| Locus | Gene model | Sequence | Description |
| AT1G01090 | AT1G01090.1 | GTGGGTCC | pyruvate dehydrogenase E1 alpha subunit |
| AT1G01140 | AT1G01140.1 | GGGACCCAC | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
| AT1G01140.2 | GGGACCCAC | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
| AT1G01140.3 | GGGACCCAC | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
| AT1G02660 | AT1G02660.1 | GTGGGTCCCACGTGGG | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT3G62590.1); Has 601 Blast hits to 595 proteins in 116 species: Archae - 0; Bacteria - 17; Metazoa - 188; Fungi - 136; Plants - 92; Viruses - 14; Other Eukaryotes - 154 (source: NCBI BLink). |
| AT1G02850 | AT1G02850.1 | GGACCCAC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.1 | GTGGGTCC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.2 | GGACCCAC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.2 | GTGGGTCC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.3 | GGACCCAC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.3 | GTGGGTCC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.4 | GGACCCAC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.4 | GTGGGTCC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.5 | GGACCCAC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G02850.5 | GTGGGTCC | BETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT1G05230 | AT1G05230.1 | GTGGGTCC | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT1G05230.2 | GTGGGTCC | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT1G05230.3 | GTGGGTCC | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT1G05260 | AT1G05260.1 | GGACCCAC | Encodes a cold-inducible cationic peroxidase that is involved in the stress response. In response to low temperature, RCI3 transcripts accumulate in the aerial part and in roots of etiolated seedlings but only in roots of light-grown seedlings. |
| AT1G05410 | AT1G05410.1 | GGACCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G05410.2 | GGACCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G06390 | AT1G06390.1 | GTGGGTCC | encodes a GSK3/shaggy-like protein kinase. Gene expression is induced by NaCl and ABA but not KCl, suggesting that this gene may be involved in response to osmotic stress. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
| AT1G06390.2 | GTGGGTCC | encodes a GSK3/shaggy-like protein kinase. Gene expression is induced by NaCl and ABA but not KCl, suggesting that this gene may be involved in response to osmotic stress. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
| AT1G07970 | AT1G07970.1 | GTGGGTCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 164 Blast hits to 163 proteins in 58 species: Archae - 0; Bacteria - 2; Metazoa - 113; Fungi - 15; Plants - 20; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT1G08720 | AT1G08720.1 | GTGGGTCCC | enhanced disease resistance 1 (EDR1) confers resistance to powdery mildew disease caused by the fungus Erysiphe cichoracearum |
| AT1G10940 | AT1G10940.1 | GTGGGTCCC | Encodes a plant protein kinase similar to the calcium/calmodulin-dependent protein kinase subfamily and the SNF1 kinase subfamily (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Kinase activity of its homolog in tobacco is induced by hyperosmotic condition within 1 minute. |
| AT1G11940 | AT1G11940.1 | GTGGGTCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62305.1); Has 329 Blast hits to 329 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 304; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT1G12230 | AT1G12230.1 | GGGACCCAC | transaldolase, putative; FUNCTIONS IN: transaldolase activity, catalytic activity; INVOLVED IN: glucose catabolic process to lactate and acetate, 5-phosphoribose 1-diphosphate biosynthetic process, carbohydrate metabolic process, metabolic process, pentose-phosphate shunt, non-oxidative branch; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Transaldolase (InterPro:IPR001585); Has 4687 Blast hits to 4687 proteins in 1248 species: Archae - 40; Bacteria - 2981; Metazoa - 141; Fungi - 151; Plants - 60; Viruses - 7; Other Eukaryotes - 1307 (source: NCBI BLink). |
| AT1G17120 | AT1G17120.1 | GTGGGTCC | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
| AT1G17120.1 | GTGGGTCCC | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
| AT1G19350 | AT1G19350.1 | GGACCCAC | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19350.3 | GGACCCAC | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19350.4 | GGACCCAC | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19350.5 | GGACCCAC | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G19350.6 | GGACCCAC | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes |
| AT1G22065 | AT1G22065.1 | GGACCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G28400 | AT1G28400.1 | GGACCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33850.1); Has 44658 Blast hits to 17636 proteins in 467 species: Archae - 50; Bacteria - 837; Metazoa - 1245; Fungi - 895; Plants - 135; Viruses - 63; Other Eukaryotes - 41433 (source: NCBI BLink). |
| AT1G29670 | AT1G29670.1 | GGACCCAC | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: apoplast, cell wall, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT1G29660.1); Has 1995 Blast hits to 1979 proteins in 221 species: Archae - 0; Bacteria - 342; Metazoa - 1; Fungi - 54; Plants - 1578; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT1G31930 | AT1G31930.1 | GTGGGTCC | Encodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses. |
| AT1G31930.2 | GTGGGTCC | Encodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses. |
| AT1G33420 | AT1G33420.1 | GGGACCCAC | PHD finger family protein; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: MMD1 (MALE MEIOCYTE DEATH 1); DNA binding / protein binding / zinc ion binding (TAIR:AT1G66170.1); Has 482 Blast hits to 477 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 172; Plants - 97; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G52740 | AT1G52740.1 | GTGGGTCC | Encodes HTA9, a histone H2A protein. |
| AT1G62290 | AT1G62290.1 | GTGGGTCCCAC | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink). |
| AT1G62290.2 | GTGGGTCCCAC | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink). |
| AT1G67750 | AT1G67750.1 | GTGGGTCC | pectate lyase family protein; FUNCTIONS IN: pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT4G24780.1); Has 983 Blast hits to 980 proteins in 166 species: Archae - 0; Bacteria - 418; Metazoa - 0; Fungi - 154; Plants - 399; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G76160 | AT1G76160.1 | GTGGGTCC | SKU5 Similar 5 (sks5); FUNCTIONS IN: oxidoreductase activity, copper ion binding; LOCATED IN: apoplast, cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multicopper oxidase, type 3 (InterPro:IPR011707), Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type 2 (InterPro:IPR011706), Multicopper oxidase, type 1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein match is: SKS6 (SKU5-SIMILAR 6); pectinesterase (TAIR:AT1G41830.1); Has 3613 Blast hits to 3566 proteins in 612 species: Archae - 8; Bacteria - 911; Metazoa - 254; Fungi - 1504; Plants - 791; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink). |
| AT1G77760 | AT1G77760.1 | GTGGGTCCC | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
| AT1G78900 | AT1G78900.1 | GGACCCACTTATTGGGCCGTA | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. |
| AT1G78900.2 | GGACCCACTTATTGGGCCGTA | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. |
| AT1G80080 | AT1G80080.1 | GGACCCAC | Encodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. |
| AT2G07718 | AT2G07718.1 | GGACCCAC | cytochrome b, putative; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; INVOLVED IN: respiratory electron transport chain; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Cytochrome b/b6 (InterPro:IPR016175), Cytochrome b/b6, N-terminal (InterPro:IPR005797); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATMG00590.1); Has 22999 Blast hits to 22998 proteins in 3944 species: Archae - 0; Bacteria - 28; Metazoa - 21735; Fungi - 0; Plants - 517; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink). |
| AT2G15790 | AT2G15790.1 | GTGGGTCC | SQN encodes the Arabidopsis homolog of cyclophilin 40 (CyP40). It is specifically required for the vegetative but not the reproductive maturation of the shoot. |
| AT2G28900 | AT2G28900.1 | GTGGGTCC | Encodes AtOEP16, a 16-KDa plastid outer membrane protein involved in plastid import of protochlorophyllide oxidoreductase A. Predominantly expressed in leaves and is also inducible by cold treatment. |
| AT2G30000 | AT2G30000.1 | GGACCCAC | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G07170.2); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G30170 | AT2G30170.2 | GGACCCAC | catalytic; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932); BEST Arabidopsis thaliana protein match is: 5-azacytidine resistance protein -related (TAIR:AT5G66720.2); Has 637 Blast hits to 627 proteins in 184 species: Archae - 2; Bacteria - 71; Metazoa - 153; Fungi - 150; Plants - 121; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink). |
| AT2G30590 | AT2G30590.1 | GGACCCAC | Encodes WRKY DNA-binding protein 21 (WRKY21). |
| AT2G33280 | AT2G33280.1 | GTGGGTCCCA | integral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: endomembrane system, membrane; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT1G04570.1); Has 372 Blast hits to 365 proteins in 86 species: Archae - 4; Bacteria - 66; Metazoa - 0; Fungi - 4; Plants - 130; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT2G35060 | AT2G35060.1 | GGACCCAC | potassium transporter |
| AT2G35060.2 | GGACCCAC | potassium transporter |
| AT2G40800 | AT2G40800.1 | GTGGGTCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56430.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G41770 | AT2G41770.1 | GTGGGTCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF288 (InterPro:IPR005049); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57420.1); Has 153 Blast hits to 153 proteins in 20 species: Archae - 2; Bacteria - 7; Metazoa - 47; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). |
| AT2G42790 | AT2G42790.1 | GTGGGTCCCAC | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT2G45430 | AT2G45430.1 | GGACCCAC | DNA-binding protein-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT3G60870.1); Has 474 Blast hits to 471 proteins in 35 species: Archae - 0; Bacteria - 4; Metazoa - 34; Fungi - 10; Plants - 424; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G01310 | AT3G01310.1 | GTGGGTCC | acid phosphatase/ oxidoreductase/ transition metal ion binding; FUNCTIONS IN: oxidoreductase activity, transition metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histidine acid phosphatase (InterPro:IPR000560), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078); BEST Arabidopsis thaliana protein match is: acid phosphatase/ oxidoreductase/ transition metal ion binding (TAIR:AT5G15070.1); Has 471 Blast hits to 374 proteins in 140 species: Archae - 0; Bacteria - 2; Metazoa - 201; Fungi - 125; Plants - 35; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT3G01310.2 | GTGGGTCC | acid phosphatase/ oxidoreductase/ transition metal ion binding; FUNCTIONS IN: oxidoreductase activity, transition metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histidine acid phosphatase (InterPro:IPR000560), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078); BEST Arabidopsis thaliana protein match is: acid phosphatase/ oxidoreductase/ transition metal ion binding (TAIR:AT5G15070.1); Has 471 Blast hits to 374 proteins in 140 species: Archae - 0; Bacteria - 2; Metazoa - 201; Fungi - 125; Plants - 35; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT3G06470 | AT3G06470.1 | TGGGACCCAC | GNS1/SUR4 membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GNS1/SUR4 membrane protein (InterPro:IPR002076); BEST Arabidopsis thaliana protein match is: GNS1/SUR4 membrane family protein (TAIR:AT3G06460.1); Has 1723 Blast hits to 1718 proteins in 184 species: Archae - 0; Bacteria - 0; Metazoa - 1179; Fungi - 248; Plants - 58; Viruses - 13; Other Eukaryotes - 225 (source: NCBI BLink). |
| AT3G07650 | AT3G07650.1 | GGGACCCACAATACCCT | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. |
| AT3G07650.2 | GGGACCCACAATACCCT | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. |
| AT3G07650.3 | GGGACCCACAATACCCT | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. |
| AT3G07650.4 | GGGACCCACAATACCCT | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. |
| AT3G10410 | AT3G10410.1 | TGGGACCCAC | serine carboxypeptidase-like 49 (scpl49); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl48 (serine carboxypeptidase-like 48); serine-type carboxypeptidase (TAIR:AT3G45010.1); Has 2453 Blast hits to 2354 proteins in 260 species: Archae - 0; Bacteria - 98; Metazoa - 602; Fungi - 570; Plants - 872; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink). |
| AT3G11780 | AT3G11780.1 | GGACCCAC | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin E-set (InterPro:IPR014756), MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G06480.1); Has 141 Blast hits to 141 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 76; Plants - 53; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G13360 | AT3G13360.1 | GTGGGTCCCAC | WPP-domain Interacting Protein 3 (WIP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 130 Blast hits to 126 proteins in 35 species: Archae - 0; Bacteria - 7; Metazoa - 18; Fungi - 8; Plants - 43; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
| AT3G14410 | AT3G14410.1 | GTGGGACCCAC | transporter-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: organic anion transmembrane transporter (TAIR:AT1G53660.1); Has 1496 Blast hits to 1495 proteins in 199 species: Archae - 4; Bacteria - 38; Metazoa - 438; Fungi - 259; Plants - 598; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT3G14415 | AT3G14415.1 | GTGGGTCCCAC | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: cotyledon, fruit, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14420.2); Has 8872 Blast hits to 8856 proteins in 1094 species: Archae - 112; Bacteria - 3084; Metazoa - 295; Fungi - 423; Plants - 161; Viruses - 0; Other Eukaryotes - 4797 (source: NCBI BLink). |
| AT3G14930 | AT3G14930.1 | GTGGGTCC | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink). |
| AT3G14930.2 | GTGGGTCC | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink). |
| AT3G14930.3 | GTGGGTCC | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink). |
| AT3G15220 | AT3G15220.1 | GGGACCCAC | protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: spindle, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATMAP4K ALPHA1; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT1G53165.2); Has 97460 Blast hits to 95819 proteins in 3033 species: Archae - 88; Bacteria - 8614; Metazoa - 42541; Fungi - 8570; Plants - 18723; Viruses - 614; Other Eukaryotes - 18310 (source: NCBI BLink). |
| AT3G15356 | AT3G15356.1 | GTGGGTCC | legume lectin family protein; FUNCTIONS IN: carbohydrate binding, sugar binding; INVOLVED IN: biological_process unknown; LOCATED IN: apoplast, cell wall; EXPRESSED IN: 7 plant structures; CONTAINS InterPro DOMAIN/s: Legume lectin, beta domain (InterPro:IPR001220), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), L-type lectin, plant (InterPro:IPR016363); BEST Arabidopsis thaliana protein match is: legume lectin family protein (TAIR:AT3G16530.1); Has 1383 Blast hits to 1370 proteins in 111 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 1349; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT3G17611 | AT3G17611.1 | GTGGGTCCCAC | ARABIDOPSIS RHOMBOID-LIKE PROTEIN 14 (ATRBL14); FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S54, rhomboid (InterPro:IPR002610), Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: ATRBL15 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 15) (TAIR:AT3G58460.1); Has 479 Blast hits to 479 proteins in 160 species: Archae - 8; Bacteria - 189; Metazoa - 73; Fungi - 28; Plants - 84; Viruses - 3; Other Eukaryotes - 94 (source: NCBI BLink). |
| AT3G17611.2 | GTGGGTCCCAC | ARABIDOPSIS RHOMBOID-LIKE PROTEIN 14 (ATRBL14); FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S54, rhomboid (InterPro:IPR002610), Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: ATRBL15 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 15) (TAIR:AT3G58460.1); Has 479 Blast hits to 479 proteins in 160 species: Archae - 8; Bacteria - 189; Metazoa - 73; Fungi - 28; Plants - 84; Viruses - 3; Other Eukaryotes - 94 (source: NCBI BLink). |
| AT3G17611.3 | GTGGGTCCCAC | ARABIDOPSIS RHOMBOID-LIKE PROTEIN 14 (ATRBL14); FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S54, rhomboid (InterPro:IPR002610), Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: ATRBL15 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 15) (TAIR:AT3G58460.1); Has 479 Blast hits to 479 proteins in 160 species: Archae - 8; Bacteria - 189; Metazoa - 73; Fungi - 28; Plants - 84; Viruses - 3; Other Eukaryotes - 94 (source: NCBI BLink). |
| AT3G18890 | AT3G18890.1 | GTGGGTCCCA | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: flavin reductase-related (TAIR:AT2G34460.1); Has 22640 Blast hits to 13883 proteins in 1103 species: Archae - 75; Bacteria - 3686; Metazoa - 9197; Fungi - 3839; Plants - 1321; Viruses - 607; Other Eukaryotes - 3915 (source: NCBI BLink). |
| AT3G46600 | AT3G46600.1 | GGACCCAC | scarecrow transcription factor family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GRAS transcription factor (InterPro:IPR005202); BEST Arabidopsis thaliana protein match is: scarecrow-like transcription factor 11 (SCL11) (TAIR:AT5G59450.1); Has 1351 Blast hits to 1311 proteins in 188 species: Archae - 0; Bacteria - 3; Metazoa - 2; Fungi - 0; Plants - 1346; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G46600.2 | GGACCCAC | scarecrow transcription factor family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GRAS transcription factor (InterPro:IPR005202); BEST Arabidopsis thaliana protein match is: scarecrow-like transcription factor 11 (SCL11) (TAIR:AT5G59450.1); Has 1351 Blast hits to 1311 proteins in 188 species: Archae - 0; Bacteria - 3; Metazoa - 2; Fungi - 0; Plants - 1346; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G46600.3 | GGACCCAC | scarecrow transcription factor family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GRAS transcription factor (InterPro:IPR005202); BEST Arabidopsis thaliana protein match is: scarecrow-like transcription factor 11 (SCL11) (TAIR:AT5G59450.1); Has 1351 Blast hits to 1311 proteins in 188 species: Archae - 0; Bacteria - 3; Metazoa - 2; Fungi - 0; Plants - 1346; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G48360 | AT3G48360.1 | GGACCCAC | encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. |
| AT3G50340 | AT3G50340.1 | GGACCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G67020.1); Has 59 Blast hits to 59 proteins in 21 species: Archae - 0; Bacteria - 23; Metazoa - 0; Fungi - 3; Plants - 32; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G60370 | AT3G60370.1 | GTGGGTCC | Encodes an immunophilin, FKBP20-2, that belongs to the FK-506 binding protein (FKBP) subfamily functioning as peptidyl-prolyl isomerases (PPIases) in protein folding. FKBP20-2 has a unique pair of cysteines at the C terminus and was found to be reduced by thioredoxin (Trx) (itself reduced by NADPH by means of NADP-Trx reductase). The FKBP20-2 protein, which contains only two of the five amino acids required for catalysis, showed a low level of PPIase activity that was unaffected on reduction by Trx. Genetic disruption of the FKBP20-2 gene provide evidence that FKBP20-2 participates specifically in the accumulation of the PSII supercomplex in the chloroplast thylakoid lumen by means of a mechanism that has yet to be determined. |
| AT3G62220 | AT3G62220.1 | GTGGGTCCC | serine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G47060.2); Has 82520 Blast hits to 81517 proteins in 3289 species: Archae - 50; Bacteria - 7570; Metazoa - 36328; Fungi - 6173; Plants - 18156; Viruses - 365; Other Eukaryotes - 13878 (source: NCBI BLink). |
| AT3G63010 | AT3G63010.1 | GTGGGACCCAC | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. |
| AT4G02700 | AT4G02700.1 | GTGGGTCC | sulfate transporter 3;2 (SULTR3;2); FUNCTIONS IN: sulfate transmembrane transporter activity; INVOLVED IN: sulfate transport, transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Sulphate transporter (InterPro:IPR011547), Sulphate transporter/antisigma-factor antagonist STAS (InterPro:IPR002645), Sulphate anion transporter, conserved site (InterPro:IPR018045), Sulphate anion transporter (InterPro:IPR001902); BEST Arabidopsis thaliana protein match is: SULTR3;1 (SULFATE TRANSPORTER 3;1); secondary active sulfate transmembrane transporter/ sulfate transmembrane transporter/ transporter (TAIR:AT3G51895.1); Has 6707 Blast hits to 6650 proteins in 1091 species: Archae - 34; Bacteria - 3425; Metazoa - 985; Fungi - 298; Plants - 324; Viruses - 0; Other Eukaryotes - 1641 (source: NCBI BLink). |
| AT4G12870 | AT4G12870.1 | GGACCCACGTG | gamma interferon responsive lysosomal thiol reductase family protein / GILT family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Gamma interferon inducible lysosomal thiol reductase GILT (InterPro:IPR004911); BEST Arabidopsis thaliana protein match is: gamma interferon responsive lysosomal thiol reductase family protein / GILT family protein (TAIR:AT4G12900.1); Has 343 Blast hits to 340 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 264; Fungi - 2; Plants - 50; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT4G15910 | AT4G15910.1 | GTGGGTCC | encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants. |
| AT4G24520 | AT4G24520.1 | GGACCCAC | Encodes a cyp450 reductase likely to be involved in phenylpropanoid metabolism. |
| AT4G25050 | AT4G25050.1 | GTGGGACCCAC | encodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light. |
| AT4G25260 | AT4G25260.1 | GGACCCAC | invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: shade avoidance; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein / DC 1.2 homolog (FL5-2I22) (TAIR:AT5G62350.1); Has 406 Blast hits to 401 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 406; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25620 | AT4G25620.1 | AAGCGCGTGGGTCCAAACCG | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT5G52430.1); Has 844 Blast hits to 627 proteins in 148 species: Archae - 0; Bacteria - 72; Metazoa - 151; Fungi - 122; Plants - 173; Viruses - 60; Other Eukaryotes - 266 (source: NCBI BLink). |
| AT4G25672 | AT4G25672.1 | GGACCCAC | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF12 represents a conserved upstream opening reading frame relative to major ORF AT4G25670.1 |
| AT4G26555 | AT4G26555.1 | GTGGGTCCCAC | immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT4G19830.1); Has 2159 Blast hits to 2148 proteins in 673 species: Archae - 12; Bacteria - 1209; Metazoa - 160; Fungi - 145; Plants - 239; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). |
| AT4G28250 | AT4G28250.1 | GTGGGTCC | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G28250.2 | GTGGGTCC | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G30190 | AT4G30190.1 | GGACCCAC | belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal dom |
| AT4G30190.1 | TGGGACCCAC | belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal dom |
| AT4G34050 | AT4G34050.1 | GGGACCCAC | caffeoyl-CoA 3-O-methyltransferase, putative; FUNCTIONS IN: caffeoyl-CoA O-methyltransferase activity; INVOLVED IN: coumarin biosynthetic process, response to cadmium ion; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: caffeoyl-CoA 3-O-methyltransferase, putative (TAIR:AT4G26220.1); Has 3455 Blast hits to 3452 proteins in 740 species: Archae - 19; Bacteria - 1446; Metazoa - 216; Fungi - 70; Plants - 444; Viruses - 0; Other Eukaryotes - 1260 (source: NCBI BLink). |
| AT4G34050.2 | GGGACCCAC | caffeoyl-CoA 3-O-methyltransferase, putative; FUNCTIONS IN: caffeoyl-CoA O-methyltransferase activity; INVOLVED IN: coumarin biosynthetic process, response to cadmium ion; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: caffeoyl-CoA 3-O-methyltransferase, putative (TAIR:AT4G26220.1); Has 3455 Blast hits to 3452 proteins in 740 species: Archae - 19; Bacteria - 1446; Metazoa - 216; Fungi - 70; Plants - 444; Viruses - 0; Other Eukaryotes - 1260 (source: NCBI BLink). |
| AT4G34740 | AT4G34740.1 | GGGACCCAC | Encodes glutamine 5-phosphoribosylpyrophosphate amidotransferase. Mutants are deficient in leaf, but not cotyledon, plastid and palisade cell development. Mutants exhibit defective chloroplast development under non-low light, suggesting that the defect in chloroplast development is caused by photo-oxidative damage. |
| AT4G34860 | AT4G34860.1 | GTACACGTGGACCCAC | beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: sucrose catabolic process, using beta-fructofuranosidase; LOCATED IN: cytosol; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT4G09510.1); Has 530 Blast hits to 529 proteins in 80 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT4G34860.2 | GTACACGTGGACCCAC | beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: sucrose catabolic process, using beta-fructofuranosidase; LOCATED IN: cytosol; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT4G09510.1); Has 530 Blast hits to 529 proteins in 80 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT4G35750 | AT4G35750.1 | GGACCCAC | Rho-GTPase-activating protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G10210.1); Has 313 Blast hits to 313 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 237; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT4G37390 | AT4G37390.1 | GTGGGTCCC | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
| AT4G37610 | AT4G37610.1 | GTGGGTCCCA | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT4G39350 | AT4G39350.1 | GGGACCCAC | Encodes a cellulose synthase isomer, related to CESA6. |
| AT4G39710 | AT4G39710.1 | GTGGGTCCCA | immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: FK506-binding protein 1 (FKBP13) (TAIR:AT5G45680.1); Has 6176 Blast hits to 5824 proteins in 1083 species: Archae - 68; Bacteria - 2849; Metazoa - 1385; Fungi - 335; Plants - 363; Viruses - 0; Other Eukaryotes - 1176 (source: NCBI BLink). |
| AT4G39770 | AT4G39770.1 | GGACCCAC | trehalose-6-phosphate phosphatase, putative; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: catalytic/ trehalose-phosphatase (TAIR:AT2G22190.1); Has 1503 Blast hits to 1499 proteins in 531 species: Archae - 29; Bacteria - 768; Metazoa - 195; Fungi - 108; Plants - 274; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). |
| AT5G01370 | AT5G01370.1 | GTGGGTCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 1409 Blast hits to 1156 proteins in 159 species: Archae - 0; Bacteria - 100; Metazoa - 453; Fungi - 138; Plants - 56; Viruses - 1; Other Eukaryotes - 661 (source: NCBI BLink). |
| AT5G10740 | AT5G10740.1 | GGACCCACGTG | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT5G24940.1); Has 5631 Blast hits to 5529 proteins in 624 species: Archae - 9; Bacteria - 1045; Metazoa - 1489; Fungi - 552; Plants - 1360; Viruses - 11; Other Eukaryotes - 1165 (source: NCBI BLink). |
| AT5G10745 | AT5G10745.1 | CACGTGGGTCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G18130 | AT5G18130.1 | GTGGGTCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03870.2); Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G18130.2 | GTGGGTCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03870.2); Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G18590 | AT5G18590.1 | TGGGACCCAC | kelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: ACBP4 (ACYL-COA BINDING PROTEIN 4); acyl-CoA binding (TAIR:AT3G05420.2); Has 6904 Blast hits to 3522 proteins in 233 species: Archae - 14; Bacteria - 240; Metazoa - 3345; Fungi - 666; Plants - 992; Viruses - 6; Other Eukaryotes - 1641 (source: NCBI BLink). |
| AT5G18590.2 | TGGGACCCAC | kelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: ACBP4 (ACYL-COA BINDING PROTEIN 4); acyl-CoA binding (TAIR:AT3G05420.2); Has 6904 Blast hits to 3522 proteins in 233 species: Archae - 14; Bacteria - 240; Metazoa - 3345; Fungi - 666; Plants - 992; Viruses - 6; Other Eukaryotes - 1641 (source: NCBI BLink). |
| AT5G20380 | AT5G20380.1 | GGGACCCAC | Encodes an inorganic phosphate transporter (PHT4;5). |
| AT5G24810 | AT5G24810.1 | GTGGGTCCCA | ABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae - 93; Bacteria - 6015; Metazoa - 395; Fungi - 388; Plants - 356; Viruses - 16; Other Eukaryotes - 4320 (source: NCBI BLink). |
| AT5G25190 | AT5G25190.1 | GTGGGTCC | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G26160 | AT5G26160.1 | GGACCCACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20610.1); Has 138 Blast hits to 117 proteins in 36 species: Archae - 0; Bacteria - 14; Metazoa - 25; Fungi - 15; Plants - 62; Viruses - 2; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G27920 | AT5G27920.1 | GTGGGTCCC | F-box family protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL3) (TAIR:AT5G01720.1); Has 10236 Blast hits to 3505 proteins in 207 species: Archae - 0; Bacteria - 631; Metazoa - 4869; Fungi - 921; Plants - 2316; Viruses - 19; Other Eukaryotes - 1480 (source: NCBI BLink). |
| AT5G47200 | AT5G47200.1 | GTGGGTCCC | ATRAB1A; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1C; GTP binding (TAIR:AT4G17530.1); Has 23714 Blast hits to 23664 proteins in 649 species: Archae - 17; Bacteria - 107; Metazoa - 13262; Fungi - 2840; Plants - 2236; Viruses - 19; Other Eukaryotes - 5233 (source: NCBI BLink). |
| AT5G47970 | AT5G47970.1 | GTGGGTCCC | nitrogen regulation family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, tRNA processing, oxidation reduction, metabolic process; LOCATED IN: nucleus, phragmoplast, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G63510.1); Has 7166 Blast hits to 7164 proteins in 1353 species: Archae - 16; Bacteria - 3970; Metazoa - 102; Fungi - 62; Plants - 54; Viruses - 0; Other Eukaryotes - 2962 (source: NCBI BLink). |
| AT5G47970.2 | GTGGGTCCC | nitrogen regulation family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, tRNA processing, oxidation reduction, metabolic process; LOCATED IN: nucleus, phragmoplast, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G63510.1); Has 7166 Blast hits to 7164 proteins in 1353 species: Archae - 16; Bacteria - 3970; Metazoa - 102; Fungi - 62; Plants - 54; Viruses - 0; Other Eukaryotes - 2962 (source: NCBI BLink). |
| AT5G49200 | AT5G49200.1 | GGACCCAC | WD-40 repeat family protein / zfwd4 protein (ZFWD4); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / zfwd3 protein (ZFWD3) (TAIR:AT5G40880.1); Has 25041 Blast hits to 14412 proteins in 471 species: Archae - 20; Bacteria - 3252; Metazoa - 10699; Fungi - 5302; Plants - 2300; Viruses - 0; Other Eukaryotes - 3468 (source: NCBI BLink). |
| AT5G55180 | AT5G55180.1 | CACGTGGGTCC | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G26830.1). |
| AT5G55180.2 | CACGTGGGTCC | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G26830.1). |
| AT5G57300 | AT5G57300.1 | GGACCCAC | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57300.2 | GGACCCAC | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G59540 | AT5G59540.1 | GGACCCAC | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate-dependent dioxygenase, putative (TAIR:AT5G59530.1); Has 5683 Blast hits to 5661 proteins in 686 species: Archae - 0; Bacteria - 714; Metazoa - 123; Fungi - 539; Plants - 3068; Viruses - 0; Other Eukaryotes - 1239 (source: NCBI BLink). |
| AT5G59540.2 | GGACCCAC | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate-dependent dioxygenase, putative (TAIR:AT5G59530.1); Has 5683 Blast hits to 5661 proteins in 686 species: Archae - 0; Bacteria - 714; Metazoa - 123; Fungi - 539; Plants - 3068; Viruses - 0; Other Eukaryotes - 1239 (source: NCBI BLink). |
| AT5G61440 | AT5G61440.1 | GGACCCAC | Encodes a member of the thioredoxin family protein. Located in the chloroplast. |
| AT5G61610 | AT5G61610.1 | GGACCCAC | INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, endomembrane system, integral to membrane, membrane; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); Has 6250 Blast hits to 2851 proteins in 405 species: Archae - 6; Bacteria - 1198; Metazoa - 1427; Fungi - 369; Plants - 513; Viruses - 103; Other Eukaryotes - 2634 (source: NCBI BLink). |
| AT5G61900 | AT5G61900.1 | GTGGGTCCCATTTA | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
| AT5G61900.3 | GTGGGTCCCATTTA | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
| AT5G62570 | AT5G62570.1 | GTGGGTCCCAC | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Calmodulin binding protein-like (InterPro:IPR012416); BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT4G25800.2); Has 164 Blast hits to 160 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 164; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G63180 | AT5G63180.1 | GTGGGTCC | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT4G24780.1); Has 922 Blast hits to 919 proteins in 165 species: Archae - 0; Bacteria - 401; Metazoa - 0; Fungi - 114; Plants - 397; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G63600 | AT5G63600.1 | GGACCCAC | encodes a protein whose sequence is similar to flavonol synthase |
| AT5G63600.2 | GGACCCAC | encodes a protein whose sequence is similar to flavonol synthase |