| Locus | Gene model | Sequence | Description |
| AT1G02930 | AT1G02930.1 | ATCCACGTGGAC | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G02950 | AT1G02950.1 | ACGTGGAT | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G02950.2 | ACGTGGAT | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G02950.3 | ACGTGGAT | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G02950.4 | ACGTGGAT | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G03905 | AT1G03905.1 | ATGACGTGGAT | ABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink). |
| AT1G04250 | AT1G04250.1 | ATCCACGTGTCT | Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. |
| AT1G06890 | AT1G06890.1 | ACGTGGAT | transporter-related; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30460.2); Has 1730 Blast hits to 1725 proteins in 204 species: Archae - 2; Bacteria - 41; Metazoa - 571; Fungi - 289; Plants - 633; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink). |
| AT1G06890.2 | ACGTGGAT | transporter-related; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30460.2); Has 1730 Blast hits to 1725 proteins in 204 species: Archae - 2; Bacteria - 41; Metazoa - 571; Fungi - 289; Plants - 633; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink). |
| AT1G07150 | AT1G07150.1 | ATCCACGTGGG | member of MEKK subfamily |
| AT1G07820 | AT1G07820.1 | ATCCACGTCATC | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT1G07820.2 | ATCCACGTCATC | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT1G07830 | AT1G07830.1 | GATGACGTGGAT | ribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome, mitochondrial ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L47, mitochondrial (InterPro:IPR010729), Ribosomal protein L29 (InterPro:IPR001854); Has 236 Blast hits to 236 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 80; Plants - 22; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G09795 | AT1G09795.1 | ATCCACGTGTAC | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
| AT1G10560 | AT1G10560.1 | ACCACGTGGAT | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G11480 | AT1G11480.1 | ATCCACGTGTG | eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT1G11480.2 | ATCCACGTGTG | eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT1G12370 | AT1G12370.1 | ATCCACGTAG | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
| AT1G12370.2 | ATCCACGTAG | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
| AT1G13080 | AT1G13080.1 | AACACGTGGAT | cytochrome P450 monooxygenase |
| AT1G13080.2 | AACACGTGGAT | cytochrome P450 monooxygenase |
| AT1G14360 | AT1G14360.1 | ATCCACGT | UDP-GALACTOSE TRANSPORTER 3 (UTR3); FUNCTIONS IN: pyrimidine nucleotide sugar transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: UTR1 (UDP-GALACTOSE TRANSPORTER 1); UDP-galactose transmembrane transporter/ UDP-glucose transmembrane transporter/ pyrimidine nucleotide sugar transmembrane transporter (TAIR:AT2G02810.1); Has 750 Blast hits to 744 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 423; Fungi - 103; Plants - 108; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). |
| AT1G15140 | AT1G15140.1 | ATCCACGTGGCAA | oxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink). |
| AT1G15140.2 | ATCCACGTGGCAA | oxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink). |
| AT1G15140.3 | ATCCACGTGGCAA | oxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink). |
| AT1G15880 | AT1G15880.1 | ATCCACGT | Golgi SNARE 11 protein (GOS11) |
| AT1G15890 | AT1G15890.1 | ACGTGGAT | disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation, defense response, apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G43730.1); Has 12716 Blast hits to 11782 proteins in 513 species: Archae - 12; Bacteria - 543; Metazoa - 2689; Fungi - 133; Plants - 9121; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink). |
| AT1G15930 | AT1G15930.1 | ATCCACGT | 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| AT1G15930.2 | ATCCACGT | 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| AT1G16630 | AT1G16630.1 | ATCCACGT | unknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16270.1); Has 11932 Blast hits to 5221 proteins in 448 species: Archae - 45; Bacteria - 656; Metazoa - 5756; Fungi - 729; Plants - 423; Viruses - 460; Other Eukaryotes - 3863 (source: NCBI BLink). |
| AT1G17760 | AT1G17760.1 | ATCCACGTGGAC | Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. |
| AT1G17810 | AT1G17810.1 | ATCCACGTGTT | beta-tonoplast intrinsic protein (beta-TIP) mRNA, complete |
| AT1G18040 | AT1G18040.1 | AACACGTGGAT | CYCLIN-DEPENDENT KINASE D1;3 (CDKD1;3); FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CDKD1;1 (CYCLIN-DEPENDENT KINASE D1;1); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT1G73690.1); Has 86988 Blast hits to 85857 proteins in 2791 species: Archae - 31; Bacteria - 7397; Metazoa - 37676; Fungi - 8140; Plants - 16874; Viruses - 362; Other Eukaryotes - 16508 (source: NCBI BLink). |
| AT1G21440 | AT1G21440.1 | ATGACACGTGGAT | mutase family protein; FUNCTIONS IN: isocitrate lyase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Isocitrate lyase and phosphorylmutase, conserved site (InterPro:IPR018523), Isocitrate lyase and phosphorylmutase (InterPro:IPR000918); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 6447 Blast hits to 6447 proteins in 860 species: Archae - 75; Bacteria - 2907; Metazoa - 29; Fungi - 322; Plants - 109; Viruses - 0; Other Eukaryotes - 3005 (source: NCBI BLink). |
| AT1G21670 | AT1G21670.1 | ATCCACGTCATC | INVOLVED IN: proteolysis; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Peptidase S9B, dipeptidylpeptidase IV N-terminal (InterPro:IPR002469), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21680.1); Has 6126 Blast hits to 3685 proteins in 788 species: Archae - 47; Bacteria - 3362; Metazoa - 27; Fungi - 47; Plants - 58; Viruses - 0; Other Eukaryotes - 2585 (source: NCBI BLink). |
| AT1G23310 | AT1G23310.1 | AAAACGACGGACACGTGGAT | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway. |
| AT1G23310.2 | AAAACGACGGACACGTGGAT | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway. |
| AT1G25520 | AT1G25520.1 | ATCCACGTGGT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0016 (InterPro:IPR001727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68650.1); Has 1239 Blast hits to 1181 proteins in 440 species: Archae - 13; Bacteria - 667; Metazoa - 131; Fungi - 99; Plants - 104; Viruses - 0; Other Eukaryotes - 225 (source: NCBI BLink). |
| AT1G31812 | AT1G31812.1 | ATCCACGT | Acyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases. |
| AT1G32640 | AT1G32640.1 | ATCCACGT | Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif. Its transcription is induced by dehydration stress and ABA treatment. Negative regulator of blue light–mediated photomorphogenic growth and blue and far-red-light–regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. |
| AT1G45474 | AT1G45474.1 | ACGTGGAT | Encodes a component of the light harvesting complex of photosystem I. |
| AT1G45474.2 | ACGTGGAT | Encodes a component of the light harvesting complex of photosystem I. |
| AT1G50575 | AT1G50575.1 | ATCCACGTGTA | lysine decarboxylase family protein; FUNCTIONS IN: carboxy-lyase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP00730 (InterPro:IPR005269); Has 2104 Blast hits to 2104 proteins in 559 species: Archae - 2; Bacteria - 1299; Metazoa - 4; Fungi - 31; Plants - 102; Viruses - 0; Other Eukaryotes - 666 (source: NCBI BLink). |
| AT1G52220 | AT1G52220.1 | ATGCCACGTGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G52220.2 | ATGCCACGTGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G52220.3 | ATGCCACGTGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G52230 | AT1G52230.1 | ATCCACGTGGCAT | PHOTOSYSTEM I SUBUNIT H2 (PSAH2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem I reaction centre subunit VI (InterPro:IPR004928); BEST Arabidopsis thaliana protein match is: PSAH-1 (photosystem I subunit H-1) (TAIR:AT3G16140.1); Has 72 Blast hits to 72 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G52320 | AT1G52320.2 | ATCCACGTCATTACCCCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF630 (InterPro:IPR006868), Protein of unknown function DUF632 (InterPro:IPR006867); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25590.1); Has 8111 Blast hits to 6764 proteins in 511 species: Archae - 9; Bacteria - 475; Metazoa - 3444; Fungi - 1217; Plants - 1004; Viruses - 207; Other Eukaryotes - 1755 (source: NCBI BLink). |
| AT1G52410 | AT1G52410.1 | ATCCACGT | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers. |
| AT1G52410.2 | ATCCACGT | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers. |
| AT1G55810 | AT1G55810.1 | CTGACGTGGAT | uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink). |
| AT1G55810.2 | CTGACGTGGAT | uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink). |
| AT1G55810.3 | CTGACGTGGAT | uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink). |
| AT1G56100 | AT1G56100.1 | ACGTGGAT | pectinesterase inhibitor domain-containing protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, sepal; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: enzyme inhibitor/ pectinesterase (TAIR:AT4G00872.1); Has 669 Blast hits to 508 proteins in 102 species: Archae - 2; Bacteria - 18; Metazoa - 226; Fungi - 61; Plants - 51; Viruses - 2; Other Eukaryotes - 309 (source: NCBI BLink). |
| AT1G56100.2 | ACGTGGAT | pectinesterase inhibitor domain-containing protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, sepal; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: enzyme inhibitor/ pectinesterase (TAIR:AT4G00872.1); Has 669 Blast hits to 508 proteins in 102 species: Archae - 2; Bacteria - 18; Metazoa - 226; Fungi - 61; Plants - 51; Viruses - 2; Other Eukaryotes - 309 (source: NCBI BLink). |
| AT1G56100.3 | ACGTGGAT | pectinesterase inhibitor domain-containing protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, sepal; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: enzyme inhibitor/ pectinesterase (TAIR:AT4G00872.1); Has 669 Blast hits to 508 proteins in 102 species: Archae - 2; Bacteria - 18; Metazoa - 226; Fungi - 61; Plants - 51; Viruses - 2; Other Eukaryotes - 309 (source: NCBI BLink). |
| AT1G56220 | AT1G56220.1 | ATCCACGTGGCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G56220.2 | ATCCACGTGGCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G56220.3 | ATCCACGTGGCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G56220.4 | ATCCACGTGGCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G56340 | AT1G56340.1 | ACGTGGAT | Encodes calreticulin CRT1. |
| AT1G56340.2 | ACGTGGAT | Encodes calreticulin CRT1. |
| AT1G57540 | AT1G57540.1 | AGACACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G57540.2 | AGACACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G57540.3 | AGACACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G61780 | AT1G61780.1 | ACCACGTGGAT | postsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G61790 | AT1G61790.1 | ATCCACGTGGT | OST3/OST6 family protein; FUNCTIONS IN: oligosaccharide transmembrane transporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: OST3/OST6 (InterPro:IPR006844); BEST Arabidopsis thaliana protein match is: OST3/OST6 family protein (TAIR:AT1G11560.1); Has 268 Blast hits to 268 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 171; Fungi - 49; Plants - 34; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT1G72110 | AT1G72110.1 | ATCCACGT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1298 (InterPro:IPR009721), Uncharacterised protein family UPF0089 (InterPro:IPR004255); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38995.1); Has 589 Blast hits to 582 proteins in 94 species: Archae - 2; Bacteria - 456; Metazoa - 7; Fungi - 2; Plants - 109; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G72320 | AT1G72320.1 | ATCCACGTCA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.2 | ATCCACGTCA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.3 | ATCCACGTCA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G73120 | AT1G73120.1 | ACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; EXPRESSED IN: root, cultured cell; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G74020 | AT1G74020.1 | ACGTGGAT | Encodes AtSS-2 strictosidine synthase. |
| AT1G75760 | AT1G75760.1 | ATCCACGTGTCAC | ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT1G19970.1); Has 627 Blast hits to 627 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 264; Fungi - 115; Plants - 120; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT1G76940 | AT1G76940.1 | ATCCACGT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT1G21320.2); Has 450 Blast hits to 448 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 247; Fungi - 119; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT1G78660 | AT1G78660.1 | ATCCACGT | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G78660.2 | ATCCACGT | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G78660.3 | ATCCACGT | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G79440 | AT1G79440.1 | CGGTTAAACTGCCACGTGGAT | Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004). |
| AT1G79650 | AT1G79650.1 | TGTCACGTGGAT | putative DNA repair protein RAD23 |
| AT1G79650.2 | TGTCACGTGGAT | putative DNA repair protein RAD23 |
| AT1G79650.3 | TGTCACGTGGAT | putative DNA repair protein RAD23 |
| AT1G80030 | AT1G80030.1 | ATCCACGTG | DNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT3G17830.1); Has 20943 Blast hits to 20164 proteins in 2101 species: Archae - 124; Bacteria - 6520; Metazoa - 3750; Fungi - 1621; Plants - 1440; Viruses - 18; Other Eukaryotes - 7470 (source: NCBI BLink). |
| AT1G80030.2 | ATCCACGTG | DNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT3G17830.1); Has 20943 Blast hits to 20164 proteins in 2101 species: Archae - 124; Bacteria - 6520; Metazoa - 3750; Fungi - 1621; Plants - 1440; Viruses - 18; Other Eukaryotes - 7470 (source: NCBI BLink). |
| AT1G80030.3 | ATCCACGTG | DNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT3G17830.1); Has 20943 Blast hits to 20164 proteins in 2101 species: Archae - 124; Bacteria - 6520; Metazoa - 3750; Fungi - 1621; Plants - 1440; Viruses - 18; Other Eukaryotes - 7470 (source: NCBI BLink). |
| AT2G01490 | AT2G01490.1 | ATCCACGTGGAA | phytanoyl-CoA dioxygenase (PhyH) family protein; FUNCTIONS IN: phytanoyl-CoA dioxygenase activity; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phytanoyl-CoA dioxygenase (InterPro:IPR008775); Has 2632 Blast hits to 2624 proteins in 223 species: Archae - 0; Bacteria - 300; Metazoa - 320; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 1913 (source: NCBI BLink). |
| AT2G03820 | AT2G03820.1 | ATGACACGTGGAT | nonsense-mediated mRNA decay NMD3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: nuclear-transcribed mRNA catabolic process, nonsense-mediated decay; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NMD3 (InterPro:IPR007064); Has 355 Blast hits to 345 proteins in 156 species: Archae - 8; Bacteria - 0; Metazoa - 129; Fungi - 90; Plants - 42; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G04350 | AT2G04350.1 | ATCCACGTGTCC | long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink). |
| AT2G04350.2 | ATCCACGTGTCC | long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink). |
| AT2G04850 | AT2G04850.1 | ATCCACGTCAT | auxin-responsive protein-related; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive family protein (TAIR:AT3G25290.2); Has 374 Blast hits to 374 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 72; Fungi - 47; Plants - 246; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT2G17840 | AT2G17840.1 | ATCCACGT | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
| AT2G21330 | AT2G21330.1 | ATCCACGTGGCAA | fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink). |
| AT2G21330.2 | ATCCACGTGGCAA | fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink). |
| AT2G21330.3 | ATCCACGTGGCAA | fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink). |
| AT2G27600 | AT2G27600.1 | CTACGTGGAT | Encodes a SKD1 (Suppressor of K+ Transport Growth Defect1) homolog. Localized to the cytoplasm and to multivesicular endosomes. Involved in multivesicular endosome function. |
| AT2G30290 | AT2G30290.1 | ATCCACGT | vacuolar sorting receptor, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: protein targeting to vacuole; LOCATED IN: integral to plasma membrane, Golgi transport complex; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), EGF-type aspartate/asparagine hydroxylation conserved site (InterPro:IPR000152), EGF-like calcium-binding, conserved site (InterPro:IPR018097), EGF-like, type 3 (InterPro:IPR000742), Growth factor, receptor (InterPro:IPR009030), EGF-like region, conserved site (InterPro:IPR013032); BEST Arabidopsis thaliana protein match is: VSR1 (VACUOLAR SORTING RECEPTOR HOMOLOG 1); amino-terminal vacuolar sorting propeptide binding (TAIR:AT3G52850.1); Has 8236 Blast hits to 4061 proteins in 169 species: Archae - 2; Bacteria - 64; Metazoa - 7534; Fungi - 0; Plants - 232; Viruses - 0; Other Eukaryotes - 404 (source: NCBI BLink). |
| AT2G31670 | AT2G31670.1 | ATCCACGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisome, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Stress responsive alpha-beta barrel (InterPro:IPR013097), Dimeric alpha-beta barrel (InterPro:IPR011008); BEST Arabidopsis thaliana protein match is: DABB1 (DIMERIC A/B BARREL DOMAINS-PROTEIN 1) (TAIR:AT1G51360.1); Has 138 Blast hits to 135 proteins in 38 species: Archae - 0; Bacteria - 51; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G32510 | AT2G32510.1 | ATCCACGTGTG | member of MEKK subfamily |
| AT2G33250 | AT2G33250.1 | ATCCACGTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G33380 | AT2G33380.1 | ACCACGTGGAT | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers. |
| AT2G33380.2 | ACCACGTGGAT | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers. |
| AT2G34260 | AT2G34260.1 | ACGTGGAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD repeat protein 55 (InterPro:IPR017422); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 16318 Blast hits to 9709 proteins in 465 species: Archae - 44; Bacteria - 3325; Metazoa - 6190; Fungi - 3093; Plants - 1110; Viruses - 0; Other Eukaryotes - 2556 (source: NCBI BLink). |
| AT2G34260.2 | ACGTGGAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD repeat protein 55 (InterPro:IPR017422); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 16318 Blast hits to 9709 proteins in 465 species: Archae - 44; Bacteria - 3325; Metazoa - 6190; Fungi - 3093; Plants - 1110; Viruses - 0; Other Eukaryotes - 2556 (source: NCBI BLink). |
| AT2G36490 | AT2G36490.1 | ACGTGGAT | A repressor of transcriptional gene silencing. Functions by demethylating the target promoter DNA. Interacts physically with RPA2/ROR1. In the ros1 mutants, an increase in methylation is observed in a number of gene promoters. Among the loci affected by ros1, a few (RD29A and At1g76930) are affected in cytosine methylation in all sequence contexts (CpG, CpNpG or CpNpN), although many others are affected primarily in non-CpG contexts. |
| AT2G40490 | AT2G40490.1 | ATCCACGTCAGC | HEME2; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME1; uroporphyrinogen decarboxylase (TAIR:AT3G14930.2); Has 5539 Blast hits to 5539 proteins in 1187 species: Archae - 101; Bacteria - 2315; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2763 (source: NCBI BLink). |
| AT2G42490 | AT2G42490.1 | ATCCACGTCGTT | copper amine oxidase, putative; FUNCTIONS IN: quinone binding, amine oxidase activity, copper ion binding; INVOLVED IN: cellular amine metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Copper amine oxidase, N-terminal region (InterPro:IPR016182), Copper amine oxidase, N2-terminal (InterPro:IPR015800), Copper amine oxidase, N2/N3-terminal (InterPro:IPR015801), Copper amine oxidase, N3-terminal (InterPro:IPR015802), Copper amine oxidase (InterPro:IPR000269), Copper amine oxidase, C-terminal (InterPro:IPR015798); BEST Arabidopsis thaliana protein match is: copper amine oxidase, putative (TAIR:AT3G43670.1); Has 1087 Blast hits to 1084 proteins in 164 species: Archae - 4; Bacteria - 240; Metazoa - 211; Fungi - 291; Plants - 130; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G42790 | AT2G42790.1 | TACACGTGGAT | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT2G45730 | AT2G45730.1 | TTCCACGTGGAT | eukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT2G45740 | AT2G45740.1 | ATCCACGTGGAA | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT2G45740.2 | ATCCACGTGGAA | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT2G45740.3 | ATCCACGTGGAA | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT3G01060 | AT3G01060.1 | ATCCACGTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT3G01060.2 | ATCCACGTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT3G01060.3 | ATCCACGTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT3G02380 | AT3G02380.1 | ATCCACGTCAGC | homologous to the flowering-time gene CONSTANS (CO) encoding zinc-finger proteins |
| AT3G02480 | AT3G02480.1 | AACACGTGGAT | ABA-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38760.1); Has 144 Blast hits to 124 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G02580 | AT3G02580.1 | GTGACGTGGAT | Brassinosteroid biosynthetic enzyme, catalyzes delta7 sterol C-5 desaturation step. Mutant has dwarf phenotype. |
| AT3G03150 | AT3G03150.1 | AGACACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03160 | AT3G03160.1 | ATCCACGTGTCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G04740 | AT3G04740.1 | ACGTGGAT | encodes a protein with similarities to subunits of the Mediator complex, required for RNA polymerase II recruitment at target promoters in response to specific activators. Lines carrying loss of function mutations in the gene have reduced cell numbers in aerial organs. On the other hand, lines overexpressing the gene have increased number of small cells in clusters, suggesting cell division is more unsynchronized in the overexpressors. |
| AT3G05170 | AT3G05170.1 | ACGTGGAT | phosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078), Phosphoglycerate/bisphosphoglycerate mutase (InterPro:IPR001345); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT1G08940.1); Has 587 Blast hits to 577 proteins in 200 species: Archae - 2; Bacteria - 258; Metazoa - 24; Fungi - 136; Plants - 42; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). |
| AT3G05380 | AT3G05380.1 | ATCCACGTGGAC | DNA binding / nucleic acid binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding, nucleic acid binding; CONTAINS InterPro DOMAIN/s: Myb, DNA-binding (InterPro:IPR014778), Tudor (InterPro:IPR002999), DIRP (InterPro:IPR010561); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT5G27610.1); Has 3053 Blast hits to 2257 proteins in 222 species: Archae - 0; Bacteria - 292; Metazoa - 1632; Fungi - 288; Plants - 143; Viruses - 7; Other Eukaryotes - 691 (source: NCBI BLink). |
| AT3G05380.2 | ATCCACGTGGAC | DNA binding / nucleic acid binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding, nucleic acid binding; CONTAINS InterPro DOMAIN/s: Myb, DNA-binding (InterPro:IPR014778), Tudor (InterPro:IPR002999), DIRP (InterPro:IPR010561); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT5G27610.1); Has 3053 Blast hits to 2257 proteins in 222 species: Archae - 0; Bacteria - 292; Metazoa - 1632; Fungi - 288; Plants - 143; Viruses - 7; Other Eukaryotes - 691 (source: NCBI BLink). |
| AT3G05750 | AT3G05750.2 | CTACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G26910.1); Has 1939 Blast hits to 1263 proteins in 186 species: Archae - 4; Bacteria - 493; Metazoa - 564; Fungi - 152; Plants - 116; Viruses - 0; Other Eukaryotes - 610 (source: NCBI BLink). |
| AT3G05890 | AT3G05890.1 | ACCACGTGGAT | RARE-COLD-INDUCIBLE 2B (RCI2B); INVOLVED IN: response to cold; LOCATED IN: integral to membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: RCI2A (RARE-COLD-INDUCIBLE 2A) (TAIR:AT3G05880.1); Has 905 Blast hits to 905 proteins in 327 species: Archae - 0; Bacteria - 464; Metazoa - 38; Fungi - 185; Plants - 185; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G07730 | AT3G07730.1 | ATGACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01170.1); Has 1172 Blast hits to 1023 proteins in 165 species: Archae - 3; Bacteria - 80; Metazoa - 419; Fungi - 100; Plants - 69; Viruses - 2; Other Eukaryotes - 499 (source: NCBI BLink). |
| AT3G12510 | AT3G12510.1 | GTACACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte, flower, pollen tube, seed; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, E expanded cotyledon stage; Has 36 Blast hits to 36 proteins in 5 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G14180 | AT3G14180.1 | ATCCACGTCAC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT3G15500 | AT3G15500.1 | ATCCACGTGTCAT | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. |
| AT3G16700 | AT3G16700.1 | ATCCACGTCAT | fumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae - 132; Bacteria - 3815; Metazoa - 259; Fungi - 271; Plants - 44; Viruses - 0; Other Eukaryotes - 3026 (source: NCBI BLink). |
| AT3G16700.2 | ATCCACGTCAT | fumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae - 132; Bacteria - 3815; Metazoa - 259; Fungi - 271; Plants - 44; Viruses - 0; Other Eukaryotes - 3026 (source: NCBI BLink). |
| AT3G19540 | AT3G19540.1 | ATCCACGTGTCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G49840.1); Has 153 Blast hits to 150 proteins in 31 species: Archae - 0; Bacteria - 3; Metazoa - 14; Fungi - 12; Plants - 117; Viruses - 5; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G19840 | AT3G19840.1 | ATCCACGTGCG | FF domain-containing protein / WW domain-containing protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FF (InterPro:IPR002713), WW/Rsp5/WWP (InterPro:IPR001202); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G44910.2); Has 6807 Blast hits to 5122 proteins in 338 species: Archae - 15; Bacteria - 265; Metazoa - 3466; Fungi - 821; Plants - 326; Viruses - 6; Other Eukaryotes - 1908 (source: NCBI BLink). |
| AT3G20015 | AT3G20015.1 | ATCCACGT | aspartic-type endopeptidase; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT3G18490.1); Has 2556 Blast hits to 2540 proteins in 243 species: Archae - 0; Bacteria - 0; Metazoa - 850; Fungi - 401; Plants - 1179; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink). |
| AT3G21890 | AT3G21890.1 | ATCCACGTGTCC | zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: response to UV-B, regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G15248.1); Has 963 Blast hits to 745 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 953; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT3G22110 | AT3G22110.1 | ATCCACGT | Encodes the alpha-3 subunit of 20s proteasome. |
| AT3G27210 | AT3G27210.1 | CTACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40860.1); Has 132 Blast hits to 70 proteins in 18 species: Archae - 0; Bacteria - 6; Metazoa - 65; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT3G52850 | AT3G52850.1 | ATCCACGT | Encodes the Vacuolar Sorting Receptor-1 (VSR-1)/Epidermal Growth Factor Receptor-like protein1(VSR-1/ATELP1). Binds vacuolar targeting signals. Involved in sorting seed storage proteins into vacuoles. |
| AT3G54420 | AT3G54420.1 | ATCCACGT | encodes an EP3 chitinase that is expressed during somatic embryogenesis in 'nursing' cells surrounding the embryos but not in embryos themselves. The gene is also expressed in mature pollen and growing pollen tubes until they enter the receptive synergid, but not in endosperm and integuments as in carrot. Post-embryonically, expression is found in hydathodes, stipules, root epidermis and emerging root hairs. |
| AT3G54760 | AT3G54760.1 | AGCCACGTGGAT | dentin sialophosphoprotein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: guard cell, cultured cell; BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT5G02950.1); Has 22290 Blast hits to 12629 proteins in 895 species: Archae - 109; Bacteria - 4489; Metazoa - 8055; Fungi - 2114; Plants - 799; Viruses - 230; Other Eukaryotes - 6494 (source: NCBI BLink). |
| AT3G54960 | AT3G54960.1 | ATCCACGTGAC | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
| AT3G54960.2 | ATCCACGTGAC | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
| AT3G61260 | AT3G61260.1 | CACGTGGAT | DNA-binding family protein / remorin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G45820.1); Has 7363 Blast hits to 4653 proteins in 692 species: Archae - 12; Bacteria - 1846; Metazoa - 1409; Fungi - 602; Plants - 495; Viruses - 172; Other Eukaryotes - 2827 (source: NCBI BLink). |
| AT3G62600 | AT3G62600.1 | ATCCACGTGGCT | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. |
| AT3G63070 | AT3G63070.1 | CACGTGGAT | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G48160.1); Has 977 Blast hits to 907 proteins in 123 species: Archae - 0; Bacteria - 34; Metazoa - 607; Fungi - 134; Plants - 84; Viruses - 0; Other Eukaryotes - 118 (source: NCBI BLink). |
| AT3G66658 | AT3G66658.1 | ACGTGGAT | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT3G66658.2 | ACGTGGAT | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT4G00490 | AT4G00490.1 | ACGCCACGTGGAT | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. Mutant of BAM2 has no visible phenotype. |
| AT4G00710 | AT4G00710.1 | CACGTGGAT | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G00780 | AT4G00780.1 | ATCCACGT | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01390.1); Has 394 Blast hits to 352 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 375; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT4G02880 | AT4G02880.1 | ATCCACGTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03290.1); Has 3704 Blast hits to 3126 proteins in 384 species: Archae - 40; Bacteria - 363; Metazoa - 1661; Fungi - 338; Plants - 170; Viruses - 7; Other Eukaryotes - 1125 (source: NCBI BLink). |
| AT4G04020 | AT4G04020.1 | ATCCACGTGTCA | Fibrillin precursor protein. The fibrillin preprotein, but not the mature protein interacts with ABI2. Regulated by abscisic acid response regulators. Involved in abscisic acid-mediated photoprotection. |
| AT4G04870 | AT4G04870.1 | ATCCACGTGTT | Encodes a protein with cardiolipin synthase activity that is localized to the mitochondiria. |
| AT4G08230 | AT4G08230.1 | ATCCACGTAG | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; Has 13979 Blast hits to 5534 proteins in 565 species: Archae - 19; Bacteria - 2070; Metazoa - 5921; Fungi - 772; Plants - 3540; Viruses - 122; Other Eukaryotes - 1535 (source: NCBI BLink). |
| AT4G08330 | AT4G08330.1 | ATCCACGTCAGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G17705.1); Has 48 Blast hits to 48 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G08685 | AT4G08685.1 | ATCCACGTCATCAAATACCCC | Encodes a protein, expressed in leaves, with similarity to pollen allergens. |
| AT4G11570 | AT4G11570.1 | GGACACGTGGAT | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink). |
| AT4G11570.2 | GGACACGTGGAT | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink). |
| AT4G11600 | AT4G11600.1 | ATCCACGTGTCT | Encodes glutathione peroxidase. |
| AT4G12790 | AT4G12790.1 | ATCCACGTGAGACACGT | ATP-binding family protein; FUNCTIONS IN: nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, ATP binding (InterPro:IPR004130); BEST Arabidopsis thaliana protein match is: QQT1 (QUATRE-QUART 1); ATP binding / nucleotide binding (TAIR:AT5G22370.2); Has 1073 Blast hits to 1063 proteins in 199 species: Archae - 79; Bacteria - 0; Metazoa - 345; Fungi - 272; Plants - 80; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink). |
| AT4G12790.2 | ATCCACGTGAGACACGT | ATP-binding family protein; FUNCTIONS IN: nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, ATP binding (InterPro:IPR004130); BEST Arabidopsis thaliana protein match is: QQT1 (QUATRE-QUART 1); ATP binding / nucleotide binding (TAIR:AT5G22370.2); Has 1073 Blast hits to 1063 proteins in 199 species: Archae - 79; Bacteria - 0; Metazoa - 345; Fungi - 272; Plants - 80; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink). |
| AT4G12790.3 | ATCCACGTGAGACACGT | ATP-binding family protein; FUNCTIONS IN: nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, ATP binding (InterPro:IPR004130); BEST Arabidopsis thaliana protein match is: QQT1 (QUATRE-QUART 1); ATP binding / nucleotide binding (TAIR:AT5G22370.2); Has 1073 Blast hits to 1063 proteins in 199 species: Archae - 79; Bacteria - 0; Metazoa - 345; Fungi - 272; Plants - 80; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink). |
| AT4G12790.4 | ATCCACGTGAGACACGT | ATP-binding family protein; FUNCTIONS IN: nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, ATP binding (InterPro:IPR004130); BEST Arabidopsis thaliana protein match is: QQT1 (QUATRE-QUART 1); ATP binding / nucleotide binding (TAIR:AT5G22370.2); Has 1073 Blast hits to 1063 proteins in 199 species: Archae - 79; Bacteria - 0; Metazoa - 345; Fungi - 272; Plants - 80; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink). |
| AT4G12790.5 | ATCCACGTGAGACACGT | ATP-binding family protein; FUNCTIONS IN: nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, ATP binding (InterPro:IPR004130); BEST Arabidopsis thaliana protein match is: QQT1 (QUATRE-QUART 1); ATP binding / nucleotide binding (TAIR:AT5G22370.2); Has 1073 Blast hits to 1063 proteins in 199 species: Archae - 79; Bacteria - 0; Metazoa - 345; Fungi - 272; Plants - 80; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink). |
| AT4G13160 | AT4G13160.1 | TGTCACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF593 (InterPro:IPR007656); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G13630.1); Has 3849 Blast hits to 2651 proteins in 230 species: Archae - 12; Bacteria - 138; Metazoa - 1303; Fungi - 201; Plants - 240; Viruses - 104; Other Eukaryotes - 1851 (source: NCBI BLink). |
| AT4G13270 | AT4G13270.1 | ATCCACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52330.1); Has 109 Blast hits to 109 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 109; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G14900 | AT4G14900.1 | ATCCACGTCATC | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT3G22440.1); Has 1960 Blast hits to 1334 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 248; Fungi - 80; Plants - 1600; Viruses - 2; Other Eukaryotes - 22 (source: NCBI BLink). |
| AT4G15120 | AT4G15120.1 | ATCCACGTGTCC | VQ motif-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, flower, root, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: VQ motif-containing protein (TAIR:AT3G22160.1); Has 167 Blast hits to 165 proteins in 26 species: Archae - 2; Bacteria - 0; Metazoa - 18; Fungi - 12; Plants - 102; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT4G15480 | AT4G15480.1 | ACGTGGAT | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G16370 | AT4G16370.1 | CGACACGTGGAT | Encodes an oligopeptide transporter involved in metal homeostasis. |
| AT4G16670 | AT4G16670.1 | ATCCACGT | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin-like, plant (InterPro:IPR013666), Protein of unknown function DUF828, plant (InterPro:IPR008546), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: phosphoinositide binding (TAIR:AT4G17350.1); Has 124 Blast hits to 112 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 117; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G17245 | AT4G17245.1 | ATCCACGT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G47610.1); Has 4937 Blast hits to 4920 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 1569; Fungi - 378; Plants - 2323; Viruses - 12; Other Eukaryotes - 655 (source: NCBI BLink). |
| AT4G17730 | AT4G17730.1 | ATCCACGTGTCC | member of SYP2 Gene Family |
| AT4G17730.2 | ATCCACGTGTCC | member of SYP2 Gene Family |
| AT4G19490 | AT4G19490.1 | GATGACGTGGAT | Putative homolog of yeast Vps54. Thought to associate with POK and ATVPS53 in a plant GARP-like complex involved in the membrane trafficking system. |
| AT4G19490.2 | GATGACGTGGAT | Putative homolog of yeast Vps54. Thought to associate with POK and ATVPS53 in a plant GARP-like complex involved in the membrane trafficking system. |
| AT4G22890 | AT4G22890.1 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). |
| AT4G22890.2 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). |
| AT4G22890.3 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). |
| AT4G22890.4 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). |
| AT4G22890.5 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). |
| AT4G24190 | AT4G24190.1 | ATCCACGTCG | encodes an ortholog of GRP94, an ER-resident HSP90-like protein and is involved in regulation of meristem size and organization. Single and double mutant analyses suggest that SHD may be required for the correct folding and/or complex formation of CLV proteins. Lines carrying recessive mutations in this locus exhibits expanded shoot meristems, disorganized root meristems, and defective pollen tube elongation. Transcript is detected in all tissues examined and is not induced by heat. Endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. |
| AT4G24190.2 | ATCCACGTCG | encodes an ortholog of GRP94, an ER-resident HSP90-like protein and is involved in regulation of meristem size and organization. Single and double mutant analyses suggest that SHD may be required for the correct folding and/or complex formation of CLV proteins. Lines carrying recessive mutations in this locus exhibits expanded shoot meristems, disorganized root meristems, and defective pollen tube elongation. Transcript is detected in all tissues examined and is not induced by heat. Endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. |
| AT4G24480 | AT4G24480.1 | ATCCACGTGTCAC | serine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.12 twelve leaves visible; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CTR1 (CONSTITUTIVE TRIPLE RESPONSE 1); kinase/ protein binding / protein serine/threonine kinase/ protein serine/threonine/tyrosine kinase (TAIR:AT5G03730.2); Has 84626 Blast hits to 83310 proteins in 3213 species: Archae - 47; Bacteria - 6763; Metazoa - 38110; Fungi - 6771; Plants - 18285; Viruses - 390; Other Eukaryotes - 14260 (source: NCBI BLink). |
| AT4G25370 | AT4G25370.1 | ACGTGGAT | Clp amino terminal domain-containing protein; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: protein metabolic process; LOCATED IN: thylakoid, plastid stroma, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clp, N-terminal (InterPro:IPR004176); BEST Arabidopsis thaliana protein match is: Clp amino terminal domain-containing protein (TAIR:AT4G12060.1); Has 1552 Blast hits to 1379 proteins in 369 species: Archae - 0; Bacteria - 1010; Metazoa - 0; Fungi - 0; Plants - 83; Viruses - 2; Other Eukaryotes - 457 (source: NCBI BLink). |
| AT4G25470 | AT4G25470.1 | ATCCACGTGGCAT | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. |
| AT4G25570 | AT4G25570.1 | ATCCACGTGGCGA | Encodes cytochrome b561. |
| AT4G31360 | AT4G31360.1 | CACGTGGAT | selenium binding; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenium binding (TAIR:AT2G24440.1); Has 199 Blast hits to 172 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 101; Fungi - 17; Plants - 36; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT4G35780 | AT4G35780.1 | ATGACGTGGAT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein kinase activity; INVOLVED IN: protein amino acid phosphorylation, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Amino acid-binding ACT (InterPro:IPR002912), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G17700.1); Has 96534 Blast hits to 94806 proteins in 3572 species: Archae - 70; Bacteria - 8063; Metazoa - 43456; Fungi - 7958; Plants - 19255; Viruses - 472; Other Eukaryotes - 17260 (source: NCBI BLink). |
| AT4G38810 | AT4G38810.1 | CACGTGGAT | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G28830.1); Has 189 Blast hits to 127 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 186; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G01600 | AT5G01600.1 | ACGTGGAT | Encodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT5G01600.1 | TCCACGTGGAT | Encodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT5G02810 | AT5G02810.1 | ATCCACGTCAC | PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels. |
| AT5G03560 | AT5G03560.1 | ATCCACGT | nucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). |
| AT5G03560.2 | ATCCACGT | nucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). |
| AT5G04040 | AT5G04040.1 | ATCCACGTGGG | Encodes a triacylglycerol lipase that is involved in storage lipid breakdown during seed germination. The mutant plant exhibits a much slower rate of postgerminative growth than the wild type. |
| AT5G04090 | AT5G04090.2 | ATCCACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G10250.2); Has 131 Blast hits to 129 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 118; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G05370 | AT5G05370.1 | GTCCACGTGGAT | ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT3G10860.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G05380 | AT5G05380.1 | ATCCACGTGGAC | PRENYLATED RAB ACCEPTOR 1.B3 (PRA1.B3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 371 Blast hits to 371 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 59; Plants - 178; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT5G07330 | AT5G07330.1 | TGACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G63060.1); Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G09440 | AT5G09440.1 | ATCCACGTGGCAT | EXORDIUM LIKE 4 (EXL4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphate-induced protein 1 conserved region (InterPro:IPR006766); BEST Arabidopsis thaliana protein match is: EXL2 (EXORDIUM LIKE 2) (TAIR:AT5G64260.1); Has 233 Blast hits to 233 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 231; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10190 | AT5G10190.1 | ATCCACGTCG | transporter-related; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: UNE2 (unfertilized embryo sac 2); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G78130.1); Has 8728 Blast hits to 8693 proteins in 1166 species: Archae - 209; Bacteria - 6596; Metazoa - 315; Fungi - 290; Plants - 194; Viruses - 2; Other Eukaryotes - 1122 (source: NCBI BLink). |
| AT5G10290 | AT5G10290.1 | ATCCACGTAATTA | leucine-rich repeat family protein / protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, typical subtype (InterPro:IPR003591); BEST Arabidopsis thaliana protein match is: kinase (TAIR:AT5G65240.1); Has 122421 Blast hits to 85605 proteins in 2936 species: Archae - 56; Bacteria - 9576; Metazoa - 41410; Fungi - 5522; Plants - 50342; Viruses - 397; Other Eukaryotes - 15118 (source: NCBI BLink). |
| AT5G10400 | AT5G10400.1 | ATGACGTGGAT | histone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, chloroplast, nucleosome; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G65360.1); Has 10280 Blast hits to 10277 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7396; Fungi - 1309; Plants - 999; Viruses - 0; Other Eukaryotes - 576 (source: NCBI BLink). |
| AT5G11420 | AT5G11420.1 | CCCACGTGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25460.1); Has 185 Blast hits to 157 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 185; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G12850 | AT5G12850.1 | ACGTGGAT | zinc finger (CCCH-type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT2G41900.1); Has 2352 Blast hits to 1824 proteins in 179 species: Archae - 4; Bacteria - 93; Metazoa - 1168; Fungi - 124; Plants - 283; Viruses - 12; Other Eukaryotes - 668 (source: NCBI BLink). |
| AT5G14800 | AT5G14800.1 | ATCCACGTCATC | Delta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis. |
| AT5G14800.2 | ATCCACGTCATC | Delta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis. |
| AT5G15330 | AT5G15330.1 | ATCCACGT | SPX DOMAIN GENE 4 (SPX4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cellular response to phosphate starvation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: SPX, N-terminal (InterPro:IPR004331); BEST Arabidopsis thaliana protein match is: SPX2 (SPX DOMAIN GENE 2) (TAIR:AT2G26660.1); Has 673 Blast hits to 668 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 202; Fungi - 277; Plants - 160; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT5G15500 | AT5G15500.1 | ATCCACGT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). |
| AT5G15500.2 | ATCCACGT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). |
| AT5G15910 | AT5G15910.1 | ATGACACGTGGAT | dehydrogenase-related; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 4174 Blast hits to 4174 proteins in 940 species: Archae - 63; Bacteria - 2510; Metazoa - 105; Fungi - 172; Plants - 313; Viruses - 2; Other Eukaryotes - 1009 (source: NCBI BLink). |
| AT5G15948 | AT5G15948.1 | ATCCACGTGTCAC | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF10 represents a conserved upstream opening reading frame relative to major ORF AT5G15950.1 |
| AT5G15950 | AT5G15950.1 | ATCCACGTGTCAC | adenosylmethionine decarboxylase family protein; FUNCTIONS IN: adenosylmethionine decarboxylase activity; INVOLVED IN: spermidine biosynthetic process, spermine biosynthetic process, polyamine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine decarboxylase, core (InterPro:IPR016067), S-adenosylmethionine decarboxylase (InterPro:IPR001985), S-adenosylmethionine decarboxylase, conserved site (InterPro:IPR018166), S-adenosylmethionine decarboxylase subgroup (InterPro:IPR018167); BEST Arabidopsis thaliana protein match is: SAMDC (S-ADENOSYLMETHIONINE DECARBOXYLASE); adenosylmethionine decarboxylase (TAIR:AT3G02470.4); Has 830 Blast hits to 816 proteins in 205 species: Archae - 0; Bacteria - 50; Metazoa - 174; Fungi - 104; Plants - 446; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT5G15950.2 | ATCCACGTGTCAC | adenosylmethionine decarboxylase family protein; FUNCTIONS IN: adenosylmethionine decarboxylase activity; INVOLVED IN: spermidine biosynthetic process, spermine biosynthetic process, polyamine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine decarboxylase, core (InterPro:IPR016067), S-adenosylmethionine decarboxylase (InterPro:IPR001985), S-adenosylmethionine decarboxylase, conserved site (InterPro:IPR018166), S-adenosylmethionine decarboxylase subgroup (InterPro:IPR018167); BEST Arabidopsis thaliana protein match is: SAMDC (S-ADENOSYLMETHIONINE DECARBOXYLASE); adenosylmethionine decarboxylase (TAIR:AT3G02470.4); Has 830 Blast hits to 816 proteins in 205 species: Archae - 0; Bacteria - 50; Metazoa - 174; Fungi - 104; Plants - 446; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT5G15960 | AT5G15960.1 | ATCCACGTGGT | cold and ABA inducible protein kin1, possibly functions as an anti-freeze protein. Transcript level of this gene is induced by cold, ABA, dehydration and osmoticum (mannitol). However, protein activity of GUS fused to the promoter of this gene is inhibited by cold treatment, suggesting an inhibition of the protein by increased transcript level. |
| AT5G15970 | AT5G15970.1 | ATCCACGTGGT | Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance. |
| AT5G16340 | AT5G16340.1 | CACGTGGAT | AMP-binding protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: AAE5 (ACYL ACTIVATING ENZYME 5); catalytic (TAIR:AT5G16370.1); Has 50913 Blast hits to 47428 proteins in 2194 species: Archae - 554; Bacteria - 27741; Metazoa - 2839; Fungi - 2171; Plants - 1249; Viruses - 1; Other Eukaryotes - 16358 (source: NCBI BLink). |
| AT5G19520 | AT5G19520.1 | ATCCACGTG | MECHANOSENSITIVE CHANNEL OF SMALL CONDUCTANCE-LIKE 9 (MSL9); FUNCTIONS IN: mechanically-gated ion channel activity; INVOLVED IN: detection of mechanical stimulus; LOCATED IN: nucleus, plasma membrane, membrane; EXPRESSED IN: root tip, root; CONTAINS InterPro DOMAIN/s: Membrane protein, At2g17000, predicted (InterPro:IPR016688), Mechanosensitive ion channel MscS (InterPro:IPR006685), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: MSL10 (MECHANOSENSITIVE CHANNEL OF SMALL CONDUCTANCE-LIKE 10); mechanically-gated ion channel (TAIR:AT5G12080.3); Has 1950 Blast hits to 1947 proteins in 608 species: Archae - 62; Bacteria - 1279; Metazoa - 0; Fungi - 123; Plants - 84; Viruses - 2; Other Eukaryotes - 400 (source: NCBI BLink). |
| AT5G19730 | AT5G19730.1 | CTACGTGGAT | pectinesterase family protein; FUNCTIONS IN: pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, cytoplasm, plant-type cell wall; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT5G47500.1); Has 1233 Blast hits to 1201 proteins in 178 species: Archae - 0; Bacteria - 259; Metazoa - 1; Fungi - 135; Plants - 838; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G19875 | AT5G19875.1 | ATCCACGTGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31940.1); Has 63 Blast hits to 63 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G21222 | AT5G21222.1 | ATCCACGTCGTC | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Pentatricopeptide repeat (InterPro:IPR002885), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G25630.1); Has 114429 Blast hits to 95597 proteins in 2212 species: Archae - 72; Bacteria - 8552; Metazoa - 38934; Fungi - 9044; Plants - 38583; Viruses - 478; Other Eukaryotes - 18766 (source: NCBI BLink). |
| AT5G23330 | AT5G23330.1 | TGACGTGGAT | riboflavin biosynthesis protein-related; FUNCTIONS IN: FMN adenylyltransferase activity; INVOLVED IN: riboflavin biosynthetic process; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), FAD synthetase (InterPro:IPR015864); BEST Arabidopsis thaliana protein match is: riboflavin biosynthesis protein-related (TAIR:AT5G08340.1); Has 2811 Blast hits to 2811 proteins in 943 species: Archae - 0; Bacteria - 2024; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 761 (source: NCBI BLink). |
| AT5G23730 | AT5G23730.1 | ACGTGGAT | nucleotide binding; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G52250.1); Has 9016 Blast hits to 6231 proteins in 356 species: Archae - 12; Bacteria - 1820; Metazoa - 3399; Fungi - 1848; Plants - 686; Viruses - 0; Other Eukaryotes - 1251 (source: NCBI BLink). |
| AT5G23820 | AT5G23820.1 | ATCCACGTG | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G23840.1); Has 35 Blast hits to 35 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G23830 | AT5G23830.1 | ATCCACGTG | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G23840.1); Has 35 Blast hits to 35 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G23830.2 | ATCCACGTG | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G23840.1); Has 35 Blast hits to 35 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G27920 | AT5G27920.1 | ATCCACGTGGAT | F-box family protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL3) (TAIR:AT5G01720.1); Has 10236 Blast hits to 3505 proteins in 207 species: Archae - 0; Bacteria - 631; Metazoa - 4869; Fungi - 921; Plants - 2316; Viruses - 19; Other Eukaryotes - 1480 (source: NCBI BLink). |
| AT5G35180 | AT5G35180.1 | TGACGTGGAT | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: EDR2; lipid binding (TAIR:AT4G19040.1). |
| AT5G35180.2 | TGACGTGGAT | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: EDR2; lipid binding (TAIR:AT4G19040.1). |
| AT5G35180.3 | TGACGTGGAT | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: EDR2; lipid binding (TAIR:AT4G19040.1). |
| AT5G35180.4 | TGACGTGGAT | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: EDR2; lipid binding (TAIR:AT4G19040.1). |
| AT5G40720 | AT5G40720.1 | ACGTGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G27330.1); Has 216 Blast hits to 216 proteins in 64 species: Archae - 0; Bacteria - 120; Metazoa - 2; Fungi - 4; Plants - 57; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT5G42810 | AT5G42810.1 | GTCCACGTGGAT | Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. |
| AT5G44720 | AT5G44720.1 | ATCCACGTG | molybdenum cofactor sulfurase family protein; FUNCTIONS IN: molybdenum ion binding, Mo-molybdopterin cofactor sulfurase activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), MOSC, N-terminal beta barrel (InterPro:IPR005303), Molybdenum cofactor sulfurase, C-terminal (InterPro:IPR005302); BEST Arabidopsis thaliana protein match is: molybdenum cofactor sulfurase family protein (TAIR:AT1G30910.1); Has 1262 Blast hits to 1242 proteins in 421 species: Archae - 2; Bacteria - 632; Metazoa - 290; Fungi - 178; Plants - 53; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT5G44720.2 | ATCCACGTG | molybdenum cofactor sulfurase family protein; FUNCTIONS IN: molybdenum ion binding, Mo-molybdopterin cofactor sulfurase activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate kinase, beta-barrel-like (InterPro:IPR011037), MOSC, N-terminal beta barrel (InterPro:IPR005303), Molybdenum cofactor sulfurase, C-terminal (InterPro:IPR005302); BEST Arabidopsis thaliana protein match is: molybdenum cofactor sulfurase family protein (TAIR:AT1G30910.1); Has 1262 Blast hits to 1242 proteins in 421 species: Archae - 2; Bacteria - 632; Metazoa - 290; Fungi - 178; Plants - 53; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT5G45800 | AT5G45800.1 | ATCCACGTCATC | maternal effect embryo arrest 62 (MEE62); FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G24230.1); Has 55296 Blast hits to 36416 proteins in 1147 species: Archae - 36; Bacteria - 3164; Metazoa - 17246; Fungi - 1111; Plants - 30254; Viruses - 106; Other Eukaryotes - 3379 (source: NCBI BLink). |
| AT5G47120 | AT5G47120.1 | ATCCACGTGGAT | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. |
| AT5G49650 | AT5G49650.1 | ATGACGTGGAT | xylulose kinase, putative; FUNCTIONS IN: xylulokinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process, xylulose catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485); Has 2320 Blast hits to 2320 proteins in 693 species: Archae - 2; Bacteria - 1651; Metazoa - 139; Fungi - 96; Plants - 28; Viruses - 0; Other Eukaryotes - 404 (source: NCBI BLink). |
| AT5G49650.2 | ATGACGTGGAT | xylulose kinase, putative; FUNCTIONS IN: xylulokinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process, xylulose catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485); Has 2320 Blast hits to 2320 proteins in 693 species: Archae - 2; Bacteria - 1651; Metazoa - 139; Fungi - 96; Plants - 28; Viruses - 0; Other Eukaryotes - 404 (source: NCBI BLink). |
| AT5G52200 | AT5G52200.1 | ATCCACGTGGCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 509 Blast hits to 471 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 232; Fungi - 109; Plants - 74; Viruses - 6; Other Eukaryotes - 88 (source: NCBI BLink). |
| AT5G54940 | AT5G54940.1 | ATCCACGTGTCT | eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT5G54940.2 | ATCCACGTGTCT | eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT5G56100 | AT5G56100.1 | ATCCACGTGTCA | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G56100.1 | ATCCACGTGTCGT | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G57630 | AT5G57630.1 | AGCCCAATCCACGTAG | CBL-interacting protein kinase |
| AT5G57785 | AT5G57785.1 | ACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G60170 | AT5G60170.1 | ACGTGGAT | RNA binding / nucleic acid binding / nucleotide binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), RNA recognition motif, RNP-1 (InterPro:IPR000504), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), RNA recognition, region 1 (InterPro:IPR003954); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G45630.1); Has 1060 Blast hits to 628 proteins in 173 species: Archae - 0; Bacteria - 202; Metazoa - 240; Fungi - 159; Plants - 78; Viruses - 0; Other Eukaryotes - 381 (source: NCBI BLink). |
| AT5G61210 | AT5G61210.1 | ATCCACGT | membrane localized t-SNARE SNAP25 homologue, probably involved in cytokinesis and cell plate formation |
| AT5G61450 | AT5G61450.1 | ACGTGGAT | 2-phosphoglycerate kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; Has 393 Blast hits to 372 proteins in 106 species: Archae - 58; Bacteria - 24; Metazoa - 63; Fungi - 40; Plants - 52; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink). |
| AT5G63620 | AT5G63620.1 | TACACGTGGAT | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: alcohol dehydrogenase, putative (TAIR:AT1G64710.1); Has 32783 Blast hits to 32696 proteins in 2070 species: Archae - 429; Bacteria - 18028; Metazoa - 1724; Fungi - 2557; Plants - 2783; Viruses - 3; Other Eukaryotes - 7259 (source: NCBI BLink). |
| AT5G63620.2 | TACACGTGGAT | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: alcohol dehydrogenase, putative (TAIR:AT1G64710.1); Has 32783 Blast hits to 32696 proteins in 2070 species: Archae - 429; Bacteria - 18028; Metazoa - 1724; Fungi - 2557; Plants - 2783; Viruses - 3; Other Eukaryotes - 7259 (source: NCBI BLink). |
| ATMG00160 | ATMG00160.1 | ACGTGGAT | cytochrome c oxidase subunit 2 |