version

Summary of AtREG557 (All List)

OrganismArabidopsis thaliana  
IDAtREG557  
SequenceGACACGTA  
AnnotationABA, DREB1Aox  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifACGT  ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;  
ACGTG  ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;  
ACGTGKC  Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;  
ACGTGTC  Sequence present in 24 genes in the GA-down regulated d1 cluster (106 genes) found in Arabidopsis seed germination; This motif is similar to ABRE (Busk and Pages 1998);  
Total Entry Count161  

Entry Sequences (161 entries)

LocusGene modelSequenceDescription
AT1G01180AT1G01180.1AGACACGTAAAGTCAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: sperm cell, hypocotyl; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19270.1); Has 228 Blast hits to 228 proteins in 32 species: Archae - 0; Bacteria - 48; Metazoa - 2; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). 
AT1G01470AT1G01470.1AGACACGTAEncodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against dessication. 
AT1G04270AT1G04270.1TACGTGTCACEncodes cytosolic ribosomal protein S15. 
AT1G04270.2TACGTGTCACEncodes cytosolic ribosomal protein S15. 
AT1G04985AT1G04985.1TACGTGTCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G06690AT1G06690.1TACGTGTCCaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity, ATPase activity, ATP binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT5G53580.1); Has 18029 Blast hits to 18016 proteins in 1454 species: Archae - 258; Bacteria - 9842; Metazoa - 1647; Fungi - 1390; Plants - 743; Viruses - 0; Other Eukaryotes - 4149 (source: NCBI BLink). 
AT1G08200AT1G08200.1ATGACACGTAEncodes a putative UDP-D-apiose/UPD-D-xylose synthetase. 
AT1G11210AT1G11210.1TACGTGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF761, plant (InterPro:IPR008480); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11220.1); Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G15340AT1G15340.1TACGTGTCGTTProtein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. 
AT1G15430AT1G15430.1GGACACGTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1644 (InterPro:IPR012866); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G80220.1); Has 144 Blast hits to 135 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G15430.2GGACACGTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1644 (InterPro:IPR012866); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G80220.1); Has 144 Blast hits to 135 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G18460AT1G18460.1TACGTGTCATlipase family protein; FUNCTIONS IN: lipase activity; INVOLVED IN: glycerol biosynthetic process, lipid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AB-hydrolase associated lipase region (InterPro:IPR006693); BEST Arabidopsis thaliana protein match is: lipase family protein (TAIR:AT1G73920.1); Has 1378 Blast hits to 1358 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 1048; Fungi - 175; Plants - 88; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT1G21690AT1G21690.1TACGTGTCAembryo defective 1968 (emb1968); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: DNA replication factor C complex, nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), Replication factor C (InterPro:IPR013748), DNA polymerase III clamp loader subunit, C-terminal (InterPro:IPR008921); BEST Arabidopsis thaliana protein match is: replication factor C 40 kDa, putative (TAIR:AT1G63160.1); Has 12080 Blast hits to 12043 proteins in 1582 species: Archae - 427; Bacteria - 5194; Metazoa - 735; Fungi - 600; Plants - 188; Viruses - 64; Other Eukaryotes - 4872 (source: NCBI BLink). 
AT1G21690.2TACGTGTCAembryo defective 1968 (emb1968); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: DNA replication factor C complex, nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), Replication factor C (InterPro:IPR013748), DNA polymerase III clamp loader subunit, C-terminal (InterPro:IPR008921); BEST Arabidopsis thaliana protein match is: replication factor C 40 kDa, putative (TAIR:AT1G63160.1); Has 12080 Blast hits to 12043 proteins in 1582 species: Archae - 427; Bacteria - 5194; Metazoa - 735; Fungi - 600; Plants - 188; Viruses - 64; Other Eukaryotes - 4872 (source: NCBI BLink). 
AT1G22770AT1G22770.1ATGACACGTATogether with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering under long days in a circadian clock-controlled flowering pathway. GI acts earlier than CO and FT in the pathway by increasing CO and FT mRNA abundance. Located in the nucleus. Regulates several developmental processes, including photoperiod-mediated flowering, phytochrome B signaling, circadian clock, carbohydrate metabolism, and cold stress response. The gene's transcription is controlled by the circadian clock and it is post-transcriptionally regulated by light and dark. Forms a complex with FKF1 on the CO promoter to regulate CO expression. 
AT1G22930AT1G22930.1TACGTGTCGT-complex protein 11; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT4G09150.1); Has 8706 Blast hits to 5954 proteins in 561 species: Archae - 13; Bacteria - 948; Metazoa - 3901; Fungi - 587; Plants - 246; Viruses - 12; Other Eukaryotes - 2999 (source: NCBI BLink). 
AT1G22930.2TACGTGTCGT-complex protein 11; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT4G09150.1); Has 8706 Blast hits to 5954 proteins in 561 species: Archae - 13; Bacteria - 948; Metazoa - 3901; Fungi - 587; Plants - 246; Viruses - 12; Other Eukaryotes - 2999 (source: NCBI BLink). 
AT1G23710AT1G23710.1TGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70420.1); Has 203 Blast hits to 197 proteins in 42 species: Archae - 0; Bacteria - 4; Metazoa - 16; Fungi - 9; Plants - 112; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT1G29930AT1G29930.1TACGTGTCACGTCATSubunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. 
AT1G32380AT1G32380.1ATGACACGTAribose-phosphate pyrophosphokinase 2 / phosphoribosyl diphosphate synthetase 2 (PRS2); FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 1 / phosphoribosyl diphosphate synthetase 1 (PRSI) (TAIR:AT2G35390.2); Has 8056 Blast hits to 7889 proteins in 1556 species: Archae - 182; Bacteria - 3337; Metazoa - 501; Fungi - 457; Plants - 129; Viruses - 7; Other Eukaryotes - 3443 (source: NCBI BLink). 
AT1G32870AT1G32870.1TACGTGTCGTArabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT1G32870.2TACGTGTCGTArabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT1G50380AT1G50380.1GGACACGTAprolyl oligopeptidase family protein; FUNCTIONS IN: serine-type peptidase activity, serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S9, prolyl oligopeptidase active site region (InterPro:IPR001375), Peptidase S9A, oligopeptidase, N-terminal beta-propeller (InterPro:IPR004106), Peptidase S9A, prolyl oligopeptidase (InterPro:IPR002470); BEST Arabidopsis thaliana protein match is: prolyl oligopeptidase family protein (TAIR:AT1G69020.1); Has 6063 Blast hits to 6017 proteins in 719 species: Archae - 41; Bacteria - 1884; Metazoa - 253; Fungi - 18; Plants - 99; Viruses - 0; Other Eukaryotes - 3768 (source: NCBI BLink). 
AT1G58270AT1G58270.1AGACACGTAZW9 mRNA, complete cds 
AT1G58270.1TACGTGTCACZW9 mRNA, complete cds 
AT1G62570AT1G62570.1TACGTGTCAbelongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates 
AT1G67920AT1G67920.1CGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24600.1); Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G70780AT1G70780.1AGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23150.1); Has 70 Blast hits to 70 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G70782AT1G70782.1AGACACGTAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF28 represents a conserved upstream opening reading frame relative to major ORF AT1G70780.1 
AT1G71170AT1G71170.1TACGTGTCT6-phosphogluconate dehydrogenase NAD-binding domain-containing protein; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, phosphogluconate dehydrogenase (decarboxylating) activity, catalytic activity; INVOLVED IN: pentose-phosphate shunt, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), Dehydrogenase, multihelical (InterPro:IPR013328), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71180.1); Has 10923 Blast hits to 10908 proteins in 1167 species: Archae - 86; Bacteria - 5485; Metazoa - 273; Fungi - 222; Plants - 147; Viruses - 0; Other Eukaryotes - 4710 (source: NCBI BLink). 
AT1G72770AT1G72770.1TACGTGTCCmutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C 
AT1G72770.2TACGTGTCCmutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C 
AT2G05920AT2G05920.1TACGTGTCCsubtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4370 Blast hits to 3848 proteins in 648 species: Archae - 130; Bacteria - 2232; Metazoa - 135; Fungi - 512; Plants - 867; Viruses - 0; Other Eukaryotes - 494 (source: NCBI BLink). 
AT2G17560AT2G17560.1TACGTGTCAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. 
AT2G17560.2TACGTGTCAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. 
AT2G17560.3TACGTGTCAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. 
AT2G20550AT2G20550.1TACGTGTCTDNAJ chaperone C-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 7698 Blast hits to 7627 proteins in 1649 species: Archae - 68; Bacteria - 3560; Metazoa - 890; Fungi - 429; Plants - 401; Viruses - 2; Other Eukaryotes - 2348 (source: NCBI BLink). 
AT2G20550.2TACGTGTCTDNAJ chaperone C-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 7698 Blast hits to 7627 proteins in 1649 species: Archae - 68; Bacteria - 3560; Metazoa - 890; Fungi - 429; Plants - 401; Viruses - 2; Other Eukaryotes - 2348 (source: NCBI BLink). 
AT2G21970AT2G21970.1AAAACGACACGTAstress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein 
AT2G27040AT2G27040.1TACGTGTCAAGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation and increased susceptibility to bacterial pathogens. 
AT2G27950AT2G27950.1TACGTGTCAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT5G04460.1); Has 502 Blast hits to 402 proteins in 102 species: Archae - 0; Bacteria - 164; Metazoa - 106; Fungi - 26; Plants - 62; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink). 
AT2G30870AT2G30870.1CGACACGTAearly dehydration-induced gene ERD13 homologous to tobacco and maize glutathione S-transferases. Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002) 
AT2G30950AT2G30950.1GGACACGTAMetalloprotease that functions in thylakoid membrane biogenesis. Involved in the repair of PSII following damaged incurred during photoinhibition. Forms a complex with VAR1. Mutants show a variegated phenotype, which decreases during development. Transcript and protein levels increase with light intensity. 
AT2G35300AT2G35300.1GTGACACGTAlate embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, pollen tube development; LOCATED IN: cellular_component unknown; EXPRESSED IN: flower, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT1G32560.1); Has 110 Blast hits to 110 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G36420AT2G36420.1TGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03670.1); Has 11237 Blast hits to 6364 proteins in 349 species: Archae - 8; Bacteria - 288; Metazoa - 5131; Fungi - 1107; Plants - 404; Viruses - 219; Other Eukaryotes - 4080 (source: NCBI BLink). 
AT2G38810AT2G38810.1TACGTGTCTEncodes HTA8, a histone H2A protein. 
AT2G38810.2TACGTGTCTEncodes HTA8, a histone H2A protein. 
AT2G38810.3TACGTGTCTEncodes HTA8, a histone H2A protein. 
AT2G38820AT2G38820.1AGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT2G38820.2AGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT2G39570AT2G39570.1AGACACGTAGGTCCCACACT domain-containing protein; FUNCTIONS IN: amino acid binding; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: ACT domain-containing protein (TAIR:AT2G36840.1); Has 256 Blast hits to 222 proteins in 28 species: Archae - 0; Bacteria - 28; Metazoa - 0; Fungi - 0; Plants - 199; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT3G01570AT3G01570.1TACGTGTCATglycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO2 (OLEOSIN 2) (TAIR:AT5G40420.1); Has 384 Blast hits to 384 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 384; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G04060AT3G04060.1TACGTGTCTArabidopsis NAC domain containing protein 46 (anac046); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ANAC087; transcription factor (TAIR:AT5G18270.1); Has 1632 Blast hits to 1630 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1632; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G05230AT3G05230.1TACGTGTCTsignal peptidase subunit family protein; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endoplasmic reticulum, cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Signal peptidase 22 kDa subunit (InterPro:IPR007653); BEST Arabidopsis thaliana protein match is: signal peptidase subunit family protein (TAIR:AT5G27430.1); Has 300 Blast hits to 300 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). 
AT3G05230.2TACGTGTCTsignal peptidase subunit family protein; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endoplasmic reticulum, cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Signal peptidase 22 kDa subunit (InterPro:IPR007653); BEST Arabidopsis thaliana protein match is: signal peptidase subunit family protein (TAIR:AT5G27430.1); Has 300 Blast hits to 300 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). 
AT3G05630AT3G05630.1TACGTGTCATEncodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. 
AT3G07350AT3G07350.1CCCATTATTACGTGTCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G25240.1); Has 219 Blast hits to 218 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 217; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G08890AT3G08890.1TACGTGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37070.1); Has 268 Blast hits to 266 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 268; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G08890.2TACGTGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37070.1); Has 268 Blast hits to 266 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 268; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G10200AT3G10200.1TGACACGTAdehydration-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT5G04060.1); Has 593 Blast hits to 587 proteins in 96 species: Archae - 0; Bacteria - 132; Metazoa - 2; Fungi - 2; Plants - 447; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT3G10915AT3G10915.1TGACACGTAreticulon family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB11) (TAIR:AT3G19460.1). 
AT3G10915.2TGACACGTAreticulon family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB11) (TAIR:AT3G19460.1). 
AT3G10915.3TGACACGTAreticulon family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB11) (TAIR:AT3G19460.1). 
AT3G10915.4TGACACGTAreticulon family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB11) (TAIR:AT3G19460.1). 
AT3G10915.5TGACACGTAreticulon family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB11) (TAIR:AT3G19460.1). 
AT3G10920AT3G10920.1TACGTGTCAmanganese superoxide dismutase (MSD1) 
AT3G10920.2TACGTGTCAmanganese superoxide dismutase (MSD1) 
AT3G11410AT3G11410.1TACGTGTCGEncodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. 
AT3G12280AT3G12280.1TACGTGTCGEncodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA. 
AT3G13940AT3G13940.1TACGTGTCGTTTTDNA binding / DNA-directed RNA polymerase; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase I associated factor, A49-like (InterPro:IPR009668); Has 150 Blast hits to 150 proteins in 69 species: Archae - 0; Bacteria - 1; Metazoa - 57; Fungi - 66; Plants - 15; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT3G14990AT3G14990.1CGACACGTA4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). 
AT3G14990.2CGACACGTA4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). 
AT3G14990.3CGACACGTA4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). 
AT3G15150AT3G15150.1TACGTGTCGzinc ion binding; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, MIZ-type (InterPro:IPR004181); Has 205 Blast hits to 205 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 36; Plants - 24; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT3G15160AT3G15160.1CGACACGTAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 67 Blast hits to 65 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT3G15670AT3G15670.1TACGTGTCTlate embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleus; EXPRESSED DURING: dry seed stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT1G52690.2); Has 9791 Blast hits to 5043 proteins in 926 species: Archae - 24; Bacteria - 3928; Metazoa - 1452; Fungi - 554; Plants - 1082; Viruses - 109; Other Eukaryotes - 2642 (source: NCBI BLink). 
AT3G16175AT3G16175.1ATGACACGTAthioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52191.1); Has 207 Blast hits to 207 proteins in 44 species: Archae - 0; Bacteria - 4; Metazoa - 96; Fungi - 4; Plants - 99; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT3G16800AT3G16800.1TACGTGTCCprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G05640.2); Has 3956 Blast hits to 3951 proteins in 227 species: Archae - 0; Bacteria - 0; Metazoa - 1239; Fungi - 491; Plants - 1305; Viruses - 5; Other Eukaryotes - 916 (source: NCBI BLink). 
AT3G16800.2TACGTGTCCprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G05640.2); Has 3956 Blast hits to 3951 proteins in 227 species: Archae - 0; Bacteria - 0; Metazoa - 1239; Fungi - 491; Plants - 1305; Viruses - 5; Other Eukaryotes - 916 (source: NCBI BLink). 
AT3G16800.3TACGTGTCCprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G05640.2); Has 3956 Blast hits to 3951 proteins in 227 species: Archae - 0; Bacteria - 0; Metazoa - 1239; Fungi - 491; Plants - 1305; Viruses - 5; Other Eukaryotes - 916 (source: NCBI BLink). 
AT3G21230AT3G21230.1AGACACGTAThe gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. 
AT3G21720AT3G21720.1TACGTGTCACEncodes a glyoxylate cycle enzyme isocitrate lyase (ICL). 
AT3G23420AT3G23420.1TACGTGTCAF-box family protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G24580.1); Has 519 Blast hits to 495 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 519; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G45230AT3G45230.1TACGTGTCAChydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 9069 Blast hits to 3057 proteins in 443 species: Archae - 18; Bacteria - 881; Metazoa - 741; Fungi - 552; Plants - 1780; Viruses - 503; Other Eukaryotes - 4594 (source: NCBI BLink). 
AT3G50630AT3G50630.1AGACACGTAKip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Gene was isolated from a yeast two hybrid screen as an interacting protein of CDC2A. Recombinant protein has a strong kinase inhibitor activity in vitro. Transcript is expressed in all tissues examined but is differentially distributed from ICK1. Controls the onset of the endoreduplication cycle through inhibition of CDKA;1. The KRP2 protein abundance is regulated by proteolysis through CDKB1;1 phosphorylation. 
AT3G51890AT3G51890.1ATGACACGTAprotein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: clathrin coat of trans-Golgi network vesicle, clathrin coat of coated pit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT2G40060.1); Has 258 Blast hits to 256 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 126; Fungi - 42; Plants - 56; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). 
AT3G52920AT3G52920.1ACGACACGTAATTAunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36410.1); Has 2316 Blast hits to 1969 proteins in 271 species: Archae - 54; Bacteria - 179; Metazoa - 1055; Fungi - 129; Plants - 121; Viruses - 9; Other Eukaryotes - 769 (source: NCBI BLink). 
AT3G52920.2ACGACACGTAATTAunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36410.1); Has 2316 Blast hits to 1969 proteins in 271 species: Archae - 54; Bacteria - 179; Metazoa - 1055; Fungi - 129; Plants - 121; Viruses - 9; Other Eukaryotes - 769 (source: NCBI BLink). 
AT3G53710AT3G53710.1AGACACGTAA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT3G53710.2AGACACGTAA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT3G54680AT3G54680.1TACGTGTCATproteophosphoglycan-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; Has 4087 Blast hits to 405 proteins in 103 species: Archae - 2; Bacteria - 51; Metazoa - 124; Fungi - 85; Plants - 81; Viruses - 11; Other Eukaryotes - 3733 (source: NCBI BLink). 
AT3G62870AT3G62870.1TACGTGTCC60S ribosomal protein L7A (RPL7aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7A (InterPro:IPR001921), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7A (RPL7aA) (TAIR:AT2G47610.1); Has 1582 Blast hits to 1582 proteins in 296 species: Archae - 222; Bacteria - 0; Metazoa - 625; Fungi - 248; Plants - 154; Viruses - 0; Other Eukaryotes - 333 (source: NCBI BLink). 
AT4G00550AT4G00550.1GAAACGACACGTAencodes a UDP-galactose-dependent digalactosyldiacylglycerol(DGDG) synthase. Located in chloroplast outer membrane. 
AT4G01026AT4G01026.1AGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01360.1); Has 184 Blast hits to 184 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 180; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G02890AT4G02890.1TACGTGTCAPolyubiquitin gene containing 4 ubiquitin repeats. 
AT4G02890.2TACGTGTCAPolyubiquitin gene containing 4 ubiquitin repeats. 
AT4G02890.3TACGTGTCAPolyubiquitin gene containing 4 ubiquitin repeats. 
AT4G02890.4TACGTGTCAPolyubiquitin gene containing 4 ubiquitin repeats. 
AT4G05050AT4G05050.1TACGTGTCApolyubiquitin gene, belongs to a subtype group with UBQ10 and UBQ14. Various ecotypes of Arabidopsis have different numbers of ubiquitin repeats within this gene. 
AT4G05050.2TACGTGTCApolyubiquitin gene, belongs to a subtype group with UBQ10 and UBQ14. Various ecotypes of Arabidopsis have different numbers of ubiquitin repeats within this gene. 
AT4G05050.3TACGTGTCApolyubiquitin gene, belongs to a subtype group with UBQ10 and UBQ14. Various ecotypes of Arabidopsis have different numbers of ubiquitin repeats within this gene. 
AT4G12130AT4G12130.1TGACACGTAaminomethyltransferase; FUNCTIONS IN: aminomethyltransferase activity; INVOLVED IN: glycine catabolic process; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate-binding, YgfZ (InterPro:IPR017703), Glycine cleavage T-protein, N-terminal (InterPro:IPR006222), Glycine cleavage T-protein, C-terminal barrel (InterPro:IPR013977); Has 2891 Blast hits to 2889 proteins in 726 species: Archae - 6; Bacteria - 1150; Metazoa - 88; Fungi - 107; Plants - 23; Viruses - 0; Other Eukaryotes - 1517 (source: NCBI BLink). 
AT4G16980AT4G16980.1TACGTGTCACarabinogalactan-protein family; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 55729 Blast hits to 24766 proteins in 1168 species: Archae - 164; Bacteria - 9443; Metazoa - 21010; Fungi - 5539; Plants - 9700; Viruses - 2314; Other Eukaryotes - 7559 (source: NCBI BLink). 
AT4G17890AT4G17890.1TACGTGTCGTTTCA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT4G17890.2TACGTGTCGTTTCA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT4G17970AT4G17970.1GGACACGTAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0005 (InterPro:IPR006214); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46610.1); Has 461 Blast hits to 451 proteins in 136 species: Archae - 0; Bacteria - 214; Metazoa - 0; Fungi - 11; Plants - 209; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). 
AT4G18140AT4G18140.1TACGTGTCATphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G18140.2TACGTGTCATphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G18280AT4G18280.1TACGTGTCTglycine-rich cell wall protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). 
AT4G21180AT4G21180.1TACGTGTCGTJ domain protein localized in ER membrane. 
AT4G21440AT4G21440.1GGACACGTAEncodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. 
AT4G24510AT4G24510.1ACGACACGTAInvolved in C28 to C30 fatty acid elongation. 
AT4G25680AT4G25680.1GGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25660.1); Has 503 Blast hits to 503 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 175; Fungi - 41; Plants - 181; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). 
AT4G26530AT4G26530.1TGACACGTAfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity; INVOLVED IN: glycolysis, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, cytoplasmic (TAIR:AT4G26520.1); Has 4438 Blast hits to 4433 proteins in 746 species: Archae - 0; Bacteria - 439; Metazoa - 1258; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2400 (source: NCBI BLink). 
AT4G26530.2TGACACGTAfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity; INVOLVED IN: glycolysis, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, cytoplasmic (TAIR:AT4G26520.1); Has 4438 Blast hits to 4433 proteins in 746 species: Archae - 0; Bacteria - 439; Metazoa - 1258; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2400 (source: NCBI BLink). 
AT4G27780AT4G27780.1TACGTGTCGTEncodes acyl-CoA-binding protein with ankyrin repeats 
AT4G27840AT4G27840.1TACGTGTCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: vesicle-associated membrane protein-related (TAIR:AT5G52990.1); Has 165 Blast hits to 165 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G29860AT4G29860.1TAAACGACACGTAEncodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development. 
AT4G29870AT4G29870.1TACGTGTCGTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: membrane protein, putative (TAIR:AT2G19340.2); Has 163 Blast hits to 163 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT4G33666AT4G33666.1TACGTGTCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 6 Blast hits to 6 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G34950AT4G34950.1TACGTGTCTnodulin family protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT2G16660.1); Has 2125 Blast hits to 2060 proteins in 475 species: Archae - 11; Bacteria - 788; Metazoa - 4; Fungi - 198; Plants - 318; Viruses - 0; Other Eukaryotes - 806 (source: NCBI BLink). 
AT4G36240AT4G36240.1AGACACGTAzinc finger (GATA type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, NHR/GATA-type (InterPro:IPR013088), Transcription factor, GATA, plant (InterPro:IPR016679), Zinc finger, GATA-type (InterPro:IPR000679); BEST Arabidopsis thaliana protein match is: zinc finger (GATA type) family protein (TAIR:AT5G66320.2); Has 793 Blast hits to 761 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 330; Plants - 416; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). 
AT4G37560AT4G37560.1TACGTGTCTformamidase, putative / formamide amidohydrolase, putative; FUNCTIONS IN: formamidase activity, hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetamidase/Formamidase (InterPro:IPR004304); BEST Arabidopsis thaliana protein match is: formamidase, putative / formamide amidohydrolase, putative (TAIR:AT4G37550.1); Has 930 Blast hits to 919 proteins in 259 species: Archae - 41; Bacteria - 569; Metazoa - 0; Fungi - 81; Plants - 32; Viruses - 0; Other Eukaryotes - 207 (source: NCBI BLink). 
AT5G02650AT5G02650.1TACGTGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28260.2); Has 13 Blast hits to 13 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G03240AT5G03240.1ATGACACGTAencodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. 
AT5G03240.2ATGACACGTAencodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. 
AT5G03240.3ATGACACGTAencodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. 
AT5G05410AT5G05410.1TGACACGTAEncodes a transcription factor that specifically binds to DRE/CRT cis elements (responsive to drought and low-temperature stress). Belongs to the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2A). There are eight members in this subfamily including DREB2B. The protein contains one AP2 domain. Overexpression of transcriptional activation domain of DREB2A resulted in significant drought stress tolerance but only slight freezing tolerance in transgenic Arabidopsis plants. Microarray and RNA gel blot analyses revealed that DREB2A regulates expression of many water stress–inducible genes. 
AT5G05410.2TGACACGTAEncodes a transcription factor that specifically binds to DRE/CRT cis elements (responsive to drought and low-temperature stress). Belongs to the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2A). There are eight members in this subfamily including DREB2B. The protein contains one AP2 domain. Overexpression of transcriptional activation domain of DREB2A resulted in significant drought stress tolerance but only slight freezing tolerance in transgenic Arabidopsis plants. Microarray and RNA gel blot analyses revealed that DREB2A regulates expression of many water stress–inducible genes. 
AT5G13080AT5G13080.1TACGTGTCGTWRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation. 
AT5G13930AT5G13930.1AGACACGTAEncodes chalcone synthase (CHS), a key enzyme involved in the biosynthesis of flavonoids. Required for the accumulation of purple anthocyanins in leaves and stems. Also involved in the regulation of auxin transport and the modulation of root gravitropism. 
AT5G17360AT5G17360.1TACGTGTCCATTGGGCCTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: ATP dependent DNA ligase family protein (TAIR:AT1G66730.1); Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G24360AT5G24360.1TGACACGTAINOSITOL REQUIRING 1-1 (IRE1-1); FUNCTIONS IN: endoribonuclease activity, producing 5'-phosphomonoesters, protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, mRNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyrrolo-quinoline quinone beta-propeller repeat (InterPro:IPR018391), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Ribonuclease L (InterPro:IPR010513), PUG (InterPro:IPR006567), Quinonprotein alcohol dehydrogenase-like (InterPro:IPR011047); BEST Arabidopsis thaliana protein match is: IRE1A; endoribonuclease/ kinase (TAIR:AT2G17520.1); Has 75799 Blast hits to 75146 proteins in 2975 species: Archae - 53; Bacteria - 6775; Metazoa - 33392; Fungi - 6711; Plants - 14901; Viruses - 376; Other Eukaryotes - 13591 (source: NCBI BLink). 
AT5G25510AT5G25510.1TACGTGTCAserine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: ATB' GAMMA; poly(U) binding / protein phosphatase type 2A regulator (TAIR:AT4G15415.2); Has 855 Blast hits to 848 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 492; Fungi - 97; Plants - 156; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). 
AT5G25520AT5G25520.1TGACACGTAtranscription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink). 
AT5G25520.2TGACACGTAtranscription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink). 
AT5G26980AT5G26980.1TACGTGTCGmember of SYP4 Gene Family 
AT5G26980.2TACGTGTCGmember of SYP4 Gene Family 
AT5G27430AT5G27430.1TACGTGTCTsignal peptidase subunit family protein; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal peptidase 22 kDa subunit (InterPro:IPR007653); BEST Arabidopsis thaliana protein match is: signal peptidase subunit family protein (TAIR:AT3G05230.1); Has 297 Blast hits to 297 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 87; Plants - 44; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). 
AT5G35080AT5G35080.1TACGTGTCGprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); Has 480 Blast hits to 361 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 316; Fungi - 98; Plants - 25; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). 
AT5G46790AT5G46790.1TACGTGTCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17870.1); Has 179 Blast hits to 179 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 178; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G49700AT5G49700.1AGACACGTADNA-binding protein-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: shoot apex, embryo, inflorescence meristem; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G14490.1); Has 424 Blast hits to 423 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 2; Plants - 417; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G51710AT5G51710.1TGACACGTAmember of Putative potassium proton antiporter family 
AT5G51710.2TGACACGTAmember of Putative potassium proton antiporter family 
AT5G52300AT5G52300.1TACGTGTCAencodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. 
AT5G52300.2TACGTGTCAencodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. 
AT5G53850AT5G53850.1TACGTGTCGTTTChaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, acireductone synthase activity, catalytic activity, phosphoglycolate phosphatase activity, metal ion binding; INVOLVED IN: methionine salvage, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), 2,3-diketo-5-methylthio-1-phosphopentane phosphatase (InterPro:IPR010041), Class II aldolase/adducin, N-terminal (InterPro:IPR001303), HAD-superfamily hydrolase, subfamily IA, variant 1 (InterPro:IPR006439), Methylthioribulose-1-phosphate dehydratase (InterPro:IPR017714); Has 1701 Blast hits to 1701 proteins in 496 species: Archae - 17; Bacteria - 1130; Metazoa - 229; Fungi - 146; Plants - 37; Viruses - 0; Other Eukaryotes - 142 (source: NCBI BLink). 
AT5G53850.2TACGTGTCGTTTChaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, acireductone synthase activity, catalytic activity, phosphoglycolate phosphatase activity, metal ion binding; INVOLVED IN: methionine salvage, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), 2,3-diketo-5-methylthio-1-phosphopentane phosphatase (InterPro:IPR010041), Class II aldolase/adducin, N-terminal (InterPro:IPR001303), HAD-superfamily hydrolase, subfamily IA, variant 1 (InterPro:IPR006439), Methylthioribulose-1-phosphate dehydratase (InterPro:IPR017714); Has 1701 Blast hits to 1701 proteins in 496 species: Archae - 17; Bacteria - 1130; Metazoa - 229; Fungi - 146; Plants - 37; Viruses - 0; Other Eukaryotes - 142 (source: NCBI BLink). 
AT5G53850.3TACGTGTCGTTTChaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, acireductone synthase activity, catalytic activity, phosphoglycolate phosphatase activity, metal ion binding; INVOLVED IN: methionine salvage, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), 2,3-diketo-5-methylthio-1-phosphopentane phosphatase (InterPro:IPR010041), Class II aldolase/adducin, N-terminal (InterPro:IPR001303), HAD-superfamily hydrolase, subfamily IA, variant 1 (InterPro:IPR006439), Methylthioribulose-1-phosphate dehydratase (InterPro:IPR017714); Has 1701 Blast hits to 1701 proteins in 496 species: Archae - 17; Bacteria - 1130; Metazoa - 229; Fungi - 146; Plants - 37; Viruses - 0; Other Eukaryotes - 142 (source: NCBI BLink). 
AT5G54230AT5G54230.1AGACACGTAEncodes a putative transcription factor (MYB49). 
AT5G54840AT5G54840.1GTGACACGTAMonomeric G protein. Expressed in the root quiescent center, flowers, and leaf guard cells and hydathodes. 
AT5G54840.2GTGACACGTAMonomeric G protein. Expressed in the root quiescent center, flowers, and leaf guard cells and hydathodes. 
AT5G58090AT5G58090.1TACGTGTCATglycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT4G31140.1); Has 1739 Blast hits to 1690 proteins in 137 species: Archae - 0; Bacteria - 12; Metazoa - 0; Fungi - 53; Plants - 1666; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT5G58280AT5G58280.1TACGTGTCTtranscriptional factor B3 family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT3G19184.1); Has 167 Blast hits to 151 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 167; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G62960AT5G62960.1GAAACGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10660.4); Has 89 Blast hits to 88 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G64080AT5G64080.1AGACACGTAprotease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein/Par allergen (InterPro:IPR000528), Plant lipid transfer protein and hydrophobic protein, helical (InterPro:IPR013770); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT2G13820.1); Has 745 Blast hits to 741 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 743; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G64080.2AGACACGTAprotease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein/Par allergen (InterPro:IPR000528), Plant lipid transfer protein and hydrophobic protein, helical (InterPro:IPR013770); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT2G13820.1); Has 745 Blast hits to 741 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 743; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G65080AT5G65080.1TACGTGTCTIs upregulated during vernalization and regulates flowering time. Encodes MADS-domain protein. Two variants encoding proteins of 198 and 184 amino acids have been reported. 
AT5G65080.2TACGTGTCTIs upregulated during vernalization and regulates flowering time. Encodes MADS-domain protein. Two variants encoding proteins of 198 and 184 amino acids have been reported. 
AT5G65260AT5G65260.1TACGTGTCGpolyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G10350.1); Has 5533 Blast hits to 5115 proteins in 414 species: Archae - 6; Bacteria - 543; Metazoa - 2461; Fungi - 1041; Plants - 837; Viruses - 0; Other Eukaryotes - 645 (source: NCBI BLink). 
AT5G66410AT5G66410.1GGACACGTAEncodes a protein that functions in microtubule assembly. Plants with reduced levels of both PLP3a (At3g50960) and PLP3b show defects in cytokinesis, cortical microtubule array formation, oriented cell growth, and maintenance of proper ploidy. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.