| Locus | Gene model | Sequence | Description |
| AT1G01650 | AT1G01650.1 | ACACGCGT | aspartic-type endopeptidase/ peptidase; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: protease-associated (PA) domain-containing protein (TAIR:AT1G63690.1); Has 1108 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 119; Metazoa - 534; Fungi - 104; Plants - 174; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT1G06900 | AT1G06900.1 | AAACGCGTGTCGTTTT | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding; FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 36095 Blast hits to 16198 proteins in 1364 species: Archae - 66; Bacteria - 4521; Metazoa - 14084; Fungi - 4071; Plants - 1728; Viruses - 678; Other Eukaryotes - 10947 (source: NCBI BLink). |
| AT1G08820 | AT1G08820.1 | ACGCGTGT | Encodes VAP33-like protein that interacts with cowpea mosaic virus protein 60K. Is a SNARE-like protein that may be involved in vesicular transport to or from the ER. |
| AT1G08820.2 | ACGCGTGT | Encodes VAP33-like protein that interacts with cowpea mosaic virus protein 60K. Is a SNARE-like protein that may be involved in vesicular transport to or from the ER. |
| AT1G12800 | AT1G12800.1 | ACGCGTGT | S1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink). |
| AT1G13195 | AT1G13195.1 | ACACGCGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G24440.1); Has 629 Blast hits to 628 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 311; Fungi - 15; Plants - 172; Viruses - 16; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT1G13195.2 | ACACGCGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G24440.1); Has 629 Blast hits to 628 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 311; Fungi - 15; Plants - 172; Viruses - 16; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT1G17550 | AT1G17550.1 | ACACGCGT | Protein Phosphatase 2C |
| AT1G17620 | AT1G17620.1 | ACACGCGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11890.1); Has 539 Blast hits to 538 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 539; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G17620.1 | ACGCGTGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11890.1); Has 539 Blast hits to 538 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 539; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G22590 | AT1G22590.1 | ACACGCGT | AGAMOUS-LIKE 87 (AGL87); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, MADS-box (InterPro:IPR002100); BEST Arabidopsis thaliana protein match is: AGL80 (AGAMOUS-LIKE 80); DNA binding / transcription factor (TAIR:AT5G48670.1); Has 3342 Blast hits to 3341 proteins in 419 species: Archae - 0; Bacteria - 0; Metazoa - 418; Fungi - 178; Plants - 2704; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT1G27461 | AT1G27461.1 | ACACGCGT | unknown protein; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G31730 | AT1G31730.1 | ACACGCGTGT | epsilon-adaptin, putative; FUNCTIONS IN: protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Adaptor protein complex AP-4, epsilon subunit (InterPro:IPR017109), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 4111 Blast hits to 2632 proteins in 228 species: Archae - 0; Bacteria - 67; Metazoa - 1478; Fungi - 596; Plants - 220; Viruses - 3; Other Eukaryotes - 1747 (source: NCBI BLink). |
| AT1G67560 | AT1G67560.1 | ACACGCGTACGTGACA | lipoxygenase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen, lipoxygenase activity, iron ion binding, metal ion binding; INVOLVED IN: growth; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976), Lipoxygenase, C-terminal (InterPro:IPR013819), Lipoxygenase (InterPro:IPR000907), Lipoxygenase, plant (InterPro:IPR001246); BEST Arabidopsis thaliana protein match is: lipoxygenase, putative (TAIR:AT1G72520.1); Has 1115 Blast hits to 1100 proteins in 148 species: Archae - 0; Bacteria - 67; Metazoa - 487; Fungi - 37; Plants - 508; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT1G68400 | AT1G68400.1 | ACGCGTGT | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G26730.1); Has 109181 Blast hits to 85983 proteins in 3222 species: Archae - 64; Bacteria - 9468; Metazoa - 37963; Fungi - 6180; Plants - 40805; Viruses - 358; Other Eukaryotes - 14343 (source: NCBI BLink). |
| AT1G70730 | AT1G70730.1 | ACACGCGT | phosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative; FUNCTIONS IN: intramolecular transferase activity, phosphotransferases, magnesium ion binding, phosphoglucomutase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-D-phosphohexomutase, conserved site (InterPro:IPR016066), Alpha-D-phosphohexomutase, C-terminal (InterPro:IPR005843), Alpha-D-phosphohexomutase, alpha/beta/alpha I, II and III (InterPro:IPR016055), Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (InterPro:IPR005846), Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (InterPro:IPR005845), Alpha-D-phosphohexomutase, N-terminal (InterPro:IPR005841), Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (InterPro:IPR005844); BEST Arabidopsis thaliana protein match is: phosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative (TAIR:AT1G23190.1). |
| AT1G73020 | AT1G73020.1 | ACGCGTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF590 (InterPro:IPR007632); Has 925 Blast hits to 873 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 662; Fungi - 104; Plants - 12; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). |
| AT1G73030 | AT1G73030.1 | ACACGCGT | VPS46.2; INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS46.1 (VACUOLAR PROTEIN SORTING 46.1) (TAIR:AT1G17730.1); Has 975 Blast hits to 974 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 421; Fungi - 187; Plants - 221; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT1G76120 | AT1G76120.1 | ACGCGTGT | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink). |
| AT1G76120.2 | ACGCGTGT | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink). |
| AT1G76670 | AT1G76670.1 | TAAACGACACGCGT | transporter-related; INVOLVED IN: response to nematode; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: transporter-related (TAIR:AT1G21070.1); Has 1259 Blast hits to 1249 proteins in 161 species: Archae - 0; Bacteria - 14; Metazoa - 296; Fungi - 205; Plants - 598; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT2G02810 | AT2G02810.1 | ACACGCGT | Encodes a multitransmembrane hydrophobic protein that functions as transporter of UDP-galactose and UDP-glucose into the Golgi. Localized in the ER. Involved in the unfolded protein response, a mechanism that controls proper protein folding in the ER. |
| AT2G17840 | AT2G17840.1 | ACACGCGTCATTT | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
| AT2G18230 | AT2G18230.1 | ACACGCGT | Encodes a protein that might have inorganic pyrophosphatase activity. |
| AT2G27260 | AT2G27260.1 | ACACGCGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); Has 584 Blast hits to 584 proteins in 25 species: Archae - 2; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 578; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G46650 | AT2G46650.1 | ACGCGTGT | member of Cytochromes b5 |
| AT2G46915 | AT2G46915.1 | AAAGTCAACGCGTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19340.1); Has 101 Blast hits to 96 proteins in 30 species: Archae - 0; Bacteria - 24; Metazoa - 10; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT3G03150 | AT3G03150.1 | ACGCGTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03160 | AT3G03160.1 | ACACGCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03870 | AT3G03870.1 | ACACGCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18130.1); Has 28 Blast hits to 28 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03870.2 | ACACGCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18130.1); Has 28 Blast hits to 28 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G05500 | AT3G05500.1 | ACACGCGT | rubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 77 Blast hits to 77 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06850 | AT3G06850.1 | ACGCGTGT | dihydrolipoamide branched chain acyltransferase |
| AT3G06850.2 | ACGCGTGT | dihydrolipoamide branched chain acyltransferase |
| AT3G07590 | AT3G07590.1 | ACGCGTGT | small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative (TAIR:AT4G02840.1); Has 828 Blast hits to 827 proteins in 166 species: Archae - 0; Bacteria - 2; Metazoa - 337; Fungi - 221; Plants - 121; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). |
| AT3G10520 | AT3G10520.1 | ACGCGTGT | class 2 non-symbiotic hemoglobin |
| AT3G11240 | AT3G11240.1 | ACACGCGTGACGT | Encodes an arginyl-tRNA:protein arginyltransferase (ATE2), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. |
| AT3G11250 | AT3G11250.1 | ACGTCACGCGTGT | 60S acidic ribosomal protein P0 (RPP0C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, translation; LOCATED IN: cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0B) (TAIR:AT3G09200.1); Has 1503 Blast hits to 1500 proteins in 380 species: Archae - 223; Bacteria - 1; Metazoa - 578; Fungi - 277; Plants - 141; Viruses - 0; Other Eukaryotes - 283 (source: NCBI BLink). |
| AT3G18430 | AT3G18430.1 | ACACGCGT | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: CAM9 (CALMODULIN 9); calcium ion binding (TAIR:AT3G51920.1); Has 3772 Blast hits to 3771 proteins in 389 species: Archae - 0; Bacteria - 11; Metazoa - 2178; Fungi - 257; Plants - 701; Viruses - 0; Other Eukaryotes - 625 (source: NCBI BLink). |
| AT3G26580 | AT3G26580.1 | ACACGCGT | INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide region (InterPro:IPR013026); Has 2147 Blast hits to 1154 proteins in 168 species: Archae - 2; Bacteria - 99; Metazoa - 1301; Fungi - 180; Plants - 105; Viruses - 57; Other Eukaryotes - 403 (source: NCBI BLink). |
| AT3G26744 | AT3G26744.1 | ACACGCGT | Encodes a MYC-like bHLH transcriptional activator that binds specifically to the MYC recognition sequences in the CBF3 promoter. Mutants are defective in cold-regulated gene expression. Cold stress triggers protein degradation of nuclear GFPICE1 protein, and the RING finger protein HOS1 is required. Sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance. |
| AT3G26744.2 | ACACGCGT | Encodes a MYC-like bHLH transcriptional activator that binds specifically to the MYC recognition sequences in the CBF3 promoter. Mutants are defective in cold-regulated gene expression. Cold stress triggers protein degradation of nuclear GFPICE1 protein, and the RING finger protein HOS1 is required. Sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance. |
| AT3G26744.4 | ACACGCGT | Encodes a MYC-like bHLH transcriptional activator that binds specifically to the MYC recognition sequences in the CBF3 promoter. Mutants are defective in cold-regulated gene expression. Cold stress triggers protein degradation of nuclear GFPICE1 protein, and the RING finger protein HOS1 is required. Sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance. |
| AT3G27090 | AT3G27090.1 | ACGCGTGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42050.1); Has 642 Blast hits to 564 proteins in 35 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 0; Plants - 155; Viruses - 0; Other Eukaryotes - 473 (source: NCBI BLink). |
| AT3G49220 | AT3G49220.1 | ACGCGTGT | pectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: PMEPCRF (PECTIN METHYLESTERASE PCR FRAGMENT F); pectinesterase (TAIR:AT5G53370.1); Has 1605 Blast hits to 1561 proteins in 271 species: Archae - 0; Bacteria - 403; Metazoa - 1; Fungi - 128; Plants - 1073; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G51920 | AT3G51920.1 | ACACGCGT | encodes a divergent member of calmodulin, which is an EF-hand family of Ca2+-binding proteins. This gene is expressed in leaves, flowers and siliques. The gene functionally complements yeast calmodulin 1 (CAM1) but only when selected against the plasmid harboring wild-type yeast sequences. Also the protein does not form formed a complex with a basic amphiphilic helical peptide in the presence of Ca2+ in vitro. Authors suggest that this gene may represent a Ca2+-binding sensor protein that interacts with a more limited set of target proteins than do more conventional CaM isoforms. Mutations in this gene alter plant responses to abiotic stress and abscisic acid. |
| AT3G56880 | AT3G56880.1 | ACGCGTGT | VQ motif-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: ATCAMBP25 (ARABIDOPSIS THALIANA CALMODULIN (CAM)-BINDING PROTEIN OF 25 KDA); calmodulin binding (TAIR:AT2G41010.1); Has 78 Blast hits to 78 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G62450 | AT3G62450.1 | GTGCCACGCGTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 11 Blast hits to 11 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G63070 | AT3G63070.1 | ACGCGTGT | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G48160.1); Has 977 Blast hits to 907 proteins in 123 species: Archae - 0; Bacteria - 34; Metazoa - 607; Fungi - 134; Plants - 84; Viruses - 0; Other Eukaryotes - 118 (source: NCBI BLink). |
| AT3G63480 | AT3G63480.1 | ACACGCGT | kinesin heavy chain, putative; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: PAKRP1 (PHRAGMOPLAST-ASSOCIATED KINESIN-RELATED PROTEIN 1); microtubule motor/ plus-end-directed microtubule motor (TAIR:AT4G14150.1); Has 7627 Blast hits to 7290 proteins in 235 species: Archae - 0; Bacteria - 0; Metazoa - 3886; Fungi - 888; Plants - 878; Viruses - 0; Other Eukaryotes - 1975 (source: NCBI BLink). |
| AT3G63480.2 | ACACGCGT | kinesin heavy chain, putative; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: PAKRP1 (PHRAGMOPLAST-ASSOCIATED KINESIN-RELATED PROTEIN 1); microtubule motor/ plus-end-directed microtubule motor (TAIR:AT4G14150.1); Has 7627 Blast hits to 7290 proteins in 235 species: Archae - 0; Bacteria - 0; Metazoa - 3886; Fungi - 888; Plants - 878; Viruses - 0; Other Eukaryotes - 1975 (source: NCBI BLink). |
| AT3G63490 | AT3G63490.1 | ACGCGTGT | ribosomal protein L1 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, bacterial-type (InterPro:IPR005878), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: ribosomal protein L1 family protein (TAIR:AT2G42710.1); Has 6420 Blast hits to 6414 proteins in 1604 species: Archae - 183; Bacteria - 2916; Metazoa - 108; Fungi - 179; Plants - 61; Viruses - 0; Other Eukaryotes - 2973 (source: NCBI BLink). |
| AT3G63490.2 | ACGCGTGT | ribosomal protein L1 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, bacterial-type (InterPro:IPR005878), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: ribosomal protein L1 family protein (TAIR:AT2G42710.1); Has 6420 Blast hits to 6414 proteins in 1604 species: Archae - 183; Bacteria - 2916; Metazoa - 108; Fungi - 179; Plants - 61; Viruses - 0; Other Eukaryotes - 2973 (source: NCBI BLink). |
| AT4G01950 | AT4G01950.1 | ACACGCGT | Encodes a member of a family of proteins with glycerol-3-phosphate acyltransferase activity. |
| AT4G17490 | AT4G17490.1 | ACACGCGTGT | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT4G24570 | AT4G24570.1 | ACACGCGTTTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: UCP5 (UNCOUPLING PROTEIN 5); binding (TAIR:AT2G22500.1); Has 15369 Blast hits to 9513 proteins in 356 species: Archae - 0; Bacteria - 0; Metazoa - 7655; Fungi - 4171; Plants - 2183; Viruses - 0; Other Eukaryotes - 1360 (source: NCBI BLink). |
| AT4G29160 | AT4G29160.1 | ACGCGTGT | SNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT4G29160.2 | ACGCGTGT | SNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT4G29160.3 | ACGCGTGT | SNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT4G35140 | AT4G35140.1 | ACACGCGT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G38480.1); Has 7738 Blast hits to 5690 proteins in 350 species: Archae - 10; Bacteria - 1449; Metazoa - 3242; Fungi - 1387; Plants - 483; Viruses - 0; Other Eukaryotes - 1167 (source: NCBI BLink). |
| AT5G01490 | AT5G01490.1 | ACACGCGTTTT | Encodes a cation/proton antiporter, a member of Low affinity calcium antiporter CAX2 family. |
| AT5G02710 | AT5G02710.1 | AAACGCGTGT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0153 (InterPro:IPR005358); Has 211 Blast hits to 211 proteins in 60 species: Archae - 8; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). |
| AT5G04500 | AT5G04500.1 | ACACGCGT | a member of the Glycosyltransferase Family 64 (according to CAZy Database) |
| AT5G04710 | AT5G04710.1 | ACACGCGT | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G60160.1); Has 1276 Blast hits to 1273 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 40; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink). |
| AT5G04720 | AT5G04720.1 | ACGCGTGT | ADR1-like 2 (ADR1-L2); FUNCTIONS IN: protein binding, nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: defense response, apoptosis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Disease resistance, plant (InterPro:IPR014011), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: ADR1-L1 (ADR1-like 1); ATP binding / protein binding (TAIR:AT4G33300.2); Has 16716 Blast hits to 11049 proteins in 439 species: Archae - 24; Bacteria - 1102; Metazoa - 2478; Fungi - 82; Plants - 12542; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink). |
| AT5G06760 | AT5G06760.1 | ACACGCGT | late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); Has 477 Blast hits to 328 proteins in 98 species: Archae - 0; Bacteria - 70; Metazoa - 102; Fungi - 37; Plants - 214; Viruses - 1; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G07020 | AT5G07020.1 | ACACGCGT | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 32 Blast hits to 32 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 1; Plants - 28; Viruses - 1; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G07240 | AT5G07240.1 | ACGCGTGT | IQ-domain 24 (IQD24); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD23 (IQ-domain 23); calmodulin binding (TAIR:AT5G62070.1); Has 437 Blast hits to 430 proteins in 26 species: Archae - 0; Bacteria - 2; Metazoa - 30; Fungi - 0; Plants - 402; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G08410 | AT5G08410.1 | ACACGCGT | ferredoxin/thioredoxin reductase subunit A (variable subunit) 2 (FTRA2); FUNCTIONS IN: ferredoxin:thioredoxin reductase activity, lipoate synthase activity, catalytic activity, ferredoxin reductase activity; INVOLVED IN: photosynthesis, light reaction, lipoate biosynthetic process, photosynthesis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipoate synthase (InterPro:IPR003698), Ferredoxin thioredoxin reductase, alpha chain (InterPro:IPR004207), Electron transport accessory protein (InterPro:IPR008990); BEST Arabidopsis thaliana protein match is: FTRA1 (ferredoxin/thioredoxin reductase subunit A (variable subunit) 1); catalytic/ ferredoxin reductase/ ferredoxin:thioredoxin reductase/ lipoate synthase (TAIR:AT5G23440.1); Has 107 Blast hits to 107 proteins in 41 species: Archae - 0; Bacteria - 60; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G13700 | AT5G13700.1 | ACACGCGT | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT5G22220 | AT5G22220.2 | ACGCGTGT | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. Binds DPA and RBR1 proteins. Expressed throughout the cell cycle. Abundance increased by auxin through stabilization of the protein. Elevates CDK levels and activity, even under hormone-free conditions. Promotes cell division and shortens cell doubling time, inhibits cell growth. Transgenic plants overexpressing AtE2Fa contained an increased level of AtE2Fb transcripts that is paralleled by an increase in the amount of the AtE2Fb protein, suggesting that AtE2Fb expression might actually be up-regulated by the AtE2Fa transcription factor. |
| AT5G22220.3 | ACGCGTGT | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. Binds DPA and RBR1 proteins. Expressed throughout the cell cycle. Abundance increased by auxin through stabilization of the protein. Elevates CDK levels and activity, even under hormone-free conditions. Promotes cell division and shortens cell doubling time, inhibits cell growth. Transgenic plants overexpressing AtE2Fa contained an increased level of AtE2Fb transcripts that is paralleled by an increase in the amount of the AtE2Fb protein, suggesting that AtE2Fb expression might actually be up-regulated by the AtE2Fa transcription factor. |
| AT5G22510 | AT5G22510.1 | AGACACGTCGTCGTTTCACACGCGT | beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT1G56560.1); Has 513 Blast hits to 512 proteins in 79 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 230 (source: NCBI BLink). |
| AT5G22580 | AT5G22580.1 | ACACGCGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Stress responsive alpha-beta barrel (InterPro:IPR013097), Dimeric alpha-beta barrel (InterPro:IPR011008); BEST Arabidopsis thaliana protein match is: HS1 (HEAT STABLE PROTEIN 1) (TAIR:AT3G17210.1); Has 231 Blast hits to 231 proteins in 57 species: Archae - 0; Bacteria - 89; Metazoa - 0; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT5G22690 | AT5G22690.1 | ACACGCGTTT | disease resistance protein (TIR-NBS-LRR class), putative; FUNCTIONS IN: protein binding, transmembrane receptor activity, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Toll-Interleukin receptor (InterPro:IPR000157), Leucine-rich repeat 3 (InterPro:IPR011713); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT5G46470.1); Has 11710 Blast hits to 8495 proteins in 293 species: Archae - 12; Bacteria - 380; Metazoa - 722; Fungi - 5; Plants - 10309; Viruses - 0; Other Eukaryotes - 282 (source: NCBI BLink). |
| AT5G37540 | AT5G37540.1 | ACGCGTGT | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G66180.1); Has 1186 Blast hits to 1173 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 87; Plants - 1052; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT5G42980 | AT5G42980.1 | ACACGCGT | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
| AT5G46410 | AT5G46410.1 | ACACGCGT | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT4G18140.2); Has 1966 Blast hits to 1962 proteins in 182 species: Archae - 0; Bacteria - 10; Metazoa - 732; Fungi - 353; Plants - 202; Viruses - 7; Other Eukaryotes - 662 (source: NCBI BLink). |
| AT5G46410.2 | ACACGCGT | NLI interacting factor (NIF) family protein; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT4G18140.2); Has 1966 Blast hits to 1962 proteins in 182 species: Archae - 0; Bacteria - 10; Metazoa - 732; Fungi - 353; Plants - 202; Viruses - 7; Other Eukaryotes - 662 (source: NCBI BLink). |
| AT5G47430 | AT5G47430.2 | ACACGCGT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DWNN domain (InterPro:IPR014891), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G17410.1); Has 12501 Blast hits to 8536 proteins in 350 species: Archae - 0; Bacteria - 308; Metazoa - 7733; Fungi - 1802; Plants - 953; Viruses - 24; Other Eukaryotes - 1681 (source: NCBI BLink). |
| AT5G57030 | AT5G57030.1 | ACACGCGTTTT | Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase |
| AT5G64310 | AT5G64310.1 | ACACGCGT | Encodes arabinogalactan-protein (AGP1). |
| AT5G67300 | AT5G67300.1 | ACGCGTGT | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. |