| Locus | Gene model | Sequence | Description |
| AT1G04560 | AT1G04560.1 | CGGTTTGG | AWPM-19-like membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: AWPM-19-like (InterPro:IPR008390); BEST Arabidopsis thaliana protein match is: AWPM-19-like membrane family protein (TAIR:AT1G29520.1); Has 99 Blast hits to 99 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 99; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G04690 | AT1G04690.1 | CCAAACCGGT | POTASSIUM CHANNEL BETA SUBUNIT (KAB1); FUNCTIONS IN: oxidoreductase activity, potassium channel activity; INVOLVED IN: oxidation reduction, potassium ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Potassium channel, voltage-dependent, beta subunit, KCNAB-related (InterPro:IPR005399); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G60690.1); Has 17446 Blast hits to 17422 proteins in 1383 species: Archae - 314; Bacteria - 9995; Metazoa - 800; Fungi - 1248; Plants - 507; Viruses - 0; Other Eukaryotes - 4582 (source: NCBI BLink). |
| AT1G04850 | AT1G04850.1 | CCAAACCG | ubiquitin-associated (UBA)/TS-N domain-containing protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), PUG (InterPro:IPR006567), Zinc finger, C2H2-type (InterPro:IPR007087), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48690.1); Has 17438 Blast hits to 9965 proteins in 571 species: Archae - 30; Bacteria - 1031; Metazoa - 7907; Fungi - 1971; Plants - 445; Viruses - 50; Other Eukaryotes - 6004 (source: NCBI BLink). |
| AT1G05070 | AT1G05070.1 | CCAAACCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32580.1); Has 55 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G05620 | AT1G05620.1 | TTTCCGGTTTGG | URIDINE-RIBOHYDROLASE 2 (URH2); FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Inosine/uridine-preferring nucleoside hydrolase (InterPro:IPR001910); BEST Arabidopsis thaliana protein match is: URH1 (URIDINE-RIBOHYDROLASE 1); adenosine nucleosidase/ hydrolase/ inosine nucleosidase/ uridine nucleosidase (TAIR:AT2G36310.1); Has 3510 Blast hits to 3474 proteins in 706 species: Archae - 26; Bacteria - 2065; Metazoa - 165; Fungi - 155; Plants - 94; Viruses - 0; Other Eukaryotes - 1005 (source: NCBI BLink). |
| AT1G05620.2 | TTTCCGGTTTGG | URIDINE-RIBOHYDROLASE 2 (URH2); FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Inosine/uridine-preferring nucleoside hydrolase (InterPro:IPR001910); BEST Arabidopsis thaliana protein match is: URH1 (URIDINE-RIBOHYDROLASE 1); adenosine nucleosidase/ hydrolase/ inosine nucleosidase/ uridine nucleosidase (TAIR:AT2G36310.1); Has 3510 Blast hits to 3474 proteins in 706 species: Archae - 26; Bacteria - 2065; Metazoa - 165; Fungi - 155; Plants - 94; Viruses - 0; Other Eukaryotes - 1005 (source: NCBI BLink). |
| AT1G06190 | AT1G06190.1 | TTCGGTTTGG | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink). |
| AT1G06190.2 | TTCGGTTTGG | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink). |
| AT1G07150 | AT1G07150.1 | CCAAACCG | member of MEKK subfamily |
| AT1G08110 | AT1G08110.1 | CCAAACCGGAA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.2 | CCAAACCGGAA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.3 | CCAAACCGGAA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G08110.4 | CCAAACCGGAA | lactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). |
| AT1G09280 | AT1G09280.1 | GGTTCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763), Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT2G40760.1); Has 4342 Blast hits to 4339 proteins in 940 species: Archae - 0; Bacteria - 1695; Metazoa - 138; Fungi - 282; Plants - 108; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). |
| AT1G10430 | AT1G10430.1 | ATCCGGTTTGG | Encodes one of two isoforms of the catalytic subunit of protein phosphatase 2A. |
| AT1G11200 | AT1G11200.1 | CCAAACCG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21570.1); Has 593 Blast hits to 589 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 256; Fungi - 128; Plants - 126; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT1G11200.1 | CCAAACCGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21570.1); Has 593 Blast hits to 589 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 256; Fungi - 128; Plants - 126; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT1G12770 | AT1G12770.1 | GTCCGGTTTGG | embryo defective 1586 (EMB1586); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; INVOLVED IN: embryonic development ending in seed dormancy; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative (TAIR:AT3G19760.1); Has 25549 Blast hits to 25020 proteins in 1695 species: Archae - 449; Bacteria - 9955; Metazoa - 4809; Fungi - 3113; Plants - 1343; Viruses - 12; Other Eukaryotes - 5868 (source: NCBI BLink). |
| AT1G14060 | AT1G14060.1 | GTTCGGTTTGGTCCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: GCK (InterPro:IPR012891); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G02210.1); Has 243 Blast hits to 215 proteins in 60 species: Archae - 0; Bacteria - 2; Metazoa - 93; Fungi - 27; Plants - 49; Viruses - 2; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT1G17360 | AT1G17360.1 | CCAAACCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 8834 Blast hits to 6495 proteins in 406 species: Archae - 8; Bacteria - 626; Metazoa - 3389; Fungi - 793; Plants - 257; Viruses - 52; Other Eukaryotes - 3709 (source: NCBI BLink). |
| AT1G17790 | AT1G17790.1 | ACCGGTTTGG | DNA-binding bromodomain-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: GTE3 (GLOBAL TRANSCRIPTION FACTOR GROUP E 3); DNA binding / histone binding (TAIR:AT1G73150.1); Has 10421 Blast hits to 6039 proteins in 444 species: Archae - 16; Bacteria - 924; Metazoa - 4753; Fungi - 937; Plants - 711; Viruses - 164; Other Eukaryotes - 2916 (source: NCBI BLink). |
| AT1G18260 | AT1G18260.1 | CCAAACCGAA | suppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G73570.1); Has 15581 Blast hits to 5419 proteins in 820 species: Archae - 0; Bacteria - 9844; Metazoa - 747; Fungi - 658; Plants - 84; Viruses - 27; Other Eukaryotes - 4221 (source: NCBI BLink). |
| AT1G18300 | AT1G18300.1 | CCAAACCGAAC | Arabidopsis thaliana Nudix hydrolase homolog 4 (atnudt4); FUNCTIONS IN: hydrolase activity; LOCATED IN: cytosol; EXPRESSED IN: stem, root, leaf; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt21 (Arabidopsis thaliana Nudix hydrolase homolog 21); hydrolase (TAIR:AT1G73540.1); Has 801 Blast hits to 799 proteins in 226 species: Archae - 1; Bacteria - 254; Metazoa - 216; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT1G19170 | AT1G19170.1 | ACCGGTTTGG | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT3G42950.1); Has 2514 Blast hits to 2510 proteins in 316 species: Archae - 2; Bacteria - 602; Metazoa - 8; Fungi - 955; Plants - 840; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT1G24030 | AT1G24030.1 | CCAAACCG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G20530.1); Has 86914 Blast hits to 85888 proteins in 3162 species: Archae - 55; Bacteria - 7907; Metazoa - 37860; Fungi - 6978; Plants - 19048; Viruses - 419; Other Eukaryotes - 14647 (source: NCBI BLink). |
| AT1G24030.2 | CCAAACCG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G20530.1); Has 86914 Blast hits to 85888 proteins in 3162 species: Archae - 55; Bacteria - 7907; Metazoa - 37860; Fungi - 6978; Plants - 19048; Viruses - 419; Other Eukaryotes - 14647 (source: NCBI BLink). |
| AT1G26180 | AT1G26180.1 | CCAAACCGGATTTTAACCG | unknown protein; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 229 Blast hits to 229 proteins in 65 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT1G26530 | AT1G26530.1 | TGGTTCGGTTCGGTTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46230.1); Has 345 Blast hits to 345 proteins in 143 species: Archae - 0; Bacteria - 0; Metazoa - 142; Fungi - 99; Plants - 37; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT1G26670 | AT1G26670.1 | TTCGGTTTGG | member of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles. |
| AT1G27650 | AT1G27650.1 | CCAAACCGGAT | U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions. |
| AT1G27650.2 | CCAAACCGGAT | U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions. |
| AT1G27750 | AT1G27750.1 | CCAAACCG | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504); BEST Arabidopsis thaliana protein match is: FPA; RNA binding (TAIR:AT2G43410.4); Has 43321 Blast hits to 25070 proteins in 1124 species: Archae - 78; Bacteria - 4579; Metazoa - 20319; Fungi - 5516; Plants - 6313; Viruses - 1307; Other Eukaryotes - 5209 (source: NCBI BLink). |
| AT1G27750.1 | TTCGGTTTGG | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504); BEST Arabidopsis thaliana protein match is: FPA; RNA binding (TAIR:AT2G43410.4); Has 43321 Blast hits to 25070 proteins in 1124 species: Archae - 78; Bacteria - 4579; Metazoa - 20319; Fungi - 5516; Plants - 6313; Viruses - 1307; Other Eukaryotes - 5209 (source: NCBI BLink). |
| AT1G28320 | AT1G28320.1 | CCAAACCG | Mutants in this gene are defective in the processing of pre-glyoxysomal malate dehydrogenase (pre-gMDH) to gMDH. |
| AT1G29680 | AT1G29680.1 | GTCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1264 (InterPro:IPR010686); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45690.1); Has 188 Blast hits to 188 proteins in 83 species: Archae - 0; Bacteria - 84; Metazoa - 0; Fungi - 43; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G29900 | AT1G29900.1 | CCAAACCGGAA | carbamoyl phosphate synthetase large chain (CARB) mRNA, |
| AT1G30510 | AT1G30510.1 | TGGTTCGGTTTGG | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G30510.2 | TGGTTCGGTTTGG | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G30510.3 | TGGTTCGGTTTGG | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G30550 | AT1G30550.2 | CCAAACCGGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: WW domain-containing protein (TAIR:AT1G45231.2); Has 891 Blast hits to 591 proteins in 275 species: Archae - 68; Bacteria - 248; Metazoa - 211; Fungi - 176; Plants - 45; Viruses - 3; Other Eukaryotes - 140 (source: NCBI BLink). |
| AT1G31460 | AT1G31460.1 | CCAAACCGGTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23270.1); Has 1177 Blast hits to 701 proteins in 148 species: Archae - 0; Bacteria - 210; Metazoa - 433; Fungi - 158; Plants - 37; Viruses - 17; Other Eukaryotes - 322 (source: NCBI BLink). |
| AT1G31730 | AT1G31730.1 | CCAAACCGAA | epsilon-adaptin, putative; FUNCTIONS IN: protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Adaptor protein complex AP-4, epsilon subunit (InterPro:IPR017109), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 4111 Blast hits to 2632 proteins in 228 species: Archae - 0; Bacteria - 67; Metazoa - 1478; Fungi - 596; Plants - 220; Viruses - 3; Other Eukaryotes - 1747 (source: NCBI BLink). |
| AT1G32530 | AT1G32530.1 | CCAAACCGAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink). |
| AT1G33265 | AT1G33265.1 | CCAAACCGAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); Has 119 Blast hits to 119 proteins in 43 species: Archae - 0; Bacteria - 27; Metazoa - 33; Fungi - 2; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G33265.1 | TAACCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); Has 119 Blast hits to 119 proteins in 43 species: Archae - 0; Bacteria - 27; Metazoa - 33; Fungi - 2; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G33520 | AT1G33520.1 | GACCCGGTTTGG | Has single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4; |
| AT1G33780 | AT1G33780.1 | TTTAACCGAACCAAACCG | unknown protein; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF179 (InterPro:IPR003774); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29240.2); Has 1773 Blast hits to 1773 proteins in 611 species: Archae - 0; Bacteria - 1186; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 522 (source: NCBI BLink). |
| AT1G34000 | AT1G34000.1 | CCAAACCGAA | Encodes a novel member of the Lhc family from Arabidopsis with one predicted transmembrane alpha-helix closely related to helix I of Lhc protein from PSI (Lhca4). Gene expression is triggered by light stress and both transcript and protein accumulate in a light intensity-dependent manner. Ohp2 is associated with PSI under low- or high-light conditions. |
| AT1G34000.1 | TTTCCGGTTTGG | Encodes a novel member of the Lhc family from Arabidopsis with one predicted transmembrane alpha-helix closely related to helix I of Lhc protein from PSI (Lhca4). Gene expression is triggered by light stress and both transcript and protein accumulate in a light intensity-dependent manner. Ohp2 is associated with PSI under low- or high-light conditions. |
| AT1G34770 | AT1G34770.1 | CCAAACCGAA | MAGE-8 antigen-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MAGE protein (InterPro:IPR002190); Has 1021 Blast hits to 1019 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 886; Fungi - 33; Plants - 28; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G34770.2 | CCAAACCGAA | MAGE-8 antigen-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MAGE protein (InterPro:IPR002190); Has 1021 Blast hits to 1019 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 886; Fungi - 33; Plants - 28; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G45474 | AT1G45474.1 | CCAAACCGAA | Encodes a component of the light harvesting complex of photosystem I. |
| AT1G45474.2 | CCAAACCGAA | Encodes a component of the light harvesting complex of photosystem I. |
| AT1G47260 | AT1G47260.1 | TTCGGTTTGG | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
| AT1G47420 | AT1G47420.1 | TTCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: GAMMA CA2 (GAMMA CARBONIC ANHYDRASE 2); carbonate dehydratase (TAIR:AT1G47260.1); Has 85 Blast hits to 85 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G48420 | AT1G48420.1 | CCAAACCGACCCGACCCGA | Encodes an enzyme that decomposes D-cysteine into pyruvate, H2S, and NH3. Only D-cysteine but not L-cysteine was converted by D-CDes to pyruvate, H2S, and NH3. Unlike homologous bacterial enzymes, it does not have 1-aminocyclopropane-1-carboxylate deaminase activity. |
| AT1G49590 | AT1G49590.1 | CCAAACCG | formin-binding protein-related; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 340 Blast hits to 336 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 213; Fungi - 38; Plants - 54; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT1G49590.2 | CCAAACCG | formin-binding protein-related; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 340 Blast hits to 336 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 213; Fungi - 38; Plants - 54; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT1G49670 | AT1G49670.1 | GACCGGTTTGG | molecular function has not been defined. Was shown involved in oxidative stress tolerance. |
| AT1G50050 | AT1G50050.1 | TAATTACGGTTTGG | pathogenesis-related protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, extracellular region; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Ves allergen (InterPro:IPR002413), Allergen V5/Tpx-1 related (InterPro:IPR001283), SCP-like extracellular (InterPro:IPR014044); BEST Arabidopsis thaliana protein match is: pathogenesis-related protein, putative (TAIR:AT1G50060.1); Has 1743 Blast hits to 1713 proteins in 242 species: Archae - 0; Bacteria - 47; Metazoa - 855; Fungi - 195; Plants - 614; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT1G50250 | AT1G50250.1 | CCAAACCGAAC | encodes an FTSH protease that is localized to the chloroplast. Involved in the D1 repair cycle of Photosystem II. FtsH1 and FtsH5 are interchangeable in thylakoid membranes. |
| AT1G50380 | AT1G50380.1 | CCGGTTTATCCAAACCGGAT | prolyl oligopeptidase family protein; FUNCTIONS IN: serine-type peptidase activity, serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S9, prolyl oligopeptidase active site region (InterPro:IPR001375), Peptidase S9A, oligopeptidase, N-terminal beta-propeller (InterPro:IPR004106), Peptidase S9A, prolyl oligopeptidase (InterPro:IPR002470); BEST Arabidopsis thaliana protein match is: prolyl oligopeptidase family protein (TAIR:AT1G69020.1); Has 6063 Blast hits to 6017 proteins in 719 species: Archae - 41; Bacteria - 1884; Metazoa - 253; Fungi - 18; Plants - 99; Viruses - 0; Other Eukaryotes - 3768 (source: NCBI BLink). |
| AT1G52340 | AT1G52340.1 | CGGTTTGG | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
| AT1G52340.1 | CGGTTTGG | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
| AT1G53350 | AT1G53350.1 | TTGAACCGGTTTGG | ATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: defense response, apoptosis; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G35450.1); Has 11361 Blast hits to 10470 proteins in 414 species: Archae - 9; Bacteria - 687; Metazoa - 857; Fungi - 33; Plants - 9637; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT1G56330 | AT1G56330.1 | CGGTTTGG | Encodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol. |
| AT1G57660 | AT1G57660.1 | CCAAACCGAA | 60S ribosomal protein L21 (RPL21E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (TAIR:AT1G57860.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT1G62150 | AT1G62150.1 | ATAAACCGGTTTGG | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G62085.1); Has 429 Blast hits to 366 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 418; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G62600 | AT1G62600.1 | CCAAACCGGTTTAC | flavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960); BEST Arabidopsis thaliana protein match is: flavin-containing monooxygenase family protein / FMO family protein (TAIR:AT1G62620.1); Has 8846 Blast hits to 8478 proteins in 928 species: Archae - 35; Bacteria - 3635; Metazoa - 1030; Fungi - 886; Plants - 455; Viruses - 0; Other Eukaryotes - 2805 (source: NCBI BLink). |
| AT1G65220 | AT1G65220.1 | CGAACCGGTTTGG | eIF4-gamma/eIF5/eIF2-epsilon domain-containing protein; FUNCTIONS IN: binding, translation initiation factor activity; INVOLVED IN: regulation of translational initiation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: eIF4-gamma/eIF5/eIF2-epsilon (InterPro:IPR003307), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: eIF4-gamma/eIF5/eIF2-epsilon domain-containing protein (TAIR:AT5G36230.1); Has 618 Blast hits to 616 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 468; Fungi - 26; Plants - 99; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT1G69460 | AT1G69460.1 | CCAAACCGGTTTAT | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1075 Blast hits to 1073 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 530; Fungi - 308; Plants - 128; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). |
| AT1G72510 | AT1G72510.1 | CCAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G72510.2 | CCAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G72530 | AT1G72530.1 | CCAAACCG | plastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1). |
| AT1G72530.2 | CCAAACCG | plastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1). |
| AT1G73090 | AT1G73090.1 | TTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G76550 | AT1G76550.1 | CCAAACCGAA | pyrophosphate--fructose-6-phosphate 1-phosphotransferase alpha subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, alpha-subunit complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: pyrophosphate--fructose-6-phosphate 1-phosphotransferase-related / pyrophosphate-dependent 6-phosphofructose-1-kinase-related (TAIR:AT1G20950.1); Has 2719 Blast hits to 2653 proteins in 853 species: Archae - 15; Bacteria - 1820; Metazoa - 8; Fungi - 4; Plants - 258; Viruses - 0; Other Eukaryotes - 614 (source: NCBI BLink). |
| AT1G76550.1 | CCAAACCGAA | pyrophosphate--fructose-6-phosphate 1-phosphotransferase alpha subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, alpha-subunit complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: pyrophosphate--fructose-6-phosphate 1-phosphotransferase-related / pyrophosphate-dependent 6-phosphofructose-1-kinase-related (TAIR:AT1G20950.1); Has 2719 Blast hits to 2653 proteins in 853 species: Archae - 15; Bacteria - 1820; Metazoa - 8; Fungi - 4; Plants - 258; Viruses - 0; Other Eukaryotes - 614 (source: NCBI BLink). |
| AT1G79010 | AT1G79010.1 | CGGTTTGG | NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY); FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative (TAIR:AT1G16700.1); Has 7771 Blast hits to 7380 proteins in 1556 species: Archae - 918; Bacteria - 3924; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink). |
| AT1G80410 | AT1G80410.1 | TTGAACCGGTTTGG | EMBRYO DEFECTIVE 2753 (EMB2753); FUNCTIONS IN: binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 3255 Blast hits to 2440 proteins in 375 species: Archae - 356; Bacteria - 819; Metazoa - 489; Fungi - 174; Plants - 61; Viruses - 3; Other Eukaryotes - 1353 (source: NCBI BLink). |
| AT1G80520 | AT1G80520.1 | CCAAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, 4 leaf senescence stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15760.1); Has 30 Blast hits to 30 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G02080 | AT2G02080.1 | CCAAACCG | Arabidopsis thaliana Indeterminate(ID)-Domain 4 (AtIDD4); FUNCTIONS IN: transcription factor activity; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT1G14580.1); Has 43707 Blast hits to 17172 proteins in 249 species: Archae - 2; Bacteria - 145; Metazoa - 41423; Fungi - 218; Plants - 408; Viruses - 5; Other Eukaryotes - 1506 (source: NCBI BLink). |
| AT2G02080.2 | CCAAACCG | Arabidopsis thaliana Indeterminate(ID)-Domain 4 (AtIDD4); FUNCTIONS IN: transcription factor activity; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT1G14580.1); Has 43707 Blast hits to 17172 proteins in 249 species: Archae - 2; Bacteria - 145; Metazoa - 41423; Fungi - 218; Plants - 408; Viruses - 5; Other Eukaryotes - 1506 (source: NCBI BLink). |
| AT2G04540 | AT2G04540.1 | CCAAACCGGAAA | 3-oxoacyl-(acyl-carrier-protein) synthase II, putative; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, fatty-acid synthase activity, catalytic activity; INVOLVED IN: biosynthetic process, fatty acid biosynthetic process, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-ketoacyl synthase (InterPro:IPR000794), Thiolase-like (InterPro:IPR016039), Beta-ketoacyl synthase, C-terminal (InterPro:IPR014031), 3-oxoacyl-[acyl-carrier-protein] synthase 2 (InterPro:IPR017568), Beta-ketoacyl synthase, N-terminal (InterPro:IPR014030), Thiolase-like, subgroup (InterPro:IPR016038), Beta-ketoacyl synthase, active site (InterPro:IPR018201); BEST Arabidopsis thaliana protein match is: FAB1 (FATTY ACID BIOSYNTHESIS 1); 3-oxoacyl-[acyl-carrier-protein] synthase/ fatty-acid synthase (TAIR:AT1G74960.2); Has 19605 Blast hits to 17878 proteins in 2069 species: Archae - 5; Bacteria - 11810; Metazoa - 457; Fungi - 1652; Plants - 223; Viruses - 0; Other Eukaryotes - 5458 (source: NCBI BLink). |
| AT2G05620 | AT2G05620.1 | CCAAACCGAACCGA | Involved in electron flow in Photosystem I. Essential for photoprotection. |
| AT2G05910 | AT2G05910.1 | AACCGAACCCAAACCGAACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20640.1); Has 150 Blast hits to 150 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G16640 | AT2G16640.1 | CCAAACCGAA | MULTIMERIC TRANSLOCON COMPLEX IN THE OUTER ENVELOPE MEMBRANE 132 (TOC132); FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: protein targeting to chloroplast; LOCATED IN: chloroplast outer membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloroplast protein import component Toc86/159 (InterPro:IPR005690), AIG1 (InterPro:IPR006703); BEST Arabidopsis thaliana protein match is: ATTOC120; GTP binding (TAIR:AT3G16620.1); Has 6352 Blast hits to 4186 proteins in 415 species: Archae - 14; Bacteria - 449; Metazoa - 2396; Fungi - 635; Plants - 342; Viruses - 83; Other Eukaryotes - 2433 (source: NCBI BLink). |
| AT2G19680 | AT2G19680.1 | ATAAACCGGTTTGG | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G19680.2 | ATAAACCGGTTTGG | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT2G20050 | AT2G20050.1 | CCAAACCG | ATP binding / cAMP-dependent protein kinase regulator/ catalytic/ protein kinase/ protein serine/threonine phosphatase; FUNCTIONS IN: cAMP-dependent protein kinase regulator activity, protein kinase activity, protein serine/threonine phosphatase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, protein amino acid dephosphorylation, N-terminal protein myristoylation, regulation of protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), cAMP/cGMP-dependent protein kinase (InterPro:IPR002373), Protein phosphatase 2C-related (InterPro:IPR001932), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein kinase, core (InterPro:IPR000719), Cyclic nucleotide-binding-like (InterPro:IPR018490), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G06270.1); Has 47754 Blast hits to 46925 proteins in 1357 species: Archae - 17; Bacteria - 4246; Metazoa - 21070; Fungi - 5337; Plants - 5628; Viruses - 191; Other Eukaryotes - 11265 (source: NCBI BLink). |
| AT2G30000 | AT2G30000.1 | CCGGTTTGG | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G07170.2); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G30280 | AT2G30280.1 | CGGTTTGGGCTTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 44325 Blast hits to 17174 proteins in 814 species: Archae - 92; Bacteria - 12397; Metazoa - 14270; Fungi - 4388; Plants - 1716; Viruses - 607; Other Eukaryotes - 10855 (source: NCBI BLink). |
| AT2G31740 | AT2G31740.1 | TTTCCGGTTCGGTTTGG | methyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: spermidine synthase-related / putrescine aminopropyltransferase-related (TAIR:AT5G04610.1); Has 1448 Blast hits to 1421 proteins in 339 species: Archae - 18; Bacteria - 478; Metazoa - 298; Fungi - 34; Plants - 123; Viruses - 0; Other Eukaryotes - 497 (source: NCBI BLink). |
| AT2G31970 | AT2G31970.1 | CGGTTTGG | RAD50; FUNCTIONS IN: zinc ion binding, ATP binding, nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: chromosome, Mre11 complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc hook, Rad50 (InterPro:IPR013134), Rad50 zinc hook (InterPro:IPR007517), RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395), Recombination/repair protein Rad50 (InterPro:IPR004584); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27595.1); Has 83241 Blast hits to 43267 proteins in 1813 species: Archae - 1109; Bacteria - 10221; Metazoa - 39962; Fungi - 5795; Plants - 2652; Viruses - 436; Other Eukaryotes - 23066 (source: NCBI BLink). |
| AT2G35410 | AT2G35410.1 | CCAAACCGGCCCA | 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT4G09040.2); Has 19540 Blast hits to 13531 proteins in 594 species: Archae - 12; Bacteria - 1397; Metazoa - 10397; Fungi - 2454; Plants - 3010; Viruses - 0; Other Eukaryotes - 2270 (source: NCBI BLink). |
| AT2G35550 | AT2G35550.1 | CGGTTTGGGC | BASIC PENTACYSTEINE 7 (BPC7); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: GAGA binding-like (InterPro:IPR010409); BEST Arabidopsis thaliana protein match is: BPC2 (BASIC PENTACYSTEINE 2); DNA binding / transcription factor (TAIR:AT1G14685.3); Has 130 Blast hits to 130 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G36230 | AT2G36230.1 | CCAAACCGGAATAAACCGA | Encodes a BBMII isomerase involved in histidine biosynthesis. |
| AT2G36240 | AT2G36240.1 | TCGGTTTATTCCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 18740 Blast hits to 5421 proteins in 159 species: Archae - 3; Bacteria - 12; Metazoa - 272; Fungi - 258; Plants - 17650; Viruses - 2; Other Eukaryotes - 543 (source: NCBI BLink). |
| AT2G38550 | AT2G38550.1 | TTCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57280.1); Has 94 Blast hits to 92 proteins in 26 species: Archae - 0; Bacteria - 4; Metazoa - 3; Fungi - 4; Plants - 69; Viruses - 7; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT2G38560 | AT2G38560.1 | CCAAACCG | Encodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy. |
| AT2G39270 | AT2G39270.1 | CCAAACCGGAA | adenylate kinase family protein; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; CONTAINS InterPro DOMAIN/s: Adenylate kinase, subfamily (InterPro:IPR006259), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: ADK (ADENOSINE KINASE); adenylate kinase/ nucleotide kinase (TAIR:AT2G37250.1); Has 8604 Blast hits to 8484 proteins in 1852 species: Archae - 61; Bacteria - 4479; Metazoa - 995; Fungi - 287; Plants - 246; Viruses - 0; Other Eukaryotes - 2536 (source: NCBI BLink). |
| AT2G40085 | AT2G40085.1 | TGGTTCGGTTTGGTTCGGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT2G41110 | AT2G41110.1 | CCAAACCG | Encodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. |
| AT2G43250 | AT2G43250.1 | CCAAACCGAA | unknown protein; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G43510 | AT2G43510.1 | CGGTTTGG | Member of the defensin-like (DEFL) family. Encodes putative trypsin inhibitor protein which may function in defense against herbivory. |
| AT2G46260 | AT2G46260.1 | CCAAACCGGTTAAA | BTB/POZ domain-containing protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: ATPOB1; protein binding (TAIR:AT3G61600.1); Has 3167 Blast hits to 3141 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 3012; Fungi - 0; Plants - 79; Viruses - 9; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT2G46560 | AT2G46560.1 | CCAAACCG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1588 Blast hits to 1099 proteins in 199 species: Archae - 0; Bacteria - 444; Metazoa - 395; Fungi - 420; Plants - 69; Viruses - 0; Other Eukaryotes - 260 (source: NCBI BLink). |
| AT2G46570 | AT2G46570.1 | CGGTTTGG | putative laccase, a member of laccase family of genes (with 17 members in Arabidopsis). |
| AT3G03890 | AT3G03890.1 | CCAAACCGGGTT | FMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT3G03890.2 | CCAAACCGGGTT | FMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT3G04550 | AT3G04550.1 | CGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G28500.1); Has 79 Blast hits to 79 proteins in 37 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G05020 | AT3G05020.1 | CGGTTTGG | encodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light. |
| AT3G06140 | AT3G06140.1 | CCAAACCGGAAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G19080.1); Has 6615 Blast hits to 4433 proteins in 311 species: Archae - 2; Bacteria - 83; Metazoa - 2278; Fungi - 466; Plants - 2616; Viruses - 263; Other Eukaryotes - 907 (source: NCBI BLink). |
| AT3G06610 | AT3G06610.1 | CCGGTTTGG | DNA-binding enhancer protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 145 Blast hits to 145 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 98; Fungi - 15; Plants - 20; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G06760 | AT3G06760.1 | CCAAACCGCGTGAAACGAC | INVOLVED IN: response to water deprivation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: HRB1 (HYPERSENSITIVE TO RED AND BLUE); protein binding (TAIR:AT5G49230.1). |
| AT3G06760.2 | CCAAACCGCGTGAAACGAC | INVOLVED IN: response to water deprivation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: HRB1 (HYPERSENSITIVE TO RED AND BLUE); protein binding (TAIR:AT5G49230.1). |
| AT3G07140 | AT3G07140.1 | CCAAACCG | GPI transamidase component Gpi16 subunit family protein; FUNCTIONS IN: GPI-anchor transamidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gpi16 subunit, GPI transamidase component (InterPro:IPR007245); Has 252 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 88; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G07140.2 | CCAAACCG | GPI transamidase component Gpi16 subunit family protein; FUNCTIONS IN: GPI-anchor transamidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gpi16 subunit, GPI transamidase component (InterPro:IPR007245); Has 252 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 88; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G07670 | AT3G07670.1 | AAACCGAACCAAACCG | SET domain-containing protein; FUNCTIONS IN: [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco methyltransferase (InterPro:IPR011192), SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT5G14260.3); Has 844 Blast hits to 844 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 238; Plants - 226; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT3G09300 | AT3G09300.1 | TTCCGGTTTGG | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 3B (ORP3B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein, conserved site (InterPro:IPR018494), Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: UNE18 (UNFERTILIZED EMBRYO SAC 18); oxysterol binding / sterol binding (TAIR:AT5G02100.1); Has 1795 Blast hits to 1772 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 940; Fungi - 458; Plants - 154; Viruses - 0; Other Eukaryotes - 243 (source: NCBI BLink). |
| AT3G09370 | AT3G09370.1 | GTTCGGTTTGG | putative c-myb-like transcription factor (MYB3R3) mRNA, |
| AT3G09370.2 | GTTCGGTTTGG | putative c-myb-like transcription factor (MYB3R3) mRNA, |
| AT3G09570 | AT3G09570.1 | CCAAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18520.1); Has 385 Blast hits to 385 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 216; Fungi - 12; Plants - 132; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT3G10030 | AT3G10030.1 | TGGTTCGGTTTGG | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). |
| AT3G10030.1 | TTCGGTTTGG | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). |
| AT3G10030.2 | TGGTTCGGTTTGG | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). |
| AT3G10030.2 | TTCGGTTTGG | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). |
| AT3G10050 | AT3G10050.1 | CCAAACCGGTC | first enzyme in the biosynthetic pathway of isoleucine |
| AT3G10060 | AT3G10060.1 | GACCGGTTTGG | immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT1G20810.1); Has 5654 Blast hits to 5251 proteins in 998 species: Archae - 30; Bacteria - 2476; Metazoa - 1330; Fungi - 312; Plants - 488; Viruses - 0; Other Eukaryotes - 1018 (source: NCBI BLink). |
| AT3G11320 | AT3G11320.1 | CCAAACCGAACCGA | organic anion transmembrane transporter; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT5G05820.1); Has 2042 Blast hits to 2037 proteins in 214 species: Archae - 8; Bacteria - 61; Metazoa - 646; Fungi - 307; Plants - 755; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink). |
| AT3G11760 | AT3G11760.1 | CCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04860.1); Has 43 Blast hits to 38 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G12760 | AT3G12760.1 | CAAACCGGTTTGGCGAACCGGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defective in cullin neddylation (InterPro:IPR014764), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Protein of unknown function DUF298 (InterPro:IPR005176), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15860.2); Has 628 Blast hits to 626 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 408; Fungi - 99; Plants - 64; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT3G14220 | AT3G14220.1 | CGGTTTGG | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: ESM1 (epithiospecifier modifier 1); carboxylesterase/ hydrolase, acting on ester bonds (TAIR:AT3G14210.1); Has 1563 Blast hits to 1553 proteins in 83 species: Archae - 0; Bacteria - 93; Metazoa - 1; Fungi - 3; Plants - 1460; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT3G15090 | AT3G15090.1 | TCGGTTCGGTTTGG | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 20659 Blast hits to 20565 proteins in 1484 species: Archae - 253; Bacteria - 11042; Metazoa - 1064; Fungi - 2188; Plants - 463; Viruses - 0; Other Eukaryotes - 5649 (source: NCBI BLink). |
| AT3G16200 | AT3G16200.1 | CCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 70 Blast hits to 70 proteins in 9 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT3G16200.1 | TAACCGGTTTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 70 Blast hits to 70 proteins in 9 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT3G17668 | AT3G17668.1 | GTCCGGTTTGG | ENHANCER OF ATNSI ACTIVITY (ENA); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 103 Blast hits to 95 proteins in 30 species: Archae - 2; Bacteria - 13; Metazoa - 34; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G18890 | AT3G18890.1 | CCAAACCGAA | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: flavin reductase-related (TAIR:AT2G34460.1); Has 22640 Blast hits to 13883 proteins in 1103 species: Archae - 75; Bacteria - 3686; Metazoa - 9197; Fungi - 3839; Plants - 1321; Viruses - 607; Other Eukaryotes - 3915 (source: NCBI BLink). |
| AT3G19640 | AT3G19640.1 | AAAACCGGTTTGG | magnesium transporter CorA-like family protein (MRS2-3); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-1) (TAIR:AT1G16010.2); Has 603 Blast hits to 521 proteins in 126 species: Archae - 0; Bacteria - 31; Metazoa - 102; Fungi - 198; Plants - 203; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT3G20000 | AT3G20000.1 | CCAAACCGG | Encodes a component of the TOM receptor complex responsible for the recognition and translocation of cytosolically synthesized mitochondrial preproteins. With TOM22, functions as the transit peptide receptor at the surface of the mitochondrial outer membrane and facilitates the movement of preproteins into the translocation pore. |
| AT3G20440 | AT3G20440.1 | CGGTTTGG | EMBRYO DEFECTIVE 2729 (EMB2729); FUNCTIONS IN: cation binding, catalytic activity, alpha-amylase activity; INVOLVED IN: embryonic development ending in seed dormancy, carbohydrate metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl hydrolase, family 13, subfamily, catalytic region (InterPro:IPR006589), Glycosyl hydrolase, family 13, all-beta (InterPro:IPR013780), Immunoglobulin E-set (InterPro:IPR014756), Alpha-amylase, C-terminal all beta (InterPro:IPR006048), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycosyl hydrolase, family 13, catalytic region (InterPro:IPR006047); BEST Arabidopsis thaliana protein match is: SBE2.1 (starch branching enzyme 2.1); 1,4-alpha-glucan branching enzyme (TAIR:AT2G36390.1). |
| AT3G20440.2 | CGGTTTGG | EMBRYO DEFECTIVE 2729 (EMB2729); FUNCTIONS IN: cation binding, catalytic activity, alpha-amylase activity; INVOLVED IN: embryonic development ending in seed dormancy, carbohydrate metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl hydrolase, family 13, subfamily, catalytic region (InterPro:IPR006589), Glycosyl hydrolase, family 13, all-beta (InterPro:IPR013780), Immunoglobulin E-set (InterPro:IPR014756), Alpha-amylase, C-terminal all beta (InterPro:IPR006048), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycosyl hydrolase, family 13, catalytic region (InterPro:IPR006047); BEST Arabidopsis thaliana protein match is: SBE2.1 (starch branching enzyme 2.1); 1,4-alpha-glucan branching enzyme (TAIR:AT2G36390.1). |
| AT3G20680 | AT3G20680.1 | CCAAACCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G20680.1 | TTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G20935 | AT3G20935.1 | CCAAACCG | CYP705A28; FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, heme binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401), Cytochrome P450, C-terminal region (InterPro:IPR017973), Cytochrome P450, conserved site (InterPro:IPR017972); BEST Arabidopsis thaliana protein match is: CYP705A30; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding (TAIR:AT3G20940.1). |
| AT3G22845 | AT3G22845.1 | TTTCCGGTTTGG | emp24/gp25L/p24 protein-related; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT3G07680.1); Has 1355 Blast hits to 1355 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 771; Fungi - 319; Plants - 146; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink). |
| AT3G24030 | AT3G24030.1 | CCAAACCG | hydroxyethylthiazole kinase family protein; FUNCTIONS IN: catalytic activity, hydroxyethylthiazole kinase activity; INVOLVED IN: thiamin biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hydroxyethylthiazole kinase (InterPro:IPR000417), Hydroxyethylthiazole kinase, monofunctional (InterPro:IPR011144); Has 1376 Blast hits to 1376 proteins in 593 species: Archae - 84; Bacteria - 1080; Metazoa - 1; Fungi - 85; Plants - 22; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). |
| AT3G24100 | AT3G24100.1 | CCAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Four F5 protein (InterPro:IPR007513); BEST Arabidopsis thaliana protein match is: four F5 protein-related / 4F5 protein-related (TAIR:AT4G13615.1); Has 195 Blast hits to 195 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 136; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G25040 | AT3G25040.1 | CCAAACCG | ER lumen protein retaining receptor, putative / HDEL receptor, putative; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ERD2 (ENDOPLASMIC RETICULUM RETENTION DEFECTIVE 2); KDEL sequence binding / receptor (TAIR:AT1G29330.1); Has 642 Blast hits to 641 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 121; Plants - 119; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). |
| AT3G26630 | AT3G26630.1 | ATCCGGTTTGG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 11770 Blast hits to 4443 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 21; Plants - 11596; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| AT3G46100 | AT3G46100.1 | CCAAACCGGT | histidyl-tRNA synthetase |
| AT3G49500 | AT3G49500.1 | CGGTTTGG | Encodes RNA-dependent RNA polymerase. Involved in trans-acting siRNA and other siRNA biogenesis. Required for post-transcriptional gene silencing and natural virus resistance. |
| AT3G49530 | AT3G49530.1 | CCAAACCGCGT | Arabidopsis NAC domain containing protein 62 (anac062); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: TIP (TCV-INTERACTING PROTEIN); transcription coactivator/ transcription factor (TAIR:AT5G24590.2); Has 1568 Blast hits to 1566 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1568; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G51100 | AT3G51100.1 | TGGTTCGGGTTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G51100.2 | TGGTTCGGGTTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G51100.3 | TGGTTCGGGTTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52420 | AT3G52420.1 | GAAGCCCAAACCGGCCCATTT | encodes a 7 kDa chloroplast outer envelope membrane protein. |
| AT3G52930 | AT3G52930.1 | TCTGACGGTTTGGGCCGT | fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, response to salt stress, pentose-phosphate shunt; LOCATED IN: in 7 components; EXPRESSED IN: 29 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT2G36460.1); Has 4403 Blast hits to 4398 proteins in 740 species: Archae - 0; Bacteria - 427; Metazoa - 1257; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2378 (source: NCBI BLink). |
| AT3G53300 | AT3G53300.1 | CGGTTTGG | putative cytochrome P450 |
| AT3G54363 | AT3G54363.1 | AAAAAGCCAAACCG | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT3G54900 | AT3G54900.1 | CCAAACCGAACCGGAA | A.thaliana PICOT protein.It activates CAX1 gene Calcium transport activity.In other organisms, PICOT proteins appear to play a negative regulatory role in cellular stress responses. |
| AT3G55140 | AT3G55140.1 | CCAAACCGGTTTGG | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G55140.2 | CCAAACCGGTTTGG | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G58970 | AT3G58970.1 | CCAAACCG | magnesium transporter CorA-like family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-6) (TAIR:AT4G28580.1); Has 487 Blast hits to 476 proteins in 123 species: Archae - 2; Bacteria - 17; Metazoa - 63; Fungi - 134; Plants - 201; Viruses - 2; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT3G58970.1 | CCGAACCAAACCG | magnesium transporter CorA-like family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-6) (TAIR:AT4G28580.1); Has 487 Blast hits to 476 proteins in 123 species: Archae - 2; Bacteria - 17; Metazoa - 63; Fungi - 134; Plants - 201; Viruses - 2; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT3G58980 | AT3G58980.1 | ATCCGGTTTGG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58920.1); Has 1321 Blast hits to 1026 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 1320; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G61930 | AT3G61930.1 | AAATACCCAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355 | AT4G00355.1 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.2 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.3 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00355.4 | ACCCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00560 | AT4G00560.1 | CCAAACCGGA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.1 | CCAAACCGGAAA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.2 | CCAAACCGGA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.2 | CCAAACCGGAAA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.3 | CCAAACCGGA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G00560.3 | CCAAACCGGAAA | methionine adenosyltransferase regulatory beta subunit-related; FUNCTIONS IN: dTDP-4-dehydrorhamnose reductase activity, binding, catalytic activity; INVOLVED IN: dTDP-rhamnose biosynthetic process, extracellular polysaccharide biosynthetic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), dTDP-4-dehydrorhamnose reductase (InterPro:IPR005913); Has 5283 Blast hits to 5283 proteins in 1010 species: Archae - 187; Bacteria - 2829; Metazoa - 101; Fungi - 79; Plants - 23; Viruses - 0; Other Eukaryotes - 2064 (source: NCBI BLink). |
| AT4G05460 | AT4G05460.1 | TTCGGTTTGG | F-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT4G11860 | AT4G11860.1 | ACCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF544 (InterPro:IPR007518), Ubiquitin interacting motif (InterPro:IPR003903); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22960.1); Has 761 Blast hits to 466 proteins in 133 species: Archae - 0; Bacteria - 44; Metazoa - 311; Fungi - 246; Plants - 57; Viruses - 0; Other Eukaryotes - 103 (source: NCBI BLink). |
| AT4G13340 | AT4G13340.1 | CCAAACCGTAAACCGGAT | leucine-rich repeat family protein / extensin family protein; FUNCTIONS IN: structural constituent of cell wall, protein binding; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein / extensin family protein (TAIR:AT3G24480.1); Has 527469 Blast hits to 98695 proteins in 2588 species: Archae - 1432; Bacteria - 100230; Metazoa - 200562; Fungi - 58262; Plants - 84057; Viruses - 13216; Other Eukaryotes - 69710 (source: NCBI BLink). |
| AT4G15545 | AT4G15545.1 | CCAAACCGGAA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16520.1); Has 557 Blast hits to 539 proteins in 129 species: Archae - 0; Bacteria - 87; Metazoa - 242; Fungi - 51; Plants - 82; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink). |
| AT4G16630 | AT4G16630.1 | CCAAACCG | DEAD/DEAH box helicase, putative (RH28); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G16280.1); Has 75014 Blast hits to 49574 proteins in 2104 species: Archae - 542; Bacteria - 21437; Metazoa - 22382; Fungi - 7369; Plants - 2826; Viruses - 629; Other Eukaryotes - 19829 (source: NCBI BLink). |
| AT4G17340 | AT4G17340.1 | CGGTTTGGGC | TONOPLAST INTRINSIC PROTEIN 2;2 (TIP2;2); FUNCTIONS IN: water channel activity; INVOLVED IN: transport, response to salt stress; LOCATED IN: plasma membrane, chloroplast, vacuole, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Aquaporin (InterPro:IPR012269), Major intrinsic protein (InterPro:IPR000425); BEST Arabidopsis thaliana protein match is: AtTIP2;3; ammonia transporter/ methylammonium transmembrane transporter/ water channel (TAIR:AT5G47450.1); Has 6879 Blast hits to 6845 proteins in 1255 species: Archae - 57; Bacteria - 2652; Metazoa - 1285; Fungi - 264; Plants - 1472; Viruses - 2; Other Eukaryotes - 1147 (source: NCBI BLink). |
| AT4G18060 | AT4G18060.1 | GACCGGTTTGG | clathrin binding; FUNCTIONS IN: clathrin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neutrophil cytosol factor 2 (InterPro:IPR000108), Src homology-3 domain (InterPro:IPR001452); BEST Arabidopsis thaliana protein match is: SH3 domain-containing protein 2 (SH3P2) (TAIR:AT4G34660.1); Has 2031 Blast hits to 1692 proteins in 137 species: Archae - 0; Bacteria - 6; Metazoa - 1668; Fungi - 93; Plants - 91; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink). |
| AT4G19190 | AT4G19190.1 | CCAAACCGAA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); Has 29640 Blast hits to 15322 proteins in 578 species: Archae - 9; Bacteria - 1666; Metazoa - 14701; Fungi - 2090; Plants - 1417; Viruses - 133; Other Eukaryotes - 9624 (source: NCBI BLink). |
| AT4G21100 | AT4G21100.1 | CCAAACCGGAA | One of two closely related genes similar to a damaged DNA binding protein originally described in mammals. May form a complex with DET1 to regulate photomorphogenesis. Loss of function mutations are lethal. The DDB1b protein binds with a number of DWD-containing proteins and may form part of a CUL4-based E3 ubiquitin ligase. |
| AT4G21105 | AT4G21105.1 | TTCCGGTTTGG | cytochrome-c oxidase/ electron carrier; FUNCTIONS IN: electron carrier activity, cytochrome-c oxidase activity; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIIa (InterPro:IPR003177); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G21105.2 | TTCCGGTTTGG | cytochrome-c oxidase/ electron carrier; FUNCTIONS IN: electron carrier activity, cytochrome-c oxidase activity; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIIa (InterPro:IPR003177); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G21660 | AT4G21660.1 | CCAAACCGGAAA | proline-rich spliceosome-associated (PSP) family protein; INVOLVED IN: mRNA processing; LOCATED IN: nucleus, chloroplast; CONTAINS InterPro DOMAIN/s: PSP, proline-rich (InterPro:IPR006568), Protein of unknown function DUF382 (InterPro:IPR007180); BEST Arabidopsis thaliana protein match is: pliceosome associated protein-related (TAIR:AT1G11520.1); Has 12288 Blast hits to 5916 proteins in 388 species: Archae - 20; Bacteria - 224; Metazoa - 7139; Fungi - 832; Plants - 388; Viruses - 239; Other Eukaryotes - 3446 (source: NCBI BLink). |
| AT4G21710 | AT4G21710.1 | CCAAACCG | Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. |
| AT4G22220 | AT4G22220.1 | CCAAACCGACT | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
| AT4G22380 | AT4G22380.1 | CGGTTTGG | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT5G20160.1); Has 1361 Blast hits to 1361 proteins in 295 species: Archae - 226; Bacteria - 7; Metazoa - 464; Fungi - 191; Plants - 162; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink). |
| AT4G24110 | AT4G24110.1 | CCAAACCGCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; Has 49 Blast hits to 49 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G24830 | AT4G24830.1 | CCAAACCG | arginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink). |
| AT4G24830.2 | CCAAACCG | arginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink). |
| AT4G24840 | AT4G24840.1 | TCCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport, Golgi organization; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: COG complex component, COG2 (InterPro:IPR009316); Has 214 Blast hits to 204 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 56; Plants - 22; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT4G24880 | AT4G24880.1 | CCAAACCG | unknown protein; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; Has 140 Blast hits to 140 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink). |
| AT4G24880.1 | CCAAACCGATCCGGTTCA | unknown protein; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; Has 140 Blast hits to 140 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink). |
| AT4G25620 | AT4G25620.1 | AAGCGCGTGGGTCCAAACCG | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT5G52430.1); Has 844 Blast hits to 627 proteins in 148 species: Archae - 0; Bacteria - 72; Metazoa - 151; Fungi - 122; Plants - 173; Viruses - 60; Other Eukaryotes - 266 (source: NCBI BLink). |
| AT4G25850 | AT4G25850.1 | CCAAACCGGAT | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4B (ORP4B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: ORP4A (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4A); oxysterol binding (TAIR:AT4G25860.1); Has 1645 Blast hits to 1644 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 908; Fungi - 430; Plants - 143; Viruses - 0; Other Eukaryotes - 164 (source: NCBI BLink). |
| AT4G26100 | AT4G26100.1 | CCAAACCGAAC | Encodes a member of the casein kinase 1 protein family that is expressed in punctate particles at the cell periphery suggesting possible plasmodesmatal localization. |
| AT4G27110 | AT4G27110.1 | CGGTTTGG | COBRA-LIKE PROTEIN 11 PRECURSOR (COBL11); INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Glycosyl-phosphatidyl inositol-anchored, plant (InterPro:IPR006918); BEST Arabidopsis thaliana protein match is: COBL10 (COBRA-LIKE PROTEIN 10 PRECURSOR) (TAIR:AT3G20580.1); Has 243 Blast hits to 239 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 243; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G27130 | AT4G27130.1 | CCAAACCG | eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT5G54760.2); Has 620 Blast hits to 617 proteins in 201 species: Archae - 6; Bacteria - 1; Metazoa - 295; Fungi - 109; Plants - 120; Viruses - 3; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT4G27940 | AT4G27940.1 | CCAAACCGAA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G46320.1); Has 13258 Blast hits to 8472 proteins in 324 species: Archae - 0; Bacteria - 0; Metazoa - 6659; Fungi - 3535; Plants - 2092; Viruses - 0; Other Eukaryotes - 972 (source: NCBI BLink). |
| AT4G28590 | AT4G28590.1 | CCAAACCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31840.1); Has 81 Blast hits to 81 proteins in 33 species: Archae - 2; Bacteria - 0; Metazoa - 16; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT4G28980 | AT4G28980.1 | CGGTTTGG | Encodes a CDK-activating kinase that regulates root initial cell differentiation. Phosphorylates CDKD2 and CDKD3, but not CDKD1. Controls CDK activities and basal transcription. |
| AT4G28980.2 | CGGTTTGG | Encodes a CDK-activating kinase that regulates root initial cell differentiation. Phosphorylates CDKD2 and CDKD3, but not CDKD1. Controls CDK activities and basal transcription. |
| AT4G29510 | AT4G29510.1 | TAACCGGTTTGG | Has arginine N-methyltransferase activity. Modifies AtMBD7. |
| AT4G32160 | AT4G32160.1 | CCAAACCGAA | phox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G25350.1); Has 27288 Blast hits to 16752 proteins in 957 species: Archae - 276; Bacteria - 2134; Metazoa - 15048; Fungi - 1956; Plants - 870; Viruses - 159; Other Eukaryotes - 6845 (source: NCBI BLink). |
| AT4G33630 | AT4G33630.1 | CGGTTTGG | EXECUTER1 (EX1); INVOLVED IN: response to singlet oxygen; LOCATED IN: thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27510.1); Has 263 Blast hits to 253 proteins in 71 species: Archae - 0; Bacteria - 6; Metazoa - 96; Fungi - 34; Plants - 52; Viruses - 5; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT4G33630.2 | CGGTTTGG | EXECUTER1 (EX1); INVOLVED IN: response to singlet oxygen; LOCATED IN: thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27510.1); Has 263 Blast hits to 253 proteins in 71 species: Archae - 0; Bacteria - 6; Metazoa - 96; Fungi - 34; Plants - 52; Viruses - 5; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT4G33680 | AT4G33680.1 | CCAAACCGAA | Involved in disease resistance against Pseudomonas syringae. mutants have elevated SA levels, a low level of spontaneous cell death, callose deposition, and enlarged cells in leaves. genetically maps on chr 4 between L23H3 and nga1139. |
| AT4G33690 | AT4G33690.1 | TTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: pollen tube; Has 499 Blast hits to 464 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 283; Fungi - 48; Plants - 38; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). |
| AT4G34265 | AT4G34265.1 | CCAAACCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G15000.3); Has 58 Blast hits to 58 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G34265.2 | CCAAACCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G15000.3); Has 58 Blast hits to 58 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G34430 | AT4G34430.1 | CCAAACCGGT | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34430.2 | CCAAACCGGT | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34430.3 | CCAAACCGGT | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34430.4 | CCAAACCGGT | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G34490 | AT4G34490.1 | ATCCGGTTTGG | CYCLASE ASSOCIATED PROTEIN |
| AT4G35785 | AT4G35785.1 | CCGAACCAAACCGAA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G35785.2 | CCGAACCAAACCGAA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G35785.3 | CCGAACCAAACCGAA | nucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). |
| AT4G38090 | AT4G38090.1 | CCAAACCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0029, N-terminal (InterPro:IPR001498); Has 1854 Blast hits to 1854 proteins in 915 species: Archae - 44; Bacteria - 1618; Metazoa - 34; Fungi - 27; Plants - 22; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). |
| AT4G38090.2 | CCAAACCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0029, N-terminal (InterPro:IPR001498); Has 1854 Blast hits to 1854 proteins in 915 species: Archae - 44; Bacteria - 1618; Metazoa - 34; Fungi - 27; Plants - 22; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). |
| AT4G38090.3 | CCAAACCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0029, N-terminal (InterPro:IPR001498); Has 1854 Blast hits to 1854 proteins in 915 species: Archae - 44; Bacteria - 1618; Metazoa - 34; Fungi - 27; Plants - 22; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). |
| AT4G38380 | AT4G38380.1 | CGGTTTGG | antiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G38330.1); Has 7271 Blast hits to 7248 proteins in 1132 species: Archae - 174; Bacteria - 5061; Metazoa - 70; Fungi - 101; Plants - 194; Viruses - 0; Other Eukaryotes - 1671 (source: NCBI BLink). |
| AT5G02100 | AT5G02100.1 | ATCCGGTTTGGTTCGGTT | Encodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent. |
| AT5G05590 | AT5G05590.1 | TTCGGTTTGGTTCGGTTTAA | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. |
| AT5G05590.2 | TTCGGTTTGGTTCGGTTTAA | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. |
| AT5G06180 | AT5G06180.1 | TTCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1022 (InterPro:IPR009367); BEST Arabidopsis thaliana protein match is: ELM1 (ELONGATED MITOCHONDRIA 1) (TAIR:AT5G22350.1); Has 1314 Blast hits to 1313 proteins in 81 species: Archae - 0; Bacteria - 151; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 1132 (source: NCBI BLink). |
| AT5G06180.2 | TTCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1022 (InterPro:IPR009367); BEST Arabidopsis thaliana protein match is: ELM1 (ELONGATED MITOCHONDRIA 1) (TAIR:AT5G22350.1); Has 1314 Blast hits to 1313 proteins in 81 species: Archae - 0; Bacteria - 151; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 1132 (source: NCBI BLink). |
| AT5G06430 | AT5G06430.1 | TTCGGTTTGG | thioredoxin-related; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: HCF164; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT4G37200.1); Has 165 Blast hits to 164 proteins in 55 species: Archae - 0; Bacteria - 86; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT5G07320 | AT5G07320.1 | CCAAACCGGA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), Mitochondrial substrate carrier (InterPro:IPR001993), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248), Mitochondrial carrier protein (InterPro:IPR002067), EF-HAND 2 (InterPro:IPR018249), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT5G61810.1); Has 25974 Blast hits to 15681 proteins in 989 species: Archae - 0; Bacteria - 9; Metazoa - 12328; Fungi - 6441; Plants - 4249; Viruses - 5; Other Eukaryotes - 2942 (source: NCBI BLink). |
| AT5G07560 | AT5G07560.1 | CCAAACCGAA | Lipid-binding oleosins, glycine-rich protein. |
| AT5G08080 | AT5G08080.1 | CCAAACCGAACCG | member of SYP13 Gene Family |
| AT5G08080.1 | CGGTTTGG | member of SYP13 Gene Family |
| AT5G08080.2 | CCAAACCGAACCG | member of SYP13 Gene Family |
| AT5G08080.2 | CGGTTTGG | member of SYP13 Gene Family |
| AT5G09270 | AT5G09270.1 | CCAAACCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G09270.2 | CCAAACCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10780 | AT5G10780.1 | ACCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT5G10780.2 | ACCGGTTTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT5G10840 | AT5G10840.1 | CCAAACCGGAAA | endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G25100.1); Has 1057 Blast hits to 1040 proteins in 178 species: Archae - 0; Bacteria - 38; Metazoa - 446; Fungi - 142; Plants - 235; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT5G12030 | AT5G12030.1 | CCAAACCGGAT | Encodes a cytosolic small heat shock protein with chaperone activity that is induced by heat and osmotic stress and is also expressed late in seed development. |
| AT5G12040 | AT5G12040.1 | ATCCGGTTTGG | carbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT5G12040.2 | ATCCGGTTTGG | carbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT5G12190 | AT5G12190.1 | CGGTTTGG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G14870.1); Has 4144 Blast hits to 3915 proteins in 315 species: Archae - 0; Bacteria - 181; Metazoa - 2335; Fungi - 721; Plants - 421; Viruses - 0; Other Eukaryotes - 486 (source: NCBI BLink). |
| AT5G13850 | AT5G13850.1 | ACCGGTTTGG | NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 3 (NACA3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT3G12390.1); Has 794 Blast hits to 784 proteins in 197 species: Archae - 0; Bacteria - 0; Metazoa - 341; Fungi - 176; Plants - 104; Viruses - 14; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G14580 | AT5G14580.1 | CCAAACCG | polyribonucleotide nucleotidyltransferase, putative; FUNCTIONS IN: polyribonucleotide nucleotidyltransferase activity, 3'-5'-exoribonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: mRNA catabolic process, RNA processing; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), K Homology, type 1, subgroup (InterPro:IPR018111), Exoribonuclease, phosphorolytic domain 2 (InterPro:IPR015847), S1, RNA binding (InterPro:IPR003029), Polynucleotide phosphorylase, phosphorolytic RNA-binding, bacterial/organelle-type (InterPro:IPR015848), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), K Homology (InterPro:IPR004087), Exoribonuclease, phosphorolytic domain 1 (InterPro:IPR001247), Polyribonucleotide nucleotidyltransferase (InterPro:IPR012162); BEST Arabidopsis thaliana protein match is: RIF10 (resistant to inhibition with FSM 10); 3'-5'-exoribonuclease/ RNA binding / nucleic acid binding / polyribonucleotide nucleotidyltransferase (TAIR:AT3G03710.1); Has 19856 Blast hits to 18048 proteins in 1642 species: Archae - 206; Bacteria - 10090; Metazoa - 440; Fungi - 100; Plants - 266; Viruses - 0; Other Eukaryotes - 8754 (source: NCBI BLink). |
| AT5G14590 | AT5G14590.1 | ATCCGGTTTGG | isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NADP+) activity, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor; INVOLVED IN: isocitrate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NADP-dependent, eukaryotic (InterPro:IPR004790); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative (TAIR:AT1G65930.1); Has 4142 Blast hits to 4125 proteins in 584 species: Archae - 19; Bacteria - 563; Metazoa - 433; Fungi - 160; Plants - 265; Viruses - 0; Other Eukaryotes - 2702 (source: NCBI BLink). |
| AT5G14600 | AT5G14600.1 | CCAAACCGGAT | tRNA (adenine-N1-)-methyltransferase; FUNCTIONS IN: tRNA (adenine-N1-)-methyltransferase activity; INVOLVED IN: tRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: tRNA methyltransferase complex GCD14 subunit (InterPro:IPR014816); Has 1145 Blast hits to 1142 proteins in 382 species: Archae - 132; Bacteria - 313; Metazoa - 135; Fungi - 115; Plants - 30; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink). |
| AT5G15530 | AT5G15530.1 | CGGTTTGG | biotin carboxyl carrier protein isoform 2 (BCCP2) mRNA, |
| AT5G16510 | AT5G16510.1 | TTCGGTTTGG | reversibly glycosylated polypeptide, putative; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: response to salt stress; LOCATED IN: Golgi apparatus, cell junction, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1,4-glucan-protein synthase, UDP-forming (InterPro:IPR004901); BEST Arabidopsis thaliana protein match is: RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1); cellulose synthase (UDP-forming) (TAIR:AT3G02230.1); Has 134 Blast hits to 133 proteins in 31 species: Archae - 12; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G16510.2 | TTCGGTTTGG | reversibly glycosylated polypeptide, putative; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: response to salt stress; LOCATED IN: Golgi apparatus, cell junction, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1,4-glucan-protein synthase, UDP-forming (InterPro:IPR004901); BEST Arabidopsis thaliana protein match is: RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1); cellulose synthase (UDP-forming) (TAIR:AT3G02230.1); Has 134 Blast hits to 133 proteins in 31 species: Archae - 12; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G17150 | AT5G17150.1 | CCAAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf whorl, embryo, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cystatin-related, plant (InterPro:IPR006525); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17120.1); Has 23 Blast hits to 23 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G17150.1 | CCAAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf whorl, embryo, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cystatin-related, plant (InterPro:IPR006525); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17120.1); Has 23 Blast hits to 23 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G17270 | AT5G17270.1 | CCAAACCGGAT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G37130.1); Has 5379 Blast hits to 3587 proteins in 480 species: Archae - 397; Bacteria - 1752; Metazoa - 604; Fungi - 281; Plants - 148; Viruses - 0; Other Eukaryotes - 2197 (source: NCBI BLink). |
| AT5G18100 | AT5G18100.1 | ATCCGGTTTGG | A putative peroxisomal CuZnSOD inducible by a high-light pulse. |
| AT5G18100.2 | ATCCGGTTTGG | A putative peroxisomal CuZnSOD inducible by a high-light pulse. |
| AT5G18200 | AT5G18200.1 | TTCGGTTTGG | encodes an adenylyltransferase |
| AT5G18400 | AT5G18400.1 | CCAAACCGCGTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G18400.2 | CCAAACCGCGTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G18400.3 | CCAAACCGCGTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G18440 | AT5G18440.1 | TTAACCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). |
| AT5G18440.2 | TTAACCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). |
| AT5G18475 | AT5G18475.1 | CCAAACCG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19623 Blast hits to 5874 proteins in 176 species: Archae - 4; Bacteria - 16; Metazoa - 456; Fungi - 363; Plants - 18095; Viruses - 0; Other Eukaryotes - 689 (source: NCBI BLink). |
| AT5G18475.1 | CCAAACCG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19623 Blast hits to 5874 proteins in 176 species: Archae - 4; Bacteria - 16; Metazoa - 456; Fungi - 363; Plants - 18095; Viruses - 0; Other Eukaryotes - 689 (source: NCBI BLink). |
| AT5G19660 | AT5G19660.1 | CCAAACCGAACCA | S1P appears to function as a Golgi-localized subtilase and to help protect seedlings against salt and osmotic stress. The roots of s1p-3 mutants are hypersensitive to NaCl, KCl, LiCl, and mannitol. Several salt-stress responsive genes show weaker induction in an s1P-3 mutant background. The proteolytic cleavage of the bZIP17 transcription factor depends on S1P in vitro. And there is evidence that S1P can cleave bZIP17 in vitro. |
| AT5G19670 | AT5G19670.1 | TGGTTCGGTTTGG | exostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT5G25820.1); Has 802 Blast hits to 800 proteins in 88 species: Archae - 0; Bacteria - 10; Metazoa - 236; Fungi - 4; Plants - 470; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). |
| AT5G19690 | AT5G19690.1 | CGGTTTGGAAAGTCAA | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions |
| AT5G20090 | AT5G20090.1 | TCCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G20090.2 | TCCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G20090.3 | TCCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22310.1); Has 657 Blast hits to 656 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 314; Fungi - 175; Plants - 98; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G20140 | AT5G20140.1 | CCAAACCGAACCGA | SOUL heme-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790), SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT3G10130.1); Has 1348 Blast hits to 1346 proteins in 137 species: Archae - 10; Bacteria - 204; Metazoa - 88; Fungi - 0; Plants - 111; Viruses - 0; Other Eukaryotes - 935 (source: NCBI BLink). |
| AT5G20520 | AT5G20520.1 | CGGTTTGG | Encodes a Bem46-like protein. WAV2 negatively regulates root bending when roots alter their growth direction. It's not involved in sensing environmental stimuli (e.g. gravity, light, water, touch). |
| AT5G20910 | AT5G20910.1 | CCAAACCGAAC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G19950.1); Has 6524 Blast hits to 6509 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2244; Fungi - 556; Plants - 2592; Viruses - 49; Other Eukaryotes - 1083 (source: NCBI BLink). |
| AT5G20910.1 | CGGTTTGG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G19950.1); Has 6524 Blast hits to 6509 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2244; Fungi - 556; Plants - 2592; Viruses - 49; Other Eukaryotes - 1083 (source: NCBI BLink). |
| AT5G20910.1 | TTGAACCGAACCAAACCGAAC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G19950.1); Has 6524 Blast hits to 6509 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2244; Fungi - 556; Plants - 2592; Viruses - 49; Other Eukaryotes - 1083 (source: NCBI BLink). |
| AT5G20980 | AT5G20980.1 | TTCGGTTTGG | encodes a plastidic methionine synthase, involved in methionine de novo synthesis in the chloroplast |
| AT5G20980.1 | TTCGGTTTGG | encodes a plastidic methionine synthase, involved in methionine de novo synthesis in the chloroplast |
| AT5G20980.2 | TTCGGTTTGG | encodes a plastidic methionine synthase, involved in methionine de novo synthesis in the chloroplast |
| AT5G20980.2 | TTCGGTTTGG | encodes a plastidic methionine synthase, involved in methionine de novo synthesis in the chloroplast |
| AT5G22360 | AT5G22360.1 | CCAAACCGAA | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family. |
| AT5G23340 | AT5G23340.1 | CCAAACCG | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL4) (TAIR:AT4G15475.1); Has 9095 Blast hits to 3545 proteins in 210 species: Archae - 0; Bacteria - 454; Metazoa - 4575; Fungi - 774; Plants - 2118; Viruses - 15; Other Eukaryotes - 1159 (source: NCBI BLink). |
| AT5G24320 | AT5G24320.1 | CGGTTTGG | WD-40 repeat family protein; FUNCTIONS IN: signal transducer activity; INVOLVED IN: signal transduction; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein (TAIR:AT5G53500.1); Has 19366 Blast hits to 12310 proteins in 508 species: Archae - 52; Bacteria - 3690; Metazoa - 8156; Fungi - 3441; Plants - 1498; Viruses - 3; Other Eukaryotes - 2526 (source: NCBI BLink). |
| AT5G24320.2 | CGGTTTGG | WD-40 repeat family protein; FUNCTIONS IN: signal transducer activity; INVOLVED IN: signal transduction; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein (TAIR:AT5G53500.1); Has 19366 Blast hits to 12310 proteins in 508 species: Archae - 52; Bacteria - 3690; Metazoa - 8156; Fungi - 3441; Plants - 1498; Viruses - 3; Other Eukaryotes - 2526 (source: NCBI BLink). |
| AT5G26110 | AT5G26110.1 | CCAAACCGAAC | ATP binding / catalytic/ protein kinase; FUNCTIONS IN: protein kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), RIO-like kinase (InterPro:IPR018934), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08120.1); Has 1182 Blast hits to 1178 proteins in 337 species: Archae - 148; Bacteria - 370; Metazoa - 229; Fungi - 137; Plants - 43; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). |
| AT5G26110.2 | CCAAACCGAAC | ATP binding / catalytic/ protein kinase; FUNCTIONS IN: protein kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), RIO-like kinase (InterPro:IPR018934), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08120.1); Has 1182 Blast hits to 1178 proteins in 337 species: Archae - 148; Bacteria - 370; Metazoa - 229; Fungi - 137; Plants - 43; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). |
| AT5G27430 | AT5G27430.1 | CGGTTTGG | signal peptidase subunit family protein; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal peptidase 22 kDa subunit (InterPro:IPR007653); BEST Arabidopsis thaliana protein match is: signal peptidase subunit family protein (TAIR:AT3G05230.1); Has 297 Blast hits to 297 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 87; Plants - 44; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
| AT5G27430.1 | CGGTTTGG | signal peptidase subunit family protein; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal peptidase 22 kDa subunit (InterPro:IPR007653); BEST Arabidopsis thaliana protein match is: signal peptidase subunit family protein (TAIR:AT3G05230.1); Has 297 Blast hits to 297 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 87; Plants - 44; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
| AT5G27440 | AT5G27440.1 | TTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: shoot, shoot apex, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; Has 3 Blast hits to 3 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G27450 | AT5G27450.1 | CCAAACCGAA | Encodes a protein with mevalonate kinase activity involved in the mevalonate pathway. |
| AT5G27450.2 | CCAAACCGAA | Encodes a protein with mevalonate kinase activity involved in the mevalonate pathway. |
| AT5G28350 | AT5G28350.1 | CCAAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1339 (InterPro:IPR009771), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61480.1); Has 271 Blast hits to 226 proteins in 106 species: Archae - 0; Bacteria - 9; Metazoa - 133; Fungi - 64; Plants - 30; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT5G28350.2 | CCAAACCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1339 (InterPro:IPR009771), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61480.1); Has 271 Blast hits to 226 proteins in 106 species: Archae - 0; Bacteria - 9; Metazoa - 133; Fungi - 64; Plants - 30; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT5G28500 | AT5G28500.1 | CCAAACCGGTTTAAATCCGGTTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04550.1); Has 79 Blast hits to 79 proteins in 36 species: Archae - 0; Bacteria - 52; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G35320 | AT5G35320.1 | CCAAACCGGAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G37850 | AT5G37850.2 | CCAAACCGAA | Encodes a pyridoxal kinase required for root hair development. Mutants are hypersensitive to Na+, K+ and Li+. |
| AT5G41140 | AT5G41140.1 | TTCGGTTTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G63300.1); Has 134231 Blast hits to 67045 proteins in 2157 species: Archae - 1495; Bacteria - 17732; Metazoa - 63246; Fungi - 9993; Plants - 4740; Viruses - 695; Other Eukaryotes - 36330 (source: NCBI BLink). |
| AT5G43280 | AT5G43280.1 | CCAAACCGGAAA | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. |
| AT5G43280.2 | CCAAACCGGAAA | Encodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. |
| AT5G44070 | AT5G44070.1 | CCAAACCGAA | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. |
| AT5G44070.1 | CCAAACCGGAT | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. |
| AT5G45620 | AT5G45620.1 | CCAAACCGGAAA | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G45620.2 | CCAAACCGGAAA | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G45930 | AT5G45930.1 | CCAAACCGAA | encodes a second Chl I gene (CHLI2), a subunit of magnesium chelatase which is required for chlorophyll biosynthesis. Has ATPase activity, regulated by TRX-f. Involved in the assembly of the Mg chelatase complex. |
| AT5G47450 | AT5G47450.1 | CGGTTTGGGC | Tonoplast intrinsic protein, transports ammonium (NH3) and methylammonium across the tonoplast membrane, gene expression shows diurnal regulation and is upregulated by ammonium (NH3). |
| AT5G49230 | AT5G49230.1 | TTCGGTTTGG | Identified in a screen for mutations hypersensitive to red and blue light. Mutants have shorter hypocotyls. Encodes a nuclear localized protein with similarity to drought induced proteins. Contains a ZZ zinc finger domain which is thought to mediate protein-protein interactions.May be involved in red and blue light signal transduction. |
| AT5G51350 | AT5G51350.1 | TGGTTCGGTTTGG | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G61480.1); Has 68844 Blast hits to 28909 proteins in 838 species: Archae - 29; Bacteria - 3219; Metazoa - 20839; Fungi - 694; Plants - 39080; Viruses - 14; Other Eukaryotes - 4969 (source: NCBI BLink). |
| AT5G52430 | AT5G52430.1 | CCAAACCG | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G25620.1); Has 849 Blast hits to 464 proteins in 107 species: Archae - 2; Bacteria - 43; Metazoa - 236; Fungi - 114; Plants - 84; Viruses - 9; Other Eukaryotes - 361 (source: NCBI BLink). |
| AT5G52540 | AT5G52540.1 | TTCGGTTTGG | unknown protein; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF819 (InterPro:IPR008537); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24000.1); Has 519 Blast hits to 519 proteins in 137 species: Archae - 2; Bacteria - 275; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 208 (source: NCBI BLink). |
| AT5G53620 | AT5G53620.1 | CCAAACCGAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.1 | CCAAACCGAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.1 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.1 | TTCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.2 | CCAAACCGAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.2 | CCAAACCGAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.2 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.2 | TTCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.3 | CCAAACCGAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.3 | CCAAACCGAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.3 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.3 | TTCGGTTTGG | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G54900 | AT5G54900.1 | CCAAACCGGTC | RNA-binding protein 45A (ATRBP45A); FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 26274 Blast hits to 15473 proteins in 616 species: Archae - 10; Bacteria - 1663; Metazoa - 15334; Fungi - 2743; Plants - 3912; Viruses - 0; Other Eukaryotes - 2612 (source: NCBI BLink). |
| AT5G60930 | AT5G60930.1 | CGGTTTGG | chromosome-associated kinesin, putative; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: FRA1 (FRAGILE FIBER 1); microtubule motor (TAIR:AT5G47820.2); Has 57499 Blast hits to 37773 proteins in 1353 species: Archae - 400; Bacteria - 4055; Metazoa - 29566; Fungi - 4402; Plants - 2518; Viruses - 179; Other Eukaryotes - 16379 (source: NCBI BLink). |
| AT5G62050 | AT5G62050.1 | CCAAACCGAAC | essential factor for protein sorting and assembly into membranes |
| AT5G62060 | AT5G62060.1 | GTTCGGTTTGG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 3 (InterPro:IPR013187), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G32420.1); Has 662 Blast hits to 644 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 662; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G62390 | AT5G62390.1 | CCAAACCGGAT | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G62920 | AT5G62920.1 | CGGTTTGG | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. |
| AT5G63870 | AT5G63870.1 | TTAAACCGGCCGGTTTGG | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G63870.2 | TTAAACCGGCCGGTTTGG | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G63870.3 | TTAAACCGGCCGGTTTGG | Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling. |
| AT5G64370 | AT5G64370.1 | CCAAACCG | PYD3 encodes a beta-ureidopropionase which, when expressed in E. coli, has been shown to convert beta-ureidopropionate into beta-alanine. |
| AT5G65925 | AT5G65925.1 | CCAAACCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49820.1); Has 15 Blast hits to 15 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G66140 | AT5G66140.1 | CGGTTTGG | Encodes alpha5 subunit of 20S proteosome complex involved in protein degradation. |