version

Summary of AtREG555 (All List)

OrganismArabidopsis thaliana  
IDAtREG555  
SequenceATCGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE MotifGGGCC  one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);  
Total Entry Count105  

Entry Sequences (105 entries)

LocusGene modelSequenceDescription
AT1G02690AT1G02690.1GTTGGGCCGATATTGGGCTAAPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. 
AT1G02690.2GTTGGGCCGATATTGGGCTAAPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. 
AT1G04930AT1G04930.1AATACCCTCAGGCCCAGATCGGCCCAAAAhydroxyproline-rich glycoprotein family protein; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT2G32840.1); Has 1563 Blast hits to 1268 proteins in 183 species: Archae - 0; Bacteria - 127; Metazoa - 510; Fungi - 165; Plants - 332; Viruses - 182; Other Eukaryotes - 247 (source: NCBI BLink). 
AT1G04940AT1G04940.1TTTTGGGCCGATCTGGGCCTGAGGGTATTTic20 is believed to function as a component of the protein-conducting channel at the inner envelope membrane. Genes AT1G04940 and AT1G04945 were switched for the TAIR7 genome release to give consistency with MIPs annotation. 
AT1G06220AT1G06220.1AATTGGGCCGATEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS. 
AT1G06220.2AATTGGGCCGATEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS. 
AT1G07000AT1G07000.1ATCGGCCCATAAA member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. 
AT1G07070AT1G07070.1GGGCCGAT60S ribosomal protein L35a (RPL35aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aC) (TAIR:AT1G74270.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). 
AT1G07140AT1G07140.1ATCGGCCCATAEncodes a putative Ran-binding protein (siRanBP). 
AT1G08640AT1G08640.1ATTGGGCCGATunknown protein; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 54 Blast hits to 54 proteins in 19 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT1G09140AT1G09140.1ATATGGGCCGATEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. 
AT1G09140.2ATATGGGCCGATEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. 
AT1G09150AT1G09150.1ATCGGCCCATATpseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink). 
AT1G09800AT1G09800.1TGTGGGCCATCGGCCCACAtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT3G06950.1); Has 6844 Blast hits to 5672 proteins in 1445 species: Archae - 71; Bacteria - 3683; Metazoa - 118; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2917 (source: NCBI BLink). 
AT1G09815AT1G09815.1CAATGGGCCGATPOLYMERASE DELTA 4 (POLD4); FUNCTIONS IN: DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase delta, subunit 4 (InterPro:IPR007218); Has 137 Blast hits to 137 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 58; Plants - 33; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G12810AT1G12810.1ATCGGCCCAAATCCAATAAGproline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages. 
AT1G12810.2ATCGGCCCAAATCCAATAAGproline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages. 
AT1G13060AT1G13060.1ATCGGCCCATTAAEncodes 20S proteasome beta subunit PBE1 (PBE1). 
AT1G14250AT1G14250.1ATCGGCCCACAnucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14240.4); Has 1087 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 20; Metazoa - 530; Fungi - 212; Plants - 197; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). 
AT1G15720AT1G15720.1TTATGGGCCGATArabidopsis thaliana myb family transcription factor (At1g15720) 
AT1G21190AT1G21190.1ATATTGGGCCGATsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G76860.1); Has 924 Blast hits to 924 proteins in 209 species: Archae - 244; Bacteria - 0; Metazoa - 275; Fungi - 141; Plants - 102; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink). 
AT1G21200AT1G21200.1ATCGGCCCAATATtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76870.1); Has 251 Blast hits to 233 proteins in 48 species: Archae - 2; Bacteria - 24; Metazoa - 66; Fungi - 2; Plants - 75; Viruses - 9; Other Eukaryotes - 73 (source: NCBI BLink). 
AT1G22520AT1G22520.1ATAAGGCCCATTAATCGGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1). 
AT1G22520.2ATAAGGCCCATTAATCGGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1). 
AT1G23205AT1G23205.1TCAGGCCCAGATCGGCCCATTAAinvertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G70720.1); Has 417 Blast hits to 412 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 417; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G23360AT1G23360.1CTTATTGGGCCTAAAATCGGCCCAATATUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink). 
AT1G23360.2CTTATTGGGCCTAAAATCGGCCCAATATUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink). 
AT1G23360.3CTTATTGGGCCTAAAATCGGCCCAATATUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink). 
AT1G25260AT1G25260.1ATCGGCCCAGAacidic ribosomal protein P0-related; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 809 Blast hits to 807 proteins in 249 species: Archae - 78; Bacteria - 0; Metazoa - 294; Fungi - 172; Plants - 102; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink). 
AT1G29060AT1G29060.1ATCGGCCCGTTAAAAAAGCCCATAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14600.1); Has 95 Blast hits to 95 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 15; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G56460AT1G56460.1TAATGGGCCGATPAPA-1-like family protein / zinc finger (HIT type) family protein; FUNCTIONS IN: protein binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT2G47350.1); Has 6344 Blast hits to 4558 proteins in 417 species: Archae - 6; Bacteria - 427; Metazoa - 2467; Fungi - 794; Plants - 231; Viruses - 26; Other Eukaryotes - 2393 (source: NCBI BLink). 
AT1G61450AT1G61450.1ATTGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61415.1); Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G74260AT1G74260.1ATCGGCCCTTAGGCCCATTAGEncodes formylglycinamidine ribonucleotide synthase an enzyme involved in de novo purine biosynthesis. PUR4 is localizes to the chloroplast and mitochondria. Loss of PUR4 function affects male but not female gametophyte development. 
AT1G74970AT1G74970.1TTAATGGGCTCTAATGGGCCGATribosomal protein S9, nuclear encoded component of the chloroplast ribosome 
AT1G76300AT1G76300.1CTAATGGGCCGATsnRNP core protein SmD3 (SmD3); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nuclear body, nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 890 Blast hits to 890 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 227; Plants - 127; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). 
AT1G78870AT1G78870.1ATCGGCCCAACUBC35/UBC13A encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UBC35/UBC13A can form diubiquitin and triubiquitin chains in combination with MMZ1,2,3,4/(UEV1A,B,C,D) in vitro. It can also functionally complement an mms2 ubc13 mutation in budding yeast by increasing the double mutant's viability in the presence of the DNA damaging agent MMS, when it is co-expressed with MMZ / UEV1 genes. A wild type phenotype is restored with MMZ3/UEV1C and MMZ4/UEV1D, but only partial complementation is achieved with MMZ1/UEV1A or MMZ2/UEV1B. 
AT1G78870.2ATCGGCCCAACUBC35/UBC13A encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UBC35/UBC13A can form diubiquitin and triubiquitin chains in combination with MMZ1,2,3,4/(UEV1A,B,C,D) in vitro. It can also functionally complement an mms2 ubc13 mutation in budding yeast by increasing the double mutant's viability in the presence of the DNA damaging agent MMS, when it is co-expressed with MMZ / UEV1 genes. A wild type phenotype is restored with MMZ3/UEV1C and MMZ4/UEV1D, but only partial complementation is achieved with MMZ1/UEV1A or MMZ2/UEV1B. 
AT1G78870.3ATCGGCCCAACUBC35/UBC13A encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UBC35/UBC13A can form diubiquitin and triubiquitin chains in combination with MMZ1,2,3,4/(UEV1A,B,C,D) in vitro. It can also functionally complement an mms2 ubc13 mutation in budding yeast by increasing the double mutant's viability in the presence of the DNA damaging agent MMS, when it is co-expressed with MMZ / UEV1 genes. A wild type phenotype is restored with MMZ3/UEV1C and MMZ4/UEV1D, but only partial complementation is achieved with MMZ1/UEV1A or MMZ2/UEV1B. 
AT1G80550AT1G80550.1ATCGGCCCAAATpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink). 
AT2G02910AT2G02910.1TGTGGGCCGATGGCCCACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: EMB2756 (EMBRYO DEFECTIVE 2756) (TAIR:AT1G34550.1); Has 191 Blast hits to 191 proteins in 22 species: Archae - 6; Bacteria - 21; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). 
AT2G14660AT2G14660.1ATCGGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0310 (InterPro:IPR002740); Has 2334 Blast hits to 2333 proteins in 479 species: Archae - 5; Bacteria - 781; Metazoa - 60; Fungi - 50; Plants - 22; Viruses - 0; Other Eukaryotes - 1416 (source: NCBI BLink). 
AT2G17670AT2G17670.1TTTGGGCCGATpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink). 
AT2G17670.2TTTGGGCCGATpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink). 
AT2G20410AT2G20410.1TGGGCCGATactivating signal cointegrator-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ASCH domain (InterPro:IPR007374); Has 193 Blast hits to 192 proteins in 83 species: Archae - 2; Bacteria - 44; Metazoa - 93; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT2G20410.1TGTGGGCCATCGGCCCACAactivating signal cointegrator-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ASCH domain (InterPro:IPR007374); Has 193 Blast hits to 192 proteins in 83 species: Archae - 2; Bacteria - 44; Metazoa - 93; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT2G21150AT2G21150.1AAAAGCCCAATTATTGGGCCGATXAP5 family protein involved in light regulation of the circadian clock and photomorphogenesis. Nuclear localized. 
AT2G21410AT2G21410.1ATATGGGCCGATVacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. 
AT2G23780AT2G23780.1ATCGGCCCAATAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G19310.1); Has 2997 Blast hits to 2989 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 1936; Fungi - 317; Plants - 374; Viruses - 17; Other Eukaryotes - 353 (source: NCBI BLink). 
AT2G34250AT2G34250.1ATCGGCCCAATprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). 
AT2G34250.2ATCGGCCCAATprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). 
AT2G34520AT2G34520.1TAGTGGGCCGATnuclear-encoded mitochondrial ribosomal protein S14 
AT2G42780AT2G42780.1GGGCCGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of transcription; LOCATED IN: integral to membrane, nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase II transcription factor SIII, subunit A (InterPro:IPR010684); Has 143 Blast hits to 142 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 19; Plants - 18; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT2G47580AT2G47580.1ATCGGCCCACTAencodes spliceosomal protein U1A 
AT3G05280AT3G05280.1TAGTGGGCCGATintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 381 Blast hits to 380 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 69; Plants - 47; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT3G06540AT3G06540.1AGATGGGCCATGTTGGGCCGATGDP dissociation inhibitor family protein / Rab GTPase activator family protein; FUNCTIONS IN: RAB GDP-dissociation inhibitor activity; INVOLVED IN: intracellular protein transport, regulation of GTPase activity, protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rab GTPase activator (InterPro:IPR002005), Rab protein geranylgeranyltransferase component A, eukaryota (InterPro:IPR016664), Yeast Mrs6p protein (InterPro:IPR000632), GDP dissociation inhibitor (InterPro:IPR018203); BEST Arabidopsis thaliana protein match is: ATGDI1 (ARABIDOPSIS THALIANA GUANOSINE NUCLEOTIDE DIPHOSPHATE DISSOCIATION INHIBITOR 1); RAB GDP-dissociation inhibitor (TAIR:AT2G44100.2); Has 948 Blast hits to 858 proteins in 184 species: Archae - 0; Bacteria - 2; Metazoa - 512; Fungi - 195; Plants - 103; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). 
AT3G06610AT3G06610.1GGGCCGATDNA-binding enhancer protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 145 Blast hits to 145 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 98; Fungi - 15; Plants - 20; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT3G08640AT3G08640.1CGCACGTGGGAAATGGGCCGATalphavirus core protein family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G08630.1); Has 10912 Blast hits to 4701 proteins in 450 species: Archae - 4; Bacteria - 2405; Metazoa - 4145; Fungi - 556; Plants - 2369; Viruses - 93; Other Eukaryotes - 1340 (source: NCBI BLink). 
AT3G11120AT3G11120.1ATCGGCCCAATAT60S ribosomal protein L41 (RPL41E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT3G11200AT3G11200.1ATTTGGGCCGATAL2 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. 
AT3G11200.2ATTTGGGCCGATAL2 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. 
AT3G13290AT3G13290.1TATGGGCCGATVARICOSE-RELATED (VCR); FUNCTIONS IN: nucleotide binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: VCS (VARICOSE); nucleotide binding / protein homodimerization (TAIR:AT3G13300.1); Has 812 Blast hits to 636 proteins in 176 species: Archae - 4; Bacteria - 160; Metazoa - 282; Fungi - 137; Plants - 80; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). 
AT3G15420AT3G15420.1ATCGGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80745.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G15430AT3G15430.1GGGCCGATregulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink). 
AT3G15430.2GGGCCGATregulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink). 
AT3G18940AT3G18940.1ATCGGCCCAAATclast3-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP010044 (InterPro:IPR016562); Has 170 Blast hits to 170 proteins in 73 species: Archae - 1; Bacteria - 0; Metazoa - 98; Fungi - 37; Plants - 26; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT3G21790AT3G21790.1ATCGGCCCAACAUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71B8 (UDP-GLUCOSYL TRANSFERASE 71B8); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ quercetin 4'-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT3G21800.1); Has 4493 Blast hits to 4475 proteins in 265 species: Archae - 0; Bacteria - 82; Metazoa - 1698; Fungi - 10; Plants - 2668; Viruses - 11; Other Eukaryotes - 24 (source: NCBI BLink). 
AT3G26560AT3G26560.1ATCGGCCCAAATATP-dependent RNA helicase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cytosol, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Region of unknown function DUF1605 (InterPro:IPR011709), S1, RNA binding (InterPro:IPR003029), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 44749 Blast hits to 27526 proteins in 1894 species: Archae - 128; Bacteria - 7760; Metazoa - 17585; Fungi - 4781; Plants - 2372; Viruses - 1049; Other Eukaryotes - 11074 (source: NCBI BLink). 
AT3G27520AT3G27520.1ATCGGCCCATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G46720AT3G46720.1GGGCCGATUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf whorl, hypocotyl, flower, root; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT3G46690.1); Has 4581 Blast hits to 4560 proteins in 297 species: Archae - 0; Bacteria - 117; Metazoa - 1697; Fungi - 9; Plants - 2672; Viruses - 65; Other Eukaryotes - 21 (source: NCBI BLink). 
AT3G52090AT3G52090.1ATCGGCCCNon-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB11 and the E. oli RNA polymerase alpha subunit. 
AT3G56820AT3G56820.1TGTGGGCCATCGGCCCACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT3G63250AT3G63250.1ATTGGGCCGATEncodes a homocysteine methyltransferase (HMT). Among the three HMT coding genes in the genome, HMT2 is responsible for a significant proportion of HMT activity in the flower stalks and silique hulls. However, HMT2 does not significantly contribute to the total HMT activity in seeds. 
AT3G63250.2ATTGGGCCGATEncodes a homocysteine methyltransferase (HMT). Among the three HMT coding genes in the genome, HMT2 is responsible for a significant proportion of HMT activity in the flower stalks and silique hulls. However, HMT2 does not significantly contribute to the total HMT activity in seeds. 
AT4G01940AT4G01940.1ATCGGCCCATTTEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast. 
AT4G11380AT4G11380.1ATCGGCCCGTTAbeta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink). 
AT4G12620AT4G12620.1ATCGGCCCAAAAOrigin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime. 
AT4G12640AT4G12640.1TTTTGGGCCGATRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: FPA; RNA binding (TAIR:AT2G43410.4); Has 6679 Blast hits to 5578 proteins in 311 species: Archae - 8; Bacteria - 143; Metazoa - 3956; Fungi - 1074; Plants - 834; Viruses - 0; Other Eukaryotes - 664 (source: NCBI BLink). 
AT4G20300AT4G20300.1TAGTGGGCCTGATAATGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT4G20300.2TAGTGGGCCTGATAATGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT4G24370AT4G24370.1GGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT4G24380AT4G24380.1ATCGGCCCunknown protein; INVOLVED IN: 10-formyltetrahydrofolate biosynthetic process, folic acid and derivative biosynthetic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65400.1); Has 484 Blast hits to 484 proteins in 112 species: Archae - 0; Bacteria - 2; Metazoa - 89; Fungi - 296; Plants - 68; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT4G24380.2ATCGGCCCunknown protein; INVOLVED IN: 10-formyltetrahydrofolate biosynthetic process, folic acid and derivative biosynthetic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65400.1); Has 484 Blast hits to 484 proteins in 112 species: Archae - 0; Bacteria - 2; Metazoa - 89; Fungi - 296; Plants - 68; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT4G28540AT4G28540.1GTTTGGGCCGATCASEIN KINASE I-LIKE 6 (CKL6); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasmodesma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ADK1 (dual specificity kinase 1); kinase/ protein serine/threonine/tyrosine kinase (TAIR:AT1G03930.1); Has 46100 Blast hits to 45721 proteins in 1424 species: Archae - 12; Bacteria - 5612; Metazoa - 19980; Fungi - 4668; Plants - 5911; Viruses - 338; Other Eukaryotes - 9579 (source: NCBI BLink). 
AT4G31790AT4G31790.1GGGCCGATdiphthine synthase, putative (DPH5); FUNCTIONS IN: methyltransferase activity, diphthine synthase activity; INVOLVED IN: peptidyl-diphthamide biosynthetic process from peptidyl-histidine, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Diphthine synthase (InterPro:IPR004551), Tetrapyrrole methylase (InterPro:IPR000878), Tetrapyrrole methylase, subdomain 1 (InterPro:IPR014777), Tetrapyrrole methylase, subdomain 2 (InterPro:IPR014776); Has 751 Blast hits to 751 proteins in 237 species: Archae - 337; Bacteria - 22; Metazoa - 120; Fungi - 101; Plants - 21; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). 
AT4G31790.2GGGCCGATdiphthine synthase, putative (DPH5); FUNCTIONS IN: methyltransferase activity, diphthine synthase activity; INVOLVED IN: peptidyl-diphthamide biosynthetic process from peptidyl-histidine, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Diphthine synthase (InterPro:IPR004551), Tetrapyrrole methylase (InterPro:IPR000878), Tetrapyrrole methylase, subdomain 1 (InterPro:IPR014777), Tetrapyrrole methylase, subdomain 2 (InterPro:IPR014776); Has 751 Blast hits to 751 proteins in 237 species: Archae - 337; Bacteria - 22; Metazoa - 120; Fungi - 101; Plants - 21; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). 
AT4G34700AT4G34700.1TTAATGGGCCGATcomplex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, plasma membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 169 Blast hits to 169 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 51; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT4G39710AT4G39710.1TGTGGGCCGATimmunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: FK506-binding protein 1 (FKBP13) (TAIR:AT5G45680.1); Has 6176 Blast hits to 5824 proteins in 1083 species: Archae - 68; Bacteria - 2849; Metazoa - 1385; Fungi - 335; Plants - 363; Viruses - 0; Other Eukaryotes - 1176 (source: NCBI BLink). 
AT5G01400AT5G01400.1AATAGGCCCACATCGGCCCATTATEncodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64. 
AT5G03290AT5G03290.1TAATTGGGCCGATisocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink). 
AT5G03690AT5G03690.1TATGGGCCGATfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: pentose-phosphate shunt; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT2G36460.1); Has 4408 Blast hits to 4403 proteins in 738 species: Archae - 0; Bacteria - 420; Metazoa - 1258; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2389 (source: NCBI BLink). 
AT5G03690.2TATGGGCCGATfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: pentose-phosphate shunt; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT2G36460.1); Has 4408 Blast hits to 4403 proteins in 738 species: Archae - 0; Bacteria - 420; Metazoa - 1258; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2389 (source: NCBI BLink). 
AT5G11170AT5G11170.1GGGCCGATATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus; EXPRESSED IN: guard cell, root, cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT5G11200.1); Has 28546 Blast hits to 28139 proteins in 1749 species: Archae - 514; Bacteria - 11832; Metazoa - 5046; Fungi - 3322; Plants - 1384; Viruses - 50; Other Eukaryotes - 6398 (source: NCBI BLink). 
AT5G13010AT5G13010.1ATCGGCCCATATembryo defective 3011 (EMB3011); FUNCTIONS IN: RNA helicase activity, helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP-dependent RNA helicase, putative (TAIR:AT3G26560.1); Has 7285 Blast hits to 6618 proteins in 979 species: Archae - 6; Bacteria - 1991; Metazoa - 2135; Fungi - 867; Plants - 393; Viruses - 401; Other Eukaryotes - 1492 (source: NCBI BLink). 
AT5G25610AT5G25610.1ATCGGCCCAAATresponsive to dehydration 22 (RD22) mediated by ABA 
AT5G41520AT5G41520.1ATCGGCCCAATTA40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink). 
AT5G41520.2ATCGGCCCAATTA40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink). 
AT5G42060AT5G42060.1ATCGGCCCATTTAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64490.1); Has 37 Blast hits to 36 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G47320AT5G47320.1ATCGGCCCAGTNuclear encoded mitochondrial ribosome subunit. 
AT5G47580AT5G47580.1TAATTGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17250.1); Has 17 Blast hits to 16 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G52470AT5G52470.1ATCGGCCCATTATencodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. 
AT5G52470.2ATCGGCCCATTATencodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. 
AT5G59910AT5G59910.1CATGGGCCGATHTB4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT2G28720.1); Has 3079 Blast hits to 2919 proteins in 300 species: Archae - 0; Bacteria - 69; Metazoa - 1920; Fungi - 175; Plants - 374; Viruses - 0; Other Eukaryotes - 541 (source: NCBI BLink). 
AT5G65400AT5G65400.1ATATGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G24380.1); Has 479 Blast hits to 479 proteins in 121 species: Archae - 0; Bacteria - 2; Metazoa - 88; Fungi - 285; Plants - 66; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT5G65750AT5G65750.1TTTTGGGCCGATAAGCCCAATAT2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor, oxoglutarate dehydrogenase (succinyl-transferring) activity, thiamin pyrophosphate binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxoglutarate dehydrogenase, E1 component (InterPro:IPR011603), Dehydrogenase, E1 component (InterPro:IPR001017), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative (TAIR:AT3G55410.1); Has 8716 Blast hits to 8694 proteins in 1114 species: Archae - 2; Bacteria - 2389; Metazoa - 550; Fungi - 187; Plants - 68; Viruses - 0; Other Eukaryotes - 5520 (source: NCBI BLink). 
AT5G66010AT5G66010.1TTTGGGCCGATRNA binding / nucleic acid binding / nucleotide binding; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G20890.1); Has 2870 Blast hits to 1043 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 2605; Fungi - 10; Plants - 100; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.