| Locus | Gene model | Sequence | Description |
| AT1G05850 | AT1G05850.1 | GGCCTTAC | Encodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants. |
| AT1G05860 | AT1G05860.1 | GTAAGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31600.1); Has 51 Blast hits to 50 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G07210 | AT1G07210.1 | GGCCTTAC | 30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink). |
| AT1G09520 | AT1G09520.1 | TTATTGGGCCTTAC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G13900 | AT1G13900.1 | GTAAGGCCCATAATATTGGGCTTAGATAGGCCCATATA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity, metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP9 (PURPLE ACID PHOSPHATASE 9); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G03450.1); Has 1052 Blast hits to 1042 proteins in 232 species: Archae - 0; Bacteria - 259; Metazoa - 179; Fungi - 58; Plants - 399; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT1G13910 | AT1G13910.1 | TATATGGGCCTATCTAAGCCCAATATTATGGGCCTTAC | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT5G61240.1); Has 54187 Blast hits to 17810 proteins in 751 species: Archae - 26; Bacteria - 3393; Metazoa - 14506; Fungi - 646; Plants - 32565; Viruses - 0; Other Eukaryotes - 3051 (source: NCBI BLink). |
| AT1G14770 | AT1G14770.1 | GTAAGGCCC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G14770.2 | GTAAGGCCC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G26940 | AT1G26940.1 | ATATGGGCCTTAC | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 7846 Blast hits to 7844 proteins in 1250 species: Archae - 78; Bacteria - 3271; Metazoa - 1001; Fungi - 616; Plants - 300; Viruses - 0; Other Eukaryotes - 2580 (source: NCBI BLink). |
| AT1G28375 | AT1G28375.1 | ATTTGGGCCTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, petal, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 6 Blast hits to 6 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G29990 | AT1G29990.1 | TTTTGGGCCTTAC | Encodes a cytoplastic protein with similarity to yeast prefoldin6, a subunit of the prefoldin complex. The PFD complex is thought to function along with the TCP ring complex to properly fold microtubule proteins. |
| AT1G48900 | AT1G48900.1 | GTAAGGCCCATTAA | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink). |
| AT1G48900.2 | GTAAGGCCCATTAA | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink). |
| AT1G51965 | AT1G51965.1 | GTAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 21191 Blast hits to 6126 proteins in 185 species: Archae - 5; Bacteria - 14; Metazoa - 565; Fungi - 542; Plants - 18830; Viruses - 0; Other Eukaryotes - 1235 (source: NCBI BLink). |
| AT1G58210 | AT1G58210.1 | GGCCTTAC | EMBRYO DEFECTIVE 1674 (EMB1674); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT1G09720.1); Has 24624 Blast hits to 15362 proteins in 900 species: Archae - 370; Bacteria - 1847; Metazoa - 13466; Fungi - 2008; Plants - 1045; Viruses - 70; Other Eukaryotes - 5818 (source: NCBI BLink). |
| AT1G68600 | AT1G68600.1 | GGCCTTAC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0005 (InterPro:IPR006214); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25480.1); Has 529 Blast hits to 527 proteins in 171 species: Archae - 0; Bacteria - 279; Metazoa - 0; Fungi - 30; Plants - 197; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT1G78190 | AT1G78190.1 | TTATGGGCCTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22270.1); Has 285 Blast hits to 285 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 81; Plants - 34; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G79650 | AT1G79650.1 | GGGCCTTACTGGGCTATT | putative DNA repair protein RAD23 |
| AT1G79650.2 | GGGCCTTACTGGGCTATT | putative DNA repair protein RAD23 |
| AT1G79650.3 | GGGCCTTACTGGGCTATT | putative DNA repair protein RAD23 |
| AT1G79660 | AT1G79660.1 | AATAGCCCAGTAAGGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16170.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G80750 | AT1G80750.1 | GTAAGGCCTTACATAAGCCCATAAATATTGGGCTTTTTTAGCCCAATAG | 60S ribosomal protein L7 (RPL7A); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7D) (TAIR:AT3G13580.3); Has 856 Blast hits to 856 proteins in 248 species: Archae - 76; Bacteria - 0; Metazoa - 354; Fungi - 146; Plants - 114; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink). |
| AT2G02140 | AT2G02140.1 | GTAAGGCC | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT2G04230 | AT2G04230.1 | ATTGGGCCTTAC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G49030.1); Has 1566 Blast hits to 1530 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 1562; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G27100 | AT2G27100.1 | GTAAGGCCC | Identified as a leaf form mutant by Redei having serrated leaves. Further analysis of the single loss of function allele indicated pleiotropic effects extending to many aspects of shoot development such as taller meristems, alterations in phase transition, phyllotaxy and branching. Encodes a single zinc finger containing protein that is expressed in meristems and organ primordia. |
| AT2G27100.1 | GTAAGGCCTATT | Identified as a leaf form mutant by Redei having serrated leaves. Further analysis of the single loss of function allele indicated pleiotropic effects extending to many aspects of shoot development such as taller meristems, alterations in phase transition, phyllotaxy and branching. Encodes a single zinc finger containing protein that is expressed in meristems and organ primordia. |
| AT2G34450 | AT2G34450.1 | GGCCTTAC | high mobility group (HMG1/2) family protein; FUNCTIONS IN: transcription factor activity; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group, superfamily (InterPro:IPR009071), High mobility group, HMG1/HMG2 (InterPro:IPR000910); BEST Arabidopsis thaliana protein match is: HMGB3 (HIGH MOBILITY GROUP B 3); DNA binding / chromatin binding / structural constituent of chromatin / transcription factor (TAIR:AT1G20696.3); Has 2168 Blast hits to 1709 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1499; Fungi - 168; Plants - 295; Viruses - 2; Other Eukaryotes - 204 (source: NCBI BLink). |
| AT2G34450.2 | GGCCTTAC | high mobility group (HMG1/2) family protein; FUNCTIONS IN: transcription factor activity; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group, superfamily (InterPro:IPR009071), High mobility group, HMG1/HMG2 (InterPro:IPR000910); BEST Arabidopsis thaliana protein match is: HMGB3 (HIGH MOBILITY GROUP B 3); DNA binding / chromatin binding / structural constituent of chromatin / transcription factor (TAIR:AT1G20696.3); Has 2168 Blast hits to 1709 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1499; Fungi - 168; Plants - 295; Viruses - 2; Other Eukaryotes - 204 (source: NCBI BLink). |
| AT2G40090 | AT2G40090.1 | CAAGCCCAATAAGTAAGGCCCACA | member of ATH subfamily |
| AT3G02080 | AT3G02080.1 | GTAAGGCC | 40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae - 134; Bacteria - 4; Metazoa - 345; Fungi - 96; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT3G02090 | AT3G02090.1 | GGCCTTAC | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT3G02090.2 | GGCCTTAC | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT3G02630 | AT3G02630.1 | TTATGGGCCTTAC | acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT5G16240.1); Has 567 Blast hits to 564 proteins in 126 species: Archae - 0; Bacteria - 200; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT3G02780 | AT3G02780.1 | GGCCTTAC | Encodes a protein with isopentenyl diphosphate:dimethylallyl diphosphate isomerase activity. There is genetic evidence that it functions in the mevalonate, but not the MEP biosynthetic pathway. |
| AT3G03220 | AT3G03220.1 | ATTTGGGCCTTAC | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G06040 | AT3G06040.1 | GGCCTTAC | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). |
| AT3G06040.2 | GGCCTTAC | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). |
| AT3G06040.3 | GGCCTTAC | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). |
| AT3G07590 | AT3G07590.1 | TTATGGGCCTTAC | small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative (TAIR:AT4G02840.1); Has 828 Blast hits to 827 proteins in 166 species: Archae - 0; Bacteria - 2; Metazoa - 337; Fungi - 221; Plants - 121; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). |
| AT3G13050 | AT3G13050.1 | AAATGGGCCTTAC | transporter-related; FUNCTIONS IN: carbohydrate transmembrane transporter activity, transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: AtOCT4 (Arabidopsis thaliana ORGANIC CATION/CARNITINE TRANSPORTER4); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G20660.1); Has 24061 Blast hits to 23627 proteins in 1387 species: Archae - 383; Bacteria - 12067; Metazoa - 4488; Fungi - 4369; Plants - 1324; Viruses - 0; Other Eukaryotes - 1430 (source: NCBI BLink). |
| AT3G18250 | AT3G18250.1 | GGCCTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, LP.02 two leaves visible, petal differentiation and expansion stage; Has 20 Blast hits to 20 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G27630 | AT3G27630.1 | GTAAGGCCCATATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40460.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G27670 | AT3G27670.1 | GTAAGGCC | A novel protein, did not show high similarity to any protein of known function; reveals a novel genetic connection between lipid synthesis and embryo development. Expressed in all tissues examined including leaves, flowers, roots, stems, and siliques, but accumulation levels were not correlated with the degree to which different organs appeared affected by the mutation. Mutant plants showed alterations in the cuticular wax profiles and embryo development. |
| AT3G52930 | AT3G52930.1 | GTAAGGCC | fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, response to salt stress, pentose-phosphate shunt; LOCATED IN: in 7 components; EXPRESSED IN: 29 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT2G36460.1); Has 4403 Blast hits to 4398 proteins in 740 species: Archae - 0; Bacteria - 427; Metazoa - 1257; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2378 (source: NCBI BLink). |
| AT3G54600 | AT3G54600.1 | GGCCTTAC | DJ-1 family protein; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: YLS5 (TAIR:AT2G38860.2); Has 2977 Blast hits to 1806 proteins in 669 species: Archae - 176; Bacteria - 2553; Metazoa - 7; Fungi - 4; Plants - 52; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT3G59380 | AT3G59380.1 | GTAAGGCC | Encodes the alpha-subunit shared between protein farnesyltransferase and protein geranylgeranyltransferase-I. Involved in protein prenylation: covalent attachment of the C-15 isoprene farnesyl or the C-20 isoprene geranylgeranyl groups to the C-terminal end of some proteins. Involved in shoot and flower meristem homeostasis, and response to ABA and drought. Also regulates leaf cell shape. Mutant is epistatic to era1. |
| AT3G59990 | AT3G59990.1 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase |
| AT3G59990.2 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase |
| AT3G59990.3 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase |
| AT3G63500 | AT3G63500.2 | TGATGGGCCTTAC | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1423, plant (InterPro:IPR004082); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14740.1); Has 2817 Blast hits to 2297 proteins in 310 species: Archae - 8; Bacteria - 278; Metazoa - 1232; Fungi - 288; Plants - 201; Viruses - 10; Other Eukaryotes - 800 (source: NCBI BLink). |
| AT4G01990 | AT4G01990.1 | GGCCTTAC | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02370.1); Has 2034 Blast hits to 1378 proteins in 59 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 24; Plants - 1941; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT4G03260 | AT4G03260.1 | GTAAGGCCCATTTA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). |
| AT4G03260.2 | GTAAGGCCCATTTA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). |
| AT4G15910 | AT4G15910.1 | GTAAGGCCCATGAGCCCAAAT | encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants. |
| AT4G21860 | AT4G21860.1 | ATATTGGGCTAAAGGGCCCAAACGTAAGGCCCAAAT | methionine sulfoxide reductase B 2 (MSRB2); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04800.1); Has 5933 Blast hits to 5932 proteins in 1231 species: Archae - 53; Bacteria - 2689; Metazoa - 222; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2775 (source: NCBI BLink). |
| AT4G21860.2 | ATATTGGGCTAAAGGGCCCAAACGTAAGGCCCAAAT | methionine sulfoxide reductase B 2 (MSRB2); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04800.1); Has 5933 Blast hits to 5932 proteins in 1231 species: Archae - 53; Bacteria - 2689; Metazoa - 222; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2775 (source: NCBI BLink). |
| AT4G26320 | AT4G26320.1 | GGCCTTAC | arabinogalactan protein 13 (AGP13); LOCATED IN: anchored to membrane; EXPRESSED IN: inflorescence meristem, hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; Has 32 Blast hits to 32 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G29520 | AT4G29520.1 | TTAATGGGCCTTAC | LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139); Has 120 Blast hits to 120 proteins in 43 species: Archae - 2; Bacteria - 0; Metazoa - 42; Fungi - 10; Plants - 19; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT4G29530 | AT4G29530.1 | GTAAGGCCCATTAA | 2,3-diketo-5-methylthio-1-phosphopentane phosphatase family; FUNCTIONS IN: phosphatase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G17710.1); Has 269 Blast hits to 267 proteins in 80 species: Archae - 0; Bacteria - 19; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT4G31600 | AT4G31600.1 | TTTGGGCCTTTTGGGCCTTAC | UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32272.1); Has 1648 Blast hits to 1639 proteins in 227 species: Archae - 10; Bacteria - 72; Metazoa - 464; Fungi - 365; Plants - 570; Viruses - 0; Other Eukaryotes - 167 (source: NCBI BLink). |
| AT4G31600.2 | TTTGGGCCTTTTGGGCCTTAC | UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32272.1); Has 1648 Blast hits to 1639 proteins in 227 species: Archae - 10; Bacteria - 72; Metazoa - 464; Fungi - 365; Plants - 570; Viruses - 0; Other Eukaryotes - 167 (source: NCBI BLink). |
| AT4G35760 | AT4G35760.1 | GTAAGGCCCAATTG | LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vitamin K epoxide reductase (InterPro:IPR012932), Thioredoxin-like fold (InterPro:IPR012336); Has 447 Blast hits to 447 proteins in 86 species: Archae - 0; Bacteria - 179; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink). |
| AT4G35770 | AT4G35770.1 | CAATTGGGCCTTAC | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT4G35770.2 | CAATTGGGCCTTAC | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT4G35770.3 | CAATTGGGCCTTAC | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT4G38280 | AT4G38280.1 | ATAATGGGCCTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45250.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G03880 | AT5G03880.1 | TTAAGGCCCAAAAGTAAGGCCCATTAAG | electron carrier; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin active site (InterPro:IPR011767), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron carrier/ protein disulfide oxidoreductase (TAIR:AT4G10000.2); Has 401 Blast hits to 305 proteins in 119 species: Archae - 48; Bacteria - 196; Metazoa - 1; Fungi - 33; Plants - 60; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT5G15750 | AT5G15750.1 | CTAAGGCCTTAC | RNA-binding S4 domain-containing protein; FUNCTIONS IN: RNA binding, rRNA binding; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), RNA-binding S4 (InterPro:IPR002942); Has 877 Blast hits to 877 proteins in 267 species: Archae - 114; Bacteria - 0; Metazoa - 268; Fungi - 193; Plants - 105; Viruses - 0; Other Eukaryotes - 197 (source: NCBI BLink). |
| AT5G16400 | AT5G16400.1 | GGCCTTAC | Encodes an f-type thioredoxin (Trx-f2) localized in chloroplast stroma. |
| AT5G28060 | AT5G28060.1 | GTAAGGCCCAATTA | 40S ribosomal protein S24 (RPS24B); FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S24e (InterPro:IPR001976), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal S24e conserved site (InterPro:IPR018098); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S24 (RPS24A) (TAIR:AT3G04920.1); Has 644 Blast hits to 644 proteins in 256 species: Archae - 59; Bacteria - 0; Metazoa - 306; Fungi - 104; Plants - 74; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT5G49555 | AT5G49555.1 | ATAAGGCCTTAC | amine oxidase-related; FUNCTIONS IN: oxidoreductase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD dependent oxidoreductase (InterPro:IPR006076); BEST Arabidopsis thaliana protein match is: CRTISO (CAROTENOID ISOMERASE); carotenoid isomerase (TAIR:AT1G06820.1); Has 5195 Blast hits to 5140 proteins in 685 species: Archae - 86; Bacteria - 2216; Metazoa - 109; Fungi - 51; Plants - 87; Viruses - 0; Other Eukaryotes - 2646 (source: NCBI BLink). |
| AT5G49945 | AT5G49945.1 | GGCCTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1682 (InterPro:IPR012879); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G24330.1); Has 400 Blast hits to 354 proteins in 128 species: Archae - 0; Bacteria - 45; Metazoa - 130; Fungi - 69; Plants - 26; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). |
| AT5G50250 | AT5G50250.1 | GTAAGGCCCAATAA | Encodes a RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT5G56540 | AT5G56540.1 | GGCCTTAC | Encodes arabinogalactan protein (AGP14). |
| AT5G58290 | AT5G58290.1 | ACTGGGCCTTAC | 26S proteasome AAA-ATPase subunit RPT3 (RPT3) mRNA, |
| AT5G66055 | AT5G66055.1 | GTAAGGCCCATTAG | ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink). |
| AT5G66055.2 | GTAAGGCCCATTAG | ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink). |
| AT5G66060 | AT5G66060.1 | CTAATGGGCCTTAC | iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G17720.1); Has 1779 Blast hits to 1774 proteins in 217 species: Archae - 0; Bacteria - 195; Metazoa - 891; Fungi - 57; Plants - 219; Viruses - 14; Other Eukaryotes - 403 (source: NCBI BLink). |
| AT5G67100 | AT5G67100.1 | GTAAGGCCCATTAAG | Encodes the putative catalytic subunit of the DNA polymerase alpha. Interacts with genes involved in chromatin-mediated cellular memory. ICU2 genetically interacts with TERMINAL FLOWER2, the ortholog of HETEROCHROMATIN PROTEIN1 of animals and yeasts, and with the Polycomb group (PcG) gene CURLY LEAF. A number of regulatory genes were derepressed in the icu2-1 mutant, including genes associated with flowering time, floral meristem, and floral organ identity. Mutant has curled, involute leaves and causes early flowering. |