| Locus | Gene model | Sequence | Description |
| AT1G07020 | AT1G07020.1 | TAGTGGGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; Has 22 Blast hits to 22 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 3; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G07890 | AT1G07890.1 | TAGTGGGCCCT | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT1G07890.2 | TAGTGGGCCCT | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT1G07890.3 | TAGTGGGCCCT | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT1G07890.4 | TAGTGGGCCCT | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT1G07890.5 | TAGTGGGCCCT | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT1G07890.6 | TAGTGGGCCCT | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT1G07890.7 | TAGTGGGCCCT | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT1G07890.8 | TAGTGGGCCCT | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT1G09520 | AT1G09520.1 | TCAGCCCACTA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G09800 | AT1G09800.1 | AAAGCCCACTA | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT3G06950.1); Has 6844 Blast hits to 5672 proteins in 1445 species: Archae - 71; Bacteria - 3683; Metazoa - 118; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2917 (source: NCBI BLink). |
| AT1G10570 | AT1G10570.1 | GAAGCCCACTA | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation. |
| AT1G10570.2 | GAAGCCCACTA | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation. |
| AT1G11180 | AT1G11180.1 | TAGTGGGCTTTT | secretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: SC3 (SECRETORY CARRIER 3); transmembrane transporter (TAIR:AT1G61250.1); Has 511 Blast hits to 511 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 333; Fungi - 12; Plants - 121; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). |
| AT1G16180 | AT1G16180.1 | ATTTGGGCCATTAGTGGGCCAA | TMS membrane family protein / tumour differentially expressed (TDE) family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TMS membrane protein/tumour differentially expressed protein (InterPro:IPR005016); BEST Arabidopsis thaliana protein match is: TMS membrane family protein / tumour differentially expressed (TDE) family protein (TAIR:AT3G06170.1); Has 608 Blast hits to 602 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 87; Plants - 80; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). |
| AT1G16740 | AT1G16740.1 | TAGTGGGCTTTG | ribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink). |
| AT1G19140 | AT1G19140.1 | TAGTGGGCCAAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT1G19140.2 | TAGTGGGCCAAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT1G19150 | AT1G19150.1 | ATTGGCCCACTA | PSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA, |
| AT1G20560 | AT1G20560.1 | GCCCACTA | ACYL ACTIVATING ENZYME 1 (AAE1); FUNCTIONS IN: AMP binding; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: AMP-dependent synthetase and ligase family protein (TAIR:AT2G17650.1); Has 51225 Blast hits to 47390 proteins in 2212 species: Archae - 568; Bacteria - 27901; Metazoa - 2931; Fungi - 2228; Plants - 1263; Viruses - 1; Other Eukaryotes - 16333 (source: NCBI BLink). |
| AT1G20560.2 | GCCCACTA | ACYL ACTIVATING ENZYME 1 (AAE1); FUNCTIONS IN: AMP binding; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: AMP-dependent synthetase and ligase family protein (TAIR:AT2G17650.1); Has 51225 Blast hits to 47390 proteins in 2212 species: Archae - 568; Bacteria - 27901; Metazoa - 2931; Fungi - 2228; Plants - 1263; Viruses - 1; Other Eukaryotes - 16333 (source: NCBI BLink). |
| AT1G30230 | AT1G30230.1 | TATAGGCCCACTA | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G30230.2 | TATAGGCCCACTA | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G33120 | AT1G33120.1 | TAGTGGGCTGA | 60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G33780 | AT1G33780.1 | TTATGGGCTTAGCCCACTA | unknown protein; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF179 (InterPro:IPR003774); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29240.2); Has 1773 Blast hits to 1773 proteins in 611 species: Archae - 0; Bacteria - 1186; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 522 (source: NCBI BLink). |
| AT1G48770 | AT1G48770.1 | TAGTGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18295.1); Has 142 Blast hits to 142 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 142; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G48920 | AT1G48920.1 | AAAAAGCCCACTA | Encodes the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants. |
| AT1G51510 | AT1G51510.1 | GAGCCCAAAATAAGCCCACTA | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
| AT1G52270 | AT1G52270.1 | TAGTGGGCCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28310.1); Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G54260 | AT1G54260.1 | TAGTGGGCCAT | histone H1/H5 family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Histone H1/H5 (InterPro:IPR005818); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / histone H1/H5 family protein (TAIR:AT1G72740.2); Has 265 Blast hits to 265 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 265; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G70720 | AT1G70720.1 | TTCGGCCCGGCCCACTA | invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G23205.1); Has 428 Blast hits to 423 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 428; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75710 | AT1G75710.1 | AGCCCACTA | zinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT4G27240.1); Has 475 Blast hits to 218 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 74; Fungi - 30; Plants - 106; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink). |
| AT1G76120 | AT1G76120.1 | GCCCACTA | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink). |
| AT1G76120.2 | GCCCACTA | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink). |
| AT1G79550 | AT1G79550.1 | TCAGCCCACTA | Encodes cytosolic phosphoglycerate kinase (PGK). |
| AT1G79550.2 | TCAGCCCACTA | Encodes cytosolic phosphoglycerate kinase (PGK). |
| AT1G79560 | AT1G79560.1 | TAGTGGGCTGA | encodes an FtsH protease that is localized to the chloroplast |
| AT1G79650 | AT1G79650.1 | AGCCCACTA | putative DNA repair protein RAD23 |
| AT1G79650.2 | AGCCCACTA | putative DNA repair protein RAD23 |
| AT1G79650.3 | AGCCCACTA | putative DNA repair protein RAD23 |
| AT1G79660 | AT1G79660.1 | TAGTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16170.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G02790 | AT2G02790.1 | CCAATAAGCCCACTAATAAAGCCCATTAT | IQ-domain 29 (IQD29); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD28 (IQ67 DOMAIN PROTEIN 28); calmodulin binding (TAIR:AT1G14380.2); Has 7393 Blast hits to 5438 proteins in 475 species: Archae - 15; Bacteria - 609; Metazoa - 3092; Fungi - 719; Plants - 642; Viruses - 17; Other Eukaryotes - 2299 (source: NCBI BLink). |
| AT2G14660 | AT2G14660.1 | TAGTGGGCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0310 (InterPro:IPR002740); Has 2334 Blast hits to 2333 proteins in 479 species: Archae - 5; Bacteria - 781; Metazoa - 60; Fungi - 50; Plants - 22; Viruses - 0; Other Eukaryotes - 1416 (source: NCBI BLink). |
| AT2G15790 | AT2G15790.1 | TAGTGGGC | SQN encodes the Arabidopsis homolog of cyclophilin 40 (CyP40). It is specifically required for the vegetative but not the reproductive maturation of the shoot. |
| AT2G17240 | AT2G17240.1 | TTATGGGCCACCCAATAAAAGCCTTTAAAAGCCCACTATCAAAACGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G24506.1); Has 3052 Blast hits to 987 proteins in 134 species: Archae - 0; Bacteria - 363; Metazoa - 1137; Fungi - 63; Plants - 119; Viruses - 54; Other Eukaryotes - 1316 (source: NCBI BLink). |
| AT2G20130 | AT2G20130.1 | TAGTGGGCCTTAG | LIKE COV 1 (LCV1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, flower, root, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1965 Blast hits to 1965 proteins in 370 species: Archae - 6; Bacteria - 694; Metazoa - 0; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 1180 (source: NCBI BLink). |
| AT2G20140 | AT2G20140.1 | CTAAGGCCCACTA | 26S protease regulatory complex subunit 4, putative; FUNCTIONS IN: hydrolase activity, nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), 26S proteasome subunit P45 (InterPro:IPR005937); BEST Arabidopsis thaliana protein match is: RPT2a (regulatory particle AAA-ATPase 2a); ATPase (TAIR:AT4G29040.1); Has 21701 Blast hits to 20141 proteins in 1744 species: Archae - 831; Bacteria - 5748; Metazoa - 4078; Fungi - 2440; Plants - 1746; Viruses - 26; Other Eukaryotes - 6832 (source: NCBI BLink). |
| AT2G20450 | AT2G20450.1 | TAGTGGGCTTC | 60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT2G24395 | AT2G24395.1 | TCAGCCCACTA | chaperone protein dnaJ-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 17 Blast hits to 17 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G27250 | AT2G27250.1 | GCCCACTA | One of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) is a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline. CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function. |
| AT2G27250.2 | GCCCACTA | One of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) is a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline. CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function. |
| AT2G27250.3 | GCCCACTA | One of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) is a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline. CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function. |
| AT2G27530 | AT2G27530.1 | GCCCACTA | Encodes ribosomal protein L10aP. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2. |
| AT2G27530.2 | GCCCACTA | Encodes ribosomal protein L10aP. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2. |
| AT2G31890 | AT2G31890.1 | TAGTGGGC | Protein contains putative RNA binding domain. Expressed in response to Pseudomonas syringae infection. Resistance requires silencing of AtRAP suggesting it functions as a negative regulator of plant disease resistance. |
| AT2G34520 | AT2G34520.1 | TAGTGGGCCGAT | nuclear-encoded mitochondrial ribosomal protein S14 |
| AT2G38320 | AT2G38320.1 | TAGTGGGC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G01620.2); Has 716 Blast hits to 702 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 714; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G38420 | AT2G38420.1 | TAGTGGGCTTTT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G64320.1); Has 11671 Blast hits to 4113 proteins in 157 species: Archae - 3; Bacteria - 20; Metazoa - 337; Fungi - 320; Plants - 10463; Viruses - 0; Other Eukaryotes - 528 (source: NCBI BLink). |
| AT2G40180 | AT2G40180.1 | GCCCACTA | ATHPP2C5; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT2G30020.1); Has 4428 Blast hits to 4380 proteins in 326 species: Archae - 4; Bacteria - 211; Metazoa - 1380; Fungi - 537; Plants - 1317; Viruses - 9; Other Eukaryotes - 970 (source: NCBI BLink). |
| AT2G40510 | AT2G40510.1 | ATAAAGCCCAAGCCCACTA | 40S ribosomal protein S26 (RPS26A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome, chloroplast; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26B) (TAIR:AT2G40590.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT2G40590 | AT2G40590.1 | ATAAAGCCTAAGCCCACTA | 40S ribosomal protein S26 (RPS26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26A) (TAIR:AT2G40510.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT2G47580 | AT2G47580.1 | ATCGGCCCACTA | encodes spliceosomal protein U1A |
| AT3G04840 | AT3G04840.1 | TAGTGGGCCAT | 40S ribosomal protein S3A (RPS3aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane, chloroplast; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S3Ae, conserved site (InterPro:IPR018281), Ribosomal protein S3Ae (InterPro:IPR001593); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3A (RPS3aB) (TAIR:AT4G34670.1); Has 943 Blast hits to 938 proteins in 297 species: Archae - 150; Bacteria - 1; Metazoa - 369; Fungi - 110; Plants - 126; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink). |
| AT3G05280 | AT3G05280.1 | TAGTGGGCCGAT | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 381 Blast hits to 380 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 69; Plants - 47; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT3G06790 | AT3G06790.1 | CAAAGGCCCACTAAGCCCATATA | plastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1); Has 160 Blast hits to 148 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06790.2 | CAAAGGCCCACTAAGCCCATATA | plastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1); Has 160 Blast hits to 148 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G07270 | AT3G07270.1 | TAGTGGGC | GTP cyclohydrolase I; FUNCTIONS IN: GTP cyclohydrolase I activity; INVOLVED IN: tetrahydrofolate biosynthetic process, biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GTP cyclohydrolase I (InterPro:IPR001474); Has 9830 Blast hits to 5158 proteins in 1246 species: Archae - 70; Bacteria - 5063; Metazoa - 375; Fungi - 212; Plants - 40; Viruses - 16; Other Eukaryotes - 4054 (source: NCBI BLink). |
| AT3G08720 | AT3G08720.1 | GCCCACTA | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
| AT3G08720.2 | GCCCACTA | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
| AT3G08730 | AT3G08730.1 | GCCCACTA | Encodes a protein-serine kinase that phosphorylates ribosomal protein in vitro. Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Involved in translational up-regulation of ribosomal proteins. Phosphorylated by PDK1. Interacts with RAPTOR1, which in turn interacts with TOR. SPK6 activity is affected by osmotic stress, and plants overexpressing S6k1 are hypersensitive to osmotic stress. The gene is expressed in all tissues examined, with highest expression level detected in metabolically active tissues. |
| AT3G09630 | AT3G09630.1 | ATAAGGCCCACTA | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G09630.1 | ATTAGGCCCACTA | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G09630.2 | ATAAGGCCCACTA | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G09630.2 | ATTAGGCCCACTA | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G10970 | AT3G10970.1 | TTAGCCCACTA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G10970.2 | TTAGCCCACTA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G10970.3 | TTAGCCCACTA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G12300 | AT3G12300.1 | GGCTTTATTAGTGGGCCGAGGCCCAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF667 (InterPro:IPR007714); Has 280 Blast hits to 278 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 2; Plants - 29; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT3G14840 | AT3G14840.1 | GCCCACTA | leucine-rich repeat family protein / protein kinase family protein; FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase-related (TAIR:AT1G53420.1); Has 124439 Blast hits to 95007 proteins in 3413 species: Archae - 67; Bacteria - 9885; Metazoa - 43727; Fungi - 7330; Plants - 45507; Viruses - 414; Other Eukaryotes - 17509 (source: NCBI BLink). |
| AT3G14840.2 | GCCCACTA | leucine-rich repeat family protein / protein kinase family protein; FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase-related (TAIR:AT1G53420.1); Has 124439 Blast hits to 95007 proteins in 3413 species: Archae - 67; Bacteria - 9885; Metazoa - 43727; Fungi - 7330; Plants - 45507; Viruses - 414; Other Eukaryotes - 17509 (source: NCBI BLink). |
| AT3G15351 | AT3G15351.1 | TAGTGGGCCGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15351.2 | TAGTGGGCCGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15351.3 | TAGTGGGCCGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G17590 | AT3G17590.1 | TGAGCCCATTTAAAGCCCACTA | Encodes the Arabidopsis homologue of yeast SNF5 and represents a conserved subunit of plant SWI/SNF complexes. |
| AT3G19760 | AT3G19760.1 | TAAAGGCCCACTA | eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: nucleolus, nucleus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative (TAIR:AT1G51380.1); Has 32402 Blast hits to 31825 proteins in 1817 species: Archae - 512; Bacteria - 14379; Metazoa - 5291; Fungi - 3422; Plants - 1433; Viruses - 38; Other Eukaryotes - 7327 (source: NCBI BLink). |
| AT3G45280 | AT3G45280.1 | CAAGCCCACTA | syntaxin of plants 72 (SYP72) |
| AT3G45530 | AT3G45530.1 | AACGACGTGCCCACTA | DC1 domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular signaling cascade; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Zinc finger, PHD-type (InterPro:IPR001965), DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT3G27473.1); Has 1427 Blast hits to 498 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 1403; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G45680 | AT3G45680.1 | TAGTGGGC | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT3G45710.1); Has 2367 Blast hits to 2314 proteins in 371 species: Archae - 0; Bacteria - 529; Metazoa - 412; Fungi - 151; Plants - 1093; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink). |
| AT3G52960 | AT3G52960.1 | TTTAGGCCCACTA | peroxiredoxin type 2, putative; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: defense response to bacterium, peptidyl-cysteine S-nitrosylation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336), Redoxin (InterPro:IPR013740); BEST Arabidopsis thaliana protein match is: TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase (TAIR:AT1G65980.1); Has 3329 Blast hits to 3329 proteins in 622 species: Archae - 43; Bacteria - 1005; Metazoa - 160; Fungi - 217; Plants - 175; Viruses - 0; Other Eukaryotes - 1729 (source: NCBI BLink). |
| AT3G53020 | AT3G53020.1 | TGATGGGCCTATTTAGTGGGCTTA | RPL24B encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B. Mutants showed defects in apical-basal gynoecium patterning similar to previously described ett and mp mutants. Transformation of stv1-1 mutant with a uORF-eliminated ETT construct partially suppressed the stv1 gynoecium phenotype, implying that STV1 could influence ETT translation through its uORFs. Regulated by TCP20. |
| AT3G53030 | AT3G53030.1 | TAAGCCCACTAAATAGGCCCATCA | Encodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31. |
| AT3G56820 | AT3G56820.1 | AAAGCCCACTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT3G62220 | AT3G62220.1 | CCCAATTAATTAGGCCCACTA | serine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G47060.2); Has 82520 Blast hits to 81517 proteins in 3289 species: Archae - 50; Bacteria - 7570; Metazoa - 36328; Fungi - 6173; Plants - 18156; Viruses - 365; Other Eukaryotes - 13878 (source: NCBI BLink). |
| AT3G62290 | AT3G62290.1 | CCAGGCCCACTA | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT3G62360 | AT3G62360.1 | TAGTGGGCTTTATAAAGCCCATTAAGCCCTA | carbohydrate binding; FUNCTIONS IN: carbohydrate binding; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784), Collagen-binding surface protein Cna-like, B region (InterPro:IPR008454); Has 234 Blast hits to 193 proteins in 70 species: Archae - 4; Bacteria - 76; Metazoa - 122; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT3G62370 | AT3G62370.1 | TAGGGCTTAATGGGCTTTATAAAGCCCACTA | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G63340 | AT3G63340.1 | TAGTGGGCTGGGCTTTTA | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C-related / PP2C-related (TAIR:AT3G63320.1); Has 3271 Blast hits to 3269 proteins in 215 species: Archae - 0; Bacteria - 0; Metazoa - 1075; Fungi - 380; Plants - 1004; Viruses - 5; Other Eukaryotes - 807 (source: NCBI BLink). |
| AT4G02730 | AT4G02730.1 | TAGTGGGC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 78608 Blast hits to 31153 proteins in 723 species: Archae - 58; Bacteria - 7156; Metazoa - 36882; Fungi - 14702; Plants - 7512; Viruses - 12; Other Eukaryotes - 12286 (source: NCBI BLink). |
| AT4G03430 | AT4G03430.1 | AAAAAGCCCATTAAAAAGCCCACTA | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT4G11380 | AT4G11380.1 | AGCCCACTA | beta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink). |
| AT4G14110 | AT4G14110.1 | TAGTGGGCTTGGCCCATTTA | Represses photomorphogenesis and induces skotomorphogenesis in the dark. A component of the COP9 signalosome complex. |
| AT4G17010 | AT4G17010.1 | TAAGCCCACTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 8 growth stages; Has 58 Blast hits to 56 proteins in 16 species: Archae - 3; Bacteria - 2; Metazoa - 8; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT4G17960 | AT4G17960.1 | AGCCCACTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46620.1); Has 22 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G20300 | AT4G20300.1 | TAGTGGGCCTGATAATGGGCCGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G20300.2 | TAGTGGGCCTGATAATGGGCCGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G24920 | AT4G24920.1 | AGCCCACTA | protein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT5G50460.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT4G25580 | AT4G25580.1 | GAATGGGCTAGTGGGCTAA | stress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT4G28365 | AT4G28365.1 | AAAGGCCCACTA | plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to membrane; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT4G32490.1); Has 721 Blast hits to 710 proteins in 49 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 4; Plants - 711; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31770 | AT4G31770.1 | TAGTGGGCTTTTGGGCCTAAC | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, protein serine/threonine phosphatase activity; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lariat debranching enzyme, C-terminal (InterPro:IPR007708), Metallophosphoesterase (InterPro:IPR004843); Has 452 Blast hits to 397 proteins in 153 species: Archae - 0; Bacteria - 12; Metazoa - 181; Fungi - 155; Plants - 28; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT4G32250 | AT4G32250.1 | TAGTGGGC | protein kinase family protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: KEG (KEEP ON GOING); protein binding / protein kinase/ ubiquitin-protein ligase (TAIR:AT5G13530.1); Has 51165 Blast hits to 50929 proteins in 2385 species: Archae - 40; Bacteria - 5097; Metazoa - 24000; Fungi - 4193; Plants - 8569; Viruses - 165; Other Eukaryotes - 9101 (source: NCBI BLink). |
| AT4G32250.2 | TAGTGGGC | protein kinase family protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: KEG (KEEP ON GOING); protein binding / protein kinase/ ubiquitin-protein ligase (TAIR:AT5G13530.1); Has 51165 Blast hits to 50929 proteins in 2385 species: Archae - 40; Bacteria - 5097; Metazoa - 24000; Fungi - 4193; Plants - 8569; Viruses - 165; Other Eukaryotes - 9101 (source: NCBI BLink). |
| AT4G32250.3 | TAGTGGGC | protein kinase family protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: KEG (KEEP ON GOING); protein binding / protein kinase/ ubiquitin-protein ligase (TAIR:AT5G13530.1); Has 51165 Blast hits to 50929 proteins in 2385 species: Archae - 40; Bacteria - 5097; Metazoa - 24000; Fungi - 4193; Plants - 8569; Viruses - 165; Other Eukaryotes - 9101 (source: NCBI BLink). |
| AT4G32390 | AT4G32390.1 | TAGTGGGCCTATA | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT2G25520.1); Has 1575 Blast hits to 1573 proteins in 180 species: Archae - 0; Bacteria - 6; Metazoa - 425; Fungi - 287; Plants - 687; Viruses - 0; Other Eukaryotes - 170 (source: NCBI BLink). |
| AT4G33110 | AT4G33110.1 | TAGTGGGCTGA | coclaurine N-methyltransferase, putative; FUNCTIONS IN: cyclopropane-fatty-acyl-phospholipid synthase activity, (S)-coclaurine-N-methyltransferase activity; INVOLVED IN: lipid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Cyclopropane-fatty-acyl-phospholipid synthase (InterPro:IPR003333); BEST Arabidopsis thaliana protein match is: coclaurine N-methyltransferase, putative (TAIR:AT4G33120.1); Has 6032 Blast hits to 6030 proteins in 921 species: Archae - 32; Bacteria - 2504; Metazoa - 56; Fungi - 238; Plants - 239; Viruses - 0; Other Eukaryotes - 2963 (source: NCBI BLink). |
| AT4G33120 | AT4G33120.1 | TAGTGGGCTGA | coclaurine N-methyltransferase, putative; FUNCTIONS IN: cyclopropane-fatty-acyl-phospholipid synthase activity, (S)-coclaurine-N-methyltransferase activity; INVOLVED IN: lipid biosynthetic process; CONTAINS InterPro DOMAIN/s: Cyclopropane-fatty-acyl-phospholipid synthase (InterPro:IPR003333); BEST Arabidopsis thaliana protein match is: coclaurine N-methyltransferase, putative (TAIR:AT4G33110.1); Has 5982 Blast hits to 5978 proteins in 904 species: Archae - 32; Bacteria - 2580; Metazoa - 59; Fungi - 244; Plants - 209; Viruses - 0; Other Eukaryotes - 2858 (source: NCBI BLink). |
| AT4G35050 | AT4G35050.1 | TAGTGGGCCTC | Encodes a WD-40 repeat protein similar to yeast MSI1. The predicted protein has a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT4G37300 | AT4G37300.1 | AAAAGGCCCACTAAAAGCCCATATA | maternal effect embryo arrest 59 (MEE59); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38920 | AT4G38920.1 | TAGTGGGCCGTATGATGGGCCTAAG | VACUOLAR-TYPE H(+)-ATPASE C3 (ATVHA-C3); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: AVA-P1; ATPase/ proton-transporting ATPase, rotational mechanism (TAIR:AT4G34720.1); Has 1818 Blast hits to 1637 proteins in 400 species: Archae - 127; Bacteria - 312; Metazoa - 519; Fungi - 315; Plants - 225; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink). |
| AT5G01500 | AT5G01500.1 | AAGGCCCAACTGAGCCCACTA | encodes an ATP/ADP carrier that is located to the thylakoid membrane involved in providing ATP during thylakoid biogenesis and turnover |
| AT5G09300 | AT5G09300.1 | TAGTGGGCCAT | 2-oxoisovalerate dehydrogenase, putative / 3-methyl-2-oxobutanoate dehydrogenase, putative / branched-chain alpha-keto acid dehydrogenase E1 alpha subunit, putative; FUNCTIONS IN: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor, 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Dehydrogenase, E1 component (InterPro:IPR001017); BEST Arabidopsis thaliana protein match is: 2-oxoisovalerate dehydrogenase, putative / 3-methyl-2-oxobutanoate dehydrogenase, putative / branched-chain alpha-keto acid dehydrogenase E1 alpha subunit, putative (TAIR:AT1G21400.1); Has 5958 Blast hits to 5956 proteins in 1027 species: Archae - 48; Bacteria - 2954; Metazoa - 450; Fungi - 159; Plants - 112; Viruses - 0; Other Eukaryotes - 2235 (source: NCBI BLink). |
| AT5G09300.2 | TAGTGGGCCAT | 2-oxoisovalerate dehydrogenase, putative / 3-methyl-2-oxobutanoate dehydrogenase, putative / branched-chain alpha-keto acid dehydrogenase E1 alpha subunit, putative; FUNCTIONS IN: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor, 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Dehydrogenase, E1 component (InterPro:IPR001017); BEST Arabidopsis thaliana protein match is: 2-oxoisovalerate dehydrogenase, putative / 3-methyl-2-oxobutanoate dehydrogenase, putative / branched-chain alpha-keto acid dehydrogenase E1 alpha subunit, putative (TAIR:AT1G21400.1); Has 5958 Blast hits to 5956 proteins in 1027 species: Archae - 48; Bacteria - 2954; Metazoa - 450; Fungi - 159; Plants - 112; Viruses - 0; Other Eukaryotes - 2235 (source: NCBI BLink). |
| AT5G09660 | AT5G09660.1 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G09660.2 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G09660.3 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G09660.4 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G11190 | AT5G11190.1 | TAGTGGGCTCA | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G11240 | AT5G11240.1 | ATAAGCCCACTA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Protein of unknown function NUC189, C-terminal (InterPro:IPR012979), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 6246 Blast hits to 3792 proteins in 274 species: Archae - 28; Bacteria - 2331; Metazoa - 1477; Fungi - 1133; Plants - 291; Viruses - 0; Other Eukaryotes - 986 (source: NCBI BLink). |
| AT5G13700 | AT5G13700.1 | TAGTGGGCCATA | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT5G14970 | AT5G14970.1 | TAGTGGGCTCA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14910.1); Has 481 Blast hits to 320 proteins in 77 species: Archae - 0; Bacteria - 238; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). |
| AT5G15450 | AT5G15450.1 | TAGTGGGCCAAT | Encodes a chloroplast-targeted Hsp101 homologue. Functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. APG6 expression is upregulated in response to heat shock in various organs, but not in response to other abiotic stresses. Apg6 mutants have a pale-green phenotype. |
| AT5G16250 | AT5G16250.1 | ACGGCCCACTAGGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G02640.1); Has 56 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G16260 | AT5G16260.1 | GTGGGCCTAGTGGGCCGT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), GYF (InterPro:IPR003169); Has 1767 Blast hits to 1758 proteins in 207 species: Archae - 0; Bacteria - 82; Metazoa - 1049; Fungi - 296; Plants - 184; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink). |
| AT5G16940 | AT5G16940.1 | TAAGCCCACTA | carbon-sulfur lyase; FUNCTIONS IN: carbon-sulfur lyase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione-dependent formaldehyde-activating, GFA (InterPro:IPR006913); Has 1933 Blast hits to 1931 proteins in 352 species: Archae - 0; Bacteria - 664; Metazoa - 60; Fungi - 38; Plants - 18; Viruses - 0; Other Eukaryotes - 1153 (source: NCBI BLink). |
| AT5G16940.2 | TAAGCCCACTA | carbon-sulfur lyase; FUNCTIONS IN: carbon-sulfur lyase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione-dependent formaldehyde-activating, GFA (InterPro:IPR006913); Has 1933 Blast hits to 1931 proteins in 352 species: Archae - 0; Bacteria - 664; Metazoa - 60; Fungi - 38; Plants - 18; Viruses - 0; Other Eukaryotes - 1153 (source: NCBI BLink). |
| AT5G16950 | AT5G16950.1 | TAGTGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G19950 | AT5G19950.1 | ATATGGGCCATTAGGCCCACTA | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19950.2 | ATATGGGCCATTAGGCCCACTA | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19950.3 | ATATGGGCCATTAGGCCCACTA | unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT5G19960 | AT5G19960.1 | TAGTGGGCCTAATGGCCCATAT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: GR-RBP8; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G39260.2); Has 17397 Blast hits to 14212 proteins in 592 species: Archae - 12; Bacteria - 964; Metazoa - 9774; Fungi - 1887; Plants - 2774; Viruses - 3; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT5G20570 | AT5G20570.1 | AAAGCCCACTA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein. |
| AT5G20570.2 | AAAGCCCACTA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein. |
| AT5G20570.3 | AAAGCCCACTA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein. |
| AT5G23520 | AT5G23520.1 | ATATGGGCCGTTAAGGCCCACTA | LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Region of unknown function DUF1771 (InterPro:IPR013899); Has 91 Blast hits to 91 proteins in 45 species: Archae - 0; Bacteria - 6; Metazoa - 8; Fungi - 45; Plants - 27; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G26742 | AT5G26742.1 | AGCCCAATAACGGCCCACTA | embryo defective 1138 (emb1138); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), GUCT (InterPro:IPR012562), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, CCHC-type (InterPro:IPR001878), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: PMH2 (putative mitochondrial RNA helicase 2); ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT3G22330.1); Has 41664 Blast hits to 39827 proteins in 1977 species: Archae - 837; Bacteria - 17695; Metazoa - 6892; Fungi - 3987; Plants - 1854; Viruses - 126; Other Eukaryotes - 10273 (source: NCBI BLink). |
| AT5G26742.2 | AGCCCAATAACGGCCCACTA | embryo defective 1138 (emb1138); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), GUCT (InterPro:IPR012562), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, CCHC-type (InterPro:IPR001878), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: PMH2 (putative mitochondrial RNA helicase 2); ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT3G22330.1); Has 41664 Blast hits to 39827 proteins in 1977 species: Archae - 837; Bacteria - 17695; Metazoa - 6892; Fungi - 3987; Plants - 1854; Viruses - 126; Other Eukaryotes - 10273 (source: NCBI BLink). |
| AT5G38380 | AT5G38380.1 | TAGTGGGCTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 90 Blast hits to 90 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 66; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G38380.2 | TAGTGGGCTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 90 Blast hits to 90 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 66; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G49000 | AT5G49000.1 | TAAAGGCCCACTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae - 10; Bacteria - 167; Metazoa - 4114; Fungi - 13; Plants - 659; Viruses - 110; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT5G49000.2 | TAAAGGCCCACTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae - 10; Bacteria - 167; Metazoa - 4114; Fungi - 13; Plants - 659; Viruses - 110; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT5G54520 | AT5G54520.1 | TGGCCCAATTAAAGCCCACTA | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G10580.1); Has 17905 Blast hits to 12742 proteins in 467 species: Archae - 38; Bacteria - 2465; Metazoa - 8443; Fungi - 2995; Plants - 1496; Viruses - 0; Other Eukaryotes - 2468 (source: NCBI BLink). |
| AT5G56920 | AT5G56920.1 | GCCCACTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cystatin-related, plant (InterPro:IPR006525); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56910.1); Has 27 Blast hits to 27 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G57580 | AT5G57580.1 | TAGTGGGCCCTA | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Calmodulin binding protein-like (InterPro:IPR012416); BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT4G25800.2); Has 187 Blast hits to 178 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 187; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G58590 | AT5G58590.1 | TTAGCCCACTA | Encodes a Ran-binding protein 1 homolog (RanBP1). |
| AT5G59140 | AT5G59140.1 | TAGTGGGCTAA | SKP1 family protein; FUNCTIONS IN: protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); Has 313 Blast hits to 313 proteins in 108 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 77; Plants - 28; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G64900 | AT5G64900.1 | TTAGCCCACTA | Encodes a putative 92-aa protein that is the precursor of AtPep1, a 23-aa peptide which activates transcription of the defensive gene defensin (PDF1.2) and activates the synthesis of H2O2, both being components of the innate immune response. |
| AT5G67220 | AT5G67220.1 | TAAGCCCACTAAAGCCCAAAA | nitrogen regulation family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, oxidation reduction, tRNA processing, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G49640.1); Has 7771 Blast hits to 7769 proteins in 1423 species: Archae - 42; Bacteria - 4261; Metazoa - 411; Fungi - 347; Plants - 96; Viruses - 0; Other Eukaryotes - 2614 (source: NCBI BLink). |