| Locus | Gene model | Sequence | Description |
| AT1G01060 | AT1G01060.1 | ACCACGTGTCG | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
| AT1G01060.2 | ACCACGTGTCG | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
| AT1G01060.3 | ACCACGTGTCG | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
| AT1G01060.4 | ACCACGTGTCG | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
| AT1G03070 | AT1G03070.1 | GCCACGTGGT | glutamate binding; FUNCTIONS IN: glutamate binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0005 (InterPro:IPR006214); BEST Arabidopsis thaliana protein match is: glutamate binding (TAIR:AT4G02690.1); Has 3927 Blast hits to 3927 proteins in 938 species: Archae - 0; Bacteria - 1737; Metazoa - 709; Fungi - 89; Plants - 119; Viruses - 54; Other Eukaryotes - 1219 (source: NCBI BLink). |
| AT1G05360 | AT1G05360.1 | ATGACACGTGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT1G06070 | AT1G06070.1 | ACCACGTG | bZIP transcription factor, putative (bZIP69); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: bZIP transcription factor (POSF21) (TAIR:AT2G31370.5); Has 38161 Blast hits to 16134 proteins in 672 species: Archae - 6; Bacteria - 1085; Metazoa - 14914; Fungi - 4009; Plants - 2167; Viruses - 428; Other Eukaryotes - 15552 (source: NCBI BLink). |
| AT1G07645 | AT1G07645.1 | ACCACGTGTT | DESSICATION-INDUCED 1VOC SUPERFAMILY PROTEIN (ATDSI-1VOC); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to abiotic stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Has 442 Blast hits to 442 proteins in 189 species: Archae - 0; Bacteria - 413; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G07985 | AT1G07985.1 | ACCACGTGTT | Expressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 33 Blast hits to 33 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G08200 | AT1G08200.1 | CACGTGGT | Encodes a putative UDP-D-apiose/UPD-D-xylose synthetase. |
| AT1G09850 | AT1G09850.1 | CACACGTGGT | Arabidopsis thaliana papain-like cysteine peptidase |
| AT1G10360 | AT1G10360.1 | ACCACGTGTCG | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G10560 | AT1G10560.1 | ACCACGTGGAT | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G10760 | AT1G10760.1 | GTGCCACGTGGT | Encodes an α-glucan, water dikinase required for starch degradation. Involved in cold-induced freezing tolerance. Mutations that eliminate the GWD protein or affect the dikinase domain of the enzyme dramatically reduce both the amount of phosphate in the amylopectin and the rate of starch degradation. Mature leaves of these mutants accumulate amounts of starch up to seven times greater than those in wild-type leaves. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C6 position. |
| AT1G12800 | AT1G12800.1 | ACCACGTGTCT | S1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink). |
| AT1G12990 | AT1G12990.1 | ACCACGTGTCAC | glycosyl transferase family 17 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 17 (InterPro:IPR006813); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 17 protein (TAIR:AT1G67880.1); Has 972 Blast hits to 971 proteins in 58 species: Archae - 0; Bacteria - 24; Metazoa - 46; Fungi - 23; Plants - 68; Viruses - 4; Other Eukaryotes - 807 (source: NCBI BLink). |
| AT1G13000 | AT1G13000.1 | ACCACGTGGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26440.2); Has 194 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT1G13000.2 | ACCACGTGGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26440.2); Has 194 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT1G13245 | AT1G13245.1 | ACCACGTGGCGT | ROTUNDIFOLIA LIKE 17 (RTFL17); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: shoot development; EXPRESSED IN: stem, flower, root, leaf; CONTAINS InterPro DOMAIN/s: DVL (InterPro:IPR012552); BEST Arabidopsis thaliana protein match is: RTFL15 (ROTUNDIFOLIA LIKE 15) (TAIR:AT1G68825.2); Has 68 Blast hits to 68 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G16560 | AT1G16560.1 | AGACACGTGGT | Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G16560.2 | AGACACGTGGT | Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G16560.3 | AGACACGTGGT | Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G16560.4 | AGACACGTGGT | Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G16740 | AT1G16740.1 | GTGACACGTGGT | ribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink). |
| AT1G25220 | AT1G25220.1 | CACGTGGT | Catalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2). |
| AT1G25520 | AT1G25520.1 | ATCCACGTGGT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0016 (InterPro:IPR001727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68650.1); Has 1239 Blast hits to 1181 proteins in 440 species: Archae - 13; Bacteria - 667; Metazoa - 131; Fungi - 99; Plants - 104; Viruses - 0; Other Eukaryotes - 225 (source: NCBI BLink). |
| AT1G33170 | AT1G33170.1 | ACCACGTG | dehydration-responsive family protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive family protein (TAIR:AT4G10440.1); Has 559 Blast hits to 552 proteins in 56 species: Archae - 2; Bacteria - 61; Metazoa - 1; Fungi - 0; Plants - 483; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G49330 | AT1G49330.1 | ACCACGTGGCAC | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16190.1); Has 840 Blast hits to 686 proteins in 130 species: Archae - 0; Bacteria - 47; Metazoa - 222; Fungi - 69; Plants - 342; Viruses - 66; Other Eukaryotes - 94 (source: NCBI BLink). |
| AT1G49840 | AT1G49840.1 | CACGTGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19540.1); Has 110 Blast hits to 108 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G52690 | AT1G52690.1 | ACCACGTGTCT | late embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G15670.1); Has 2025 Blast hits to 947 proteins in 265 species: Archae - 6; Bacteria - 474; Metazoa - 312; Fungi - 113; Plants - 812; Viruses - 15; Other Eukaryotes - 293 (source: NCBI BLink). |
| AT1G52690.2 | ACCACGTGTCT | late embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G15670.1); Has 2025 Blast hits to 947 proteins in 265 species: Archae - 6; Bacteria - 474; Metazoa - 312; Fungi - 113; Plants - 812; Viruses - 15; Other Eukaryotes - 293 (source: NCBI BLink). |
| AT1G53770 | AT1G53770.1 | CGCACGTGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G50420.1); Has 40 Blast hits to 40 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G54500 | AT1G54500.1 | AAAAGGCCACGTGGT | rubredoxin family protein; FUNCTIONS IN: electron carrier activity, metal ion binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubredoxin, iron-binding site (InterPro:IPR018527), Rubredoxin-type Fe(Cys)4 protein (InterPro:IPR004039), Rubredoxin (InterPro:IPR001052); Has 2007 Blast hits to 1988 proteins in 612 species: Archae - 138; Bacteria - 1563; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink). |
| AT1G60950 | AT1G60950.1 | ACGCCACGTGGT | encodes a major leaf ferredoxin |
| AT1G61780 | AT1G61780.1 | ACCACGTGGAA | postsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G61780.1 | ACCACGTGGAT | postsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G61790 | AT1G61790.1 | ATCCACGTGGT | OST3/OST6 family protein; FUNCTIONS IN: oligosaccharide transmembrane transporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: OST3/OST6 (InterPro:IPR006844); BEST Arabidopsis thaliana protein match is: OST3/OST6 family protein (TAIR:AT1G11560.1); Has 268 Blast hits to 268 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 171; Fungi - 49; Plants - 34; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT1G61790.1 | TTCCACGTGGT | OST3/OST6 family protein; FUNCTIONS IN: oligosaccharide transmembrane transporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: OST3/OST6 (InterPro:IPR006844); BEST Arabidopsis thaliana protein match is: OST3/OST6 family protein (TAIR:AT1G11560.1); Has 268 Blast hits to 268 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 171; Fungi - 49; Plants - 34; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT1G63970 | AT1G63970.1 | TACACGTGGT | Encodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF |
| AT1G63970.2 | TACACGTGGT | Encodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF |
| AT1G63980 | AT1G63980.1 | ACCACGTGTA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink). |
| AT1G63980.2 | ACCACGTGTA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink). |
| AT1G67880 | AT1G67880.1 | AAGCCACGTGGT | glycosyl transferase family 17 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 17 (InterPro:IPR006813); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 17 protein (TAIR:AT1G12990.1); Has 882 Blast hits to 881 proteins in 59 species: Archae - 0; Bacteria - 22; Metazoa - 50; Fungi - 23; Plants - 70; Viruses - 4; Other Eukaryotes - 713 (source: NCBI BLink). |
| AT1G69010 | AT1G69010.1 | ACCACGTG | BES1-interacting Myc-like protein 2 (BIM2); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: dTDP-rhamnose biosynthetic process, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM1; DNA binding / protein binding / transcription factor (TAIR:AT5G08130.3); Has 1614 Blast hits to 1609 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 38; Plants - 1371; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G70710 | AT1G70710.1 | TCCACGTGGT | endo-1,4-beta-glucanase. Involved in cell elongation. |
| AT1G73080 | AT1G73080.1 | ACCACGTGTG | Encodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks. |
| AT1G73170 | AT1G73170.1 | GTCCACGTGGT | ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT1G73170.2 | GTCCACGTGGT | ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT1G74840 | AT1G74840.1 | ACCACGTGGC | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 9 processes; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G19000.2); Has 742 Blast hits to 741 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 677; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT1G76910 | AT1G76910.1 | CACGTGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT1G78510 | AT1G78510.1 | ATGACACGTGGT | Encodes a protein with solanesyl diphosphate synthase activity. |
| AT1G78510.2 | ATGACACGTGGT | Encodes a protein with solanesyl diphosphate synthase activity. |
| AT1G78680 | AT1G78680.1 | ACCACGTGTAC | The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G78700 | AT1G78700.1 | CACGTGGT | brassinosteroid signalling positive regulator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: brassinosteroid signalling positive regulator-related (TAIR:AT4G18890.1); Has 3132 Blast hits to 468 proteins in 84 species: Archae - 0; Bacteria - 18; Metazoa - 271; Fungi - 99; Plants - 190; Viruses - 0; Other Eukaryotes - 2554 (source: NCBI BLink). |
| AT1G79280 | AT1G79280.1 | GCCACGTGGTTAAAAGCCACGCGCT | Encodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development. |
| AT2G17870 | AT2G17870.1 | CACACGTGGT | cold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink). |
| AT2G21430 | AT2G21430.1 | ACCACGTG | cysteine proteinase A494, putative / thiol protease, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: RD19 (RESPONSIVE TO DEHYDRATION 19); cysteine-type endopeptidase/ cysteine-type peptidase (TAIR:AT4G39090.1); Has 6074 Blast hits to 6031 proteins in 584 species: Archae - 31; Bacteria - 96; Metazoa - 2794; Fungi - 4; Plants - 1193; Viruses - 124; Other Eukaryotes - 1832 (source: NCBI BLink). |
| AT2G22190 | AT2G22190.1 | ACCACGTGGCG | catalytic/ trehalose-phosphatase; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: trehalose-6-phosphate phosphatase, putative (TAIR:AT4G39770.1); Has 1471 Blast hits to 1467 proteins in 515 species: Archae - 29; Bacteria - 759; Metazoa - 195; Fungi - 105; Plants - 269; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT2G25890 | AT2G25890.1 | ACCACGTGTCA | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: leaf whorl, petal, flower, carpel; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO1 (OLEOSIN 1) (TAIR:AT4G25140.1); Has 402 Blast hits to 402 proteins in 48 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 398; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G33380 | AT2G33380.1 | ACCACGTGGAT | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers. |
| AT2G33380.2 | ACCACGTGGAT | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers. |
| AT2G35300 | AT2G35300.1 | TACACGTGGT | late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, pollen tube development; LOCATED IN: cellular_component unknown; EXPRESSED IN: flower, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT1G32560.1); Has 110 Blast hits to 110 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G43140 | AT2G43140.1 | ACCACGTG | DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G05805.1); Has 937 Blast hits to 923 proteins in 54 species: Archae - 0; Bacteria - 2; Metazoa - 50; Fungi - 2; Plants - 870; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT2G43240 | AT2G43240.1 | ACCACGTGTCA | nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G43240.2 | ACCACGTGTCA | nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G45680 | AT2G45680.1 | CACGTGGT | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT5G51910.2); Has 1037 Blast hits to 398 proteins in 90 species: Archae - 0; Bacteria - 18; Metazoa - 101; Fungi - 57; Plants - 215; Viruses - 0; Other Eukaryotes - 646 (source: NCBI BLink). |
| AT2G45730 | AT2G45730.1 | ACCACGTGGCAC | eukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT2G45740 | AT2G45740.1 | GTGCCACGTGGT | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT2G45740.2 | GTGCCACGTGGT | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT2G45740.3 | GTGCCACGTGGT | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT3G02230 | AT3G02230.1 | ACCACGTGTCA | reversibly glycosylated polypeptide possibly involved in plant cell wall synthesis |
| AT3G02540 | AT3G02540.1 | ACCACGTGGCAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink). |
| AT3G02540.2 | ACCACGTGGCAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink). |
| AT3G02990 | AT3G02990.1 | CCCACGTGGT | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G04210 | AT3G04210.1 | CACGTGGT | disease resistance protein (TIR-NBS class), putative; FUNCTIONS IN: transmembrane receptor activity, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane, endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT3G04220.1); Has 5085 Blast hits to 4996 proteins in 186 species: Archae - 0; Bacteria - 29; Metazoa - 11; Fungi - 0; Plants - 5040; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G05890 | AT3G05890.1 | ACCACGTGGAT | RARE-COLD-INDUCIBLE 2B (RCI2B); INVOLVED IN: response to cold; LOCATED IN: integral to membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: RCI2A (RARE-COLD-INDUCIBLE 2A) (TAIR:AT3G05880.1); Has 905 Blast hits to 905 proteins in 327 species: Archae - 0; Bacteria - 464; Metazoa - 38; Fungi - 185; Plants - 185; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G07180 | AT3G07180.1 | GCCACGTGGTTAAAAGCCACGCGCT | GPI transamidase component PIG-S-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 9 growth stages; Has 218 Blast hits to 216 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 81; Plants - 21; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G07180.2 | GCCACGTGGTTAAAAGCCACGCGCT | GPI transamidase component PIG-S-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 9 growth stages; Has 218 Blast hits to 216 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 81; Plants - 21; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G08670 | AT3G08670.1 | ACCACGTGGT | unknown protein; INVOLVED IN: response to oxidative stress; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G51540.1); Has 42170 Blast hits to 24550 proteins in 1008 species: Archae - 36; Bacteria - 4261; Metazoa - 16862; Fungi - 10439; Plants - 1834; Viruses - 857; Other Eukaryotes - 7881 (source: NCBI BLink). |
| AT3G09640 | AT3G09640.1 | ATGACACGTGGT | Encodes a cytosolic ascorbate peroxidase APX2. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT3G09640.2 | ATGACACGTGGT | Encodes a cytosolic ascorbate peroxidase APX2. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT3G10340 | AT3G10340.1 | AGACACGTGGT | Phenylalanine ammonia-lyase 4 (PAL4); FUNCTIONS IN: ammonia-lyase activity, ammonia ligase activity, catalytic activity; INVOLVED IN: L-phenylalanine catabolic process, biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Phenylalanine/histidine ammonia-lyase (InterPro:IPR001106), L-Aspartase-like (InterPro:IPR008948), Phenylalanine ammonia-lyase (InterPro:IPR005922); BEST Arabidopsis thaliana protein match is: pal1 (Phe ammonia lyase 1); phenylalanine ammonia-lyase (TAIR:AT2G37040.1); Has 3125 Blast hits to 3120 proteins in 832 species: Archae - 21; Bacteria - 1672; Metazoa - 68; Fungi - 91; Plants - 781; Viruses - 0; Other Eukaryotes - 492 (source: NCBI BLink). |
| AT3G11590 | AT3G11590.1 | ACCACGTGGAC | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22310.1); Has 18950 Blast hits to 12386 proteins in 794 species: Archae - 267; Bacteria - 1381; Metazoa - 9845; Fungi - 1311; Plants - 683; Viruses - 61; Other Eukaryotes - 5402 (source: NCBI BLink). |
| AT3G12390 | AT3G12390.1 | AGCGCGTGGCTTTTAACCACGTGGC | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA3 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 3) (TAIR:AT5G13850.1); Has 5006 Blast hits to 2282 proteins in 284 species: Archae - 50; Bacteria - 639; Metazoa - 1963; Fungi - 710; Plants - 330; Viruses - 56; Other Eukaryotes - 1258 (source: NCBI BLink). |
| AT3G13550 | AT3G13550.1 | CACGTGGT | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
| AT3G13550.2 | CACGTGGT | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
| AT3G14150 | AT3G14150.1 | TGACACGTGGT | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink). |
| AT3G14150.2 | TGACACGTGGT | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink). |
| AT3G14160 | AT3G14160.1 | ACCACGTGTCA | oxidoreductase; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G14140.1); Has 756 Blast hits to 755 proteins in 353 species: Archae - 0; Bacteria - 523; Metazoa - 76; Fungi - 30; Plants - 41; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT3G15790 | AT3G15790.1 | AGACACGTGGT | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G17040 | AT3G17040.1 | ACCACGTGTCAC | It is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis. |
| AT3G21865 | AT3G21865.1 | ACCACGTGTT | Interacts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes. |
| AT3G23230 | AT3G23230.1 | ACCACGTGGAA | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT3G32030 | AT3G32030.1 | ACCACGTGACA | terpene synthase/cyclase family protein; FUNCTIONS IN: lyase activity, magnesium ion binding; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Terpene synthase, metal-binding domain (InterPro:IPR005630), Terpenoid synthase (InterPro:IPR008949), Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Terpene synthase-like (InterPro:IPR001906); BEST Arabidopsis thaliana protein match is: terpene synthase/cyclase family protein (TAIR:AT3G14490.1); Has 1079 Blast hits to 1068 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1074; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G44310 | AT3G44310.1 | ACCACGTGGG | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. |
| AT3G44310.3 | ACCACGTGGG | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. |
| AT3G45310 | AT3G45310.1 | ACCACGTGTA | cysteine proteinase, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: AALP (Arabidopsis aleurain-like protease); cysteine-type peptidase (TAIR:AT5G60360.1); Has 6209 Blast hits to 6164 proteins in 602 species: Archae - 25; Bacteria - 133; Metazoa - 2840; Fungi - 4; Plants - 1213; Viruses - 129; Other Eukaryotes - 1865 (source: NCBI BLink). |
| AT3G45310.2 | ACCACGTGTA | cysteine proteinase, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: AALP (Arabidopsis aleurain-like protease); cysteine-type peptidase (TAIR:AT5G60360.1); Has 6209 Blast hits to 6164 proteins in 602 species: Archae - 25; Bacteria - 133; Metazoa - 2840; Fungi - 4; Plants - 1213; Viruses - 129; Other Eukaryotes - 1865 (source: NCBI BLink). |
| AT3G45680 | AT3G45680.1 | ACCACGTG | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT3G45710.1); Has 2367 Blast hits to 2314 proteins in 371 species: Archae - 0; Bacteria - 529; Metazoa - 412; Fungi - 151; Plants - 1093; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink). |
| AT3G46790 | AT3G46790.1 | ACCACGTG | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-H subfamily) with 9 pentatricopeptide (PPR) repeats. The protein is involved the intergenic processing of chloroplast RNA between rps7 and ndhB, which is essential for ndhB translation. |
| AT3G46920 | AT3G46920.1 | ACCACGTG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G16270.1); Has 83354 Blast hits to 82275 proteins in 3383 species: Archae - 53; Bacteria - 6385; Metazoa - 38452; Fungi - 6355; Plants - 17795; Viruses - 390; Other Eukaryotes - 13924 (source: NCBI BLink). |
| AT3G48260 | AT3G48260.1 | TTGCCACGTGGT | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
| AT3G51510 | AT3G51510.1 | ACCACGTGTCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G54000 | AT3G54000.1 | CACGTGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G54000.2 | CACGTGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G54000.3 | CACGTGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G54440 | AT3G54440.1 | ACGACACCACGTGGCAT | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink). |
| AT3G54440.2 | ACGACACCACGTGGCAT | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink). |
| AT3G54650 | AT3G54650.1 | ACCACGTGACGTG | FBL17; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: embryonic development, generative cell mitosis, seed development, pollen development, ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 1265 Blast hits to 887 proteins in 101 species: Archae - 0; Bacteria - 21; Metazoa - 649; Fungi - 49; Plants - 355; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink). |
| AT3G57470 | AT3G57470.1 | ACCACGTGGGCTAA | peptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 1962 Blast hits to 1906 proteins in 499 species: Archae - 0; Bacteria - 815; Metazoa - 327; Fungi - 126; Plants - 77; Viruses - 0; Other Eukaryotes - 617 (source: NCBI BLink). |
| AT3G57470.2 | ACCACGTGGGCTAA | peptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 1962 Blast hits to 1906 proteins in 499 species: Archae - 0; Bacteria - 815; Metazoa - 327; Fungi - 126; Plants - 77; Viruses - 0; Other Eukaryotes - 617 (source: NCBI BLink). |
| AT3G59210 | AT3G59210.1 | TACACGTGGT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G59230.1); Has 1281 Blast hits to 1248 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1281; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G60020 | AT3G60020.1 | AACACGTGGT | ARABIDOPSIS SKP1-LIKE 5 (ASK5); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: SKP1 (S PHASE KINASE-ASSOCIATED PROTEIN 1); protein binding / ubiquitin-protein ligase (TAIR:AT1G75950.1); Has 1076 Blast hits to 1074 proteins in 197 species: Archae - 0; Bacteria - 0; Metazoa - 480; Fungi - 110; Plants - 355; Viruses - 11; Other Eukaryotes - 120 (source: NCBI BLink). |
| AT3G62140 | AT3G62140.1 | ACCACGTGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; Has 331 Blast hits to 328 proteins in 104 species: Archae - 0; Bacteria - 6; Metazoa - 181; Fungi - 52; Plants - 23; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT4G00630 | AT4G00630.1 | ACCACGTGTA | member of Putative potassium transporter family |
| AT4G02370 | AT4G02370.1 | ACCACGTGTCC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02816.1); Has 336 Blast hits to 333 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 335; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G03030 | AT4G03030.1 | ACCACGTGGG | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G63220.2); Has 1405 Blast hits to 1314 proteins in 98 species: Archae - 0; Bacteria - 31; Metazoa - 962; Fungi - 4; Plants - 358; Viruses - 9; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT4G04870 | AT4G04870.1 | ACCACGTGTAC | Encodes a protein with cardiolipin synthase activity that is localized to the mitochondiria. |
| AT4G05020 | AT4G05020.1 | ATGCCACGTGGT | NAD(P)H dehydrogenase B2 (NDB2); FUNCTIONS IN: disulfide oxidoreductase activity, oxidoreductase activity, FAD binding; LOCATED IN: extrinsic to mitochondrial inner membrane, mitochondrion; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), EF-HAND 1 (InterPro:IPR018247), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327), EF-HAND 2 (InterPro:IPR018249), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: NDB3; NADH dehydrogenase (TAIR:AT4G21490.1); Has 9447 Blast hits to 9170 proteins in 1455 species: Archae - 245; Bacteria - 6823; Metazoa - 105; Fungi - 514; Plants - 280; Viruses - 0; Other Eukaryotes - 1480 (source: NCBI BLink). |
| AT4G05180 | AT4G05180.1 | ACCACGTGTCA | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G10960 | AT4G10960.1 | ACCACGTGGCAT | Encodes a protein with UDP-D-glucose 4-epimerase activity. |
| AT4G18230 | AT4G18230.1 | GTCACGTGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Oligosaccharide biosynthesis protein Alg14 like (InterPro:IPR013969); Has 453 Blast hits to 453 proteins in 176 species: Archae - 4; Bacteria - 199; Metazoa - 76; Fungi - 83; Plants - 28; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT4G19112 | AT4G19112.1 | ACCACGTG | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF25 represents a conserved upstream opening reading frame relative to major ORF AT4G19110.1 |
| AT4G21020 | AT4G21020.1 | ACCACGTGGCTT | late embryogenesis abundant domain-containing protein / LEA domain-containing protein; INVOLVED IN: embryonic development ending in seed dormancy; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT5G44310.2); Has 20047 Blast hits to 9539 proteins in 1087 species: Archae - 69; Bacteria - 4524; Metazoa - 4955; Fungi - 1474; Plants - 1716; Viruses - 139; Other Eukaryotes - 7170 (source: NCBI BLink). |
| AT4G21280 | AT4G21280.1 | ATGACACGTGGT | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G21280.2 | ATGACACGTGGT | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G21570 | AT4G21570.1 | CACGTGGTAAACGCGT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11200.1); Has 590 Blast hits to 587 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 255; Fungi - 125; Plants - 125; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT4G23590 | AT4G23590.1 | ACCACGTG | aminotransferase class I and II family protein; FUNCTIONS IN: 1-aminocyclopropane-1-carboxylate synthase activity, pyridoxal phosphate binding, transferase activity, transferring nitrogenous groups, transaminase activity, catalytic activity; INVOLVED IN: cellular amino acid and derivative metabolic process, biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: 1-aminocyclopropane-1-carboxylate synthase (InterPro:IPR001176), Aminotransferase, class I and II (InterPro:IPR004839), Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Tyrosine/nicotianamine aminotransferase (InterPro:IPR005958), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: CORI3 (CORONATINE INDUCED 1); cystathionine beta-lyase/ transaminase (TAIR:AT4G23600.1); Has 21625 Blast hits to 21622 proteins in 1678 species: Archae - 555; Bacteria - 12393; Metazoa - 596; Fungi - 414; Plants - 837; Viruses - 0; Other Eukaryotes - 6830 (source: NCBI BLink). |
| AT4G23650 | AT4G23650.1 | ACGCCACGTGGT | Encodes calcium dependent protein kinase 3 (CPK3), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK3 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. CPK6 is also a member of the Arabidopsis CDPK family. |
| AT4G24190 | AT4G24190.1 | ACCACGTGGCT | encodes an ortholog of GRP94, an ER-resident HSP90-like protein and is involved in regulation of meristem size and organization. Single and double mutant analyses suggest that SHD may be required for the correct folding and/or complex formation of CLV proteins. Lines carrying recessive mutations in this locus exhibits expanded shoot meristems, disorganized root meristems, and defective pollen tube elongation. Transcript is detected in all tissues examined and is not induced by heat. Endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. |
| AT4G24190.2 | ACCACGTGGCT | encodes an ortholog of GRP94, an ER-resident HSP90-like protein and is involved in regulation of meristem size and organization. Single and double mutant analyses suggest that SHD may be required for the correct folding and/or complex formation of CLV proteins. Lines carrying recessive mutations in this locus exhibits expanded shoot meristems, disorganized root meristems, and defective pollen tube elongation. Transcript is detected in all tissues examined and is not induced by heat. Endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. |
| AT4G25580 | AT4G25580.1 | TACGTGGCATGACACGTGGT | stress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT4G25690 | AT4G25690.1 | ACCACGTGGCTT | unknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25670.1); Has 45 Blast hits to 36 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25690.2 | ACCACGTGGCTT | unknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25670.1); Has 45 Blast hits to 36 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25692 | AT4G25692.1 | ACCACGTGGCTT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF13 represents a conserved upstream opening reading frame relative to major ORF AT4G25690.1 |
| AT4G33330 | AT4G33330.1 | CACGTGGT | PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 3 (PGSIP3); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: sperm cell, inflorescence meristem, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: PGSIP1 (PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 1); transferase, transferring glycosyl groups (TAIR:AT3G18660.2). |
| AT4G33330.2 | CACGTGGT | PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 3 (PGSIP3); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: sperm cell, inflorescence meristem, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: PGSIP1 (PLANT GLYCOGENIN-LIKE STARCH INITIATION PROTEIN 1); transferase, transferring glycosyl groups (TAIR:AT3G18660.2). |
| AT4G34380 | AT4G34380.1 | ACCACGTGTGA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G18950.1); Has 22712 Blast hits to 12420 proteins in 443 species: Archae - 16; Bacteria - 3157; Metazoa - 9533; Fungi - 4921; Plants - 1930; Viruses - 0; Other Eukaryotes - 3155 (source: NCBI BLink). |
| AT4G35580 | AT4G35580.1 | CACGTGGT | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G35580.2 | CACGTGGT | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G36700 | AT4G36700.1 | CCATTAAGCCACGTGGT | cupin family protein; FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: seed; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: cupin family protein (TAIR:AT2G18540.1); Has 24566 Blast hits to 7767 proteins in 626 species: Archae - 33; Bacteria - 1512; Metazoa - 12314; Fungi - 1899; Plants - 799; Viruses - 447; Other Eukaryotes - 7562 (source: NCBI BLink). |
| AT4G39090 | AT4G39090.1 | AACACGTGGT | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R–mediated resistance response. |
| AT4G39770 | AT4G39770.1 | ACCACGTGGCGG | trehalose-6-phosphate phosphatase, putative; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: catalytic/ trehalose-phosphatase (TAIR:AT2G22190.1); Has 1503 Blast hits to 1499 proteins in 531 species: Archae - 29; Bacteria - 768; Metazoa - 195; Fungi - 108; Plants - 274; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). |
| AT5G02100 | AT5G02100.1 | ATATTGGGCCTCACGTGGT | Encodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent. |
| AT5G02770 | AT5G02770.1 | GTCACGTGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 367 Blast hits to 255 proteins in 95 species: Archae - 0; Bacteria - 48; Metazoa - 197; Fungi - 19; Plants - 22; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink). |
| AT5G04120 | AT5G04120.1 | ATGACACGTGGT | phosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078), Phosphoglycerate/bisphosphoglycerate mutase (InterPro:IPR001345); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT3G50520.1); Has 8851 Blast hits to 8694 proteins in 1334 species: Archae - 50; Bacteria - 5552; Metazoa - 723; Fungi - 290; Plants - 143; Viruses - 0; Other Eukaryotes - 2093 (source: NCBI BLink). |
| AT5G08580 | AT5G08580.1 | ACCACGTGGA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT4G27790.1); Has 1683 Blast hits to 1652 proteins in 245 species: Archae - 0; Bacteria - 5; Metazoa - 858; Fungi - 86; Plants - 540; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink). |
| AT5G08590 | AT5G08590.1 | TCCACGTGGT | Encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Similar to the calcium/calmodulin-dependent protein kinase subfamily and the SNF1 kinase subfamily. |
| AT5G10280 | AT5G10280.1 | CACGTGGT | Encodes a putative transcription factor (MYB92). |
| AT5G10750 | AT5G10750.1 | AACACGTGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24990.1); Has 176 Blast hits to 175 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G13840 | AT5G13840.1 | GCCACGTGGTTAAAAGCCACGCGCT | FIZZY-RELATED 3 (FZR3); FUNCTIONS IN: signal transducer activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, heterotrimeric G-protein complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: FZR2 (FIZZY-RELATED 2); signal transducer (TAIR:AT4G22910.1); Has 36052 Blast hits to 18440 proteins in 539 species: Archae - 52; Bacteria - 4990; Metazoa - 16346; Fungi - 7057; Plants - 2837; Viruses - 0; Other Eukaryotes - 4770 (source: NCBI BLink). |
| AT5G13850 | AT5G13850.1 | AGCGCGTGGCTTTTAACCACGTGGC | NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 3 (NACA3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT3G12390.1); Has 794 Blast hits to 784 proteins in 197 species: Archae - 0; Bacteria - 0; Metazoa - 341; Fungi - 176; Plants - 104; Viruses - 14; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G15960 | AT5G15960.1 | ATCCACGTGGT | cold and ABA inducible protein kin1, possibly functions as an anti-freeze protein. Transcript level of this gene is induced by cold, ABA, dehydration and osmoticum (mannitol). However, protein activity of GUS fused to the promoter of this gene is inhibited by cold treatment, suggesting an inhibition of the protein by increased transcript level. |
| AT5G15970 | AT5G15970.1 | ATCCACGTGGT | Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance. |
| AT5G19875 | AT5G19875.1 | ATCCACGTGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31940.1); Has 63 Blast hits to 63 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G20190 | AT5G20190.1 | ACCACGTG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G80130.1); Has 303 Blast hits to 195 proteins in 27 species: Archae - 0; Bacteria - 78; Metazoa - 7; Fungi - 10; Plants - 171; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT5G27520 | AT5G27520.1 | ACCACGTGGC | encodes a peroxisomal adenine nucleotide transporter, involved in fatty acid beta-oxidation during early stage of postgerminative growth. |
| AT5G38470 | AT5G38470.1 | ACCACGTG | DNA repair protein RAD23, putative; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: response to cold, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), Ubiquitin (InterPro:IPR000626), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: RAD23-3 (PUTATIVE DNA REPAIR PROTEIN RAD23-3); damaged DNA binding (TAIR:AT3G02540.1); Has 8363 Blast hits to 4927 proteins in 738 species: Archae - 4; Bacteria - 553; Metazoa - 3443; Fungi - 1049; Plants - 1653; Viruses - 160; Other Eukaryotes - 1501 (source: NCBI BLink). |
| AT5G38470.2 | ACCACGTG | DNA repair protein RAD23, putative; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: response to cold, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), Ubiquitin (InterPro:IPR000626), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: RAD23-3 (PUTATIVE DNA REPAIR PROTEIN RAD23-3); damaged DNA binding (TAIR:AT3G02540.1); Has 8363 Blast hits to 4927 proteins in 738 species: Archae - 4; Bacteria - 553; Metazoa - 3443; Fungi - 1049; Plants - 1653; Viruses - 160; Other Eukaryotes - 1501 (source: NCBI BLink). |
| AT5G42810 | AT5G42810.1 | AACACGTGGT | Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. |
| AT5G45410 | AT5G45410.1 | ACCACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G45410.2 | ACCACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G45410.3 | ACCACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25030.2); Has 68 Blast hits to 68 proteins in 16 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G48470 | AT5G48470.1 | AGCGCGTGGCTTTTAACCACGTGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G50920 | AT5G50920.1 | TCGGTTTACCACGTG | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery. |
| AT5G52820 | AT5G52820.1 | AGCGCGTGGCTTTTAACCACGTGGC | WD-40 repeat family protein / notchless protein, putative; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), G-protein, beta subunit (InterPro:IPR001632); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 92804 Blast hits to 28593 proteins in 717 species: Archae - 60; Bacteria - 7422; Metazoa - 44321; Fungi - 18160; Plants - 9806; Viruses - 6; Other Eukaryotes - 13029 (source: NCBI BLink). |
| AT5G54930 | AT5G54930.1 | AGACACGTGGT | AT hook motif-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif-containing protein (TAIR:AT5G52890.1); Has 26 Blast hits to 26 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G54930.2 | AGACACGTGGT | AT hook motif-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif-containing protein (TAIR:AT5G52890.1); Has 26 Blast hits to 26 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G54960 | AT5G54960.1 | GTCACGTGGT | pyruvate decarboxylase-2 |
| AT5G57110 | AT5G57110.1 | CACGTGGT | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
| AT5G57110.2 | CACGTGGT | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
| AT5G59840 | AT5G59840.1 | ACCACGTGTCT | Ras-related GTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB8; GTP binding (TAIR:AT3G53610.3); Has 23810 Blast hits to 23756 proteins in 654 species: Archae - 17; Bacteria - 124; Metazoa - 13243; Fungi - 2913; Plants - 2226; Viruses - 19; Other Eukaryotes - 5268 (source: NCBI BLink). |
| AT5G60360 | AT5G60360.1 | ACCACGTGTCC | Encodes a senescence-associated thiol protease. |
| AT5G60360.2 | ACCACGTGTCC | Encodes a senescence-associated thiol protease. |
| AT5G60360.3 | ACCACGTGTCC | Encodes a senescence-associated thiol protease. |
| ATCG00330 | ATCG00330.1 | CACGTGGT | 30S chloroplast ribosomal protein S14 |