Organism | Arabidopsis thaliana | |
ID | AtREG559 | |
Sequence | CAAAGCCC | |
Annotation | ||
PPDB Motif | GCCCA | Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression |
PLACE Motif | ||
Total Entry Count | 233 |
Locus | Gene model | Sequence | Description |
AT1G02150 | AT1G02150.1 | GGCCTTTGGGCTTTG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 5042 Blast hits to 2597 proteins in 108 species: Archae - 0; Bacteria - 2; Metazoa - 25; Fungi - 66; Plants - 4783; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink).  |
AT1G02180 | AT1G02180.1 | CAAAGCCCAATAA | ferredoxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G02475 | AT1G02475.1 | CAATGGGCTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01883.1); Has 350 Blast hits to 350 proteins in 105 species: Archae - 0; Bacteria - 211; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).  |
AT1G02560 | AT1G02560.1 | CAAAGCCCATAA | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).  |
AT1G02560.1 | CAAAGCCCATAA | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).  | |
AT1G03200 | AT1G03200.1 | CAAAGCCCAACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03240.1); Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G03600 | AT1G03600.1 | GTGGGCTTTG | photosystem II family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 218 Blast hits to 218 proteins in 63 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT1G05805 | AT1G05805.1 | CAAAGCCCAAA | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT2G43140.1); Has 2445 Blast hits to 1444 proteins in 113 species: Archae - 2; Bacteria - 55; Metazoa - 778; Fungi - 140; Plants - 840; Viruses - 0; Other Eukaryotes - 630 (source: NCBI BLink).  |
AT1G06190 | AT1G06190.1 | CAAAGCCCATAAAGCCCAATA | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).  |
AT1G06190.2 | CAAAGCCCATAAAGCCCAATA | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).  | |
AT1G08695 | AT1G08695.1 | GGGCTTTG | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).  |
AT1G13560 | AT1G13560.1 | CAAAGCCC | Encodes aminoalcoholphosphotransferase AAPT1.  |
AT1G13560.2 | CAAAGCCC | Encodes aminoalcoholphosphotransferase AAPT1.  | |
AT1G14270 | AT1G14270.1 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  |
AT1G14270.2 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G14270.3 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G14270.4 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G15810 | AT1G15810.1 | GGGCTTTG | ribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G80620.1); Has 5651 Blast hits to 5651 proteins in 1607 species: Archae - 0; Bacteria - 3067; Metazoa - 94; Fungi - 81; Plants - 397; Viruses - 0; Other Eukaryotes - 2012 (source: NCBI BLink).  |
AT1G16110 | AT1G16110.1 | GGGCTTTG | WAK-like kinase  |
AT1G16740 | AT1G16740.1 | TAGTGGGCTTTG | ribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).  |
AT1G16810 | AT1G16810.1 | CAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
AT1G16810.2 | CAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  | |
AT1G17560 | AT1G17560.1 | CAAAGCCCAC | Mutant shows abnormal ovule development  |
AT1G18480 | AT1G18480.1 | CAAAGCCCAACT | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G07010.1); Has 433 Blast hits to 431 proteins in 108 species: Archae - 12; Bacteria - 139; Metazoa - 0; Fungi - 17; Plants - 53; Viruses - 3; Other Eukaryotes - 209 (source: NCBI BLink).  |
AT1G19140 | AT1G19140.1 | TTATGGGCTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).  |
AT1G19140.2 | TTATGGGCTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).  | |
AT1G19150 | AT1G19150.1 | CAAAGCCCATAA | PSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA,  |
AT1G20340 | AT1G20340.1 | CAAAGCCCATTAAGGCCCATTT | recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis.  |
AT1G20350 | AT1G20350.1 | AAATGGGCCTTAATGGGCTTTG | mitochondrial inner membrane translocase  |
AT1G24560 | AT1G24560.1 | CAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49055.1); Has 56279 Blast hits to 28796 proteins in 1542 species: Archae - 818; Bacteria - 6598; Metazoa - 28656; Fungi - 4716; Plants - 2272; Viruses - 181; Other Eukaryotes - 13038 (source: NCBI BLink).  |
AT1G27630 | AT1G27630.1 | AAAGTCAAAGCCCATAT | CYCLIN T 1;3 (CYCT1;3); FUNCTIONS IN: cyclin-dependent protein kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like (InterPro:IPR011028), Transcription regulator cyclin (InterPro:IPR015429), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: cyclin family protein (TAIR:AT5G45190.1); Has 1136 Blast hits to 1136 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 700; Fungi - 230; Plants - 139; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
AT1G28050 | AT1G28050.1 | CAAAGCCC | zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc finger (B-box type) family protein (TAIR:AT2G33500.2); Has 1872 Blast hits to 1279 proteins in 90 species: Archae - 2; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1798; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT1G28281 | AT1G28281.1 | GGGCTTTG | unknown protein; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).  |
AT1G32530 | AT1G32530.1 | TAATGGGCTCAAAGCCCATAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink).  |
AT1G32630 | AT1G32630.1 | CAAAGCCCTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 10 Blast hits to 10 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 4; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G34130 | AT1G34130.1 | TTAATGGGCTTTG | Encodes homolog of yeast STT3, a subunit of oligosaccharyltransferase.  |
AT1G48450 | AT1G48450.1 | CTTAATGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT1G48450.2 | CTTAATGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT1G48460 | AT1G48460.1 | CAAAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63040.2); Has 36 Blast hits to 36 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G48770 | AT1G48770.1 | GGGCTTTGTGGGCTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18295.1); Has 142 Blast hits to 142 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 142; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G49400 | AT1G49400.1 | AGTTGGGCTTTG | embryo defective 1129 (emb1129); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: ribosomal protein S17 family protein (TAIR:AT3G18880.1); Has 5009 Blast hits to 5009 proteins in 1493 species: Archae - 95; Bacteria - 2929; Metazoa - 38; Fungi - 60; Plants - 74; Viruses - 0; Other Eukaryotes - 1813 (source: NCBI BLink).  |
AT1G52670 | AT1G52670.1 | ATAATGGGCTTTG | biotin/lipoyl attachment domain-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin carboxyl carrier protein of acetyl-CoA carboxylase-related (TAIR:AT3G15690.2); Has 1945 Blast hits to 1945 proteins in 695 species: Archae - 0; Bacteria - 1300; Metazoa - 2; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 568 (source: NCBI BLink).  |
AT1G59580 | AT1G59580.1 | CAAAGCCCAC | encodes a mitogen-activated kinase involved in innate immunity  |
AT1G59580.2 | CAAAGCCCAC | encodes a mitogen-activated kinase involved in innate immunity  | |
AT1G65290 | AT1G65290.1 | CAAAGCCCAA | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. As part of the mitochondrial matrix, it is likely to be involved in fatty acid or lipoic acid biogenesis.  |
AT1G66730 | AT1G66730.1 | TGTTGGGCTTTG | ATP dependent DNA ligase family protein; FUNCTIONS IN: DNA binding, DNA ligase (ATP) activity, ATP binding; INVOLVED IN: DNA repair, DNA replication, DNA recombination; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), DNA ligase, N-terminal (InterPro:IPR012308), ATP dependent DNA ligase, central (InterPro:IPR012310), ATP-dependent DNA ligase, conserved site (InterPro:IPR016059), DNA repair metallo-beta-lactamase (InterPro:IPR011084), ATP dependent DNA ligase, C-terminal (InterPro:IPR012309), ATP-dependent DNA ligase (InterPro:IPR000977); BEST Arabidopsis thaliana protein match is: ATLIG1 (ARABIDOPSIS THALIANA DNA LIGASE 1); ATP binding / DNA binding / DNA ligase (ATP) (TAIR:AT1G08130.1); Has 3133 Blast hits to 3071 proteins in 628 species: Archae - 227; Bacteria - 996; Metazoa - 564; Fungi - 431; Plants - 130; Viruses - 148; Other Eukaryotes - 637 (source: NCBI BLink).  |
AT1G66850 | AT1G66850.1 | CAAAGCCCTA | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein and hydrophobic protein, helical (InterPro:IPR013770); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G38160.1); Has 198 Blast hits to 195 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 198; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G68130 | AT1G68130.1 | CAAAGCCC | Arabidopsis thaliana Indeterminate(ID)-Domain 14 (AtIDD14); FUNCTIONS IN: transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: AtIDD16 (Arabidopsis thaliana Indeterminate(ID)-Domain 16); nucleic acid binding / transcription factor/ zinc ion binding (TAIR:AT1G25250.1); Has 29325 Blast hits to 14409 proteins in 248 species: Archae - 1; Bacteria - 0; Metazoa - 27970; Fungi - 141; Plants - 398; Viruses - 0; Other Eukaryotes - 815 (source: NCBI BLink).  |
AT1G68130.2 | CAAAGCCC | Arabidopsis thaliana Indeterminate(ID)-Domain 14 (AtIDD14); FUNCTIONS IN: transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: AtIDD16 (Arabidopsis thaliana Indeterminate(ID)-Domain 16); nucleic acid binding / transcription factor/ zinc ion binding (TAIR:AT1G25250.1); Has 29325 Blast hits to 14409 proteins in 248 species: Archae - 1; Bacteria - 0; Metazoa - 27970; Fungi - 141; Plants - 398; Viruses - 0; Other Eukaryotes - 815 (source: NCBI BLink).  | |
AT1G68590 | AT1G68590.1 | CAAAGCCCATAA | plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, PSRP-3/Ycf65 (InterPro:IPR006924); BEST Arabidopsis thaliana protein match is: plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative (TAIR:AT5G15760.1); Has 334 Blast hits to 334 proteins in 87 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink).  |
AT1G68590.2 | CAAAGCCCATAA | plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, PSRP-3/Ycf65 (InterPro:IPR006924); BEST Arabidopsis thaliana protein match is: plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative (TAIR:AT5G15760.1); Has 334 Blast hits to 334 proteins in 87 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink).  | |
AT1G69420 | AT1G69420.1 | CAAAGCCCAAA | zinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT4G15080.1); Has 3791 Blast hits to 3785 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1905; Fungi - 464; Plants - 413; Viruses - 0; Other Eukaryotes - 1009 (source: NCBI BLink).  |
AT1G69420.2 | CAAAGCCCAAA | zinc finger (DHHC type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT4G15080.1); Has 3791 Blast hits to 3785 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1905; Fungi - 464; Plants - 413; Viruses - 0; Other Eukaryotes - 1009 (source: NCBI BLink).  | |
AT1G70550 | AT1G70550.2 | CAAAGCCC | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF239, plant (InterPro:IPR004314); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23340.2); Has 437 Blast hits to 404 proteins in 17 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 10; Plants - 423; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G74410 | AT1G74410.1 | CAAAGCCCACT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G66070.1); Has 5472 Blast hits to 5456 proteins in 200 species: Archae - 0; Bacteria - 2; Metazoa - 1838; Fungi - 348; Plants - 2530; Viruses - 21; Other Eukaryotes - 733 (source: NCBI BLink).  |
AT1G75660 | AT1G75660.1 | CAAAGCCCATAT | Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN3 acts as a suppressor of posttranscriptional gene silencing. Mutants accumulate excised miRNA products suggesting that XRN3 is involved in degradation of these products.  |
AT1G77450 | AT1G77450.1 | CAAAGCCC | Arabidopsis NAC domain containing protein 32 (anac032); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ATAF1; transcription activator/ transcription factor (TAIR:AT1G01720.1); Has 1620 Blast hits to 1617 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1620; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G77750 | AT1G77750.1 | CAAAGCCCAACACGTCA | 30S ribosomal protein S13, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: mitochondrion, small ribosomal subunit, chloroplast, mitochondrial small ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: 30S ribosomal protein S13, chloroplast (CS13) (TAIR:AT5G14320.1); Has 5725 Blast hits to 5725 proteins in 1762 species: Archae - 116; Bacteria - 2963; Metazoa - 147; Fungi - 105; Plants - 348; Viruses - 0; Other Eukaryotes - 2046 (source: NCBI BLink).  |
AT1G78670 | AT1G78670.1 | CAAAGCCCAATAT | gamma-glutamyl hydrolase 3 (ATGGH3); FUNCTIONS IN: hydrolase activity, omega peptidase activity, catalytic activity; INVOLVED IN: glutamine metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C26, gamma-glutamyl hydrolase (InterPro:IPR015527), Peptidase C26 (InterPro:IPR011697); BEST Arabidopsis thaliana protein match is: gamma-glutamyl hydrolase, putative / gamma-Glu-X carboxypeptidase, putative / conjugase, putative (TAIR:AT1G78660.2); Has 274 Blast hits to 271 proteins in 59 species: Archae - 0; Bacteria - 0; Metazoa - 163; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT1G79690 | AT1G79690.1 | CAAAGCCC | Arabidopsis thaliana Nudix hydrolase homolog 3 (atnudt3); FUNCTIONS IN: hydrolase activity; LOCATED IN: cytosol, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: IPP1 (ISOPENTENYL DIPHOSPHATE ISOMERASE 1); isopentenyl-diphosphate delta-isomerase (TAIR:AT5G16440.1); Has 1689 Blast hits to 1689 proteins in 505 species: Archae - 17; Bacteria - 1144; Metazoa - 42; Fungi - 50; Plants - 114; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink).  |
AT1G80550 | AT1G80550.1 | GGGCTTTGGGCCCATAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink).  |
AT2G01930 | AT2G01930.1 | AGTGGGCTTTG | BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.  |
AT2G01930.2 | AGTGGGCTTTG | BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.  | |
AT2G02480 | AT2G02480.1 | GGGCTTTG | STICHEL mutant shows trichomes with fewer than normal branches.  |
AT2G02860 | AT2G02860.1 | CAAAGCCC | encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding.  |
AT2G02880 | AT2G02880.1 | CAAAGCCCAACT | mucin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62270.1); Has 72 Blast hits to 72 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT2G03200 | AT2G03200.1 | TAGGGCTTTG | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: CDR1 (CONSTITUTIVE DISEASE RESISTANCE 1); aspartic-type endopeptidase (TAIR:AT5G33340.1); Has 1708 Blast hits to 1685 proteins in 189 species: Archae - 0; Bacteria - 0; Metazoa - 176; Fungi - 322; Plants - 1102; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT2G17350 | AT2G17350.1 | CAAAGCCCTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 93 Blast hits to 67 proteins in 31 species: Archae - 0; Bacteria - 1; Metazoa - 16; Fungi - 13; Plants - 21; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  |
AT2G17360 | AT2G17360.1 | TAGGGCTTTG | 40S ribosomal protein S4 (RPS4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).  |
AT2G18400 | AT2G18400.1 | AGCCCACTGGGCTTTG | ribosomal protein L6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: emb2394 (embryo defective 2394); structural constituent of ribosome (TAIR:AT1G05190.1); Has 5053 Blast hits to 5053 proteins in 1481 species: Archae - 1; Bacteria - 2961; Metazoa - 3; Fungi - 77; Plants - 71; Viruses - 0; Other Eukaryotes - 1940 (source: NCBI BLink).  |
AT2G19480 | AT2G19480.1 | CAAAGCCC | This gene is predicted to encode a nucleosome assembly protein. Plant lines expressing an RNAi construct directed against this gene show a reduction in agrobacterium-mediated root transformation.  |
AT2G19480.2 | CAAAGCCC | This gene is predicted to encode a nucleosome assembly protein. Plant lines expressing an RNAi construct directed against this gene show a reduction in agrobacterium-mediated root transformation.  | |
AT2G20610 | AT2G20610.1 | CAAAGCCC | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis.  |
AT2G20610.2 | CAAAGCCC | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis.  | |
AT2G21280 | AT2G21280.1 | CAAAGCCCAATAAGGGCCTTTAA | A nuclear-encoded, plastid-targeted protein (AtSulA) whose overexpression causes severe yet stochastic plastid (shown in chloroplasts and leucoplasts) division defects. The protein does not appear to interact with either AtFtsZ proteins when studied in a yeast two-hybrid system.  |
AT2G21290 | AT2G21290.1 | TTAAAGGCCCTTATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G26280 | AT2G26280.1 | CAAAGCCCAAAA | smr (Small MutS Related) domain-containing protein mRNA, complete cds  |
AT2G26840 | AT2G26840.1 | CAAAGCCCAATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43910.1); Has 799 Blast hits to 799 proteins in 14 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 2; Other Eukaryotes - 768 (source: NCBI BLink).  |
AT2G33430 | AT2G33430.1 | TTAATGGGCTTTGAGCCCAACT | DIFFERENTIATION AND GREENING-LIKE 1 (DAL1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: plastid organization, endonucleolytic cleavage of tetracistronic rRNA transcript (SSU-rRNA, LSU-rRNA, 4.5S-rRNA, 5S-rRNA); LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 147 Blast hits to 134 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G34250 | AT2G34250.1 | CAAAGCCCATTTGACCC | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink).  |
AT2G34250.2 | CAAAGCCCATTTGACCC | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink).  | |
AT2G36170 | AT2G36170.1 | TTAATGGGCTTTG | ubiquitin extension protein 2 (UBQ2) / 60S ribosomal protein L40 (RPL40A); FUNCTIONS IN: protein binding, structural constituent of ribosome; INVOLVED IN: protein modification process, translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L40e (InterPro:IPR001975), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: UBQ1 (UBIQUITIN EXTENSION PROTEIN 1); protein binding / structural constituent of ribosome (TAIR:AT3G52590.1); Has 9155 Blast hits to 5428 proteins in 614 species: Archae - 0; Bacteria - 7; Metazoa - 4223; Fungi - 953; Plants - 1966; Viruses - 162; Other Eukaryotes - 1844 (source: NCBI BLink).  |
AT2G37190 | AT2G37190.1 | CAAAGCCCATA | 60S ribosomal protein L12 (RPL12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cold, ribosome biogenesis; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L12 (RPL12B) (TAIR:AT3G53430.1); Has 1152 Blast hits to 1152 proteins in 433 species: Archae - 208; Bacteria - 278; Metazoa - 292; Fungi - 109; Plants - 81; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  |
AT2G37550 | AT2G37550.1 | CAAAGCCCAT | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  |
AT2G37550.2 | CAAAGCCCAT | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  | |
AT2G38730 | AT2G38730.1 | CAAAGCCCAAAT | peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase (TAIR:AT2G21130.1); Has 10133 Blast hits to 10113 proteins in 1461 species: Archae - 80; Bacteria - 3058; Metazoa - 2388; Fungi - 954; Plants - 718; Viruses - 4; Other Eukaryotes - 2931 (source: NCBI BLink).  |
AT2G39390 | AT2G39390.1 | CAAAGCCCAAAT | 60S ribosomal protein L35 (RPL35B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 796 Blast hits to 796 proteins in 298 species: Archae - 108; Bacteria - 128; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).  |
AT2G39750 | AT2G39750.1 | CAAAGCCCTA | dehydration-responsive family protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT5G06050.1); Has 1179 Blast hits to 1086 proteins in 154 species: Archae - 2; Bacteria - 119; Metazoa - 231; Fungi - 82; Plants - 566; Viruses - 29; Other Eukaryotes - 150 (source: NCBI BLink).  |
AT2G40700 | AT2G40700.1 | ATGGGCTTTG | DEAD/DEAH box helicase, putative (RH17); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT5G65900.1); Has 26770 Blast hits to 25070 proteins in 1684 species: Archae - 453; Bacteria - 10406; Metazoa - 5242; Fungi - 3151; Plants - 1377; Viruses - 5; Other Eukaryotes - 6136 (source: NCBI BLink).  |
AT2G42390 | AT2G42390.1 | CAAAGCCCAATAT | protein kinase C substrate, heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT5G56360.1); Has 464 Blast hits to 443 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 290; Fungi - 79; Plants - 29; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).  |
AT2G42390.1 | CAAAGCCCAT | protein kinase C substrate, heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT5G56360.1); Has 464 Blast hits to 443 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 290; Fungi - 79; Plants - 29; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).  | |
AT2G42700 | AT2G42700.1 | CAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport, vesicle docking during exocytosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Sec1-like protein (InterPro:IPR001619); Has 95 Blast hits to 92 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT2G43150 | AT2G43150.1 | CAAAGCCCAC | proline-rich extensin-like family protein; FUNCTIONS IN: structural constituent of cell wall; INVOLVED IN: plant-type cell wall organization; LOCATED IN: endomembrane system; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Extensin-like region (InterPro:IPR006706); Has 117548 Blast hits to 32359 proteins in 1305 species: Archae - 300; Bacteria - 16136; Metazoa - 48351; Fungi - 15669; Plants - 18324; Viruses - 3530; Other Eukaryotes - 15238 (source: NCBI BLink).  |
AT2G44270 | AT2G44270.1 | CAAAGCCCATTTATGGCCCACA | ATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: tRNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Uncharacterised protein family UPF0021 (InterPro:IPR000541), PP-loop (InterPro:IPR011063), 2-thiocytidine tRNA biosynthesis protein, TtcA (InterPro:IPR012089); BEST Arabidopsis thaliana protein match is: ATP binding (TAIR:AT1G76170.1); Has 3072 Blast hits to 3023 proteins in 1040 species: Archae - 205; Bacteria - 2091; Metazoa - 125; Fungi - 122; Plants - 38; Viruses - 0; Other Eukaryotes - 491 (source: NCBI BLink).  |
AT2G48110 | AT2G48110.1 | TTGGGCTTTG | Encodes a novel protein of unknown function with homologs in non-seed plants. Sequence analysis predicts membrane spanning domains and a putative protein-protein interaction domain. Semi-dominant mutations display defects in phenylpropanoid accumulation suggesting a role in phenylpropanoid metabolism.  |
AT3G01150 | AT3G01150.1 | GTGGGCTTTG | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination.  |
AT3G01150.2 | GTGGGCTTTG | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination.  | |
AT3G01480 | AT3G01480.1 | CAAAGCCCAACT | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes.  |
AT3G01480.2 | CAAAGCCCAACT | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes.  | |
AT3G02180 | AT3G02180.1 | AAAAGCCCAAATCAAAGCCC | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion.  |
AT3G02180.2 | AAAAGCCCAAATCAAAGCCC | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion.  | |
AT3G02180.3 | AAAAGCCCAAATCAAAGCCC | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion.  | |
AT3G02230 | AT3G02230.1 | CAAAGCCC | reversibly glycosylated polypeptide possibly involved in plant cell wall synthesis  |
AT3G02910 | AT3G02910.1 | CAAAGCCCTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Butirosin biosynthesis, BtrG-like (InterPro:IPR013024), AIG2-like (InterPro:IPR009288); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46720.1); Has 210 Blast hits to 210 proteins in 66 species: Archae - 2; Bacteria - 27; Metazoa - 122; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
AT3G04130 | AT3G04130.1 | CAAAGCCCA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink).  |
AT3G04130.2 | CAAAGCCCA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink).  | |
AT3G06300 | AT3G06300.1 | TTATGGGCTTTG | Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins.  |
AT3G06400 | AT3G06400.1 | CAAAGCCCAAAT | Encodes a SWI2/SNF2 chromatin remodeling protein belonging to the ISWI family. Involved in nuclear proliferation during megagametogenesis and cell expansion in the sporophyte. Constitutively expressed. RNAi induced loss of function in megagametogenesis results in female sterility.35S:RNAi plants have reduced stature.  |
AT3G07200 | AT3G07200.1 | CAAAGCCCATGGGCCTTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G48655.3); Has 4419 Blast hits to 4404 proteins in 583 species: Archae - 0; Bacteria - 0; Metazoa - 3082; Fungi - 473; Plants - 291; Viruses - 27; Other Eukaryotes - 546 (source: NCBI BLink).  |
AT3G07200.2 | CAAAGCCCATGGGCCTTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G48655.3); Has 4419 Blast hits to 4404 proteins in 583 species: Archae - 0; Bacteria - 0; Metazoa - 3082; Fungi - 473; Plants - 291; Viruses - 27; Other Eukaryotes - 546 (source: NCBI BLink).  | |
AT3G08610 | AT3G08610.1 | TATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G09250 | AT3G09250.1 | CAAAGCCCATTAA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: nucleotide-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UvrB/UvrC protein (InterPro:IPR001943); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G10925.2); Has 169 Blast hits to 169 proteins in 54 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
AT3G09570 | AT3G09570.1 | ATTAGGCCCAATGGGCTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18520.1); Has 385 Blast hits to 385 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 216; Fungi - 12; Plants - 132; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT3G10985 | AT3G10985.1 | CAAAGCCC | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis.  |
AT3G11280 | AT3G11280.1 | AGTGGGCTTTG | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay).  |
AT3G11280.2 | AGTGGGCTTTG | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay).  | |
AT3G12680 | AT3G12680.1 | GGGCTTTGTTCGGTTT | Member of the floral homeotic AGAMOUS pathway.  |
AT3G13882 | AT3G13882.1 | AATTGGGCCTGTGGCCCAAAGCCCAT | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34 (InterPro:IPR000271).  |
AT3G15260 | AT3G15260.1 | GTTTGGGCTTTG | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 4540 Blast hits to 4534 proteins in 402 species: Archae - 3; Bacteria - 375; Metazoa - 1354; Fungi - 535; Plants - 1305; Viruses - 11; Other Eukaryotes - 957 (source: NCBI BLink).  |
AT3G15260.2 | GTTTGGGCTTTG | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 4540 Blast hits to 4534 proteins in 402 species: Archae - 3; Bacteria - 375; Metazoa - 1354; Fungi - 535; Plants - 1305; Viruses - 11; Other Eukaryotes - 957 (source: NCBI BLink).  | |
AT3G15380 | AT3G15380.1 | CAAAGCCCATAA | choline transporter-related; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF580 (InterPro:IPR007603); BEST Arabidopsis thaliana protein match is: choline transporter-related (TAIR:AT4G38640.1); Has 687 Blast hits to 679 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 406; Fungi - 83; Plants - 66; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  |
AT3G18850 | AT3G18850.1 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink).  |
AT3G18850.2 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink).  | |
AT3G18850.3 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink).  | |
AT3G18850.4 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink).  | |
AT3G18850.5 | GTGGGCTTTCAAAGCCCGGCCCAATTG | LPAT5; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT4 (LYSOPHOSPHATIDYL ACYLTRANSFERASE 4); acyltransferase (TAIR:AT1G75020.2); Has 1293 Blast hits to 1289 proteins in 331 species: Archae - 0; Bacteria - 399; Metazoa - 468; Fungi - 121; Plants - 94; Viruses - 6; Other Eukaryotes - 205 (source: NCBI BLink).  | |
AT3G18860 | AT3G18860.1 | CAATTGGGCCGGGCTTTGAAAGCCCAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink).  |
AT3G18860.2 | CAATTGGGCCGGGCTTTGAAAGCCCAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PFU (PLAA family ubiquitin binding) (InterPro:IPR015155), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), PUL (InterPro:IPR013535); BEST Arabidopsis thaliana protein match is: RACK1B_AT (RECEPTOR FOR ACTIVATED C KINASE 1 B); nucleotide binding (TAIR:AT1G48630.1); Has 34215 Blast hits to 17060 proteins in 561 species: Archae - 40; Bacteria - 4260; Metazoa - 15055; Fungi - 7264; Plants - 3193; Viruses - 0; Other Eukaryotes - 4403 (source: NCBI BLink).  | |
AT3G18880 | AT3G18880.1 | CAAAGCCCATCA | ribosomal protein S17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: emb1129 (embryo defective 1129); structural constituent of ribosome (TAIR:AT1G49400.1); Has 4907 Blast hits to 4907 proteins in 1461 species: Archae - 81; Bacteria - 2923; Metazoa - 31; Fungi - 32; Plants - 65; Viruses - 0; Other Eukaryotes - 1775 (source: NCBI BLink).  |
AT3G20050 | AT3G20050.1 | AAATGGGCTTTG | Encodes a putative cytoplasmic chaperonin that is similar to mouse Tcp-1 (t complex polypeptide 1).  |
AT3G21370 | AT3G21370.1 | ATTTGGGCTTTG | BETA GLUCOSIDASE 19 (BGLU19); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU18 (BETA GLUCOSIDASE 18); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G52400.1); Has 5737 Blast hits to 5490 proteins in 796 species: Archae - 98; Bacteria - 3105; Metazoa - 607; Fungi - 134; Plants - 850; Viruses - 0; Other Eukaryotes - 943 (source: NCBI BLink).  |
AT3G23325 | AT3G23325.1 | CAAAGCCCAAT | splicing factor, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Splicing factor 3B subunit 5/RDS3 complex subunit 10 (InterPro:IPR009846), Splicing factor 3B, subunit 5 (InterPro:IPR017089); BEST Arabidopsis thaliana protein match is: pre-mRNA splicing factor 10 kDa subunit, putative (TAIR:AT4G14342.1); Has 220 Blast hits to 220 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 61; Plants - 31; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT3G24929 | AT3G24929.1 | ATTTGGGCTTTGGGCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown.  |
AT3G49910 | AT3G49910.1 | CAAAGCCCTA | 60S ribosomal protein L26 (RPL26A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cold, translation; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), KOW (InterPro:IPR005824), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26B) (TAIR:AT5G67510.1); Has 870 Blast hits to 870 proteins in 315 species: Archae - 232; Bacteria - 6; Metazoa - 311; Fungi - 91; Plants - 68; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink).  |
AT3G51820 | AT3G51820.1 | GTTTGGGCTTTG | Encodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP.  |
AT3G52140 | AT3G52140.1 | AAAAAGCCCAAACAAAGCCCATTAG | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G15290.1); Has 9395 Blast hits to 2929 proteins in 282 species: Archae - 109; Bacteria - 2193; Metazoa - 5294; Fungi - 854; Plants - 176; Viruses - 9; Other Eukaryotes - 760 (source: NCBI BLink).  |
AT3G55070 | AT3G55070.1 | CAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT3G55070.2 | CAAAGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  | |
AT3G56190 | AT3G56190.1 | CAAAGCCCATAT | Encodes one of two alpha-SNAPs (soluble NSF attachment protein) in Arabidopsis  |
AT3G56190.2 | CAAAGCCCATAT | Encodes one of two alpha-SNAPs (soluble NSF attachment protein) in Arabidopsis  | |
AT3G57550 | AT3G57550.1 | GGGCTTTG | guanylate kinase  |
AT3G57550.2 | GGGCTTTG | guanylate kinase  | |
AT3G57930 | AT3G57930.1 | CTAATGGGCCAAAGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae - 0; Bacteria - 32; Metazoa - 833; Fungi - 105; Plants - 87; Viruses - 30; Other Eukaryotes - 578 (source: NCBI BLink).  |
AT3G57930.2 | CTAATGGGCCAAAGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae - 0; Bacteria - 32; Metazoa - 833; Fungi - 105; Plants - 87; Viruses - 30; Other Eukaryotes - 578 (source: NCBI BLink).  | |
AT3G57940 | AT3G57940.1 | GTTTGGGCTTTGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1726 (InterPro:IPR013562), Protein of unknown function DUF699, ATPase putative (InterPro:IPR007807); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10490.1); Has 915 Blast hits to 873 proteins in 391 species: Archae - 82; Bacteria - 412; Metazoa - 163; Fungi - 92; Plants - 21; Viruses - 3; Other Eukaryotes - 142 (source: NCBI BLink).  |
AT3G60820 | AT3G60820.1 | CAAAGCCCAAATAAGGCCCATTATAAAGCC | Encodes 20S proteasome beta subunit PBF1 (PBF1).  |
AT3G60820.2 | CAAAGCCCAAATAAGGCCCATTATAAAGCC | Encodes 20S proteasome beta subunit PBF1 (PBF1).  | |
AT3G60900 | AT3G60900.1 | CAAAGCCCAC | FLA10; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); BEST Arabidopsis thaliana protein match is: FLA8 (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 8) (TAIR:AT2G45470.1); Has 12081 Blast hits to 6122 proteins in 671 species: Archae - 102; Bacteria - 3569; Metazoa - 1134; Fungi - 757; Plants - 1832; Viruses - 697; Other Eukaryotes - 3990 (source: NCBI BLink).  |
AT3G61470 | AT3G61470.1 | ATATGGGCTTTG | Encodes a component of the light harvesting antenna complex of photosystem I.  |
AT4G00090 | AT4G00090.1 | AAATGGGCTTTG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink).  |
AT4G00090.1 | TAAATGGGCTTTG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink).  | |
AT4G00550 | AT4G00550.1 | CAAAGCCC | encodes a UDP-galactose-dependent digalactosyldiacylglycerol(DGDG) synthase. Located in chloroplast outer membrane.  |
AT4G02550 | AT4G02550.1 | GTTTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G02550.2 | GTTTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G02550.3 | GTTTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G09900 | AT4G09900.1 | GTGGGCCTGGGCTTTGGGCCTG | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro.  |
AT4G14220 | AT4G14220.1 | CAAAGCCCAAT | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. RHF1a can interact with the cell cycle inhibitor ICK4/KRP6 in vitro. It apppears to target ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF1a is expressed in the carpels throughout floral development. It is expressed in various tissues of the anthers during the early stages of anther development but not in stage 12 flowers and beyond.  |
AT4G14950 | AT4G14950.1 | CAAAGCCCACACGTCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT4G14950.2 | CAAAGCCCACACGTCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  | |
AT4G14950.3 | CAAAGCCCACACGTCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  | |
AT4G16720 | AT4G16720.1 | CAAAGCCCAATAG | 60S ribosomal protein L15 (RPL15A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15B) (TAIR:AT4G17390.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).  |
AT4G22285 | AT4G22285.1 | CAAAGCCCAT | ubiquitin thiolesterase/ zinc ion binding; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin carboxyl-terminal hydrolase family protein (TAIR:AT4G22350.1); Has 2853 Blast hits to 2457 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1787; Fungi - 363; Plants - 246; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink).  |
AT4G23390 | AT4G23390.1 | ATATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF239, plant (InterPro:IPR004314); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20170.2); Has 423 Blast hits to 388 proteins in 17 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 10; Plants - 409; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G23890 | AT4G23890.1 | CAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 252 Blast hits to 252 proteins in 67 species: Archae - 0; Bacteria - 101; Metazoa - 15; Fungi - 4; Plants - 21; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink).  |
AT4G24920 | AT4G24920.1 | GCCGTTTAAAATGGGCTTTG | protein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT5G50460.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT4G26690 | AT4G26690.1 | CAAAGCCC | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development.  |
AT4G27690 | AT4G27690.1 | TGGGCTTTG | VACUOLAR PROTEIN SORTING 26B (VPS26B); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport, vacuolar transport, retrograde transport, endosome to Golgi; LOCATED IN: retromer complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated protein 26 (InterPro:IPR005377); BEST Arabidopsis thaliana protein match is: VPS26A (VACUOLAR PROTEIN SORTING 26A) (TAIR:AT5G53530.1); Has 568 Blast hits to 568 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 302; Fungi - 87; Plants - 60; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink).  |
AT4G27690.2 | TGGGCTTTG | VACUOLAR PROTEIN SORTING 26B (VPS26B); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport, vacuolar transport, retrograde transport, endosome to Golgi; LOCATED IN: retromer complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated protein 26 (InterPro:IPR005377); BEST Arabidopsis thaliana protein match is: VPS26A (VACUOLAR PROTEIN SORTING 26A) (TAIR:AT5G53530.1); Has 568 Blast hits to 568 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 302; Fungi - 87; Plants - 60; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink).  | |
AT4G31530 | AT4G31530.1 | CAAAGCCCATA | binding / catalytic; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Male sterility, NAD-binding (InterPro:IPR013120); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 2281 Blast hits to 2232 proteins in 521 species: Archae - 12; Bacteria - 1390; Metazoa - 76; Fungi - 31; Plants - 258; Viruses - 0; Other Eukaryotes - 514 (source: NCBI BLink).  |
AT4G32050 | AT4G32050.1 | CAAAGCCCATTG | neurochondrin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Neurochondrin (InterPro:IPR008709); Has 126 Blast hits to 126 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 5; Plants - 20; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT4G35730 | AT4G35730.1 | CAAAGCCCATCTAAGCCCATTAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 510 Blast hits to 497 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 187; Fungi - 123; Plants - 153; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
AT4G38930 | AT4G38930.1 | CAAAGCCCAAA | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 484 Blast hits to 484 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 135; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  |
AT4G38930.2 | CAAAGCCCAAA | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 484 Blast hits to 484 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 135; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  | |
AT4G39200 | AT4G39200.1 | ATGGGCTTTG | 40S ribosomal protein S25 (RPS25E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25B) (TAIR:AT2G21580.2); Has 505 Blast hits to 505 proteins in 181 species: Archae - 8; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
AT4G39200.2 | ATGGGCTTTG | 40S ribosomal protein S25 (RPS25E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25B) (TAIR:AT2G21580.2); Has 505 Blast hits to 505 proteins in 181 species: Archae - 8; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT5G01850 | AT5G01850.1 | CAAAGCCCATA | protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Tyrosine-protein kinase, ATN1-like (InterPro:IPR015784); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT5G50180.1); Has 95530 Blast hits to 94330 proteins in 3583 species: Archae - 82; Bacteria - 8364; Metazoa - 42500; Fungi - 8087; Plants - 19045; Viruses - 483; Other Eukaryotes - 16969 (source: NCBI BLink).  |
AT5G02740 | AT5G02740.1 | TTATGGGCTTTGGCCTTTT | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G02740.2 | TTATGGGCTTTGGCCTTTT | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G03030 | AT5G03030.1 | CAAAGCCCATTAG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G35795.1); Has 692 Blast hits to 692 proteins in 215 species: Archae - 0; Bacteria - 135; Metazoa - 169; Fungi - 136; Plants - 46; Viruses - 2; Other Eukaryotes - 204 (source: NCBI BLink).  |
AT5G03830 | AT5G03830.1 | AGTGGGCTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: p21Cip1-binding protein-related (TAIR:AT2G44510.1); Has 225 Blast hits to 225 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 68; Plants - 27; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).  |
AT5G04130 | AT5G04130.1 | TGTTGGGCTTTG | DNA topoisomerase, ATP-hydrolyzing, putative / DNA topoisomerase II, putative / DNA gyrase, putative; FUNCTIONS IN: DNA topoisomerase (ATP-hydrolyzing) activity, DNA binding, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IIA, conserved site (InterPro:IPR018522), DNA topoisomerase, type IIA, subunit B, region 2 (InterPro:IPR013506), DNA topoisomerase, type IIA, subunit B (InterPro:IPR000565), ATP-binding region, ATPase-like (InterPro:IPR003594), DNA topoisomerase, type IIA, subunit B, C-terminal (InterPro:IPR002288), DNA topoisomerase, type IIA, subunit B or N-terminal (InterPro:IPR001241), DNA topoisomerase, type IIA, subunit B or N-terminal, alpha-beta (InterPro:IPR013759), TOPRIM (InterPro:IPR006171), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), DNA topoisomerase, type IIA, central (InterPro:IPR013760); BEST Arabidopsis thaliana protein match is: ATP binding / DNA binding / DNA topoisomerase (ATP-hydrolyzing) (TAIR:AT3G10270.1); Has 23506 Blast hits to 21729 proteins in 4482 species: Archae - 75; Bacteria - 14076; Metazoa - 167; Fungi - 179; Plants - 62; Viruses - 72; Other Eukaryotes - 8875 (source: NCBI BLink).  |
AT5G04130.2 | TGTTGGGCTTTG | DNA topoisomerase, ATP-hydrolyzing, putative / DNA topoisomerase II, putative / DNA gyrase, putative; FUNCTIONS IN: DNA topoisomerase (ATP-hydrolyzing) activity, DNA binding, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IIA, conserved site (InterPro:IPR018522), DNA topoisomerase, type IIA, subunit B, region 2 (InterPro:IPR013506), DNA topoisomerase, type IIA, subunit B (InterPro:IPR000565), ATP-binding region, ATPase-like (InterPro:IPR003594), DNA topoisomerase, type IIA, subunit B, C-terminal (InterPro:IPR002288), DNA topoisomerase, type IIA, subunit B or N-terminal (InterPro:IPR001241), DNA topoisomerase, type IIA, subunit B or N-terminal, alpha-beta (InterPro:IPR013759), TOPRIM (InterPro:IPR006171), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), DNA topoisomerase, type IIA, central (InterPro:IPR013760); BEST Arabidopsis thaliana protein match is: ATP binding / DNA binding / DNA topoisomerase (ATP-hydrolyzing) (TAIR:AT3G10270.1); Has 23506 Blast hits to 21729 proteins in 4482 species: Archae - 75; Bacteria - 14076; Metazoa - 167; Fungi - 179; Plants - 62; Viruses - 72; Other Eukaryotes - 8875 (source: NCBI BLink).  | |
AT5G04710 | AT5G04710.1 | CATGGGCCCAAAGCCCATA | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G60160.1); Has 1276 Blast hits to 1273 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 40; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink).  |
AT5G05740 | AT5G05740.1 | GGGCTTTG | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria.  |
AT5G05740.2 | GGGCTTTG | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria.  | |
AT5G05750 | AT5G05750.1 | CAAAGCCC | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Tetratricopeptide region (InterPro:IPR013026), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT3G57340.2); Has 16636 Blast hits to 16631 proteins in 1960 species: Archae - 118; Bacteria - 5128; Metazoa - 3676; Fungi - 1518; Plants - 1246; Viruses - 21; Other Eukaryotes - 4929 (source: NCBI BLink).  |
AT5G06060 | AT5G06060.1 | TGATGGGCTTTG | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29290.2); Has 88350 Blast hits to 88156 proteins in 2259 species: Archae - 471; Bacteria - 47428; Metazoa - 5087; Fungi - 4564; Plants - 1650; Viruses - 7; Other Eukaryotes - 29143 (source: NCBI BLink).  |
AT5G06260 | AT5G06260.1 | GTGGGCTTTG | nucleolar protein-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571), EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: calcium ion binding (TAIR:AT4G34070.1); Has 925 Blast hits to 924 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 578; Fungi - 44; Plants - 76; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink).  |
AT5G06460 | AT5G06460.1 | CAAAGCCCAACA | Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined.  |
AT5G09770 | AT5G09770.1 | TATATGGGCCCAAAGCCCAAAC | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G64650.1); Has 5413 Blast hits to 5398 proteins in 1518 species: Archae - 0; Bacteria - 3032; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink).  |
AT5G14320 | AT5G14320.1 | CAAAGCCCAACA | 30S ribosomal protein S13, chloroplast (CS13); FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: 30S ribosomal protein S13, chloroplast, putative (TAIR:AT1G77750.1); Has 5735 Blast hits to 5735 proteins in 1744 species: Archae - 113; Bacteria - 2978; Metazoa - 171; Fungi - 134; Plants - 251; Viruses - 0; Other Eukaryotes - 2088 (source: NCBI BLink).  |
AT5G14320.2 | CAAAGCCCAACA | 30S ribosomal protein S13, chloroplast (CS13); FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: 30S ribosomal protein S13, chloroplast, putative (TAIR:AT1G77750.1); Has 5735 Blast hits to 5735 proteins in 1744 species: Archae - 113; Bacteria - 2978; Metazoa - 171; Fungi - 134; Plants - 251; Viruses - 0; Other Eukaryotes - 2088 (source: NCBI BLink).  | |
AT5G16510 | AT5G16510.1 | CTTAACCGGGCTTTG | reversibly glycosylated polypeptide, putative; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: response to salt stress; LOCATED IN: Golgi apparatus, cell junction, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1,4-glucan-protein synthase, UDP-forming (InterPro:IPR004901); BEST Arabidopsis thaliana protein match is: RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1); cellulose synthase (UDP-forming) (TAIR:AT3G02230.1); Has 134 Blast hits to 133 proteins in 31 species: Archae - 12; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G16510.2 | CTTAACCGGGCTTTG | reversibly glycosylated polypeptide, putative; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: response to salt stress; LOCATED IN: Golgi apparatus, cell junction, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1,4-glucan-protein synthase, UDP-forming (InterPro:IPR004901); BEST Arabidopsis thaliana protein match is: RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1); cellulose synthase (UDP-forming) (TAIR:AT3G02230.1); Has 134 Blast hits to 133 proteins in 31 species: Archae - 12; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT5G20570 | AT5G20570.1 | CAAAGCCCAAA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein.  |
AT5G20570.2 | CAAAGCCCAAA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein.  | |
AT5G20570.3 | CAAAGCCCAAA | Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein.  | |
AT5G25780 | AT5G25780.1 | ATAATGGGCTTTG | member of eIF3b - eukaryotic initiation factor 3b  |
AT5G25780.1 | ATAATGGGCTTTG | member of eIF3b - eukaryotic initiation factor 3b  | |
AT5G28370 | AT5G28370.1 | CAAAGCCC | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G28460.1); Has 22506 Blast hits to 6026 proteins in 190 species: Archae - 7; Bacteria - 27; Metazoa - 841; Fungi - 534; Plants - 20012; Viruses - 0; Other Eukaryotes - 1085 (source: NCBI BLink).  |
AT5G35732 | AT5G35732.1 | CAAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G04795.1); Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G37510 | AT5G37510.1 | AAAAAGCCCACAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte.  |
AT5G37510.2 | AAAAAGCCCACAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte.  | |
AT5G39250 | AT5G39250.1 | CTAATGGGCTTTGGGCCGGGCCGTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G40500 | AT5G40500.1 | GGCTTTTAGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G40500.2 | GGCTTTTAGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G42790 | AT5G42790.1 | CAAAGCCCA | encodes a protein with extensive homology to the largest subunit of the multicatalytic proteinase complex (proteasome)  |
AT5G44500 | AT5G44500.1 | CAAAGCCCAACA | small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: smB (small nuclear ribonucleoprotein associated protein B) (TAIR:AT4G20440.4); Has 53621 Blast hits to 25379 proteins in 1012 species: Archae - 54; Bacteria - 5505; Metazoa - 29637; Fungi - 5515; Plants - 6455; Viruses - 1288; Other Eukaryotes - 5167 (source: NCBI BLink).  |
AT5G44500.2 | CAAAGCCCAACA | small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: smB (small nuclear ribonucleoprotein associated protein B) (TAIR:AT4G20440.4); Has 53621 Blast hits to 25379 proteins in 1012 species: Archae - 54; Bacteria - 5505; Metazoa - 29637; Fungi - 5515; Plants - 6455; Viruses - 1288; Other Eukaryotes - 5167 (source: NCBI BLink).  | |
AT5G47010 | AT5G47010.1 | CAAAGCCCATAT | Required for nonsense-mediated mRNA decay. Involved in RNA interference. lba1 mutants has reduced sugar-induced expression of Atb- amylase, is hypersensitive to glucose and abscisic acid and resistant to mannose, and shows early flowering, short day-sensitive growth, and seed germination phenotypes.  |
AT5G47110 | AT5G47110.1 | CAAAGCCCATTAA | lil3 protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis, light harvesting; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LIL3:1; transcription factor (TAIR:AT4G17600.1); Has 51 Blast hits to 51 proteins in 19 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G47700 | AT5G47700.1 | CAAAGCCCAATAA | 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink).  |
AT5G47700.2 | CAAAGCCCAATAA | 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink).  | |
AT5G53530 | AT5G53530.1 | TGGGCTTTG | Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport.  |
AT5G53560 | AT5G53560.1 | AAAGTCAAAGCCCAACT | Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase.  |
AT5G53560.1 | CAAAGCCCAATT | Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase.  | |
AT5G55310 | AT5G55310.1 | CAAAGCCCAA | Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality.  |
AT5G57290 | AT5G57290.1 | AAATGGGCTTTG | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink).  |
AT5G57290.2 | AAATGGGCTTTG | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink).  | |
AT5G57290.3 | AAATGGGCTTTG | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink).  | |
AT5G58020 | AT5G58020.1 | CAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF602 (InterPro:IPR006735); Has 270 Blast hits to 270 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 71; Plants - 21; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  |
AT5G58920 | AT5G58920.1 | CAAAGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G59500 | AT5G59500.1 | CAAAGCCCATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 491 Blast hits to 491 proteins in 204 species: Archae - 22; Bacteria - 353; Metazoa - 4; Fungi - 21; Plants - 20; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  |
AT5G60030 | AT5G60030.1 | GGGCTTTG | unknown protein; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75335.1); Has 210106 Blast hits to 83883 proteins in 2248 species: Archae - 772; Bacteria - 18533; Metazoa - 91346; Fungi - 18704; Plants - 7840; Viruses - 1079; Other Eukaryotes - 71832 (source: NCBI BLink).  |
AT5G60030.1 | TTTTGGGCTTTGTTGGCCCATCT | unknown protein; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75335.1); Has 210106 Blast hits to 83883 proteins in 2248 species: Archae - 772; Bacteria - 18533; Metazoa - 91346; Fungi - 18704; Plants - 7840; Viruses - 1079; Other Eukaryotes - 71832 (source: NCBI BLink).  | |
AT5G60160 | AT5G60160.1 | CAATTGGGCTTTGTAATGGGCCAAT | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: response to cadmium ion, proteolysis; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G04710.1); Has 1278 Blast hits to 1277 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 41; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).  |
AT5G64270 | AT5G64270.1 | TAATTGGGCTTATGGGCTTTG | splicing factor, putative; FUNCTIONS IN: binding; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Splicing factor 3B subunit 1 (InterPro:IPR015016), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A regulator (TAIR:AT1G25490.1); Has 1441 Blast hits to 1324 proteins in 270 species: Archae - 12; Bacteria - 198; Metazoa - 607; Fungi - 267; Plants - 142; Viruses - 10; Other Eukaryotes - 205 (source: NCBI BLink).  |
AT5G65940 | AT5G65940.1 | GGGCTTTG | hydrolyzes beta-hydroxyisobutyryl-CoA  |
AT5G65940.2 | GGGCTTTG | hydrolyzes beta-hydroxyisobutyryl-CoA  | |
AT5G65940.3 | GGGCTTTG | hydrolyzes beta-hydroxyisobutyryl-CoA  | |
AT5G66080 | AT5G66080.1 | CAAAGCCCAATAAG | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51370.1); Has 3605 Blast hits to 3604 proteins in 217 species: Archae - 0; Bacteria - 11; Metazoa - 1260; Fungi - 366; Plants - 1225; Viruses - 5; Other Eukaryotes - 738 (source: NCBI BLink).  |
AT5G66090 | AT5G66090.1 | CTTATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G67510 | AT5G67510.1 | CAAAGCCCATCT | 60S ribosomal protein L26 (RPL26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26A) (TAIR:AT3G49910.1); Has 893 Blast hits to 893 proteins in 319 species: Archae - 233; Bacteria - 15; Metazoa - 308; Fungi - 91; Plants - 68; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink).  |