5 protein (InterPro:IPR007513); Has 105 Blast hits to 105 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 52; Fungi - 6; Plants - 43; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT4G13720 | AT4G13720.1 | TCGGTTTAC | inosine triphosphate pyrophosphatase, putative / HAM1 family protein; FUNCTIONS IN: hydrolase activity, pyrophosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ham1-like protein (InterPro:IPR002637); Has 4493 Blast hits to 4493 proteins in 1469 species: Archae - 141; Bacteria - 2387; Metazoa - 137; Fungi - 111; Plants - 30; Viruses - 1; Other Eukaryotes - 1686 (source: NCBI BLink).  |
| AT4G13860 | AT4G13860.1 | TTCGGTTTAA | glycine-rich RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: GR-RBP2 (GLYCINE-RICH RNA-BINDING PROTEIN 2); ATP binding / RNA binding / double-stranded DNA binding / single-stranded DNA binding (TAIR:AT4G13850.4); Has 20625 Blast hits to 15554 proteins in 614 species: Archae - 10; Bacteria - 1109; Metazoa - 12326; Fungi - 2038; Plants - 3107; Viruses - 0; Other Eukaryotes - 2035 (source: NCBI BLink).  |
| AT4G14110 | AT4G14110.1 | TCGGTTTAAGTAAACCGT | Represses photomorphogenesis and induces skotomorphogenesis in the dark. A component of the COP9 signalosome complex.  |
| AT4G14190 | AT4G14190.1 | TTAAACCGAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G42630.1); Has 7409 Blast hits to 2639 proteins in 94 species: Archae - 1; Bacteria - 0; Metazoa - 60; Fungi - 16; Plants - 7130; Viruses - 0; Other Eukaryotes - 202 (source: NCBI BLink).  |
| AT4G14190.1 | TTAAACCGAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G42630.1); Has 7409 Blast hits to 2639 proteins in 94 species: Archae - 1; Bacteria - 0; Metazoa - 60; Fungi - 16; Plants - 7130; Viruses - 0; Other Eukaryotes - 202 (source: NCBI BLink).  |
| AT4G14315 | AT4G14315.1 | ATAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G14465 | AT4G14465.1 | ATAAACCGA | DNA-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT3G04570.1); Has 440 Blast hits to 437 proteins in 23 species: Archae - 0; Bacteria - 12; Metazoa - 8; Fungi - 0; Plants - 420; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G14890 | AT4G14890.1 | TTCGGTTTAA | ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD3 (ferredoxin 3); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT2G27510.1); Has 3979 Blast hits to 3977 proteins in 721 species: Archae - 45; Bacteria - 2406; Metazoa - 8; Fungi - 2; Plants - 434; Viruses - 2; Other Eukaryotes - 1082 (source: NCBI BLink).  |
| AT4G14890.1 | TTCGGTTTAAGTCGGTTTTCGGTTT | ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD3 (ferredoxin 3); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT2G27510.1); Has 3979 Blast hits to 3977 proteins in 721 species: Archae - 45; Bacteria - 2406; Metazoa - 8; Fungi - 2; Plants - 434; Viruses - 2; Other Eukaryotes - 1082 (source: NCBI BLink).  |
| AT4G14900 | AT4G14900.1 | TTAAACCGA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT3G22440.1); Has 1960 Blast hits to 1334 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 248; Fungi - 80; Plants - 1600; Viruses - 2; Other Eukaryotes - 22 (source: NCBI BLink).  |
| AT4G14900.1 | TTCGGTTTAC | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT3G22440.1); Has 1960 Blast hits to 1334 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 248; Fungi - 80; Plants - 1600; Viruses - 2; Other Eukaryotes - 22 (source: NCBI BLink).  |
| AT4G15545 | AT4G15545.1 | TTCGGTTTAA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16520.1); Has 557 Blast hits to 539 proteins in 129 species: Archae - 0; Bacteria - 87; Metazoa - 242; Fungi - 51; Plants - 82; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink).  |
| AT4G15830 | AT4G15830.1 | GTAAACCGAACCGA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT3G01450.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 5; Plants - 61; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
| AT4G15840 | AT4G15840.1 | TCGGTTCGGTTTAC | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); Has 305 Blast hits to 303 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 12; Plants - 22; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT4G16650 | AT4G16650.1 | TCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76270.1); Has 436 Blast hits to 428 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 436; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G16830 | AT4G16830.1 | TCGGTTTAA | nuclear RNA-binding protein (RGGA); FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT5G47210.1); Has 21311 Blast hits to 10623 proteins in 811 species: Archae - 12; Bacteria - 6397; Metazoa - 7146; Fungi - 1662; Plants - 3005; Viruses - 285; Other Eukaryotes - 2804 (source: NCBI BLink).  |
| AT4G16830.2 | TCGGTTTAA | nuclear RNA-binding protein (RGGA); FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT5G47210.1); Has 21311 Blast hits to 10623 proteins in 811 species: Archae - 12; Bacteria - 6397; Metazoa - 7146; Fungi - 1662; Plants - 3005; Viruses - 285; Other Eukaryotes - 2804 (source: NCBI BLink).  |
| AT4G16830.3 | TCGGTTTAA | nuclear RNA-binding protein (RGGA); FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT5G47210.1); Has 21311 Blast hits to 10623 proteins in 811 species: Archae - 12; Bacteria - 6397; Metazoa - 7146; Fungi - 1662; Plants - 3005; Viruses - 285; Other Eukaryotes - 2804 (source: NCBI BLink).  |
| AT4G16845 | AT4G16845.1 | TCGGTTTAA | The VERNALIZATION2 (VRN2) gene mediates vernalization and encodes a nuclear-localized zinc finger protein with similarity to Polycomb group (PcG) proteins of plants and animals. In wild-type Arabidopsis, vernalization results in the stable reduction of the levels of the floral repressor FLC. In vrn2 mutants, FLC expression is downregulated normally in response to vernalization, but instead of remaining low, FLC mRNA levels increase when plants are returned to normal temperatures. VRN2 maintains FLC repression after a cold treatment, serving as a mechanism for the cellular memory of vernalization. Required for complete repression of FLC. Required for the methylation of histone H3  |
| AT4G17620 | AT4G17620.1 | TTAAACCGACT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink).  |
| AT4G17620.2 | TTAAACCGACT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink).  |
| AT4G18395 | AT4G18395.1 | TTCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G18580 | AT4G18580.1 | TTAAACCGAACCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G18580.2 | TTAAACCGAACCGGTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G18590 | AT4G18590.1 | CAAACCGGTTCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Replication factor A protein 3 (InterPro:IPR013970), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52630.2); Has 58 Blast hits to 58 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT4G18650 | AT4G18650.1 | TTCGGTTTAA | transcription factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14880.2); Has 341 Blast hits to 340 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 339; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G19390 | AT4G19390.1 | ATAAACCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022348 (InterPro:IPR016804), Uncharacterised protein family UPF0114 (InterPro:IPR005134); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13720.1); Has 553 Blast hits to 553 proteins in 219 species: Archae - 18; Bacteria - 407; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
| AT4G19400 | AT4G19400.1 | GTTCGGTTTAT | actin binding; FUNCTIONS IN: actin binding; INVOLVED IN: cytoskeleton organization; LOCATED IN: actin cytoskeleton; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Profilin/allergen (InterPro:IPR002097); Has 17 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT4G19500 | AT4G19500.1 | CTAAACCGA | ATP binding / nucleoside-triphosphatase/ nucleotide binding / protein binding / transmembrane receptor; FUNCTIONS IN: protein binding, transmembrane receptor activity, nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat 3 (InterPro:IPR011713), Toll-Interleukin receptor (InterPro:IPR000157), Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: SNC1 (SUPPRESSOR OF NPR1-1, CONSTITUTIVE 1); nucleotide binding (TAIR:AT4G16890.1); Has 13999 Blast hits to 8175 proteins in 320 species: Archae - 7; Bacteria - 332; Metazoa - 274; Fungi - 32; Plants - 12934; Viruses - 4; Other Eukaryotes - 416 (source: NCBI BLink).  |
| AT4G20280 | AT4G20280.1 | CTAAACCGA | Encodes TAF11, a putative TBP-associated factor (TBP: TATA binding protein).  |
| AT4G20960 | AT4G20960.1 | GTAAACCGA | encodes diaminohydroxyphosphoribosylaminopyrimidine deaminase catalyzing the second step in the riboflavin biosynthesis  |
| AT4G21020 | AT4G21020.1 | TTAAACCGA | late embryogenesis abundant domain-containing protein / LEA domain-containing protein; INVOLVED IN: embryonic development ending in seed dormancy; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT5G44310.2); Has 20047 Blast hits to 9539 proteins in 1087 species: Archae - 69; Bacteria - 4524; Metazoa - 4955; Fungi - 1474; Plants - 1716; Viruses - 139; Other Eukaryotes - 7170 (source: NCBI BLink).  |
| AT4G21090 | AT4G21090.1 | TCGGTTTAA | adrenodoxin-like ferredoxin 1; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Adrenodoxin (InterPro:IPR001055), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Adrenodoxin, iron-sulphur binding site (InterPro:IPR018298); BEST Arabidopsis thaliana protein match is: adrenodoxin-like ferredoxin 2 (TAIR:AT4G05450.1); Has 3478 Blast hits to 3478 proteins in 761 species: Archae - 0; Bacteria - 1382; Metazoa - 220; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 1742 (source: NCBI BLink).  |
| AT4G21090.2 | TCGGTTTAA | adrenodoxin-like ferredoxin 1; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Adrenodoxin (InterPro:IPR001055), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Adrenodoxin, iron-sulphur binding site (InterPro:IPR018298); BEST Arabidopsis thaliana protein match is: adrenodoxin-like ferredoxin 2 (TAIR:AT4G05450.1); Has 3478 Blast hits to 3478 proteins in 761 species: Archae - 0; Bacteria - 1382; Metazoa - 220; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 1742 (source: NCBI BLink).  |
| AT4G21090.3 | TCGGTTTAA | adrenodoxin-like ferredoxin 1; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Adrenodoxin (InterPro:IPR001055), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Adrenodoxin, iron-sulphur binding site (InterPro:IPR018298); BEST Arabidopsis thaliana protein match is: adrenodoxin-like ferredoxin 2 (TAIR:AT4G05450.1); Has 3478 Blast hits to 3478 proteins in 761 species: Archae - 0; Bacteria - 1382; Metazoa - 220; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 1742 (source: NCBI BLink).  |
| AT4G21650 | AT4G21650.1 | TTAAACCGAACCA | subtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: subtilase family protein (TAIR:AT4G21630.1); Has 4532 Blast hits to 3933 proteins in 710 species: Archae - 129; Bacteria - 2684; Metazoa - 30; Fungi - 172; Plants - 917; Viruses - 0; Other Eukaryotes - 600 (source: NCBI BLink).  |
| AT4G21800 | AT4G21800.1 | GTAAACCGA | Encodes QQT2. Required for early embryo development. qqt1 mutant lines are embryo-defective. Participates in the organization of microtubules during cell division. Interacts with QQT1 (encoded by AT5G22370).  |
| AT4G21800.2 | GTAAACCGA | Encodes QQT2. Required for early embryo development. qqt1 mutant lines are embryo-defective. Participates in the organization of microtubules during cell division. Interacts with QQT1 (encoded by AT5G22370).  |
| AT4G22380 | AT4G22380.1 | ATAAACCGAACTAAACCGAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT5G20160.1); Has 1361 Blast hits to 1361 proteins in 295 species: Archae - 226; Bacteria - 7; Metazoa - 464; Fungi - 191; Plants - 162; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink).  |
| AT4G22530 | AT4G22530.1 | TTAAACCGAA | embryo-abundant protein-related; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: embryo-abundant protein-related (TAIR:AT5G10830.1); Has 712 Blast hits to 708 proteins in 256 species: Archae - 2; Bacteria - 390; Metazoa - 65; Fungi - 87; Plants - 109; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).  |
| AT4G22756 | AT4G22756.1 | CTAAACCGA | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha- methyl oxidase.  |
| AT4G22830 | AT4G22830.1 | ATAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 258 Blast hits to 256 proteins in 77 species: Archae - 0; Bacteria - 125; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 103 (source: NCBI BLink).  |
| AT4G23800 | AT4G23800.1 | TCGGTTTAG | high mobility group (HMG1/2) family protein; FUNCTIONS IN: transcription factor activity; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group, superfamily (InterPro:IPR009071), High mobility group, HMG1/HMG2 (InterPro:IPR000910); BEST Arabidopsis thaliana protein match is: high mobility group (HMG1/2) family protein (TAIR:AT4G11080.1); Has 62445 Blast hits to 32833 proteins in 1549 species: Archae - 256; Bacteria - 4440; Metazoa - 33253; Fungi - 3596; Plants - 1795; Viruses - 218; Other Eukaryotes - 18887 (source: NCBI BLink).  |
| AT4G25150 | AT4G25150.1 | ATAAACCGAA | acid phosphatase, putative; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase (Class B) (InterPro:IPR005519), Vegetative storage protein/acid phosphatase (InterPro:IPR014403), Acid phosphatase, plant (InterPro:IPR010028); BEST Arabidopsis thaliana protein match is: acid phosphatase, putative (TAIR:AT5G51260.1); Has 559 Blast hits to 559 proteins in 162 species: Archae - 0; Bacteria - 269; Metazoa - 2; Fungi - 0; Plants - 241; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
| AT4G25210 | AT4G25210.1 | TCGGTTTAC | transcription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF573 (InterPro:IPR007592); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00130.1); Has 5777 Blast hits to 3070 proteins in 342 species: Archae - 2; Bacteria - 508; Metazoa - 1816; Fungi - 705; Plants - 351; Viruses - 71; Other Eukaryotes - 2324 (source: NCBI BLink).  |
| AT4G25390 | AT4G25390.1 | TTCGGTTTAA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G51770.1); Has 62019 Blast hits to 52421 proteins in 1538 species: Archae - 19; Bacteria - 4146; Metazoa - 22140; Fungi - 3414; Plants - 25096; Viruses - 163; Other Eukaryotes - 7041 (source: NCBI BLink).  |
| AT4G25390.2 | TTCGGTTTAA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G51770.1); Has 62019 Blast hits to 52421 proteins in 1538 species: Archae - 19; Bacteria - 4146; Metazoa - 22140; Fungi - 3414; Plants - 25096; Viruses - 163; Other Eukaryotes - 7041 (source: NCBI BLink).  |
| AT4G25850 | AT4G25850.1 | CTAAACCGACT | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4B (ORP4B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: ORP4A (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4A); oxysterol binding (TAIR:AT4G25860.1); Has 1645 Blast hits to 1644 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 908; Fungi - 430; Plants - 143; Viruses - 0; Other Eukaryotes - 164 (source: NCBI BLink).  |
| AT4G25880 | AT4G25880.1 | GTAAACCGA | Arabidopsis Pumilio 6 (APUM6); FUNCTIONS IN: RNA binding, binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM5 (Arabidopsis Pumilio 5); RNA binding / binding (TAIR:AT3G20250.1); Has 2980 Blast hits to 1446 proteins in 176 species: Archae - 0; Bacteria - 6; Metazoa - 940; Fungi - 833; Plants - 497; Viruses - 0; Other Eukaryotes - 704 (source: NCBI BLink).  |
| AT4G25880.2 | GTAAACCGA | Arabidopsis Pumilio 6 (APUM6); FUNCTIONS IN: RNA binding, binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM5 (Arabidopsis Pumilio 5); RNA binding / binding (TAIR:AT3G20250.1); Has 2980 Blast hits to 1446 proteins in 176 species: Archae - 0; Bacteria - 6; Metazoa - 940; Fungi - 833; Plants - 497; Viruses - 0; Other Eukaryotes - 704 (source: NCBI BLink).  |
| AT4G25880.3 | GTAAACCGA | Arabidopsis Pumilio 6 (APUM6); FUNCTIONS IN: RNA binding, binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM5 (Arabidopsis Pumilio 5); RNA binding / binding (TAIR:AT3G20250.1); Has 2980 Blast hits to 1446 proteins in 176 species: Archae - 0; Bacteria - 6; Metazoa - 940; Fungi - 833; Plants - 497; Viruses - 0; Other Eukaryotes - 704 (source: NCBI BLink).  |
| AT4G27130 | AT4G27130.1 | CTAAACCGAACCA | eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT5G54760.2); Has 620 Blast hits to 617 proteins in 201 species: Archae - 6; Bacteria - 1; Metazoa - 295; Fungi - 109; Plants - 120; Viruses - 3; Other Eukaryotes - 86 (source: NCBI BLink).  |
| AT4G28060 | AT4G28060.1 | CTAAACCGA | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT5G57815.1); Has 406 Blast hits to 406 proteins in 117 species: Archae - 0; Bacteria - 0; Metazoa - 235; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
| AT4G28060.1 | TCGGTTTAA | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT5G57815.1); Has 406 Blast hits to 406 proteins in 117 species: Archae - 0; Bacteria - 0; Metazoa - 235; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
| AT4G29510 | AT4G29510.1 | TTAAACCGA | Has arginine N-methyltransferase activity. Modifies AtMBD7.  |
| AT4G29730 | AT4G29730.1 | CTAAACCGA | cell cycle-related repressor genes encoding WD-repeat proteins.  |
| AT4G29840 | AT4G29840.1 | TTAAACCGACT | threonine synthase  |
| AT4G30010 | AT4G30010.1 | ATAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G31460 | AT4G31460.1 | CTAAACCGA | ribosomal protein L28 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28 (InterPro:IPR001383); Has 797 Blast hits to 797 proteins in 221 species: Archae - 0; Bacteria - 262; Metazoa - 81; Fungi - 82; Plants - 19; Viruses - 0; Other Eukaryotes - 353 (source: NCBI BLink).  |
| AT4G31530 | AT4G31530.1 | GTTCGGTTTAG | binding / catalytic; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Male sterility, NAD-binding (InterPro:IPR013120); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 2281 Blast hits to 2232 proteins in 521 species: Archae - 12; Bacteria - 1390; Metazoa - 76; Fungi - 31; Plants - 258; Viruses - 0; Other Eukaryotes - 514 (source: NCBI BLink).  |
| AT4G31530.1 | TCGGTTTAG | binding / catalytic; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Male sterility, NAD-binding (InterPro:IPR013120); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 2281 Blast hits to 2232 proteins in 521 species: Archae - 12; Bacteria - 1390; Metazoa - 76; Fungi - 31; Plants - 258; Viruses - 0; Other Eukaryotes - 514 (source: NCBI BLink).  |
| AT4G31780 | AT4G31780.1 | TTCGGTTTAG | Encodes an A-type monogalactosyldiacylglycerol (MGDG) synthase. It represents the isoform responsible for the bulk of MGDG synthesis in Arabidopsis.  |
| AT4G31780.2 | TTCGGTTTAG | Encodes an A-type monogalactosyldiacylglycerol (MGDG) synthase. It represents the isoform responsible for the bulk of MGDG synthesis in Arabidopsis.  |
| AT4G32120 | AT4G32120.1 | TTAAACCGA | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT2G25300.1); Has 371 Blast hits to 370 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 0; Plants - 220; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT4G32175 | AT4G32175.1 | ACGGTTTAAGTAAACCGAA | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: exonuclease-related (TAIR:AT2G25355.1); Has 380 Blast hits to 380 proteins in 172 species: Archae - 65; Bacteria - 0; Metazoa - 101; Fungi - 101; Plants - 32; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink).  |
| AT4G33470 | AT4G33470.1 | GTAAACCGAA | Encodes HDA14, a member of the histone deacetylase family proteins.  |
| AT4G33760 | AT4G33760.1 | ATAAACCGAA | tRNA synthetase class II (D, K and N) family protein; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: aspartyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast, membrane, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aspartyl-tRNA synthetase, class IIb, bacterial/mitochondrial type (InterPro:IPR004524), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Aspartyl-tRNA synthetase, class IIb, bacterial/mitochondrial type, C-terminal (InterPro:IPR018153), GAD (InterPro:IPR004115); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 20510 Blast hits to 15912 proteins in 1700 species: Archae - 534; Bacteria - 11175; Metazoa - 763; Fungi - 675; Plants - 169; Viruses - 0; Other Eukaryotes - 7194 (source: NCBI BLink).  |
| AT4G33925 | AT4G33925.1 | CTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; Has 70 Blast hits to 70 proteins in 36 species: Archae - 8; Bacteria - 0; Metazoa - 38; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT4G33925.2 | CTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; Has 70 Blast hits to 70 proteins in 36 species: Archae - 8; Bacteria - 0; Metazoa - 38; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT4G34180 | AT4G34180.1 | TTAAACCGA | cyclase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative cyclase (InterPro:IPR007325); BEST Arabidopsis thaliana protein match is: cyclase family protein (TAIR:AT1G44542.1); Has 819 Blast hits to 819 proteins in 310 species: Archae - 59; Bacteria - 600; Metazoa - 35; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  |
| AT4G34265 | AT4G34265.1 | ATAAACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G15000.3); Has 58 Blast hits to 58 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G34265.2 | ATAAACCGAACCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G15000.3); Has 58 Blast hits to 58 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G34730 | AT4G34730.1 | TTCGGTTTAA | ribosome-binding factor A family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K homology-like, alpha/beta (InterPro:IPR015946), Ribosome-binding factor A (InterPro:IPR000238); Has 2908 Blast hits to 2907 proteins in 1057 species: Archae - 0; Bacteria - 2230; Metazoa - 5; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 649 (source: NCBI BLink).  |
| AT4G35785 | AT4G35785.1 | TTAAACCGAACCA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink).  |
| AT4G35785.2 | TTAAACCGAACCA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink).  |
| AT4G35785.3 | TTAAACCGAACCA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink).  |
| AT4G36500 | AT4G36500.1 | ATAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18210.1); Has 24 Blast hits to 24 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G39350 | AT4G39350.1 | TTCGGTTTAT | Encodes a cellulose synthase isomer, related to CESA6.  |
| AT5G01420 | AT5G01420.1 | TGGTTCGGTTTAT | glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT5G03870.1); Has 300 Blast hits to 300 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 0; Plants - 195; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
| AT5G01510 | AT5G01510.1 | ATAAACCGAATTTAACCGGGTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: RUS1 (ROOT UVB SENSITIVE 1) (TAIR:AT3G45890.1); Has 266 Blast hits to 266 proteins in 86 species: Archae - 0; Bacteria - 2; Metazoa - 95; Fungi - 39; Plants - 94; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).  |
| AT5G02040 | AT5G02040.1 | TCGGTTTAG | PRENYLATED RAB ACCEPTOR 1.A1 (PRA1.A1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A2 (PRENYLATED RAB ACCEPTOR 1.A2) (TAIR:AT5G05987.1); Has 165 Blast hits to 165 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 8; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G02040.2 | TCGGTTTAG | PRENYLATED RAB ACCEPTOR 1.A1 (PRA1.A1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A2 (PRENYLATED RAB ACCEPTOR 1.A2) (TAIR:AT5G05987.1); Has 165 Blast hits to 165 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 8; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G02830 | AT5G02830.1 | TCGGTTTAT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G18940.1); Has 14432 Blast hits to 5047 proteins in 162 species: Archae - 3; Bacteria - 24; Metazoa - 323; Fungi - 205; Plants - 13092; Viruses - 0; Other Eukaryotes - 785 (source: NCBI BLink).  |
| AT5G02840 | AT5G02840.1 | ATAAACCGA | CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis.  |
| AT5G02840.2 | ATAAACCGA | CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis.  |
| AT5G02840.3 | ATAAACCGA | CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis.  |
| AT5G02870 | AT5G02870.1 | CTAAACCGAA | 60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).  |
| AT5G02870.2 | CTAAACCGAA | 60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).  |
| AT5G03220 | AT5G03220.1 | TTAAACCGAA | transcriptional co-activator-related; FUNCTIONS IN: transcription coactivator activity; INVOLVED IN: positive regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: MED7 (InterPro:IPR009244); BEST Arabidopsis thaliana protein match is: transcription coactivator (TAIR:AT5G03500.2); Has 302 Blast hits to 300 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 111; Plants - 29; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
| AT5G03630 | AT5G03630.1 | GTAAACCGA | ATMDAR2; FUNCTIONS IN: monodehydroascorbate reductase (NADH) activity; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), FAD/NAD-linked reductase, dimerisation (InterPro:IPR016156); BEST Arabidopsis thaliana protein match is: MDHAR (MONODEHYDROASCORBATE REDUCTASE); monodehydroascorbate reductase (NADH) (TAIR:AT3G09940.1); Has 15548 Blast hits to 15528 proteins in 1711 species: Archae - 317; Bacteria - 10742; Metazoa - 673; Fungi - 378; Plants - 332; Viruses - 0; Other Eukaryotes - 3106 (source: NCBI BLink).  |
| AT5G04080 | AT5G04080.1 | ATAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; Has 77 Blast hits to 77 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 73; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G04170 | AT5G04170.1 | TTAAACCGAAC | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT3G10300.3); Has 32062 Blast hits to 17618 proteins in 833 species: Archae - 4; Bacteria - 3047; Metazoa - 14595; Fungi - 4725; Plants - 3524; Viruses - 254; Other Eukaryotes - 5913 (source: NCBI BLink).  |
| AT5G05000 | AT5G05000.1 | TTCGGTTTAGTCCGGTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast.  |
| AT5G05000.2 | TTCGGTTTAGTCCGGTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast.  |
| AT5G05000.3 | TTCGGTTTAGTCCGGTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast.  |
| AT5G05010 | AT5G05010.1 | AACCGGACTAAACCGAA | clathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  |
| AT5G05010.2 | AACCGGACTAAACCGAA | clathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  |
| AT5G05200 | AT5G05200.1 | CGGTTCGGTTTAATGGG | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink).  |
| AT5G05210 | AT5G05210.1 | CCCATTAAACCGAACCG | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).  |
| AT5G05210.2 | CCCATTAAACCGAACCG | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).  |
| AT5G05590 | AT5G05590.1 | TTCGGTTTGGTTCGGTTTAA | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway.  |
| AT5G05590.2 | TTCGGTTTGGTTCGGTTTAA | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway.  |
| AT5G05860 | AT5G05860.1 | ATAAACCGA | UGT76C2; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT5G05880.1); Has 4858 Blast hits to 4839 proteins in 332 species: Archae - 0; Bacteria - 208; Metazoa - 1867; Fungi - 21; Plants - 2678; Viruses - 62; Other Eukaryotes - 22 (source: NCBI BLink).  |
| AT5G06240 | AT5G06240.1 | ATAAACCGA | embryo defective 2735 (emb2735); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 21 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G06260 | AT5G06260.1 | TTAAACCGAA | nucleolar protein-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571), EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: calcium ion binding (TAIR:AT4G34070.1); Has 925 Blast hits to 924 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 578; Fungi - 44; Plants - 76; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink).  |
| AT5G06320 | AT5G06320.1 | TTAAACCGA | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane.  |
| AT5G06430 | AT5G06430.1 | ATAAACCGAA | thioredoxin-related; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: HCF164; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT4G37200.1); Has 165 Blast hits to 164 proteins in 55 species: Archae - 0; Bacteria - 86; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
| AT5G08060 | AT5G08060.1 | TCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT5G08080 | AT5G08080.1 | ATAAACCGA | member of SYP13 Gene Family  |
| AT5G08080.1 | TTCGGTTTAC | member of SYP13 Gene Family  |
| AT5G08080.2 | ATAAACCGA | member of SYP13 Gene Family  |
| AT5G08080.2 | TTCGGTTTAC | member of SYP13 Gene Family  |
| AT5G08650 | AT5G08650.1 | TTCGGTTTAA | GTP-binding protein LepA, putative; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding protein LepA (InterPro:IPR006297), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), GTP-binding protein LepA, C-terminal (InterPro:IPR013842), Elongation factor G, III and V (InterPro:IPR009022), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: GTP binding / GTPase/ translation elongation factor (TAIR:AT5G39900.1); Has 58694 Blast hits to 51359 proteins in 6862 species: Archae - 845; Bacteria - 29013; Metazoa - 5946; Fungi - 3236; Plants - 868; Viruses - 0; Other Eukaryotes - 18786 (source: NCBI BLink).  |
| AT5G08770 | AT5G08770.1 | ATAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 654 Blast hits to 169 proteins in 45 species: Archae - 0; Bacteria - 57; Metazoa - 295; Fungi - 70; Plants - 1; Viruses - 0; Other Eukaryotes - 231 (source: NCBI BLink).  |
| AT5G08770.1 | TTAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 654 Blast hits to 169 proteins in 45 species: Archae - 0; Bacteria - 57; Metazoa - 295; Fungi - 70; Plants - 1; Viruses - 0; Other Eukaryotes - 231 (source: NCBI BLink).  |
| AT5G08780 | AT5G08780.1 | TCGGTTTAA | histone H1/H5 family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Histone H1/H5 (InterPro:IPR005818); BEST Arabidopsis thaliana protein match is: HON4; DNA binding (TAIR:AT3G18035.1); Has 220 Blast hits to 212 proteins in 61 species: Archae - 3; Bacteria - 16; Metazoa - 30; Fungi - 7; Plants - 125; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
| AT5G08780.1 | TCGGTTTAT | histone H1/H5 family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Histone H1/H5 (InterPro:IPR005818); BEST Arabidopsis thaliana protein match is: HON4; DNA binding (TAIR:AT3G18035.1); Has 220 Blast hits to 212 proteins in 61 species: Archae - 3; Bacteria - 16; Metazoa - 30; Fungi - 7; Plants - 125; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
| AT5G09920 | AT5G09920.1 | TTCGGTTTAT | Non-catalytic subunit specific to DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB4)  |
| AT5G09970 | AT5G09970.1 | TCGGTTTAA | member of CYP78A  |
| AT5G10270 | AT5G10270.1 | TTAAACCGAA | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development.  |
| AT5G11270 | AT5G11270.1 | GTAAACCGA | Encodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance.  |
| AT5G11450 | AT5G11450.1 | TTCGGTTTAATAAACCGA | oxygen-evolving complex-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 81 Blast hits to 81 proteins in 22 species: Archae - 0; Bacteria - 22; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G11680 | AT5G11680.1 | CTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 136 Blast hits to 136 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 26; Plants - 24; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
| AT5G11680.1 | CTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 136 Blast hits to 136 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 26; Plants - 24; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
| AT5G11790 | AT5G11790.1 | TTAAACCGA | Ndr family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell differentiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pollen specific protein SF21 (InterPro:IPR015511), Ndr (InterPro:IPR004142); BEST Arabidopsis thaliana protein match is: Ndr family protein (TAIR:AT5G56750.1); Has 689 Blast hits to 689 proteins in 89 species: Archae - 0; Bacteria - 44; Metazoa - 480; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).  |
| AT5G13030 | AT5G13030.1 | ATAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0061 (InterPro:IPR003846); Has 4055 Blast hits to 4018 proteins in 759 species: Archae - 4; Bacteria - 1451; Metazoa - 102; Fungi - 81; Plants - 27; Viruses - 0; Other Eukaryotes - 2390 (source: NCBI BLink).  |
| AT5G13810 | AT5G13810.1 | ATAAACCGA | glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT3G57070.1); Has 425 Blast hits to 425 proteins in 66 species: Archae - 0; Bacteria - 21; Metazoa - 92; Fungi - 4; Plants - 202; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink).  |
| AT5G13810.1 | CTAAACCGA | glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT3G57070.1); Has 425 Blast hits to 425 proteins in 66 species: Archae - 0; Bacteria - 21; Metazoa - 92; Fungi - 4; Plants - 202; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink).  |
| AT5G14240 | AT5G14240.1 | TCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Phosducin (InterPro:IPR001200), Thioredoxin-like fold (InterPro:IPR012336); Has 750 Blast hits to 750 proteins in 282 species: Archae - 0; Bacteria - 2; Metazoa - 486; Fungi - 126; Plants - 51; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).  |
| AT5G14250 | AT5G14250.1 | CTAAACCGA | Encodes subunit 3 of the COP9 signalosome.  |
| AT5G14250.2 | CTAAACCGA | Encodes subunit 3 of the COP9 signalosome.  |
| AT5G14680 | AT5G14680.1 | CTAAACCGA | universal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G01520.1); Has 1288 Blast hits to 1284 proteins in 330 species: Archae - 88; Bacteria - 759; Metazoa - 35; Fungi - 21; Plants - 361; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).  |
| AT5G15120 | AT5G15120.1 | GTAAACCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1637 (InterPro:IPR012864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39890.1); Has 239 Blast hits to 239 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
| AT5G15390 | AT5G15390.1 | CTAAACCGAA | tRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); BEST Arabidopsis thaliana protein match is: tRNA/rRNA methyltransferase (SpoU) family protein (TAIR:AT2G19870.1); Has 6929 Blast hits to 6927 proteins in 1354 species: Archae - 6; Bacteria - 4609; Metazoa - 116; Fungi - 48; Plants - 75; Viruses - 0; Other Eukaryotes - 2075 (source: NCBI BLink).  |
| AT5G15390.1 | TTAAACCGAA | tRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); BEST Arabidopsis thaliana protein match is: tRNA/rRNA methyltransferase (SpoU) family protein (TAIR:AT2G19870.1); Has 6929 Blast hits to 6927 proteins in 1354 species: Archae - 6; Bacteria - 4609; Metazoa - 116; Fungi - 48; Plants - 75; Viruses - 0; Other Eukaryotes - 2075 (source: NCBI BLink).  |
| AT5G15410 | AT5G15410.1 | ATAAACCGAA | 'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens.  |
| AT5G15410.2 | ATAAACCGAA | 'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens.  |
| AT5G15930 | AT5G15930.1 | TTAAACCGA | Encodes a putative plant adhesion molecule.  |
| AT5G16310 | AT5G16310.1 | TCGGTTTAG | UCH1; FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: shoot development, shoot morphogenesis, leaf development, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus, intracellular, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578), Ubiquitinyl hydrolase, UCH37 type (InterPro:IPR017390); BEST Arabidopsis thaliana protein match is: UCH2; ubiquitin thiolesterase/ ubiquitin-specific protease (TAIR:AT1G65650.1); Has 931 Blast hits to 925 proteins in 172 species: Archae - 0; Bacteria - 2; Metazoa - 511; Fungi - 225; Plants - 76; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
| AT5G16320 | AT5G16320.1 | CTAAACCGA | family member of FRI-related genes that is required for the winter-annual habit. Genbank accession BK004884  |
| AT5G16820 | AT5G16820.1 | TTAAACCGAA | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes.  |
| AT5G16820.2 | TTAAACCGAA | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes.  |
| AT5G17060 | AT5G17060.1 | TTAAACCGA | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster), other ARFs and ARF-like proteins.  |
| AT5G17310 | AT5G17310.2 | CTAAACCGAAC | UTP--glucose-1-phosphate uridylyltransferase, putative / UDP-glucose pyrophosphorylase, putative / UGPase, putative; FUNCTIONS IN: UTP:glucose-1-phosphate uridylyltransferase activity, nucleotidyltransferase activity; INVOLVED IN: response to cadmium ion, response to salt stress, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: UTP--glucose-1-phosphate uridylyltransferase, subgroup (InterPro:IPR016267), UTP--glucose-1-phosphate uridylyltransferase (InterPro:IPR002618); BEST Arabidopsis thaliana protein match is: UGP (UDP-glucose pyrophosphorylase); UTP:glucose-1-phosphate uridylyltransferase/ nucleotidyltransferase (TAIR:AT3G03250.1); Has 871 Blast hits to 866 proteins in 241 species: Archae - 0; Bacteria - 171; Metazoa - 281; Fungi - 198; Plants - 121; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
| AT5G17310.2 | TCGGTTTAG | UTP--glucose-1-phosphate uridylyltransferase, putative / UDP-glucose pyrophosphorylase, putative / UGPase, putative; FUNCTIONS IN: UTP:glucose-1-phosphate uridylyltransferase activity, nucleotidyltransferase activity; INVOLVED IN: response to cadmium ion, response to salt stress, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: UTP--glucose-1-phosphate uridylyltransferase, subgroup (InterPro:IPR016267), UTP--glucose-1-phosphate uridylyltransferase (InterPro:IPR002618); BEST Arabidopsis thaliana protein match is: UGP (UDP-glucose pyrophosphorylase); UTP:glucose-1-phosphate uridylyltransferase/ nucleotidyltransferase (TAIR:AT3G03250.1); Has 871 Blast hits to 866 proteins in 241 species: Archae - 0; Bacteria - 171; Metazoa - 281; Fungi - 198; Plants - 121; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
| AT5G17650 | AT5G17650.1 | CTAAACCGAACCG | glycine/proline-rich protein; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; Has 8612 Blast hits to 5536 proteins in 501 species: Archae - 4; Bacteria - 1051; Metazoa - 4454; Fungi - 1160; Plants - 1109; Viruses - 38; Other Eukaryotes - 796 (source: NCBI BLink).  |
| AT5G17840 | AT5G17840.1 | TTATGGGCTCGGTTTAG | chaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 67 Blast hits to 67 proteins in 19 species: Archae - 0; Bacteria - 13; Metazoa - 3; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT5G17900 | AT5G17900.1 | CCGAACCGAACCGACCCGTAAACCGAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink).  |
| AT5G17900.1 | TCGGTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink).  |
| AT5G18760 | AT5G18760.1 | GTTCGGTTTAG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G06330.1); Has 907 Blast hits to 907 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 439; Fungi - 68; Plants - 331; Viruses - 4; Other Eukaryotes - 65 (source: NCBI BLink).  |
| AT5G18770 | AT5G18770.1 | CTAAACCGAAC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G18780.1); Has 1198 Blast hits to 1165 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1198; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G19240 | AT5G19240.1 | CTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19230.1); Has 42 Blast hits to 41 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G19540 | AT5G19540.1 | TGGTTCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 48 Blast hits to 47 proteins in 16 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
| AT5G19660 | AT5G19660.1 | ATAAACCGAA | S1P appears to function as a Golgi-localized subtilase and to help protect seedlings against salt and osmotic stress. The roots of s1p-3 mutants are hypersensitive to NaCl, KCl, LiCl, and mannitol. Several salt-stress responsive genes show weaker induction in an s1P-3 mutant background. The proteolytic cleavage of the bZIP17 transcription factor depends on S1P in vitro. And there is evidence that S1P can cleave bZIP17 in vitro.  |
| AT5G19670 | AT5G19670.1 | TTCGGTTTAT | exostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT5G25820.1); Has 802 Blast hits to 800 proteins in 88 species: Archae - 0; Bacteria - 10; Metazoa - 236; Fungi - 4; Plants - 470; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink).  |
| AT5G19690 | AT5G19690.1 | CTAAACCGA | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions  |
| AT5G19900 | AT5G19900.1 | TCGGTTTAAACGTGTCG | PRLI-interacting factor, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 1528 Blast hits to 1237 proteins in 215 species: Archae - 5; Bacteria - 69; Metazoa - 541; Fungi - 137; Plants - 125; Viruses - 37; Other Eukaryotes - 614 (source: NCBI BLink).  |
| AT5G20000 | AT5G20000.1 | TCGGTTTAT | 26S proteasome AAA-ATPase subunit, putative; FUNCTIONS IN: hydrolase activity, nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, base subcomplex, nucleus; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), 26S proteasome subunit P45 (InterPro:IPR005937); BEST Arabidopsis thaliana protein match is: RPT6A (REGULATORY PARTICLE TRIPLE-A ATPASE 6A); ATPase (TAIR:AT5G19990.1); Has 26652 Blast hits to 24996 proteins in 1846 species: Archae - 858; Bacteria - 9083; Metazoa - 4251; Fungi - 2494; Plants - 1695; Viruses - 31; Other Eukaryotes - 8240 (source: NCBI BLink).  |
| AT5G20040 | AT5G20040.1 | GTTCGGTTTAT | Encodes tRNA isopentenyltransferase AtIPT9.  |
| AT5G20040.2 | GTTCGGTTTAT | Encodes tRNA isopentenyltransferase AtIPT9.  |
| AT5G20060 | AT5G20060.1 | GTAAACCGAA | phospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink).  |
| AT5G20060.1 | TTAAACCGAA | phospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink).  |
| AT5G20060.2 | GTAAACCGAA | phospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink).  |
| AT5G20060.2 | TTAAACCGAA | phospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink).  |
| AT5G20060.3 | GTAAACCGAA | phospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink).  |
| AT5G20060.3 | TTAAACCGAA | phospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink).  |
| AT5G20570 | AT5G20570.1 | TTAAACCGAA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein.  |
| AT5G20570.2 | TTAAACCGAA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein.  |
| AT5G20570.3 | TTAAACCGAA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein.  |
| AT5G22040 | AT5G22040.1 | TCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G62330.1); Has 34 Blast hits to 34 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT5G22040.2 | TCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G62330.1); Has 34 Blast hits to 34 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT5G22360 | AT5G22360.1 | GTAAACCGTAAACCGA | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family.  |
| AT5G23660 | AT5G23660.1 | GGCCTAAACCGAA | homolog of the Medicago nodulin MTN3  |
| AT5G24313 | AT5G24313.1 | TCCGGTTCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G24314 | AT5G24314.1 | TTAAACCGAACCGG | PTAC7; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastid chromosome, nucleoid; Has 35 Blast hits to 35 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G24360 | AT5G24360.1 | TTAAACCGA | INOSITOL REQUIRING 1-1 (IRE1-1); FUNCTIONS IN: endoribonuclease activity, producing 5'-phosphomonoesters, protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, mRNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyrrolo-quinoline quinone beta-propeller repeat (InterPro:IPR018391), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Ribonuclease L (InterPro:IPR010513), PUG (InterPro:IPR006567), Quinonprotein alcohol dehydrogenase-like (InterPro:IPR011047); BEST Arabidopsis thaliana protein match is: IRE1A; endoribonuclease/ kinase (TAIR:AT2G17520.1); Has 75799 Blast hits to 75146 proteins in 2975 species: Archae - 53; Bacteria - 6775; Metazoa - 33392; Fungi - 6711; Plants - 14901; Viruses - 376; Other Eukaryotes - 13591 (source: NCBI BLink).  |
| AT5G25265 | AT5G25265.1 | AACCGAACTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: cultured cell, leaf; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25260.1); Has 112 Blast hits to 97 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 99; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
| AT5G25600 | AT5G25600.1 | TGGTTCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: nucleic acid binding / zinc ion binding (TAIR:AT5G36228.1); Has 119 Blast hits to 119 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G26060 | AT5G26060.1 | CTAAACCGAA | S1 self-incompatibility protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11820.1); Has 20 Blast hits to 19 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G26610 | AT5G26610.1 | TGGTTCGGTTTAG | D111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink).  |
| AT5G26610.2 | TGGTTCGGTTTAG | D111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink).  |
| AT5G27440 | AT5G27440.1 | TCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: shoot, shoot apex, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; Has 3 Blast hits to 3 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G27450 | AT5G27450.1 | CTAAACCGA | Encodes a protein with mevalonate kinase activity involved in the mevalonate pathway.  |
| AT5G27450.2 | CTAAACCGA | Encodes a protein with mevalonate kinase activity involved in the mevalonate pathway.  |
| AT5G28220 | AT5G28220.1 | ATAAACCGAACCGGC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT3G04830.1); Has 387 Blast hits to 385 proteins in 147 species: Archae - 20; Bacteria - 17; Metazoa - 192; Fungi - 72; Plants - 23; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  |
| AT5G28350 | AT5G28350.1 | GTAAACCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1339 (InterPro:IPR009771), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61480.1); Has 271 Blast hits to 226 proteins in 106 species: Archae - 0; Bacteria - 9; Metazoa - 133; Fungi - 64; Plants - 30; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
| AT5G28350.2 | GTAAACCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1339 (InterPro:IPR009771), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61480.1); Has 271 Blast hits to 226 proteins in 106 species: Archae - 0; Bacteria - 9; Metazoa - 133; Fungi - 64; Plants - 30; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
| AT5G30510 | AT5G30510.1 | TCGGTTTAC | RIBOSOMAL PROTEIN S1 (RPS1); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S1 (InterPro:IPR000110), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT1G71720.1); Has 17303 Blast hits to 11893 proteins in 1518 species: Archae - 42; Bacteria - 10843; Metazoa - 147; Fungi - 116; Plants - 199; Viruses - 0; Other Eukaryotes - 5956 (source: NCBI BLink).  |
| AT5G39600 | AT5G39600.1 | TCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G40150 | AT5G40150.1 | TCGGTTTAAACCGT | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT3G28200.1); Has 3213 Blast hits to 3199 proteins in 258 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 351; Plants - 2806; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
| AT5G40155 | AT5G40155.1 | ACGGTTTAAACCGA | Encodes a defensin-like (DEFL) family protein.  |
| AT5G40240 | AT5G40240.1 | TTCGGTTTAG | nodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin-related (TAIR:AT5G40230.1); Has 1618 Blast hits to 1607 proteins in 311 species: Archae - 15; Bacteria - 735; Metazoa - 4; Fungi - 9; Plants - 626; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink).  |
| AT5G40370 | AT5G40370.1 | TCGGTTTAC | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink).  |
| AT5G40370.2 | TCGGTTTAC | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink).  |
| AT5G42130 | AT5G42130.1 | ATAAACCGAA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SAMC1 (S-ADENOSYLMETHIONINE CARRIER 1); S-adenosylmethionine transmembrane transporter/ binding (TAIR:AT4G39460.1); Has 17455 Blast hits to 9853 proteins in 357 species: Archae - 0; Bacteria - 0; Metazoa - 8573; Fungi - 4742; Plants - 2529; Viruses - 0; Other Eukaryotes - 1611 (source: NCBI BLink).  |
| AT5G43260 | AT5G43260.1 | ATAAACCGAACCG | chaperone protein dnaJ-related; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 66 Blast hits to 65 proteins in 21 species: Archae - 0; Bacteria - 15; Metazoa - 2; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
| AT5G43280 | AT5G43280.1 | CTAAACCGAA | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination.  |
| AT5G43280.2 | CTAAACCGAA | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination.  |
| AT5G43430 | AT5G43430.1 | CTAAACCGGATTAAACCGAA | Encodes the electron transfer flavoprotein ETF beta, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation.  |
| AT5G43430.2 | CTAAACCGGATTAAACCGAA | Encodes the electron transfer flavoprotein ETF beta, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation.  |
| AT5G43430.3 | CTAAACCGGATTAAACCGAA | Encodes the electron transfer flavoprotein ETF beta, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation.  |
| AT5G44320 | AT5G44320.1 | TTAAACCGA | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT4G20980.3); Has 341 Blast hits to 337 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 40; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
| AT5G45900 | AT5G45900.1 | ATAAACCGAA | Component of autophagy conjugation pathway. Required for proper senescence.  |
| AT5G48240 | AT5G48240.1 | AACCCGACCTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  |
| AT5G48240.2 | AACCCGACCTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  |
| AT5G48240.3 | AACCCGACCTAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  |
| AT5G48580 | AT5G48580.1 | TTAAACCGAA | immunophilin (FKBP15-2)  |
| AT5G49830 | AT5G49830.1 | AAAACGGCGTCGGTTTAG | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10385.1).  |
| AT5G49830.2 | AAAACGGCGTCGGTTTAG | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10385.1).  |
| AT5G49830.3 | AAAACGGCGTCGGTTTAG | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10385.1).  |
| AT5G50380 | AT5G50380.1 | CTAAACCGAA | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.  |
| AT5G50850 | AT5G50850.1 | TTAAACCGA | MACCI-BOU (MAB1); FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity, catalytic activity; INVOLVED IN: defense response to bacterium; LOCATED IN: mitochondrion, nucleolus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Transketolase, C-terminal (InterPro:IPR005476), Transketolase C-terminal-like (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: PDH-E1 BETA (PYRUVATE DEHYDROGENASE E1 BETA); pyruvate dehydrogenase (acetyl-transferring) (TAIR:AT1G30120.1); Has 11982 Blast hits to 11974 proteins in 1601 species: Archae - 106; Bacteria - 6028; Metazoa - 516; Fungi - 148; Plants - 236; Viruses - 0; Other Eukaryotes - 4948 (source: NCBI BLink).  |
| AT5G50920 | AT5G50920.1 | TCGGTTTACCACGTG | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery.  |
| AT5G51430 | AT5G51430.1 | AGTCGGTTTAG | Encodes a protein that is homologous to Cog7, a subunit of the conserved oligomeric Golgi (COG) complex, which is required for the normal morphology and function of the Golgi apparatus. It is likely to be involved in transport or retention of Golgi-localized proteins and in maintenance of Golgi morphology.  |
| AT5G51510 | AT5G51510.1 | TCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT5G51510.1 | TGGTTCGGTTTAGTTCGGTTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT5G51740 | AT5G51740.1 | ATAAACCGAA | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 4555 Blast hits to 4524 proteins in 759 species: Archae - 2; Bacteria - 2617; Metazoa - 54; Fungi - 111; Plants - 18; Viruses - 0; Other Eukaryotes - 1753 (source: NCBI BLink).  |
| AT5G51820 | AT5G51820.1 | ATAAACCGA | Encodes a plastid isoform of the enzyme phosphoglucomutase involved in controlling photosynthetic carbon flow. Effective petiole movement against the direction of the gravity requires functional PGM activity that is required for full development of amyloplasts.  |
| AT5G52370 | AT5G52370.1 | CTAAACCGAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G58990.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 18; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT5G53450 | AT5G53450.1 | TTCGGTTTAT | OBP3-responsive gene 1 (ORG1); FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); Has 437 Blast hits to 437 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 146; Fungi - 39; Plants - 194; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  |
| AT5G53450.2 | TTCGGTTTAT | OBP3-responsive gene 1 (ORG1); FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); Has 437 Blast hits to 437 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 146; Fungi - 39; Plants - 194; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  |
| AT5G54310 | AT5G54310.1 | TTAAACCGAA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  |
| AT5G54310.1 | TTAAACCGAACCA | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  |
| AT5G54540 | AT5G54540.1 | ATAAACCGAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP012943 (InterPro:IPR016606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25170.1); Has 60 Blast hits to 60 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G54690 | AT5G54690.1 | TCGGTTTAG | Encodes a protein with putative galacturonosyltransferase activity. Mutants defective in this gene displayed a notable reduction in xylose (>50%) in the cell walls from stems and roots and a reduction in cellulose (~25%).  |
| AT5G55500 | AT5G55500.1 | TCGGTTCGGTTTAA | Encodes a beta-1,2-xylosyltransferase that is glycosylated at two positions.  |
| AT5G56140 | AT5G56140.1 | ATAAACCGAA | KH domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 4346 Blast hits to 2291 proteins in 261 species: Archae - 6; Bacteria - 444; Metazoa - 2561; Fungi - 214; Plants - 674; Viruses - 13; Other Eukaryotes - 434 (source: NCBI BLink).  |
| AT5G56460 | AT5G56460.1 | TTCGGTTTAA | protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G01020.1); Has 80161 Blast hits to 79301 proteins in 2452 species: Archae - 44; Bacteria - 7377; Metazoa - 35060; Fungi - 5996; Plants - 18115; Viruses - 334; Other Eukaryotes - 13235 (source: NCBI BLink).  |
| AT5G56520 | AT5G56520.1 | TCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55365.1); Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G57350 | AT5G57350.1 | CTAAACCGA | member of Plasma membrane H+-ATPase family  |
| AT5G58060 | AT5G58060.1 | CTAAACCGAACCGA | member of YKT6 Gene Family  |
| AT5G58060.2 | CTAAACCGAACCGA | member of YKT6 Gene Family  |
| AT5G58670 | AT5G58670.1 | TTCGGTTTAT | phosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one).  |
| AT5G59280 | AT5G59280.1 | AGTCGGTTTAC | Arabidopsis Pumilio 16 (APUM16); FUNCTIONS IN: RNA binding, binding; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM17 (Arabidopsis Pumilio 17); RNA binding / binding (TAIR:AT1G35850.1); Has 1554 Blast hits to 894 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 442; Fungi - 382; Plants - 344; Viruses - 0; Other Eukaryotes - 386 (source: NCBI BLink).  |
| AT5G60640 | AT5G60640.1 | GTTCGGTTTAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants.  |
| AT5G60640.1 | TCGGTTCGGTTTAG | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants.  |
| AT5G60640.2 | GTTCGGTTTAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants.  |
| AT5G60640.2 | TCGGTTCGGTTTAG | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants.  |
| AT5G61240 | AT5G61240.1 | TTCGGTTTAC | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT1G13910.1); Has 54870 Blast hits to 18308 proteins in 781 species: Archae - 35; Bacteria - 3366; Metazoa - 15390; Fungi - 767; Plants - 32078; Viruses - 0; Other Eukaryotes - 3234 (source: NCBI BLink).  |
| AT5G61580 | AT5G61580.1 | TCGGTTTAA | PHOSPHOFRUCTOKINASE 4 (PFK4); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: 6-phosphofructokinase complex, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK3 (PHOSPHOFRUCTOKINASE 3); 6-phosphofructokinase (TAIR:AT4G26270.1); Has 4811 Blast hits to 4479 proteins in 1155 species: Archae - 20; Bacteria - 2585; Metazoa - 536; Fungi - 204; Plants - 225; Viruses - 2; Other Eukaryotes - 1239 (source: NCBI BLink).  |
| AT5G61580.1 | TCGGTTTAT | PHOSPHOFRUCTOKINASE 4 (PFK4); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: 6-phosphofructokinase complex, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK3 (PHOSPHOFRUCTOKINASE 3); 6-phosphofructokinase (TAIR:AT4G26270.1); Has 4811 Blast hits to 4479 proteins in 1155 species: Archae - 20; Bacteria - 2585; Metazoa - 536; Fungi - 204; Plants - 225; Viruses - 2; Other Eukaryotes - 1239 (source: NCBI BLink).  |
| AT5G61580.2 | TCGGTTTAA | PHOSPHOFRUCTOKINASE 4 (PFK4); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: 6-phosphofructokinase complex, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK3 (PHOSPHOFRUCTOKINASE 3); 6-phosphofructokinase (TAIR:AT4G26270.1); Has 4811 Blast hits to 4479 proteins in 1155 species: Archae - 20; Bacteria - 2585; Metazoa - 536; Fungi - 204; Plants - 225; Viruses - 2; Other Eukaryotes - 1239 (source: NCBI BLink).  |
| AT5G61580.2 | TCGGTTTAT | PHOSPHOFRUCTOKINASE 4 (PFK4); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: 6-phosphofructokinase complex, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK3 (PHOSPHOFRUCTOKINASE 3); 6-phosphofructokinase (TAIR:AT4G26270.1); Has 4811 Blast hits to 4479 proteins in 1155 species: Archae - 20; Bacteria - 2585; Metazoa - 536; Fungi - 204; Plants - 225; Viruses - 2; Other Eukaryotes - 1239 (source: NCBI BLink).  |
| AT5G64160 | AT5G64160.1 | TCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 24 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 20; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT5G64290 | AT5G64290.1 | ATAAACCGA | DICARBOXYLATE TRANSPORT 2.1 (DIT2.1); FUNCTIONS IN: oxoglutarate:malate antiporter activity; INVOLVED IN: malate transport, response to nematode; LOCATED IN: chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sodium/sulphate symporter (InterPro:IPR001898); BEST Arabidopsis thaliana protein match is: DiT2.2 (dicarboxylate transporter 2.2); oxoglutarate:malate antiporter (TAIR:AT5G64280.1); Has 2721 Blast hits to 2720 proteins in 602 species: Archae - 47; Bacteria - 2055; Metazoa - 43; Fungi - 9; Plants - 101; Viruses - 2; Other Eukaryotes - 464 (source: NCBI BLink).  |