version

Summary of AtREG558 (All List)

OrganismArabidopsis thaliana  
IDAtREG558  
SequenceCCCATTAG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count261  

Entry Sequences (261 entries)

LocusGene modelSequenceDescription
AT1G03457AT1G03457.1CCCATTAGRNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Ribonucleoprotein, BRUNO-like (InterPro:IPR015903), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Paraneoplastic encephalomyelitis antigen (InterPro:IPR002343); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT4G03110.1); Has 21968 Blast hits to 12589 proteins in 581 species: Archae - 14; Bacteria - 954; Metazoa - 13308; Fungi - 2195; Plants - 3046; Viruses - 0; Other Eukaryotes - 2451 (source: NCBI BLink). 
AT1G03457.2CCCATTAGRNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Ribonucleoprotein, BRUNO-like (InterPro:IPR015903), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Paraneoplastic encephalomyelitis antigen (InterPro:IPR002343); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT4G03110.1); Has 21968 Blast hits to 12589 proteins in 581 species: Archae - 14; Bacteria - 954; Metazoa - 13308; Fungi - 2195; Plants - 3046; Viruses - 0; Other Eukaryotes - 2451 (source: NCBI BLink). 
AT1G04410AT1G04410.1AGAGGCCCATTAGmalate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G43330.1); Has 7871 Blast hits to 7869 proteins in 1725 species: Archae - 115; Bacteria - 3866; Metazoa - 1047; Fungi - 188; Plants - 460; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink). 
AT1G04420AT1G04420.1CTAATGGGCCTCTaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); oxidoreductase/ potassium channel (TAIR:AT1G04690.1); Has 17372 Blast hits to 17351 proteins in 1400 species: Archae - 300; Bacteria - 9458; Metazoa - 1333; Fungi - 1228; Plants - 519; Viruses - 0; Other Eukaryotes - 4534 (source: NCBI BLink). 
AT1G04510AT1G04510.1CTAATGGGCTTCtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). 
AT1G04510.2CTAATGGGCTTCtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). 
AT1G04630AT1G04630.1CTAATGGGCTTAGmaternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT1G04635AT1G04635.1CTAAGCCCATTAGEMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G05190AT1G05190.1CTAATGGGCCGTembryo defective 2394 (emb2394); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: ribosomal protein L6 family protein (TAIR:AT2G18400.1); Has 5749 Blast hits to 5749 proteins in 1580 species: Archae - 150; Bacteria - 2981; Metazoa - 10; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 2418 (source: NCBI BLink). 
AT1G05350AT1G05350.1CTAATGGGCTATTthiF family protein; FUNCTIONS IN: binding, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor, catalytic activity, cofactor binding; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), UBA/THIF-type NAD/FAD binding fold (InterPro:IPR000594), Molybdenum cofactor biosynthesis, MoeB (InterPro:IPR009036), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: SAE2 (SUMO-ACTIVATING ENZYME 2); SUMO activating enzyme (TAIR:AT2G21470.2); Has 7901 Blast hits to 7756 proteins in 1322 species: Archae - 133; Bacteria - 4223; Metazoa - 801; Fungi - 447; Plants - 189; Viruses - 0; Other Eukaryotes - 2108 (source: NCBI BLink). 
AT1G08700AT1G08700.1TTATTGGGCCTAATGGGCTEncodes a protein similar to animal presenilin whose expression is increased in response to potassium (K+) deprivation. 
AT1G08710AT1G08710.1AGCCCATTAGGCCCAATAAF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT1G08710.2AGCCCATTAGGCCCAATAAF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT1G10170AT1G10170.1TATAGGCCCATTGTTAGCCCATTAGEncodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response. 
AT1G11430AT1G11430.1CTAATGGGCCTAATplastid developmental protein DAG, putative; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT3G06790.2); Has 147 Blast hits to 135 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G12920AT1G12920.1ATAAAGCCCATTAGEncodes a eukaryotic release factor one homolog. 
AT1G13090AT1G13090.1ATTTGGGCCTAAACCCATTAGputative cytochrome P450 
AT1G13320AT1G13320.1CTAATGGGone of three genes encoding the 65 kDa regulatory subunit of protein phosphatase 2A (PP2A) 
AT1G13320.2CTAATGGGone of three genes encoding the 65 kDa regulatory subunit of protein phosphatase 2A (PP2A) 
AT1G14080AT1G14080.1CCCATTAGmember of Xyloglucan fucosyltransferase family 
AT1G14320AT1G14320.1TTAAAGCCCATTAGEncodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself. 
AT1G14320.2TTAAAGCCCATTAGEncodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself. 
AT1G18070AT1G18070.1CTAAGGCCCATTAGTTGGGCTTTEF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink). 
AT1G18070.2CTAAGGCCCATTAGTTGGGCTTTEF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink). 
AT1G18540AT1G18540.1ATAAGGGCCCATTAG60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). 
AT1G19890AT1G19890.1CCCATTAGhistone 3.3, male-gamete-specific expression 
AT1G21100AT1G21100.1AGAGGCCCATTAGO-methyltransferase, putative; FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol; EXPRESSED IN: stem, cotyledon, hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: O-methyltransferase, putative (TAIR:AT1G21130.1); Has 2126 Blast hits to 2123 proteins in 426 species: Archae - 0; Bacteria - 600; Metazoa - 84; Fungi - 432; Plants - 916; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink). 
AT1G28060AT1G28060.1TAAAAGCCCATTAGsmall nuclear ribonucleoprotein family protein / snRNP family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: RNA splicing factor-related (TAIR:AT3G55930.1); Has 21413 Blast hits to 11192 proteins in 554 species: Archae - 18; Bacteria - 874; Metazoa - 11490; Fungi - 2755; Plants - 1540; Viruses - 94; Other Eukaryotes - 4642 (source: NCBI BLink). 
AT1G28090AT1G28090.1CTAATGGGCTTTAAAGGCCpolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). 
AT1G28090.2CTAATGGGCTTTAAAGGCCpolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). 
AT1G28090.3CTAATGGGCTTTAAAGGCCpolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). 
AT1G31660AT1G31660.1AGTTGGGCCTAATGGGCTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bystin (InterPro:IPR007955); Has 370 Blast hits to 362 proteins in 156 species: Archae - 0; Bacteria - 7; Metazoa - 139; Fungi - 93; Plants - 32; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink). 
AT1G33980AT1G33980.1TTAAGGCCCATTAGAGGCCCATATAInvolved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) 
AT1G33980.2TTAAGGCCCATTAGAGGCCCATATAInvolved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) 
AT1G48320AT1G48320.1CTAATGGGCCTTTAthioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683), Phenylacetic acid degradation-related protein (InterPro:IPR003736); BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT5G48950.1); Has 1639 Blast hits to 1639 proteins in 507 species: Archae - 0; Bacteria - 1172; Metazoa - 3; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink). 
AT1G48320.1TAGCCCATTAGthioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683), Phenylacetic acid degradation-related protein (InterPro:IPR003736); BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT5G48950.1); Has 1639 Blast hits to 1639 proteins in 507 species: Archae - 0; Bacteria - 1172; Metazoa - 3; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink). 
AT1G52760AT1G52760.1CTAATGGGesterase/lipase/thioesterase family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G11090.1); Has 1390 Blast hits to 1388 proteins in 451 species: Archae - 17; Bacteria - 724; Metazoa - 96; Fungi - 65; Plants - 235; Viruses - 38; Other Eukaryotes - 215 (source: NCBI BLink). 
AT1G54050AT1G54050.1CTAATGGGCTAAGGCC17.4 kDa class III heat shock protein (HSP17.4-CIII); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 2777 Blast hits to 2777 proteins in 704 species: Archae - 100; Bacteria - 1361; Metazoa - 1; Fungi - 104; Plants - 843; Viruses - 0; Other Eukaryotes - 368 (source: NCBI BLink). 
AT1G54310AT1G54310.1GTGGCCCATTAGRNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: plasma membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: PUA (InterPro:IPR002478); Has 3651 Blast hits to 3638 proteins in 946 species: Archae - 69; Bacteria - 3053; Metazoa - 33; Fungi - 6; Plants - 28; Viruses - 0; Other Eukaryotes - 462 (source: NCBI BLink). 
AT1G62730AT1G62730.1CTAATGGGtransferase; FUNCTIONS IN: transferase activity; INVOLVED IN: biosynthetic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid synthase (InterPro:IPR008949), Squalene/phytoene synthase (InterPro:IPR002060); Has 671 Blast hits to 669 proteins in 308 species: Archae - 0; Bacteria - 381; Metazoa - 94; Fungi - 65; Plants - 24; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT1G69080AT1G69080.1CCCATTAGuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: MRH6 (morphogenesis of root hair 6) (TAIR:AT2G03720.1); Has 94 Blast hits to 94 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G69080.2CCCATTAGuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: MRH6 (morphogenesis of root hair 6) (TAIR:AT2G03720.1); Has 94 Blast hits to 94 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G74260AT1G74260.1ATCGGCCCTTAGGCCCATTAGEncodes formylglycinamidine ribonucleotide synthase an enzyme involved in de novo purine biosynthesis. PUR4 is localizes to the chloroplast and mitochondria. Loss of PUR4 function affects male but not female gametophyte development. 
AT1G74970AT1G74970.1TTAATGGGCTCTAATGGGCCGATribosomal protein S9, nuclear encoded component of the chloroplast ribosome 
AT1G76300AT1G76300.1CTAATGGGCCCAATAAsnRNP core protein SmD3 (SmD3); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nuclear body, nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 890 Blast hits to 890 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 227; Plants - 127; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). 
AT1G76300.1CTAATGGGCCGATsnRNP core protein SmD3 (SmD3); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nuclear body, nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 890 Blast hits to 890 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 227; Plants - 127; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). 
AT1G79710AT1G79710.1CTAATGGGCCACAAAAAGCCCATCTintegral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT5G25050.1); Has 694 Blast hits to 685 proteins in 112 species: Archae - 4; Bacteria - 113; Metazoa - 0; Fungi - 0; Plants - 141; Viruses - 0; Other Eukaryotes - 436 (source: NCBI BLink). 
AT1G80770AT1G80770.1AGAGGCCCATTAGpigment defective 318 (PDE318); FUNCTIONS IN: GTP binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G50920.1); Has 6754 Blast hits to 6749 proteins in 1535 species: Archae - 192; Bacteria - 3675; Metazoa - 331; Fungi - 218; Plants - 119; Viruses - 0; Other Eukaryotes - 2219 (source: NCBI BLink). 
AT2G02500AT2G02500.1TTATGGGCCTTATTAAAAGCCCATTAGEncodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity). 
AT2G02510AT2G02510.1CTAATGGGCTTTTAATAAGGCCCATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G03140AT2G03140.1CTAATGGGCTACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G50790.1); Has 23018 Blast hits to 13463 proteins in 1126 species: Archae - 80; Bacteria - 6803; Metazoa - 6863; Fungi - 2179; Plants - 631; Viruses - 123; Other Eukaryotes - 6339 (source: NCBI BLink). 
AT2G17975AT2G17975.1TTAATGGGCCTAATGGGCCTAGzinc finger (Ran-binding) family protein; FUNCTIONS IN: binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: zinc finger (Ran-binding) family protein (TAIR:AT5G25490.1); Has 893 Blast hits to 535 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 304; Fungi - 62; Plants - 313; Viruses - 0; Other Eukaryotes - 214 (source: NCBI BLink). 
AT2G17980AT2G17980.1CTAGGCCCATTAGGCCCATTAAmember of SLY1 Gene Family 
AT2G18020AT2G18020.1CTTAGGCCCATTAGembryo defective 2296 (EMB2296); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: in 7 components; EXPRESSED IN: male gametophyte, guard cell, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein L2, domain 3 (InterPro:IPR014726), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L8 (RPL8C) (TAIR:AT4G36130.1); Has 7419 Blast hits to 7417 proteins in 2201 species: Archae - 236; Bacteria - 3117; Metazoa - 334; Fungi - 188; Plants - 928; Viruses - 0; Other Eukaryotes - 2616 (source: NCBI BLink). 
AT2G18510AT2G18510.1CTTAATGGGCTTATAGGCCCATTAGembryo defective 2444 (emb2444); FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: PAB8 (POLY(A) BINDING PROTEIN 8); RNA binding / translation initiation factor (TAIR:AT1G49760.1); Has 56184 Blast hits to 33244 proteins in 1255 species: Archae - 48; Bacteria - 4095; Metazoa - 27429; Fungi - 7959; Plants - 8932; Viruses - 890; Other Eukaryotes - 6831 (source: NCBI BLink). 
AT2G18710AT2G18710.1TATTGGGCCTAAAAGGCCTGGCCCATTAGSecY Homolog 1 (SCY1); FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion, protein transport; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: EMB2289 (EMBRYO DEFECTIVE 2289); P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT2G31530.1); Has 6517 Blast hits to 6501 proteins in 1505 species: Archae - 48; Bacteria - 2805; Metazoa - 25; Fungi - 2; Plants - 53; Viruses - 0; Other Eukaryotes - 3584 (source: NCBI BLink). 
AT2G20530AT2G20530.1CTAATGGGCCTGAPROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink). 
AT2G20530.2CTAATGGGCCTGAPROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink). 
AT2G20610AT2G20610.1GCCCATTAGConfers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. 
AT2G20610.2GCCCATTAGConfers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. 
AT2G22370AT2G22370.1CTAATGGGCTATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 87 Blast hits to 87 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G22400AT2G22400.1CTAATGGGCTTTATACGGCCCAAAANOL1/NOP2/sun family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314); BEST Arabidopsis thaliana protein match is: NOL1/NOP2/sun family protein (TAIR:AT4G40000.1); Has 5426 Blast hits to 5396 proteins in 1280 species: Archae - 185; Bacteria - 3179; Metazoa - 525; Fungi - 201; Plants - 119; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink). 
AT2G24500AT2G24500.1TAAAAGCCCATTAGAAAGCCCATTAGEncodes a C2H2 zinc finger protein FZF. 
AT2G26780AT2G26780.1CTAATGGGbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 325 Blast hits to 275 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 149; Fungi - 125; Plants - 34; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). 
AT2G27030AT2G27030.1TTATTGGGCCTAATGGGCCTTTTencodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. 
AT2G27030.2TTATTGGGCCTAATGGGCCTTTTencodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. 
AT2G27030.3TTATTGGGCCTAATGGGCCTTTTencodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. 
AT2G29400AT2G29400.1CCCATTAGType 1 protein phosphatase, expressed in roots, rosettes and flowers 
AT2G31190AT2G31190.1TAAGCCCATTAGLOCATED IN: mitochondrion, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: emb1879 (embryo defective 1879) (TAIR:AT5G49820.1); Has 274 Blast hits to 274 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 96; Fungi - 41; Plants - 94; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). 
AT2G31200AT2G31200.1CTAATGGGCTTAEncodes actin depolymerizing factor 6 (ADF6). 
AT2G33730AT2G33730.1CTAATGGGCCTAAADEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G28180.1); Has 105850 Blast hits to 52945 proteins in 1991 species: Archae - 661; Bacteria - 41429; Metazoa - 30663; Fungi - 9349; Plants - 3951; Viruses - 317; Other Eukaryotes - 19480 (source: NCBI BLink). 
AT2G33730.1CTAATGGGCCTAAADEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G28180.1); Has 105850 Blast hits to 52945 proteins in 1991 species: Archae - 661; Bacteria - 41429; Metazoa - 30663; Fungi - 9349; Plants - 3951; Viruses - 317; Other Eukaryotes - 19480 (source: NCBI BLink). 
AT2G33840AT2G33840.1CTAATGGGCCTTTtRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tyrosine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation, tyrosyl-tRNA aminoacylation; LOCATED IN: cytoplasm; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosine tRNA ligase, archaeal/eukaryotic (InterPro:IPR016485), Tyrosyl-tRNA synthetase, class Ib, archaeal/eukaryotic cytosolic (InterPro:IPR015624), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); BEST Arabidopsis thaliana protein match is: ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / tyrosine-tRNA ligase (TAIR:AT1G28350.1); Has 3646 Blast hits to 3629 proteins in 1010 species: Archae - 254; Bacteria - 1669; Metazoa - 303; Fungi - 167; Plants - 79; Viruses - 5; Other Eukaryotes - 1169 (source: NCBI BLink). 
AT2G35490AT2G35490.1TCAGGCCCATTAGplastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: plastid-lipid associated protein PAP, putative (TAIR:AT4G22240.1); Has 293 Blast hits to 290 proteins in 66 species: Archae - 0; Bacteria - 78; Metazoa - 1; Fungi - 0; Plants - 205; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT2G35500AT2G35500.1CTAATGGGCCTGAshikimate kinase-related; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); Has 282 Blast hits to 282 proteins in 67 species: Archae - 0; Bacteria - 111; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink). 
AT2G35750AT2G35750.1CTAATGGGCTTAATTGGGCTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G39050AT2G39050.1CCCATTAGhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ricin B-related lectin (InterPro:IPR008997), Ricin B lectin (InterPro:IPR000772); Has 1440 Blast hits to 1210 proteins in 180 species: Archae - 0; Bacteria - 37; Metazoa - 486; Fungi - 318; Plants - 469; Viruses - 5; Other Eukaryotes - 125 (source: NCBI BLink). 
AT2G39390AT2G39390.1TCAGCCCATTAG60S ribosomal protein L35 (RPL35B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 796 Blast hits to 796 proteins in 298 species: Archae - 108; Bacteria - 128; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink). 
AT2G42600AT2G42600.1GCCCATTAGEncodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins. 
AT2G42600.2GCCCATTAGEncodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins. 
AT2G42880AT2G42880.1CTAATGGGmember of MAP Kinase 
AT2G45500AT2G45500.1TAAAGCCCATTAGATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink). 
AT2G45500.2TAAAGCCCATTAGATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink). 
AT2G45510AT2G45510.1CTAATGGGCTTTAmember of CYP704A 
AT2G45640AT2G45640.1AAAAGGCCCATTAGInvolved in the regulation of salt stress. Expression of AtSAP18 is induced by NaCl, cold, drought, ABA, and ethylene treatment. AtSAP18 and HDA19 associate with ERF3 and ERF4 both in vitro and in vivo. 
AT2G46090AT2G46090.1TAAGCCCATTAGEncodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. 
AT2G46580AT2G46580.1ATAAGGCCTAATGGGCCTCApyridoxine 5'-phosphate oxidase-related; FUNCTIONS IN: FMN binding, pyridoxamine-phosphate oxidase activity; INVOLVED IN: pyridoxine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxamine 5'-phosphate oxidase (InterPro:IPR000659), FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002); Has 1089 Blast hits to 1089 proteins in 214 species: Archae - 0; Bacteria - 365; Metazoa - 49; Fungi - 36; Plants - 20; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). 
AT2G47540AT2G47540.1CCCATTAGpollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041); BEST Arabidopsis thaliana protein match is: pollen Ole e 1 allergen and extensin family protein (TAIR:AT4G02270.1); Has 87 Blast hits to 87 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G47940AT2G47940.1GGGCCCATTAGEncodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. 
AT2G47940.2GGGCCCATTAGEncodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. 
AT2G48160AT2G48160.1CTAATGGGCCTCAEXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G63070.1); Has 1292 Blast hits to 1135 proteins in 175 species: Archae - 2; Bacteria - 174; Metazoa - 679; Fungi - 194; Plants - 113; Viruses - 2; Other Eukaryotes - 128 (source: NCBI BLink). 
AT3G02080AT3G02080.1ATTAGGCCCATTAG40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae - 134; Bacteria - 4; Metazoa - 345; Fungi - 96; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT3G02090AT3G02090.1CTAATGGGCCTAATMPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT3G02090.2CTAATGGGCCTAATMPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT3G02160AT3G02160.1CCCATTAGDNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Bromodomain transcription factor (InterPro:IPR006565); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15570.1); Has 126 Blast hits to 126 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT3G02320AT3G02320.1ATGGCCCATTAGRNA binding / tRNA (guanine-N2-)-methyltransferase; FUNCTIONS IN: RNA binding, tRNA (guanine-N2-)-methyltransferase activity; INVOLVED IN: tRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: N2,N2-dimethylguanosine tRNA methyltransferase (InterPro:IPR002905); BEST Arabidopsis thaliana protein match is: N2,N2-dimethylguanosine tRNA methyltransferase family protein (TAIR:AT5G15810.1); Has 751 Blast hits to 711 proteins in 254 species: Archae - 149; Bacteria - 57; Metazoa - 179; Fungi - 100; Plants - 52; Viruses - 0; Other Eukaryotes - 214 (source: NCBI BLink). 
AT3G03920AT3G03920.1TGAGGCCCATTAGGar1 RNA-binding region family protein; FUNCTIONS IN: RNA binding, rRNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast thylakoid membrane, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gar1 protein RNA-binding region (InterPro:IPR007504); BEST Arabidopsis thaliana protein match is: Gar1 RNA-binding region family protein (TAIR:AT5G18180.1); Has 26246 Blast hits to 8264 proteins in 726 species: Archae - 15; Bacteria - 4613; Metazoa - 10704; Fungi - 2027; Plants - 5901; Viruses - 362; Other Eukaryotes - 2624 (source: NCBI BLink). 
AT3G04160AT3G04160.1CTAATGGGCCTAATTAAATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 1599 Blast hits to 1235 proteins in 157 species: Archae - 0; Bacteria - 45; Metazoa - 652; Fungi - 193; Plants - 164; Viruses - 0; Other Eukaryotes - 545 (source: NCBI BLink). 
AT3G06270AT3G06270.1GGGCCTTAGGCCCATTAGprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: ATP binding / cAMP-dependent protein kinase regulator/ catalytic/ protein kinase/ protein serine/threonine phosphatase (TAIR:AT2G20050.1); Has 3686 Blast hits to 3670 proteins in 257 species: Archae - 2; Bacteria - 83; Metazoa - 1132; Fungi - 383; Plants - 1219; Viruses - 4; Other Eukaryotes - 863 (source: NCBI BLink). 
AT3G07568AT3G07568.1CTAATGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 6 Blast hits to 6 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G07670AT3G07670.1GGCTTTTTCCCATTAGSET domain-containing protein; FUNCTIONS IN: [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco methyltransferase (InterPro:IPR011192), SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT5G14260.3); Has 844 Blast hits to 844 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 238; Plants - 226; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). 
AT3G09470AT3G09470.1AAAAGGCCAAGGCCCATTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). 
AT3G09470.2AAAAGGCCAAGGCCCATTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). 
AT3G09480AT3G09480.1AAAAGGCCAAGGCCCATTAGhistone H2B, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT5G02570.1); Has 2678 Blast hits to 2678 proteins in 284 species: Archae - 0; Bacteria - 0; Metazoa - 1868; Fungi - 162; Plants - 357; Viruses - 0; Other Eukaryotes - 291 (source: NCBI BLink). 
AT3G09490AT3G09490.1CTAATGGGCCTTGGCCTTTTchloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: photosynthesis, light reaction; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 637 Blast hits to 548 proteins in 146 species: Archae - 92; Bacteria - 301; Metazoa - 8; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink). 
AT3G10110AT3G10110.1CTAATGGGCCTAAAmaternal effect embryo arrest 67 (MEE67); FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: embryonic development ending in seed dormancy, protein transport; LOCATED IN: mitochondrial inner membrane, chloroplast, mitochondrial inner membrane presequence translocase complex; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT1G18320.1); Has 509 Blast hits to 509 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 226; Fungi - 159; Plants - 86; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT3G11520AT3G11520.1CTAATGGGEncodes a B-type mitotic cyclin. 
AT3G11710AT3G11710.1CTAATGGGCTTGARABIDOPSIS THALIANA LYSYL-TRNA SYNTHETASE 1 (ATKRS-1); FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, lysine-tRNA ligase activity, ATP binding, nucleic acid binding; INVOLVED IN: lysyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Lysyl-tRNA synthetase, class II, C-terminal (InterPro:IPR018149), Lysyl-tRNA synthetase, class II (InterPro:IPR002313), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 15525 Blast hits to 13421 proteins in 1696 species: Archae - 251; Bacteria - 8760; Metazoa - 567; Fungi - 510; Plants - 102; Viruses - 0; Other Eukaryotes - 5335 (source: NCBI BLink). 
AT3G12260AT3G12260.1CTTAGGCCCATAAAAAGCCCATTAGcomplex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT3G13120AT3G13120.1ATATGGGCCTAATGGG30S ribosomal protein S10, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, bacterial (InterPro:IPR005731), Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10 (InterPro:IPR001848); Has 5644 Blast hits to 5644 proteins in 1660 species: Archae - 168; Bacteria - 2943; Metazoa - 245; Fungi - 117; Plants - 130; Viruses - 0; Other Eukaryotes - 2041 (source: NCBI BLink). 
AT3G13120.1ATTTGGGCCTAATGGG30S ribosomal protein S10, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, bacterial (InterPro:IPR005731), Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10 (InterPro:IPR001848); Has 5644 Blast hits to 5644 proteins in 1660 species: Archae - 168; Bacteria - 2943; Metazoa - 245; Fungi - 117; Plants - 130; Viruses - 0; Other Eukaryotes - 2041 (source: NCBI BLink). 
AT3G14990AT3G14990.2CCCATTAG4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). 
AT3G14990.3CCCATTAG4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). 
AT3G15180AT3G15180.1CTAATGGGCCTTATproteasome-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 82 Blast hits to 82 proteins in 33 species: Archae - 0; Bacteria - 1; Metazoa - 56; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT3G16840AT3G16840.1CTAATGGGCTTCATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 47629 Blast hits to 37227 proteins in 1876 species: Archae - 406; Bacteria - 10857; Metazoa - 14354; Fungi - 5782; Plants - 2214; Viruses - 278; Other Eukaryotes - 13738 (source: NCBI BLink). 
AT3G20630AT3G20630.1CTAATGGGCTEncodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage. 
AT3G21230AT3G21230.1CTAATGGGThe gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. 
AT3G21790AT3G21790.1CTAATGGGCCTTAAUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71B8 (UDP-GLUCOSYL TRANSFERASE 71B8); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ quercetin 4'-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT3G21800.1); Has 4493 Blast hits to 4475 proteins in 265 species: Archae - 0; Bacteria - 82; Metazoa - 1698; Fungi - 10; Plants - 2668; Viruses - 11; Other Eukaryotes - 24 (source: NCBI BLink). 
AT3G24490AT3G24490.1TTGGCCCATTAGtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 2488 Blast hits to 1665 proteins in 165 species: Archae - 0; Bacteria - 71; Metazoa - 1163; Fungi - 123; Plants - 222; Viruses - 36; Other Eukaryotes - 873 (source: NCBI BLink). 
AT3G26400AT3G26400.1CTAATGGGCTATTGTTGGGCTCmember of eIF4B - eukaryotic initiation factor 4B 
AT3G46100AT3G46100.1ATAAAGCCCAGCCCATTAGhistidyl-tRNA synthetase 
AT3G47200AT3G47200.1CCCATTAGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF247, plant (InterPro:IPR004158); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G47250.3); Has 483 Blast hits to 448 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 483; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G47200.2CCCATTAGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF247, plant (InterPro:IPR004158); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G47250.3); Has 483 Blast hits to 448 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 483; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G48680AT3G48680.1CTAATGGGCCTCTEncodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. 
AT3G50080AT3G50080.1TTATTGGGCCTTTATGGCCCATTAGEncodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. 
AT3G50210AT3G50210.1AGCCCATTAG2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). 
AT3G50210.2AGCCCATTAG2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). 
AT3G50210.3AGCCCATTAG2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). 
AT3G51010AT3G51010.1TATAGGCCCATAAGGCCCATTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G51820AT3G51820.1CTAATGGGEncodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP. 
AT3G52140AT3G52140.1AAAAAGCCCAAACAAAGCCCATTAGtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G15290.1); Has 9395 Blast hits to 2929 proteins in 282 species: Archae - 109; Bacteria - 2193; Metazoa - 5294; Fungi - 854; Plants - 176; Viruses - 9; Other Eukaryotes - 760 (source: NCBI BLink). 
AT3G52220AT3G52220.1CTAATGGGCCTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 9607 Blast hits to 4937 proteins in 278 species: Archae - 10; Bacteria - 152; Metazoa - 4787; Fungi - 1223; Plants - 656; Viruses - 23; Other Eukaryotes - 2756 (source: NCBI BLink). 
AT3G52230AT3G52230.1TTTAGGCCCATTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast outer membrane, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G53980AT3G53980.1CCCATTAGprotease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G05960.1); Has 89 Blast hits to 89 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G53980.2CCCATTAGprotease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G05960.1); Has 89 Blast hits to 89 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G56210AT3G56210.1AAGGCCCATTAGbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G56210.2AAGGCCCATTAGbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G56210.4AAGGCCCATTAGbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G57930AT3G57930.1CTAATGGGCCAAAGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae - 0; Bacteria - 32; Metazoa - 833; Fungi - 105; Plants - 87; Viruses - 30; Other Eukaryotes - 578 (source: NCBI BLink). 
AT3G57930.2CTAATGGGCCAAAGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae - 0; Bacteria - 32; Metazoa - 833; Fungi - 105; Plants - 87; Viruses - 30; Other Eukaryotes - 578 (source: NCBI BLink). 
AT3G57940AT3G57940.1GTTTGGGCTTTGGCCCATTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1726 (InterPro:IPR013562), Protein of unknown function DUF699, ATPase putative (InterPro:IPR007807); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10490.1); Has 915 Blast hits to 873 proteins in 391 species: Archae - 82; Bacteria - 412; Metazoa - 163; Fungi - 92; Plants - 21; Viruses - 3; Other Eukaryotes - 142 (source: NCBI BLink). 
AT4G02080AT4G02080.1CTAATGGGCTTGA member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. 
AT4G04830AT4G04830.1CCCATTAGmethionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04810.1); Has 5914 Blast hits to 5905 proteins in 1230 species: Archae - 53; Bacteria - 2684; Metazoa - 224; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2759 (source: NCBI BLink). 
AT4G08690AT4G08690.1CCCATTAGSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G22180.2); Has 1877 Blast hits to 1877 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 772; Fungi - 407; Plants - 461; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink). 
AT4G08690.2CCCATTAGSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G22180.2); Has 1877 Blast hits to 1877 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 772; Fungi - 407; Plants - 461; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink). 
AT4G10120AT4G10120.1CTAATGGGEncodes a protein with putative sucrose-phosphate synthase activity. 
AT4G10120.2CTAATGGGEncodes a protein with putative sucrose-phosphate synthase activity. 
AT4G10480AT4G10480.1CTAATGGGCTAAnascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). 
AT4G10480.2CTAATGGGCTAAnascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). 
AT4G13266AT4G13266.1CCCATTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G13950.1); Has 106 Blast hits to 99 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G13330AT4G13330.1CTAATGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; Has 49 Blast hits to 49 proteins in 19 species: Archae - 0; Bacteria - 9; Metazoa - 14; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT4G13830AT4G13830.1CTAATGGGCTDnaJ-like protein (J20); nuclear gene 
AT4G13830.2CTAATGGGCTDnaJ-like protein (J20); nuclear gene 
AT4G13860AT4G13860.1CCCATTAGglycine-rich RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: GR-RBP2 (GLYCINE-RICH RNA-BINDING PROTEIN 2); ATP binding / RNA binding / double-stranded DNA binding / single-stranded DNA binding (TAIR:AT4G13850.4); Has 20625 Blast hits to 15554 proteins in 614 species: Archae - 10; Bacteria - 1109; Metazoa - 12326; Fungi - 2038; Plants - 3107; Viruses - 0; Other Eukaryotes - 2035 (source: NCBI BLink). 
AT4G14230AT4G14230.1CCCGACCCCATTAGCBS domain-containing protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14240.1); Has 6669 Blast hits to 6527 proteins in 1353 species: Archae - 64; Bacteria - 4331; Metazoa - 264; Fungi - 186; Plants - 121; Viruses - 0; Other Eukaryotes - 1703 (source: NCBI BLink). 
AT4G17020AT4G17020.1ATAGGCCCATTAGtranscription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). 
AT4G17020.2ATAGGCCCATTAGtranscription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). 
AT4G18596AT4G18596.1CTAATGGGpollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular space, endomembrane system; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), Allergen Ole e 1, conserved site (InterPro:IPR006040); BEST Arabidopsis thaliana protein match is: pollen Ole e 1 allergen and extensin family protein (TAIR:AT5G45880.1); Has 212 Blast hits to 212 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G20050AT4G20050.1CCCATTAGEncodes a polygalacturonase that plays a direct role in degrading the pollen mother cell wall during microspore development. 
AT4G20050.2CCCATTAGEncodes a polygalacturonase that plays a direct role in degrading the pollen mother cell wall during microspore development. 
AT4G23450AT4G23450.1CTAATGGGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G41350.1); Has 4637 Blast hits to 4625 proteins in 197 species: Archae - 0; Bacteria - 0; Metazoa - 1480; Fungi - 298; Plants - 1981; Viruses - 9; Other Eukaryotes - 869 (source: NCBI BLink). 
AT4G23690AT4G23690.1CCCATTAGdisease resistance-responsive family protein / dirigent family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lignan biosynthetic process, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plant disease resistance response protein (InterPro:IPR004265); BEST Arabidopsis thaliana protein match is: disease resistance-responsive family protein / dirigent family protein (TAIR:AT1G64160.1); Has 431 Blast hits to 430 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 431; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G26160AT4G26160.1CTAATGGGEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. 
AT4G26310AT4G26310.1CCCATTAGelongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT3G08740.1); Has 6706 Blast hits to 6706 proteins in 1428 species: Archae - 6; Bacteria - 4287; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 2373 (source: NCBI BLink). 
AT4G26600AT4G26600.1AGCCCATTAGnucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 58475 Blast hits to 25518 proteins in 1706 species: Archae - 305; Bacteria - 24540; Metazoa - 13109; Fungi - 5777; Plants - 1987; Viruses - 583; Other Eukaryotes - 12174 (source: NCBI BLink). 
AT4G26600.1TCAGGCCCATTAGnucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 58475 Blast hits to 25518 proteins in 1706 species: Archae - 305; Bacteria - 24540; Metazoa - 13109; Fungi - 5777; Plants - 1987; Viruses - 583; Other Eukaryotes - 12174 (source: NCBI BLink). 
AT4G26990AT4G26990.1CTAATGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G54920.1); Has 176 Blast hits to 161 proteins in 44 species: Archae - 0; Bacteria - 4; Metazoa - 71; Fungi - 20; Plants - 57; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). 
AT4G27740AT4G27740.1ATGGCCCATTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27745.1); Has 684 Blast hits to 682 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 132; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). 
AT4G28060AT4G28060.1CTTAGGCCCATTAGcytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT5G57815.1); Has 406 Blast hits to 406 proteins in 117 species: Archae - 0; Bacteria - 0; Metazoa - 235; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT4G28730AT4G28730.1AAAACGCCCATTAGglutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT2G20270.1); Has 3146 Blast hits to 3143 proteins in 777 species: Archae - 0; Bacteria - 1253; Metazoa - 362; Fungi - 221; Plants - 386; Viruses - 107; Other Eukaryotes - 817 (source: NCBI BLink). 
AT4G29390AT4G29390.1CTAATGGG40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). 
AT4G29390.1CTAATGGGCCGTA40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). 
AT4G29400AT4G29400.1TACGGCCCATTAGunknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink). 
AT4G31010AT4G31010.1CTAATGGGCCCTARNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G31010.2CTAATGGGCCCTARNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G31120AT4G31120.1ATAAAGCCCATTAGAAAAGCCCInvolved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. 
AT4G31120.2ATAAAGCCCATTAGAAAAGCCCInvolved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. 
AT4G32390AT4G32390.1ATAAGCCCATTAGphosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT2G25520.1); Has 1575 Blast hits to 1573 proteins in 180 species: Archae - 0; Bacteria - 6; Metazoa - 425; Fungi - 287; Plants - 687; Viruses - 0; Other Eukaryotes - 170 (source: NCBI BLink). 
AT4G34620AT4G34620.1CTAATGGGCTTAEncodes ribosomal protein S16, has embryo-defective lethal mutant phenotype 
AT4G34960AT4G34960.1ATGGCCCATTAGpeptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP5 (CYCLOPHILIN 5); peptidyl-prolyl cis-trans isomerase (TAIR:AT2G29960.1); Has 11230 Blast hits to 11218 proteins in 1505 species: Archae - 82; Bacteria - 3582; Metazoa - 2365; Fungi - 952; Plants - 729; Viruses - 4; Other Eukaryotes - 3516 (source: NCBI BLink). 
AT4G35490AT4G35490.1CTAATGGGCTAAMITOCHONDRIAL RIBOSOMAL PROTEIN L11 (MRPL11); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11, bacterial-type (InterPro:IPR006519), Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: PRPL11 (PLASTID RIBOSOMAL PROTEIN L11); structural constituent of ribosome (TAIR:AT1G32990.1); Has 5744 Blast hits to 5744 proteins in 1575 species: Archae - 191; Bacteria - 2960; Metazoa - 99; Fungi - 83; Plants - 65; Viruses - 0; Other Eukaryotes - 2346 (source: NCBI BLink). 
AT4G36290AT4G36290.1CTAATGGGATP-binding region, ATPase-like domain-containing protein; FUNCTIONS IN: ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATP-binding region, ATPase-like (InterPro:IPR003594); BEST Arabidopsis thaliana protein match is: ATP-binding region, ATPase-like domain-containing protein (TAIR:AT4G36280.1); Has 329 Blast hits to 316 proteins in 61 species: Archae - 0; Bacteria - 34; Metazoa - 167; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT4G37340AT4G37340.1TAAACGACTAATGGGCmember of CYP81D 
AT4G38225AT4G38225.1ATTAGGCCCATTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G38225.2ATTAGGCCCATTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G38225.3ATTAGGCCCATTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G38530AT4G38530.1CCCATTAGEncodes a putative phosphoinositide-specific phospholipase C. There are two genes called ATPLC1, one corresponding to AT4g38530 (this one) and one corresponding to AT5g58670. 
AT4G39460AT4G39460.1TATAGGCCCATTAGEncodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway. 
AT4G39470AT4G39470.1CTAATGGGCTATTchloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: tetratricopeptide repeat (TPR)-containing protein (TAIR:AT3G18420.1); Has 1025 Blast hits to 856 proteins in 182 species: Archae - 118; Bacteria - 326; Metazoa - 111; Fungi - 9; Plants - 62; Viruses - 0; Other Eukaryotes - 399 (source: NCBI BLink). 
AT5G03030AT5G03030.1CAAAGCCCATTAGDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G35795.1); Has 692 Blast hits to 692 proteins in 215 species: Archae - 0; Bacteria - 135; Metazoa - 169; Fungi - 136; Plants - 46; Viruses - 2; Other Eukaryotes - 204 (source: NCBI BLink). 
AT5G03560AT5G03560.1CTAATGGGnucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). 
AT5G03560.2CTAATGGGnucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). 
AT5G09450AT5G09450.1CATGGGCCCATTAGpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 2335 Blast hits to 1588 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 6; Plants - 2224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). 
AT5G09450.1CTAATGGGCTGApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 2335 Blast hits to 1588 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 6; Plants - 2224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). 
AT5G09740AT5G09740.1CTAATGGGCCTGAEncodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. 
AT5G09740.2CTAATGGGCCTGAEncodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. 
AT5G09900AT5G09900.1ATGGCCCATTAGEncodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. 
AT5G09900.2ATGGCCCATTAGEncodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. 
AT5G09900.3ATGGCCCATTAGEncodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. 
AT5G10160AT5G10160.1CTAATGGGCTTAGbeta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: hydro-lyase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT2G22230.1); Has 4912 Blast hits to 4909 proteins in 1231 species: Archae - 0; Bacteria - 2978; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1890 (source: NCBI BLink). 
AT5G10740AT5G10740.1AATAGGCCCATTAGCCCAATTGprotein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT5G24940.1); Has 5631 Blast hits to 5529 proteins in 624 species: Archae - 9; Bacteria - 1045; Metazoa - 1489; Fungi - 552; Plants - 1360; Viruses - 11; Other Eukaryotes - 1165 (source: NCBI BLink). 
AT5G10745AT5G10745.1CAATTGGGCTAATGGGCCTATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G12410AT5G12410.1CTAATGGGTHUMP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: THUMP (InterPro:IPR004114); Has 2926 Blast hits to 1988 proteins in 205 species: Archae - 10; Bacteria - 67; Metazoa - 1296; Fungi - 226; Plants - 118; Viruses - 74; Other Eukaryotes - 1135 (source: NCBI BLink). 
AT5G13970AT5G13970.1TGGCCCATTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13310.1); Has 608 Blast hits to 543 proteins in 119 species: Archae - 2; Bacteria - 47; Metazoa - 119; Fungi - 63; Plants - 38; Viruses - 17; Other Eukaryotes - 322 (source: NCBI BLink). 
AT5G16250AT5G16250.1ACGGCCCATTAGGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G02640.1); Has 56 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G16260AT5G16260.1GGGCCTAATGGGCCGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), GYF (InterPro:IPR003169); Has 1767 Blast hits to 1758 proteins in 207 species: Archae - 0; Bacteria - 82; Metazoa - 1049; Fungi - 296; Plants - 184; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink). 
AT5G16610AT5G16610.1ATTGGCCCATTAGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT5G16610.2ATTGGCCCATTAGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT5G18500AT5G18500.1CCCATTAGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: GPK1; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT3G17420.1); Has 86619 Blast hits to 85559 proteins in 3151 species: Archae - 58; Bacteria - 8175; Metazoa - 37929; Fungi - 6495; Plants - 18661; Viruses - 395; Other Eukaryotes - 14906 (source: NCBI BLink). 
AT5G18500.2CCCATTAGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: GPK1; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT3G17420.1); Has 86619 Blast hits to 85559 proteins in 3151 species: Archae - 58; Bacteria - 8175; Metazoa - 37929; Fungi - 6495; Plants - 18661; Viruses - 395; Other Eukaryotes - 14906 (source: NCBI BLink). 
AT5G22210AT5G22210.1CTAATGGGCTTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G22210.2CTAATGGGCTTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G23080AT5G23080.1CTAATGGGCCGAAInteracts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. 
AT5G23080.2CTAATGGGCCGAAInteracts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. 
AT5G23090AT5G23090.1TTCGGCCCATTAGNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G23090.2TTCGGCCCATTAGNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G23090.3TTCGGCCCATTAGNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G23090.4TTCGGCCCATTAGNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G24165AT5G24165.1TCAGCCCATTAGCCCATTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23885.1); Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G27120AT5G27120.1CTAATGGGCCAASAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein 
AT5G27400AT5G27400.1TATAGGCCCATTAGGCCCAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 806 Blast hits to 806 proteins in 171 species: Archae - 0; Bacteria - 62; Metazoa - 389; Fungi - 161; Plants - 105; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT5G27770AT5G27770.1TCGGCCCATTAG60S ribosomal protein L22 (RPL22C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22e (InterPro:IPR002671); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L22-2 (RPL22B) (TAIR:AT3G05560.3); Has 492 Blast hits to 492 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 89; Plants - 73; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). 
AT5G28750AT5G28750.1AAAGCCCATTAGthylakoid assembly protein, putative; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion, protein transport; LOCATED IN: chloroplast thylakoid membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Twin-arginine translocation protein TatB (InterPro:IPR003998), Bacterial sec-independent translocation protein mttA/Hcf106 (InterPro:IPR003369), Twin-arginine translocation protein TatA/E (InterPro:IPR006312); BEST Arabidopsis thaliana protein match is: HCF106; proton motive force dependent protein transmembrane transporter (TAIR:AT5G52440.1); Has 1888 Blast hits to 1888 proteins in 601 species: Archae - 44; Bacteria - 1428; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 356 (source: NCBI BLink). 
AT5G38040AT5G38040.1CTAATGGGCCAATUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, stem, embryo, sepal, seed; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT5G38010.1); Has 4566 Blast hits to 4539 proteins in 305 species: Archae - 0; Bacteria - 130; Metazoa - 1639; Fungi - 14; Plants - 2694; Viruses - 70; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G39250AT5G39250.1CTAATGGGCTTTGGGCCGGGCCGTTF-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G39740AT5G39740.1TTAAAGGCCCAAATATAAAGCCCATTAGGCCTATA60S ribosomal protein L5 (RPL5B); FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5, eukaryotic (InterPro:IPR005485), Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5); 5S rRNA binding / structural constituent of ribosome (TAIR:AT3G25520.1); Has 941 Blast hits to 940 proteins in 333 species: Archae - 245; Bacteria - 6; Metazoa - 326; Fungi - 108; Plants - 79; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT5G41960AT5G41960.1TGTTGGGCTAATGGGCTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G46840AT5G46840.2CTAATGGGCTGARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink). 
AT5G46840.2CTAATGGGCTTATRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink). 
AT5G47690AT5G47690.1CTAATGGGCCTGGbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). 
AT5G47690.2CTAATGGGCCTGGbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). 
AT5G47690.3CTAATGGGCCTGGbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). 
AT5G51110AT5G51110.1CCCATTAG4-alpha-hydroxytetrahydrobiopterin dehydratase; FUNCTIONS IN: 4-alpha-hydroxytetrahydrobiopterin dehydratase activity; INVOLVED IN: tetrahydrobiopterin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional coactivator/pterin dehydratase (InterPro:IPR001533); BEST Arabidopsis thaliana protein match is: dehydratase family (TAIR:AT1G29810.1); Has 1563 Blast hits to 1563 proteins in 256 species: Archae - 17; Bacteria - 489; Metazoa - 0; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1013 (source: NCBI BLink). 
AT5G51120AT5G51120.1CTAATGGGEncodes a homolog of the protein PABN1, a polyadenylation factor subunit. 
AT5G51910AT5G51910.1CAAGGCCCATTAGTCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 547; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G51910.2CAAGGCCCATTAGTCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 547; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G52660AT5G52660.1GCCCATTAGmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 8 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT4G01280.1); Has 825 Blast hits to 821 proteins in 86 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 7; Plants - 646; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink). 
AT5G52660.1GCCCATTAGmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 8 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT4G01280.1); Has 825 Blast hits to 821 proteins in 86 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 7; Plants - 646; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink). 
AT5G52660.2GCCCATTAGmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 8 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT4G01280.1); Has 825 Blast hits to 821 proteins in 86 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 7; Plants - 646; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink). 
AT5G52660.2GCCCATTAGmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 8 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT4G01280.1); Has 825 Blast hits to 821 proteins in 86 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 7; Plants - 646; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink). 
AT5G54900AT5G54900.1CTAATGGGCTGARNA-binding protein 45A (ATRBP45A); FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 26274 Blast hits to 15473 proteins in 616 species: Archae - 10; Bacteria - 1663; Metazoa - 15334; Fungi - 2743; Plants - 3912; Viruses - 0; Other Eukaryotes - 2612 (source: NCBI BLink). 
AT5G56360AT5G56360.1CTAATGGGCCTATTcalmodulin-binding protein; FUNCTIONS IN: calmodulin binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Low density lipoprotein-receptor, class A, cysteine-rich (InterPro:IPR002172), Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); BEST Arabidopsis thaliana protein match is: protein kinase C substrate, heavy chain-related (TAIR:AT2G42390.1); Has 52492 Blast hits to 29968 proteins in 1344 species: Archae - 253; Bacteria - 7152; Metazoa - 21077; Fungi - 6018; Plants - 1646; Viruses - 404; Other Eukaryotes - 15942 (source: NCBI BLink). 
AT5G56360.1TATAGGCCCATTAGcalmodulin-binding protein; FUNCTIONS IN: calmodulin binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Low density lipoprotein-receptor, class A, cysteine-rich (InterPro:IPR002172), Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); BEST Arabidopsis thaliana protein match is: protein kinase C substrate, heavy chain-related (TAIR:AT2G42390.1); Has 52492 Blast hits to 29968 proteins in 1344 species: Archae - 253; Bacteria - 7152; Metazoa - 21077; Fungi - 6018; Plants - 1646; Viruses - 404; Other Eukaryotes - 15942 (source: NCBI BLink). 
AT5G57590AT5G57590.1CCAGGCCCATTAGMutant complemented by E coli Bio A gene encoding 7,8-diaminopelargonic acid aminotransferase. 
AT5G57930AT5G57930.1GTGGGCCTAATGGGACCUMULATION OF PHOTOSYSTEM ONE 2 
AT5G57930.2GTGGGCCTAATGGGACCUMULATION OF PHOTOSYSTEM ONE 2 
AT5G58130AT5G58130.1CTAATGGGCCTTARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G50690.1); Has 13214 Blast hits to 6289 proteins in 622 species: Archae - 145; Bacteria - 5890; Metazoa - 2525; Fungi - 1196; Plants - 360; Viruses - 129; Other Eukaryotes - 2969 (source: NCBI BLink). 
AT5G58140AT5G58140.1ATAAGGCCCATTAGMembrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. 
AT5G58140.2ATAAGGCCCATTAGMembrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. 
AT5G58140.3ATAAGGCCCATTAGMembrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. 
AT5G58140.4ATAAGGCCCATTAGMembrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. 
AT5G58440AT5G58440.1CTAATGGGCCTAAACAAGCCCATSORTING NEXIN 2a (SNX2a); FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2b (SORTING NEXIN 2b); phosphoinositide binding / protein binding (TAIR:AT5G07120.1); Has 1775 Blast hits to 1763 proteins in 175 species: Archae - 7; Bacteria - 6; Metazoa - 1144; Fungi - 391; Plants - 81; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). 
AT5G60820AT5G60820.1TTCGGCCCATTAGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G08139.1); Has 6800 Blast hits to 6591 proteins in 264 species: Archae - 0; Bacteria - 123; Metazoa - 2390; Fungi - 543; Plants - 2247; Viruses - 74; Other Eukaryotes - 1423 (source: NCBI BLink). 
AT5G60940AT5G60940.1CAAAGGCCCATTAGtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). 
AT5G60940.2CAAAGGCCCATTAGtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). 
AT5G61450AT5G61450.1CTAATGGG2-phosphoglycerate kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; Has 393 Blast hits to 372 proteins in 106 species: Archae - 58; Bacteria - 24; Metazoa - 63; Fungi - 40; Plants - 52; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink). 
AT5G66055AT5G66055.1GTAAGGCCCATTAGANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink). 
AT5G66055.2GTAAGGCCCATTAGANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink). 
AT5G66060AT5G66060.1CTAATGGGCCTTACiron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G17720.1); Has 1779 Blast hits to 1774 proteins in 217 species: Archae - 0; Bacteria - 195; Metazoa - 891; Fungi - 57; Plants - 219; Viruses - 14; Other Eukaryotes - 403 (source: NCBI BLink). 
AT5G66190AT5G66190.1TGAGCCCATTAGEncodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. 
AT5G66190.2TGAGCCCATTAGEncodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.