Organism | Arabidopsis thaliana | |
ID | AtREG561 | |
Sequence | AACCGGAT | |
Annotation | ||
PPDB Motif | AACCG(G/A) | overlapping GT1 box |
PLACE Motif | ||
Total Entry Count | 378 |
Locus | Gene model | Sequence | Description |
AT1G04590 | AT1G04590.1 | TTAAACCGATCCGGTTTAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G04590.2 | TTAAACCGATCCGGTTTAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G04900 | AT1G04900.1 | TTAAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF185 (InterPro:IPR003788); Has 159 Blast hits to 155 proteins in 81 species: Archae - 0; Bacteria - 35; Metazoa - 2; Fungi - 68; Plants - 25; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT1G05270 | AT1G05270.1 | ATCCGGTTAAA | TraB family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pheromone shutdown-related, TraB (InterPro:IPR002816); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32340.1); Has 515 Blast hits to 497 proteins in 174 species: Archae - 89; Bacteria - 148; Metazoa - 111; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  |
AT1G06515 | AT1G06515.1 | ATCCGGTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30942.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 10; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G07110 | AT1G07110.1 | ATCCGGTTAT | Encodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase.  |
AT1G08220 | AT1G08220.1 | TTAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: mitochondrial proton-transporting ATP synthase complex assembly; LOCATED IN: mitochondrial inner membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: ATPase assembly factor ATP10, mitochondria (InterPro:IPR007849); Has 100 Blast hits to 100 proteins in 48 species: Archae - 6; Bacteria - 0; Metazoa - 2; Fungi - 63; Plants - 15; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT1G08220.2 | TTAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: mitochondrial proton-transporting ATP synthase complex assembly; LOCATED IN: mitochondrial inner membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: ATPase assembly factor ATP10, mitochondria (InterPro:IPR007849); Has 100 Blast hits to 100 proteins in 48 species: Archae - 6; Bacteria - 0; Metazoa - 2; Fungi - 63; Plants - 15; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  | |
AT1G08250 | AT1G08250.1 | TTAAACCGGATCGGGTCGA | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].  |
AT1G08470 | AT1G08470.1 | ATCCGGTTCACCCGGTTTT | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: strictosidine synthase family protein (TAIR:AT5G22020.1); Has 898 Blast hits to 891 proteins in 185 species: Archae - 1; Bacteria - 239; Metazoa - 198; Fungi - 13; Plants - 301; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
AT1G08480 | AT1G08480.1 | AAAACCGGGTGAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, plastid, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; Has 22 Blast hits to 22 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G08580 | AT1G08580.1 | AAACCGAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G09140 | AT1G09140.1 | ATCCGGTTA | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.  |
AT1G09140.2 | ATCCGGTTA | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.  | |
AT1G09150 | AT1G09150.1 | TAACCGGAT | pseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink).  |
AT1G09620 | AT1G09620.1 | ATCCGGTTTT | ATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding; FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, leucine-tRNA ligase activity, ATP binding; INVOLVED IN: leucyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Leucyl-tRNA synthetase, class Ia, archaeal/eukaryotic cytosolic (InterPro:IPR004493), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: EMB2369 (EMBRYO DEFECTIVE 2369); ATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding (TAIR:AT4G04350.1); Has 10914 Blast hits to 10382 proteins in 1644 species: Archae - 486; Bacteria - 5815; Metazoa - 490; Fungi - 313; Plants - 129; Viruses - 0; Other Eukaryotes - 3681 (source: NCBI BLink).  |
AT1G09840 | AT1G09840.1 | ATCCGGTTA | SHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).  |
AT1G09840.2 | ATCCGGTTA | SHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).  | |
AT1G09840.3 | ATCCGGTTA | SHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).  | |
AT1G09840.4 | ATCCGGTTA | SHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).  | |
AT1G09840.5 | ATCCGGTTA | SHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).  | |
AT1G09840.6 | ATCCGGTTA | SHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).  | |
AT1G10430 | AT1G10430.1 | ATCCGGTTTGG | Encodes one of two isoforms of the catalytic subunit of protein phosphatase 2A.  |
AT1G11320 | AT1G11320.1 | AAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G11760 | AT1G11760.1 | ATCCGGTTTAT | unknown protein; LOCATED IN: cellular_component unknown; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G13350 | AT1G13350.1 | ATCCGGTTAAG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G53640.1); Has 80312 Blast hits to 71745 proteins in 1717 species: Archae - 65; Bacteria - 5105; Metazoa - 38133; Fungi - 9588; Plants - 8768; Viruses - 394; Other Eukaryotes - 18259 (source: NCBI BLink).  |
AT1G14060 | AT1G14060.1 | ATCCGGTTCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: GCK (InterPro:IPR012891); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G02210.1); Has 243 Blast hits to 215 proteins in 60 species: Archae - 0; Bacteria - 2; Metazoa - 93; Fungi - 27; Plants - 49; Viruses - 2; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT1G14620 | AT1G14620.1 | CAAACCGGAT | DECOY (DECOY); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 71; Fungi - 79; Plants - 19; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT1G14620.1 | CAAACCGGAT | DECOY (DECOY); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 71; Fungi - 79; Plants - 19; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT1G14620.2 | CAAACCGGAT | DECOY (DECOY); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 71; Fungi - 79; Plants - 19; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT1G14620.2 | CAAACCGGAT | DECOY (DECOY); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 71; Fungi - 79; Plants - 19; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT1G15400 | AT1G15400.1 | ATCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80180.1); Has 50 Blast hits to 50 proteins in 11 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT1G15400.2 | ATCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80180.1); Has 50 Blast hits to 50 proteins in 11 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT1G15400.3 | ATCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80180.1); Has 50 Blast hits to 50 proteins in 11 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT1G15810 | AT1G15810.1 | ATCCGGTTC | ribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G80620.1); Has 5651 Blast hits to 5651 proteins in 1607 species: Archae - 0; Bacteria - 3067; Metazoa - 94; Fungi - 81; Plants - 397; Viruses - 0; Other Eukaryotes - 2012 (source: NCBI BLink).  |
AT1G16350 | AT1G16350.1 | ATCCGGTTTT | inosine-5'-monophosphate dehydrogenase, putative; FUNCTIONS IN: IMP dehydrogenase activity, catalytic activity; INVOLVED IN: GMP biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IMP dehydrogenase (InterPro:IPR005990), IMP dehydrogenase related (InterPro:IPR018529), Aldolase-type TIM barrel (InterPro:IPR013785), IMP dehydrogenase/GMP reductase (InterPro:IPR001093), IMP dehydrogenase / GMP reductase, conserved site (InterPro:IPR015875); BEST Arabidopsis thaliana protein match is: inosine-5'-monophosphate dehydrogenase (TAIR:AT1G79470.1); Has 9519 Blast hits to 8908 proteins in 1485 species: Archae - 105; Bacteria - 3617; Metazoa - 423; Fungi - 118; Plants - 44; Viruses - 2; Other Eukaryotes - 5210 (source: NCBI BLink).  |
AT1G17730 | AT1G17730.1 | TTAAACCGGAT | VACUOLAR PROTEIN SORTING 46.1 (VPS46.1); INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS46.2 (TAIR:AT1G73030.1); Has 975 Blast hits to 975 proteins in 162 species: Archae - 2; Bacteria - 0; Metazoa - 421; Fungi - 185; Plants - 220; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink).  |
AT1G22410 | AT1G22410.1 | CTAAACCGGAT | 2-dehydro-3-deoxyphosphoheptonate aldolase, putative / 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase, putative / DAHP synthetase, putative; FUNCTIONS IN: 3-deoxy-7-phosphoheptulonate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DAHP synthetase, class II (InterPro:IPR002480); BEST Arabidopsis thaliana protein match is: DHS1 (3-DEOXY-D-ARABINO-HEPTULOSONATE 7-PHOSPHATE SYNTHASE 1); 3-deoxy-7-phosphoheptulonate synthase (TAIR:AT4G39980.1); Has 3140 Blast hits to 3125 proteins in 395 species: Archae - 0; Bacteria - 662; Metazoa - 0; Fungi - 68; Plants - 129; Viruses - 0; Other Eukaryotes - 2281 (source: NCBI BLink).  |
AT1G26180 | AT1G26180.1 | CCAAACCGGATTTTAACCG | unknown protein; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 229 Blast hits to 229 proteins in 65 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
AT1G26250 | AT1G26250.1 | ATCCGGTTTAG | proline-rich extensin, putative; FUNCTIONS IN: structural constituent of cell wall; INVOLVED IN: plant-type cell wall organization; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Extensin-like region (InterPro:IPR006706); Has 254179 Blast hits to 36300 proteins in 1345 species: Archae - 786; Bacteria - 38672; Metazoa - 98390; Fungi - 32269; Plants - 40660; Viruses - 7285; Other Eukaryotes - 36117 (source: NCBI BLink).  |
AT1G27060 | AT1G27060.1 | ATCCGGTTA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: Ran GTPase binding / chromatin binding / zinc ion binding (TAIR:AT5G12350.1); Has 15042 Blast hits to 4459 proteins in 302 species: Archae - 65; Bacteria - 1621; Metazoa - 6396; Fungi - 635; Plants - 1177; Viruses - 2; Other Eukaryotes - 5146 (source: NCBI BLink).  |
AT1G27100 | AT1G27100.1 | ATAACCGGATACCGGTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF569 (InterPro:IPR007679), Actin_cross-linking (InterPro:IPR008999); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69900.1); Has 184 Blast hits to 118 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 8; Plants - 166; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT1G27650 | AT1G27650.1 | CCAAACCGGAT | U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions.  |
AT1G27650.2 | CCAAACCGGAT | U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions.  | |
AT1G27840 | AT1G27840.1 | ATCCGGTTTT | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink).  |
AT1G27840.2 | ATCCGGTTTT | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink).  | |
AT1G27840.3 | ATCCGGTTTT | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink).  | |
AT1G30240 | AT1G30240.1 | ATCCGGTTTAATAAACCGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 120 Blast hits to 120 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 49; Fungi - 41; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT1G30240.2 | ATCCGGTTTAATAAACCGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 120 Blast hits to 120 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 49; Fungi - 41; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT1G31730 | AT1G31730.1 | AAAACCGGATTCCGGTTAAA | epsilon-adaptin, putative; FUNCTIONS IN: protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Adaptor protein complex AP-4, epsilon subunit (InterPro:IPR017109), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 4111 Blast hits to 2632 proteins in 228 species: Archae - 0; Bacteria - 67; Metazoa - 1478; Fungi - 596; Plants - 220; Viruses - 3; Other Eukaryotes - 1747 (source: NCBI BLink).  |
AT1G31920 | AT1G31920.1 | AACCGAACCGGAT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 13708 Blast hits to 5114 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 82; Fungi - 70; Plants - 13274; Viruses - 0; Other Eukaryotes - 282 (source: NCBI BLink).  |
AT1G32150 | AT1G32150.1 | ATCCGGTTTAA | bZIP transcription factor family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: transcription, DNA-dependent, regulation of transcription, DNA-dependent, regulation of transcription; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), G-box binding, MFMR (InterPro:IPR012900), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: bZIP transcription factor family protein (TAIR:AT2G35530.1); Has 4481 Blast hits to 3076 proteins in 314 species: Archae - 9; Bacteria - 333; Metazoa - 1321; Fungi - 512; Plants - 1017; Viruses - 24; Other Eukaryotes - 1265 (source: NCBI BLink).  |
AT1G35340 | AT1G35340.2 | AACCGGAT | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT1G35340.3 | AACCGGAT | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  | |
AT1G42960 | AT1G42960.1 | ATAACCGGAT | expressed protein localized to the inner membrane of the chloroplast.  |
AT1G43700 | AT1G43700.1 | GAACCGGAT | Encodes a VirE2-interacting protein. VIP1 mediates nuclear translocation of VirE2 via its amino half, and interacts with histone H2A via it carboxyl half.  |
AT1G43860 | AT1G43860.1 | CAAACCGGAT | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family, Shwachman-Bodian-Diamond syndrome related (InterPro:IPR002140), Uncharacterised protein family UPF0023, conserved site (InterPro:IPR018023); Has 774 Blast hits to 765 proteins in 243 species: Archae - 139; Bacteria - 2; Metazoa - 226; Fungi - 186; Plants - 30; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).  |
AT1G49650 | AT1G49650.1 | ATCCGGTT | cell death associated protein-related; FUNCTIONS IN: hydrolase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-3 (InterPro:IPR013094); BEST Arabidopsis thaliana protein match is: AtCXE5 (Arabidopsis thaliana carboxyesterase 5); carboxylesterase (TAIR:AT1G49660.1); Has 5320 Blast hits to 5313 proteins in 823 species: Archae - 49; Bacteria - 2825; Metazoa - 369; Fungi - 479; Plants - 664; Viruses - 3; Other Eukaryotes - 931 (source: NCBI BLink).  |
AT1G50000 | AT1G50000.1 | TTGAACCGGAT | methyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), Ribosomal RNA small subunit methyltransferase E (InterPro:IPR006700); Has 3924 Blast hits to 3924 proteins in 1156 species: Archae - 0; Bacteria - 2219; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 1687 (source: NCBI BLink).  |
AT1G50000.2 | TTGAACCGGAT | methyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), Ribosomal RNA small subunit methyltransferase E (InterPro:IPR006700); Has 3924 Blast hits to 3924 proteins in 1156 species: Archae - 0; Bacteria - 2219; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 1687 (source: NCBI BLink).  | |
AT1G50010 | AT1G50010.1 | ATCCGGTTCAA | Encodes alpha-2,4 tubulin. TUA2 and TUA4 encode identical proteins.  |
AT1G50380 | AT1G50380.1 | CCGGTTTATCCAAACCGGAT | prolyl oligopeptidase family protein; FUNCTIONS IN: serine-type peptidase activity, serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S9, prolyl oligopeptidase active site region (InterPro:IPR001375), Peptidase S9A, oligopeptidase, N-terminal beta-propeller (InterPro:IPR004106), Peptidase S9A, prolyl oligopeptidase (InterPro:IPR002470); BEST Arabidopsis thaliana protein match is: prolyl oligopeptidase family protein (TAIR:AT1G69020.1); Has 6063 Blast hits to 6017 proteins in 719 species: Archae - 41; Bacteria - 1884; Metazoa - 253; Fungi - 18; Plants - 99; Viruses - 0; Other Eukaryotes - 3768 (source: NCBI BLink).  |
AT1G51390 | AT1G51390.1 | TGGTTCGGTTAAATCCGGTTAAA | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion.  |
AT1G51630 | AT1G51630.1 | ATCCGGTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus, plant-type cell wall; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21190.1); Has 396 Blast hits to 395 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 396; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G51630.1 | ATCCGGTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus, plant-type cell wall; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21190.1); Has 396 Blast hits to 395 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 396; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G53320 | AT1G53320.1 | ATCCGGTTTAGTCGTCGTTTCCGGTTTAG | Member of TLP family  |
AT1G54870 | AT1G54870.1 | ATCCGGTTA | binding / catalytic/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G05260.1); Has 83077 Blast hits to 82922 proteins in 2231 species: Archae - 482; Bacteria - 45268; Metazoa - 5002; Fungi - 4212; Plants - 1573; Viruses - 5; Other Eukaryotes - 26535 (source: NCBI BLink).  |
AT1G61150 | AT1G61150.1 | TTAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  |
AT1G61150.2 | TTAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G61150.3 | TTAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G61150.4 | TTAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G61150.5 | TTAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G61150.6 | TTAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G61150.7 | TTAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif, subgroup (InterPro:IPR013720), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11110.1); Has 740 Blast hits to 708 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 144; Plants - 139; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G61900 | AT1G61900.1 | ATCCGGTTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30700.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G61900.2 | ATCCGGTTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30700.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G62120 | AT1G62120.1 | ATCCGGTTTG | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G62085.1); Has 415 Blast hits to 372 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 404; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G62200 | AT1G62200.1 | AAAACCGGAT | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: PTR2 (PEPTIDE TRANSPORTER 2); dipeptide transporter/ high affinity oligopeptide transporter/ nitrate transmembrane transporter/ peptide transporter/ transporter/ tripeptide transporter (TAIR:AT2G02040.1); Has 4799 Blast hits to 4477 proteins in 805 species: Archae - 0; Bacteria - 2076; Metazoa - 699; Fungi - 312; Plants - 1141; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink).  |
AT1G62570 | AT1G62570.1 | AAACCGGAT | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates  |
AT1G62850 | AT1G62850.2 | TGAACCGGAT | translation release factor; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); Has 1567 Blast hits to 1567 proteins in 680 species: Archae - 0; Bacteria - 1054; Metazoa - 116; Fungi - 68; Plants - 20; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink).  |
AT1G62850.3 | TGAACCGGAT | translation release factor; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); Has 1567 Blast hits to 1567 proteins in 680 species: Archae - 0; Bacteria - 1054; Metazoa - 116; Fungi - 68; Plants - 20; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink).  | |
AT1G64550 | AT1G64550.1 | TTAACCGGAT | member of GCN subfamily  |
AT1G65020 | AT1G65020.1 | TTAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NERD (InterPro:IPR011528); Has 53 Blast hits to 53 proteins in 19 species: Archae - 0; Bacteria - 18; Metazoa - 9; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G65030 | AT1G65030.1 | ATCCGGTTTAA | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  |
AT1G65660 | AT1G65660.1 | ATCCGGTTTT | Encodes a CCHC zinc finger protein that may function as a step II splicing factor. In an epigenetic allele of SMP1 (in which SMP1 and SMP2 mRNA is reduced) organs are smaller and contain fewer cells.  |
AT1G67350 | AT1G67350.1 | TGAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G67350.2 | TGAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G68110 | AT1G68110.1 | GTAAACCGGAT | epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: clathrin coat; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT1G25240.1); Has 192 Blast hits to 186 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 4; Plants - 177; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G70160 | AT1G70160.1 | ATCCGGTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27020.1); Has 70 Blast hits to 70 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT1G70900 | AT1G70900.1 | GAACCGGATTAAACCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23110.3); Has 29 Blast hits to 29 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G73060 | AT1G73060.1 | TTCCGGTTCAATCCGGTTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48790.1); Has 45 Blast hits to 45 proteins in 18 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G74230 | AT1G74230.1 | ATCCGGTTTCGGTTT | encodes a glycine-rich RNA binding protein.  |
AT1G76430 | AT1G76430.1 | ATCCGGTTC | phosphate transporter family protein; FUNCTIONS IN: phosphate transmembrane transporter activity, carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: phosphate transporter family protein (TAIR:AT1G20860.1); Has 19656 Blast hits to 19588 proteins in 1299 species: Archae - 338; Bacteria - 12582; Metazoa - 1996; Fungi - 2895; Plants - 1005; Viruses - 0; Other Eukaryotes - 840 (source: NCBI BLink).  |
AT1G77420 | AT1G77420.1 | ATCCGGTTTAT | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G16120.2); Has 2683 Blast hits to 2679 proteins in 755 species: Archae - 29; Bacteria - 1623; Metazoa - 110; Fungi - 139; Plants - 254; Viruses - 40; Other Eukaryotes - 488 (source: NCBI BLink).  |
AT1G77420.1 | ATCCGGTTTT | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G16120.2); Has 2683 Blast hits to 2679 proteins in 755 species: Archae - 29; Bacteria - 1623; Metazoa - 110; Fungi - 139; Plants - 254; Viruses - 40; Other Eukaryotes - 488 (source: NCBI BLink).  | |
AT1G79010 | AT1G79010.1 | ATCCGGTTC | NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY); FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative (TAIR:AT1G16700.1); Has 7771 Blast hits to 7380 proteins in 1556 species: Archae - 918; Bacteria - 3924; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink).  |
AT2G01735 | AT2G01735.1 | TAACCGGAT | encodes a RING-H2 zinc finger protein essential for seed development.  |
AT2G17190 | AT2G17190.1 | ATCCGGTTCAA | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17200.1); Has 8273 Blast hits to 4684 proteins in 635 species: Archae - 6; Bacteria - 189; Metazoa - 3590; Fungi - 1163; Plants - 1579; Viruses - 154; Other Eukaryotes - 1592 (source: NCBI BLink).  |
AT2G17790 | AT2G17790.1 | ATCCGGTTCGGTT | VPS35 HOMOLOG A (VPS35A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport, retrograde transport, endosome to Golgi; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated protein 35 (InterPro:IPR005378); BEST Arabidopsis thaliana protein match is: VPS35B (VPS35 HOMOLOG B) (TAIR:AT1G75850.1); Has 463 Blast hits to 387 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 144; Plants - 38; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT2G18915 | AT2G18915.1 | GTAAACCGGAT | encodes a member of F-box proteins that includes two other proteins in Arabidopsis (ZTL and FKF1). These proteins contain a unique structure containing a PAS domain at their N-terminus, an F-box motif, and 6 kelch repeats at their C-terminus. Overexpression results in arrhythmic phenotypes for a number of circadian clock outputs in both constant light and constant darkness, long hypocotyls under multiple fluences of both red and blue light, and a loss of photoperiodic control of flowering time. Although this the expression of this gene itself is not regulated by circadian clock, it physically interacts with Dof transcription factors that are transcriptionally regulated by circadian rhythm. LKP2 interacts with Di19, CO/COL family proteins.  |
AT2G18915.2 | GTAAACCGGAT | encodes a member of F-box proteins that includes two other proteins in Arabidopsis (ZTL and FKF1). These proteins contain a unique structure containing a PAS domain at their N-terminus, an F-box motif, and 6 kelch repeats at their C-terminus. Overexpression results in arrhythmic phenotypes for a number of circadian clock outputs in both constant light and constant darkness, long hypocotyls under multiple fluences of both red and blue light, and a loss of photoperiodic control of flowering time. Although this the expression of this gene itself is not regulated by circadian clock, it physically interacts with Dof transcription factors that are transcriptionally regulated by circadian rhythm. LKP2 interacts with Di19, CO/COL family proteins.  | |
AT2G19680 | AT2G19680.1 | ATCCGGTTCGGTT | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT2G19680.2 | ATCCGGTTCGGTT | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT2G20190 | AT2G20190.1 | AACCGGAT | Encodes a microtubule-associated protein that is involved in both cell division and cell expansion. It likely promotes microtubule stability.  |
AT2G20400 | AT2G20400.1 | ATCCGGTTC | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PHR1 (PHOSPHATE STARVATION RESPONSE 1); transcription factor (TAIR:AT4G28610.1); Has 913 Blast hits to 906 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 900; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT2G22425 | AT2G22425.1 | ATCCGGTTTAC | peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, signal peptidase complex, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT4G40042.1); Has 209 Blast hits to 209 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT2G22425.2 | ATCCGGTTTAC | peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, signal peptidase complex, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT4G40042.1); Has 209 Blast hits to 209 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  | |
AT2G24090 | AT2G24090.1 | TAACCGGAATAAACCGAAGTAAACCGGAT | ribosomal protein L35 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35, conserved site (InterPro:IPR018265), Ribosomal protein L35 (InterPro:IPR001706); Has 3401 Blast hits to 3401 proteins in 1037 species: Archae - 0; Bacteria - 2119; Metazoa - 6; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1232 (source: NCBI BLink).  |
AT2G25310 | AT2G25310.1 | ATCCGGTTTAG | carbohydrate binding; FUNCTIONS IN: carbohydrate binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784); BEST Arabidopsis thaliana protein match is: carbohydrate binding (TAIR:AT4G32130.1); Has 218 Blast hits to 218 proteins in 97 species: Archae - 0; Bacteria - 4; Metazoa - 121; Fungi - 44; Plants - 26; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT2G25850 | AT2G25850.1 | ATAAACCGGAT | nucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  |
AT2G25850.1 | TTAAACCGGAT | nucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  | |
AT2G25850.2 | ATAAACCGGAT | nucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  | |
AT2G25850.2 | TTAAACCGGAT | nucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  | |
AT2G25850.3 | ATAAACCGGAT | nucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  | |
AT2G25850.3 | TTAAACCGGAT | nucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).  | |
AT2G25870 | AT2G25870.1 | ATCCGGTTTAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cof protein (InterPro:IPR000150), HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), HAD superfamily hydrolase-like, type 3 (InterPro:IPR013200), Uncharacterised protein family UPF0054 (InterPro:IPR002036); Has 11617 Blast hits to 11603 proteins in 1525 species: Archae - 144; Bacteria - 9370; Metazoa - 28; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 2020 (source: NCBI BLink).  |
AT2G25870.1 | ATCCGGTTTAT | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cof protein (InterPro:IPR000150), HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), HAD superfamily hydrolase-like, type 3 (InterPro:IPR013200), Uncharacterised protein family UPF0054 (InterPro:IPR002036); Has 11617 Blast hits to 11603 proteins in 1525 species: Archae - 144; Bacteria - 9370; Metazoa - 28; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 2020 (source: NCBI BLink).  | |
AT2G26460 | AT2G26460.1 | ATCCGGTTT | RED family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RED-like, N-terminal (InterPro:IPR012916), RED-like, C-terminal (InterPro:IPR012492); Has 352 Blast hits to 259 proteins in 108 species: Archae - 0; Bacteria - 2; Metazoa - 220; Fungi - 53; Plants - 31; Viruses - 3; Other Eukaryotes - 43 (source: NCBI BLink).  |
AT2G30250 | AT2G30250.1 | ATCCGGTTTT | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress.  |
AT2G30390 | AT2G30390.1 | GACCGGTTCAACCGGAT | Encodes one of two ferrochelatase genes in Arabidopsis. Ferrochelatase is the terminal enzyme of heme biosynthesis. FC-II is speculated to operate in photosynthetic cytochromes  |
AT2G32080 | AT2G32080.1 | ATCCGGTTTAA | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication  |
AT2G32080.2 | ATCCGGTTTAA | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication  | |
AT2G33220 | AT2G33220.1 | ATCCGGTTCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, plastid, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: MEE4 (maternal effect embryo arrest 4) (TAIR:AT1G04630.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT2G33840 | AT2G33840.1 | TAACCGGAT | tRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tyrosine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation, tyrosyl-tRNA aminoacylation; LOCATED IN: cytoplasm; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosine tRNA ligase, archaeal/eukaryotic (InterPro:IPR016485), Tyrosyl-tRNA synthetase, class Ib, archaeal/eukaryotic cytosolic (InterPro:IPR015624), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); BEST Arabidopsis thaliana protein match is: ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / tyrosine-tRNA ligase (TAIR:AT1G28350.1); Has 3646 Blast hits to 3629 proteins in 1010 species: Archae - 254; Bacteria - 1669; Metazoa - 303; Fungi - 167; Plants - 79; Viruses - 5; Other Eukaryotes - 1169 (source: NCBI BLink).  |
AT2G34500 | AT2G34500.1 | TGAACCGGAT | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-<i>epi</i>-campesterol to brassicasterol (unlike CYP710A2).  |
AT2G34590 | AT2G34590.1 | CAAACCGGAT | transketolase family protein; FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity, transketolase activity; INVOLVED IN: pollen tube development; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transketolase, C-terminal (InterPro:IPR005476), Transketolase C-terminal-like (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: PDH-E1 BETA (PYRUVATE DEHYDROGENASE E1 BETA); pyruvate dehydrogenase (acetyl-transferring) (TAIR:AT1G30120.1); Has 9465 Blast hits to 9457 proteins in 1366 species: Archae - 92; Bacteria - 4722; Metazoa - 387; Fungi - 143; Plants - 155; Viruses - 0; Other Eukaryotes - 3966 (source: NCBI BLink).  |
AT2G36000 | AT2G36000.1 | TTAAACCGGAT | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  |
AT2G36000.2 | TTAAACCGGAT | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  | |
AT2G36360 | AT2G36360.1 | ATAACCGGAT | kelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G74150.1); Has 6904 Blast hits to 2957 proteins in 231 species: Archae - 8; Bacteria - 233; Metazoa - 2896; Fungi - 817; Plants - 1292; Viruses - 0; Other Eukaryotes - 1658 (source: NCBI BLink).  |
AT2G36360.2 | ATAACCGGAT | kelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G74150.1); Has 6904 Blast hits to 2957 proteins in 231 species: Archae - 8; Bacteria - 233; Metazoa - 2896; Fungi - 817; Plants - 1292; Viruses - 0; Other Eukaryotes - 1658 (source: NCBI BLink).  | |
AT2G36880 | AT2G36880.1 | ATCCGGTTCGG | methionine adenosyltransferase 3 (MAT3); FUNCTIONS IN: copper ion binding, methionine adenosyltransferase activity; INVOLVED IN: one-carbon compound metabolic process, S-adenosylmethionine biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine synthetase (InterPro:IPR002133); BEST Arabidopsis thaliana protein match is: MTO3 (METHIONINE OVER-ACCUMULATOR 3); methionine adenosyltransferase (TAIR:AT3G17390.1); Has 8009 Blast hits to 8008 proteins in 1637 species: Archae - 6; Bacteria - 2990; Metazoa - 309; Fungi - 109; Plants - 502; Viruses - 0; Other Eukaryotes - 4093 (source: NCBI BLink).  |
AT2G36880.2 | ATCCGGTTCGG | methionine adenosyltransferase 3 (MAT3); FUNCTIONS IN: copper ion binding, methionine adenosyltransferase activity; INVOLVED IN: one-carbon compound metabolic process, S-adenosylmethionine biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine synthetase (InterPro:IPR002133); BEST Arabidopsis thaliana protein match is: MTO3 (METHIONINE OVER-ACCUMULATOR 3); methionine adenosyltransferase (TAIR:AT3G17390.1); Has 8009 Blast hits to 8008 proteins in 1637 species: Archae - 6; Bacteria - 2990; Metazoa - 309; Fungi - 109; Plants - 502; Viruses - 0; Other Eukaryotes - 4093 (source: NCBI BLink).  | |
AT2G38550 | AT2G38550.1 | AAAGTCAACCGGAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57280.1); Has 94 Blast hits to 92 proteins in 26 species: Archae - 0; Bacteria - 4; Metazoa - 3; Fungi - 4; Plants - 69; Viruses - 7; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT2G38670 | AT2G38670.1 | ATCCGGTTTG | Encodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis.  |
AT2G40060 | AT2G40060.1 | ATCCGGTT | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT3G51890.1); Has 403 Blast hits to 391 proteins in 99 species: Archae - 2; Bacteria - 32; Metazoa - 184; Fungi - 36; Plants - 54; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink).  |
AT2G40316 | AT2G40316.1 | ATCCGGTTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT2G40316.2 | ATCCGGTTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT2G41530 | AT2G41530.1 | ATAAACCGGAT | Encodes a protein with S-formylglutathione hydrolase activity.  |
AT2G41600 | AT2G41600.1 | ATAAACCGAATTAAACCGAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT2G41600.2 | ATAAACCGAATTAAACCGAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  | |
AT2G41600.3 | ATAAACCGAATTAAACCGAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  | |
AT2G41600.4 | ATAAACCGAATTAAACCGAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  | |
AT2G41600.5 | ATAAACCGAATTAAACCGAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  | |
AT2G42120 | AT2G42120.1 | ACCGGTTTATATCCGGTTCAA | DNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink).  |
AT2G42120.2 | ACCGGTTTATATCCGGTTCAA | DNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink).  | |
AT2G42130 | AT2G42130.1 | TTGAACCGGATATAAACCGGT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT2G42130.2 | TTGAACCGGATATAAACCGGT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT2G42130.3 | TTGAACCGGATATAAACCGGT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT2G42130.4 | TTGAACCGGATATAAACCGGT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT2G42130.5 | TTGAACCGGATATAAACCGGT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT2G42260 | AT2G42260.1 | ATCCGGTTTT | Encodes a novel plant-specific protein of unknown function. The UVI4 gene is expressed mainly in actively dividing cells. The hypocotyl cells in mutant seedlings undergo one extra round of endoreduplication. The uvi4 mutation also promoted the progression of endo-reduplication during leaf development.  |
AT2G45270 | AT2G45270.1 | TTAAACCGGAT | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT4G22720.2); Has 7895 Blast hits to 7864 proteins in 1652 species: Archae - 179; Bacteria - 3268; Metazoa - 208; Fungi - 197; Plants - 129; Viruses - 0; Other Eukaryotes - 3914 (source: NCBI BLink).  |
AT3G03600 | AT3G03600.1 | ATCCGGTTTAC | Structural component of the mitochondrial ribosome small subunit  |
AT3G03610 | AT3G03610.1 | GTAAACCGGAT | phagocytosis and cell motility protein ELMO1-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: phagocytosis; LOCATED IN: cytoskeleton; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Engulfment and cell motility, ELMO (InterPro:IPR006816); BEST Arabidopsis thaliana protein match is: phagocytosis and cell motility protein ELMO1-related (TAIR:AT1G03620.1); Has 636 Blast hits to 636 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 422; Fungi - 25; Plants - 106; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).  |
AT3G04500 | AT3G04500.1 | ATCCGGTTTAGCCACGT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), RNA recognition motif-related (InterPro:IPR015464); BEST Arabidopsis thaliana protein match is: UBP1B (oligouridylate binding protein 1B); mRNA 3'-UTR binding (TAIR:AT1G17370.2); Has 10169 Blast hits to 8298 proteins in 506 species: Archae - 0; Bacteria - 623; Metazoa - 5880; Fungi - 1176; Plants - 1670; Viruses - 0; Other Eukaryotes - 820 (source: NCBI BLink).  |
AT3G04550 | AT3G04550.1 | ATCCGGTTTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G28500.1); Has 79 Blast hits to 79 proteins in 37 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G04550.1 | ATCCGGTTTAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G28500.1); Has 79 Blast hits to 79 proteins in 37 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT3G05000 | AT3G05000.1 | ATCCGGTTTAA | transport protein particle (TRAPP) component Bet3 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: pollen tube development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transport protein particle (TRAPP) component (InterPro:IPR007194); Has 331 Blast hits to 331 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 161; Fungi - 94; Plants - 35; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  |
AT3G05020 | AT3G05020.1 | ATCCGGTTAAA | encodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light.  |
AT3G05400 | AT3G05400.1 | CAAACCGGAT | sugar transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: SFP1; carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT5G27350.1); Has 15989 Blast hits to 15662 proteins in 1061 species: Archae - 222; Bacteria - 5080; Metazoa - 4416; Fungi - 4071; Plants - 1288; Viruses - 0; Other Eukaryotes - 912 (source: NCBI BLink).  |
AT3G05570 | AT3G05570.1 | ATCCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G39235.1); Has 39 Blast hits to 39 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G06430 | AT3G06430.1 | ATCCGGTTTT | embryo defective 2750 (EMB2750); INVOLVED IN: embryonic development ending in seed dormancy, pollen tube development; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53170.1); Has 13889 Blast hits to 5167 proteins in 165 species: Archae - 3; Bacteria - 14; Metazoa - 269; Fungi - 227; Plants - 12750; Viruses - 0; Other Eukaryotes - 626 (source: NCBI BLink).  |
AT3G08740 | AT3G08740.1 | GTAAACCGGAT | elongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P (InterPro:IPR011768), Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT4G26310.1); Has 6860 Blast hits to 6860 proteins in 1429 species: Archae - 3; Bacteria - 4309; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 2510 (source: NCBI BLink).  |
AT3G09300 | AT3G09300.1 | AACCGGAT | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 3B (ORP3B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein, conserved site (InterPro:IPR018494), Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: UNE18 (UNFERTILIZED EMBRYO SAC 18); oxysterol binding / sterol binding (TAIR:AT5G02100.1); Has 1795 Blast hits to 1772 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 940; Fungi - 458; Plants - 154; Viruses - 0; Other Eukaryotes - 243 (source: NCBI BLink).  |
AT3G10250 | AT3G10250.1 | ATCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04090.2); Has 135 Blast hits to 135 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT3G10250.2 | ATCCGGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04090.2); Has 135 Blast hits to 135 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  | |
AT3G10850 | AT3G10850.1 | TCGGTTCGATCCGGTTTG | glyoxalase II cytoplasmic isozyme (Glx2-2) mRNA, complete  |
AT3G10850.1 | TTGAACCGGAT | glyoxalase II cytoplasmic isozyme (Glx2-2) mRNA, complete  | |
AT3G10860 | AT3G10860.1 | ATCCGGTTCAA | ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT5G05370.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G10860.1 | CAAACCGGATCGAACCGA | ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT5G05370.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G11050 | AT3G11050.1 | ATCCGGTTT | ferritin 2 (ATFER2); FUNCTIONS IN: oxidoreductase activity, ferric iron binding, binding, transition metal ion binding; INVOLVED IN: response to oxidative stress, cellular iron ion homeostasis, response to abscisic acid stimulus, iron ion transport; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Ferritin, N-terminal (InterPro:IPR001519), Ferritin-related (InterPro:IPR012347), Ferritin-like (InterPro:IPR009040), Ferritin, conserved site (InterPro:IPR014034), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Ferritin and Dps (InterPro:IPR008331); BEST Arabidopsis thaliana protein match is: ATFER4 (ferritin 4); binding / ferric iron binding / oxidoreductase/ transition metal ion binding (TAIR:AT2G40300.1); Has 2388 Blast hits to 2383 proteins in 603 species: Archae - 119; Bacteria - 761; Metazoa - 1101; Fungi - 6; Plants - 217; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  |
AT3G11470 | AT3G11470.1 | ATCCGGTTAAA | 4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).  |
AT3G11470.2 | ATCCGGTTAAA | 4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).  | |
AT3G11470.3 | ATCCGGTTAAA | 4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).  | |
AT3G11760 | AT3G11760.1 | ATAAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04860.1); Has 43 Blast hits to 38 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G12010 | AT3G12010.1 | ATCCGGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: Colon cancer-associated Mic1-like (InterPro:IPR009755); Has 126 Blast hits to 120 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT3G12012 | AT3G12012.1 | ATCCGGTTTT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF20 represents a conserved upstream opening reading frame relative to major ORF AT3G12010.1  |
AT3G12070 | AT3G12070.1 | GAACCGGATGAACCGGTTTAA | geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Prenyltransferase/squalene oxidase (InterPro:IPR001330); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative (TAIR:AT5G12210.1); Has 1147 Blast hits to 1009 proteins in 184 species: Archae - 0; Bacteria - 22; Metazoa - 467; Fungi - 295; Plants - 126; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).  |
AT3G12070.2 | GAACCGGATGAACCGGTTTAA | geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Prenyltransferase/squalene oxidase (InterPro:IPR001330); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative (TAIR:AT5G12210.1); Has 1147 Blast hits to 1009 proteins in 184 species: Archae - 0; Bacteria - 22; Metazoa - 467; Fungi - 295; Plants - 126; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).  | |
AT3G12080 | AT3G12080.1 | TTAAACCGGTTCATCCGGTTC | embryo defective 2738 (emb2738); FUNCTIONS IN: GTP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), Small GTP-binding protein (InterPro:IPR005225), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT5G39960.1); Has 29827 Blast hits to 16895 proteins in 1667 species: Archae - 139; Bacteria - 20018; Metazoa - 342; Fungi - 286; Plants - 215; Viruses - 0; Other Eukaryotes - 8827 (source: NCBI BLink).  |
AT3G12080.2 | TTAAACCGGTTCATCCGGTTC | embryo defective 2738 (emb2738); FUNCTIONS IN: GTP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), Small GTP-binding protein (InterPro:IPR005225), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT5G39960.1); Has 29827 Blast hits to 16895 proteins in 1667 species: Archae - 139; Bacteria - 20018; Metazoa - 342; Fungi - 286; Plants - 215; Viruses - 0; Other Eukaryotes - 8827 (source: NCBI BLink).  | |
AT3G12400 | AT3G12400.1 | GTAAACCGGAT | Mutants of this gene were initially identified because of the trichome morphogenesis phenotype. Those trichomes have multiple nuclei, a defect that turns out not to be restricted to the trichomes but also in all endoreduplicating cell types. This gene encodes a ubiquitin-binding protein with sequence similarities with yeast proteins that are components of the ESCRTI-III complexes. The Arabidopsis protein is found associated with the endosome.  |
AT3G14580 | AT3G14580.1 | ATCCGGTTCA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, embryo, sepal; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 16419 Blast hits to 4807 proteins in 153 species: Archae - 2; Bacteria - 2; Metazoa - 276; Fungi - 148; Plants - 15495; Viruses - 0; Other Eukaryotes - 496 (source: NCBI BLink).  |
AT3G15040 | AT3G15040.1 | CTAAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 2804 Blast hits to 412 proteins in 66 species: Archae - 0; Bacteria - 22; Metazoa - 419; Fungi - 51; Plants - 212; Viruses - 0; Other Eukaryotes - 2100 (source: NCBI BLink).  |
AT3G16460 | AT3G16460.1 | GAACCGGAT | jacalin lectin family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: response to cold; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-binding lectin (InterPro:IPR001229); BEST Arabidopsis thaliana protein match is: MBP1 (MYROSINASE-BINDING PROTEIN 1); protein binding (TAIR:AT1G52040.1); Has 131260 Blast hits to 34126 proteins in 1746 species: Archae - 331; Bacteria - 48540; Metazoa - 26646; Fungi - 8505; Plants - 10521; Viruses - 2266; Other Eukaryotes - 34451 (source: NCBI BLink).  |
AT3G16460.2 | GAACCGGAT | jacalin lectin family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: response to cold; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-binding lectin (InterPro:IPR001229); BEST Arabidopsis thaliana protein match is: MBP1 (MYROSINASE-BINDING PROTEIN 1); protein binding (TAIR:AT1G52040.1); Has 131260 Blast hits to 34126 proteins in 1746 species: Archae - 331; Bacteria - 48540; Metazoa - 26646; Fungi - 8505; Plants - 10521; Viruses - 2266; Other Eukaryotes - 34451 (source: NCBI BLink).  | |
AT3G16840 | AT3G16840.1 | TTAACCGGAT | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 47629 Blast hits to 37227 proteins in 1876 species: Archae - 406; Bacteria - 10857; Metazoa - 14354; Fungi - 5782; Plants - 2214; Viruses - 278; Other Eukaryotes - 13738 (source: NCBI BLink).  |
AT3G17880 | AT3G17880.1 | ATAAACCGGAT | Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX.  |
AT3G17880.2 | ATAAACCGGAT | Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX.  | |
AT3G19190 | AT3G19190.1 | ATCCGGTTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATG2, C-terminal (InterPro:IPR015412); Has 603 Blast hits to 514 proteins in 156 species: Archae - 0; Bacteria - 19; Metazoa - 326; Fungi - 168; Plants - 38; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT3G19650 | AT3G19650.1 | GAACCGGAT | cyclin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT1G20920.1); Has 5115 Blast hits to 3466 proteins in 242 species: Archae - 0; Bacteria - 193; Metazoa - 2936; Fungi - 571; Plants - 368; Viruses - 7; Other Eukaryotes - 1040 (source: NCBI BLink).  |
AT3G20230 | AT3G20230.1 | ATCCGGTTCA | 50S ribosomal protein L18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G08845.2); Has 911 Blast hits to 911 proteins in 312 species: Archae - 0; Bacteria - 630; Metazoa - 35; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink).  |
AT3G20240 | AT3G20240.1 | TGAACCGGAT | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SHS1 (SODIUM HYPERSENSITIVE 1); binding / nucleotide transmembrane transporter/ transporter (TAIR:AT4G32400.1); Has 16786 Blast hits to 9647 proteins in 354 species: Archae - 0; Bacteria - 0; Metazoa - 7901; Fungi - 4785; Plants - 2484; Viruses - 0; Other Eukaryotes - 1616 (source: NCBI BLink).  |
AT3G21160 | AT3G21160.1 | TTAAACCGGAT | mannosyl-oligosaccharide 1,2-alpha-mannosidase, putative; FUNCTIONS IN: mannosyl-oligosaccharide 1,2-alpha-mannosidase activity, calcium ion binding; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 47 (InterPro:IPR001382); BEST Arabidopsis thaliana protein match is: mannosyl-oligosaccharide 1,2-alpha-mannosidase, putative (TAIR:AT1G51590.1); Has 1485 Blast hits to 1396 proteins in 139 species: Archae - 0; Bacteria - 8; Metazoa - 690; Fungi - 531; Plants - 79; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT3G24100 | AT3G24100.1 | CCAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Four F5 protein (InterPro:IPR007513); BEST Arabidopsis thaliana protein match is: four F5 protein-related / 4F5 protein-related (TAIR:AT4G13615.1); Has 195 Blast hits to 195 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 136; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT3G25040 | AT3G25040.1 | ATCCGGTT | ER lumen protein retaining receptor, putative / HDEL receptor, putative; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ERD2 (ENDOPLASMIC RETICULUM RETENTION DEFECTIVE 2); KDEL sequence binding / receptor (TAIR:AT1G29330.1); Has 642 Blast hits to 641 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 121; Plants - 119; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  |
AT3G25860 | AT3G25860.1 | ATCCGGTTAT | Nuclear encoded dihydrolipoamide S-acetyltransferase (LTA2) that encodes teh Pyruvate Decarboxylase E2 subunit. Mutant has embryo defect.  |
AT3G25860.1 | ATCCGGTTTAA | Nuclear encoded dihydrolipoamide S-acetyltransferase (LTA2) that encodes teh Pyruvate Decarboxylase E2 subunit. Mutant has embryo defect.  | |
AT3G26630 | AT3G26630.1 | ATCCGGTTTGG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 11770 Blast hits to 4443 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 21; Plants - 11596; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).  |
AT3G26922 | AT3G26922.1 | ATCCGGTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G52680.2).  |
AT3G27210 | AT3G27210.1 | TTGAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40860.1); Has 132 Blast hits to 70 proteins in 18 species: Archae - 0; Bacteria - 6; Metazoa - 65; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT3G29185 | AT3G29185.1 | ATCCGGTTCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 38 Blast hits to 38 proteins in 17 species: Archae - 0; Bacteria - 23; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G29185.2 | ATCCGGTTCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 38 Blast hits to 38 proteins in 17 species: Archae - 0; Bacteria - 23; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G44340 | AT3G44340.1 | ATAACCGGAT | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions.  |
AT3G44340.2 | ATAACCGGAT | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions.  | |
AT3G47340 | AT3G47340.1 | ATCCGGTTA | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.  |
AT3G47340.2 | ATCCGGTTA | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.  | |
AT3G47340.3 | ATCCGGTTA | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.  | |
AT3G48730 | AT3G48730.1 | AAACCGGAT | glutamate-1-semialdehyde 2,1-aminomutase 2 (GSA2); FUNCTIONS IN: glutamate-1-semialdehyde 2,1-aminomutase activity, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase class-III (InterPro:IPR005814), Tetrapyrrole biosynthesis, glutamate-1-semialdehyde aminotransferase (InterPro:IPR004639), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GSA1 (GLUTAMATE-1-SEMIALDEHYDE-2,1-AMINOMUTASE); glutamate-1-semialdehyde 2,1-aminomutase (TAIR:AT5G63570.1); Has 22952 Blast hits to 22949 proteins in 1683 species: Archae - 419; Bacteria - 12643; Metazoa - 453; Fungi - 515; Plants - 232; Viruses - 10; Other Eukaryotes - 8680 (source: NCBI BLink).  |
AT3G48730.1 | CAAACCGGAT | glutamate-1-semialdehyde 2,1-aminomutase 2 (GSA2); FUNCTIONS IN: glutamate-1-semialdehyde 2,1-aminomutase activity, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase class-III (InterPro:IPR005814), Tetrapyrrole biosynthesis, glutamate-1-semialdehyde aminotransferase (InterPro:IPR004639), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GSA1 (GLUTAMATE-1-SEMIALDEHYDE-2,1-AMINOMUTASE); glutamate-1-semialdehyde 2,1-aminomutase (TAIR:AT5G63570.1); Has 22952 Blast hits to 22949 proteins in 1683 species: Archae - 419; Bacteria - 12643; Metazoa - 453; Fungi - 515; Plants - 232; Viruses - 10; Other Eukaryotes - 8680 (source: NCBI BLink).  | |
AT3G50670 | AT3G50670.1 | ATCCGGTTA | Encodes U1 snRNP 70K  |
AT3G50670.2 | ATCCGGTTA | Encodes U1 snRNP 70K  | |
AT3G55480 | AT3G55480.1 | ATCCGGTTTAT | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink).  |
AT3G55480.2 | ATCCGGTTTAT | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink).  | |
AT3G56150 | AT3G56150.1 | ATCCGGTTTAG | member of eIF3c - eukaryotic initiation factor 3c  |
AT3G56910 | AT3G56910.1 | TTAAACCGGAT | PLASTID-SPECIFIC 50S RIBOSOMAL PROTEIN 5 (PSRP5); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G58980 | AT3G58980.1 | ATCCGGTTTGG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58920.1); Has 1321 Blast hits to 1026 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 1320; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G61130 | AT3G61130.1 | GTAAACCGGAT | Encodes a protein with putative galacturonosyltransferase activity.  |
AT4G02400 | AT4G02400.1 | ATCCGGTTTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: rRNA processing; LOCATED IN: small-subunit processome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small-subunit processome, Utp14 (InterPro:IPR006709); BEST Arabidopsis thaliana protein match is: U3 ribonucleoprotein (Utp) family protein (TAIR:AT5G08600.1); Has 7412 Blast hits to 4272 proteins in 301 species: Archae - 10; Bacteria - 517; Metazoa - 2926; Fungi - 722; Plants - 242; Viruses - 149; Other Eukaryotes - 2846 (source: NCBI BLink).  |
AT4G04910 | AT4G04910.1 | CAAACCGGAT | N-ethylmaleimide sensitive factor  |
AT4G05450 | AT4G05450.1 | ATCCGGTTCGGTTTAA | adrenodoxin-like ferredoxin 2; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: pollen tube development; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Adrenodoxin (InterPro:IPR001055), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Adrenodoxin, iron-sulphur binding site (InterPro:IPR018298); BEST Arabidopsis thaliana protein match is: adrenodoxin-like ferredoxin 1 (TAIR:AT4G21090.3); Has 3455 Blast hits to 3455 proteins in 760 species: Archae - 0; Bacteria - 1368; Metazoa - 220; Fungi - 90; Plants - 51; Viruses - 0; Other Eukaryotes - 1726 (source: NCBI BLink).  |
AT4G08930 | AT4G08930.1 | AACCGGAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group.  |
AT4G10140 | AT4G10140.1 | TTGAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33490.1); Has 39 Blast hits to 39 proteins in 13 species: Archae - 0; Bacteria - 14; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT4G10470 | AT4G10470.1 | ATCCGGTTGAACCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33050.2); Has 23 Blast hits to 11 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G11521 | AT4G11521.1 | ATCCGGTT | LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF26 (InterPro:IPR002902); BEST Arabidopsis thaliana protein match is: kinase (TAIR:AT4G11530.1).  |
AT4G13340 | AT4G13340.1 | CCAAACCGTAAACCGGAT | leucine-rich repeat family protein / extensin family protein; FUNCTIONS IN: structural constituent of cell wall, protein binding; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein / extensin family protein (TAIR:AT3G24480.1); Has 527469 Blast hits to 98695 proteins in 2588 species: Archae - 1432; Bacteria - 100230; Metazoa - 200562; Fungi - 58262; Plants - 84057; Viruses - 13216; Other Eukaryotes - 69710 (source: NCBI BLink).  |
AT4G13780 | AT4G13780.1 | CTTAACCGGAT | methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative; FUNCTIONS IN: methionine-tRNA ligase activity, tRNA binding, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, methionyl-tRNA aminoacylation; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Aminoacyl-tRNA synthetase, class I (M) (InterPro:IPR015413), Methionyl-tRNA synthetase, class Ia (InterPro:IPR002304), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Methionyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR014758), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: tRNA-binding region domain-containing protein (TAIR:AT2G40660.1); Has 12421 Blast hits to 12391 proteins in 1665 species: Archae - 324; Bacteria - 5389; Metazoa - 513; Fungi - 358; Plants - 127; Viruses - 3; Other Eukaryotes - 5707 (source: NCBI BLink).  |
AT4G13950 | AT4G13950.1 | ATCCGGTTTAA | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.  |
AT4G14270 | AT4G14270.1 | ATAACCGGAT | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins.  |
AT4G14270.2 | ATAACCGGAT | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins.  | |
AT4G15955 | AT4G15955.1 | GTAAACCGGAT | epoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1).  |
AT4G15955.2 | GTAAACCGGAT | epoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1).  | |
AT4G15955.3 | GTAAACCGGAT | epoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1).  | |
AT4G16210 | AT4G16210.1 | GACCGGTTCGATCCGGTTTAC | ENOYL-COA HYDRATASE/ISOMERASE A (ECHIA); FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Crotonase, core (InterPro:IPR001753); BEST Arabidopsis thaliana protein match is: ECHID (ENOYL-COA HYDRATASE/ISOMERASE D); catalytic/ naphthoate synthase (TAIR:AT1G60550.1); Has 25757 Blast hits to 25754 proteins in 1304 species: Archae - 201; Bacteria - 14217; Metazoa - 1423; Fungi - 585; Plants - 340; Viruses - 0; Other Eukaryotes - 8991 (source: NCBI BLink).  |
AT4G16520 | AT4G16520.1 | ATCCGGTTC | autophagy 8f (ATG8F); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: AtATG8e; microtubule binding (TAIR:AT2G45170.2); Has 1164 Blast hits to 1162 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 582; Fungi - 125; Plants - 171; Viruses - 3; Other Eukaryotes - 283 (source: NCBI BLink).  |
AT4G16520.2 | ATCCGGTTC | autophagy 8f (ATG8F); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: AtATG8e; microtubule binding (TAIR:AT2G45170.2); Has 1164 Blast hits to 1162 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 582; Fungi - 125; Plants - 171; Viruses - 3; Other Eukaryotes - 283 (source: NCBI BLink).  | |
AT4G17310 | AT4G17310.1 | ATCCGGTTAAG | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47455.7); Has 115 Blast hits to 115 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G17310.2 | ATCCGGTTAAG | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47455.7); Has 115 Blast hits to 115 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G18780 | AT4G18780.1 | AACCCGACCCGAATAAACCGGAT | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling.  |
AT4G19070 | AT4G19070.1 | GTAAACCGGAT | cadmium-responsive protein / cadmium induced protein (AS8); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 110 Blast hits to 61 proteins in 24 species: Archae - 2; Bacteria - 7; Metazoa - 10; Fungi - 0; Plants - 32; Viruses - 47; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT4G19985 | AT4G19985.1 | ATAACCGGAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: ATNSI (NUCLEAR SHUTTLE INTERACTING); N-acetyltransferase (TAIR:AT1G32070.3); Has 192 Blast hits to 192 proteins in 68 species: Archae - 6; Bacteria - 114; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT4G19985.1 | ATAACCGGAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: ATNSI (NUCLEAR SHUTTLE INTERACTING); N-acetyltransferase (TAIR:AT1G32070.3); Has 192 Blast hits to 192 proteins in 68 species: Archae - 6; Bacteria - 114; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  | |
AT4G20960 | AT4G20960.1 | TTAAACCGGAT | encodes diaminohydroxyphosphoribosylaminopyrimidine deaminase catalyzing the second step in the riboflavin biosynthesis  |
AT4G21090 | AT4G21090.1 | ATCCGGTTCGGT | adrenodoxin-like ferredoxin 1; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Adrenodoxin (InterPro:IPR001055), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Adrenodoxin, iron-sulphur binding site (InterPro:IPR018298); BEST Arabidopsis thaliana protein match is: adrenodoxin-like ferredoxin 2 (TAIR:AT4G05450.1); Has 3478 Blast hits to 3478 proteins in 761 species: Archae - 0; Bacteria - 1382; Metazoa - 220; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 1742 (source: NCBI BLink).  |
AT4G21090.2 | ATCCGGTTCGGT | adrenodoxin-like ferredoxin 1; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Adrenodoxin (InterPro:IPR001055), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Adrenodoxin, iron-sulphur binding site (InterPro:IPR018298); BEST Arabidopsis thaliana protein match is: adrenodoxin-like ferredoxin 2 (TAIR:AT4G05450.1); Has 3478 Blast hits to 3478 proteins in 761 species: Archae - 0; Bacteria - 1382; Metazoa - 220; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 1742 (source: NCBI BLink).  | |
AT4G21090.3 | ATCCGGTTCGGT | adrenodoxin-like ferredoxin 1; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Adrenodoxin (InterPro:IPR001055), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Adrenodoxin, iron-sulphur binding site (InterPro:IPR018298); BEST Arabidopsis thaliana protein match is: adrenodoxin-like ferredoxin 2 (TAIR:AT4G05450.1); Has 3478 Blast hits to 3478 proteins in 761 species: Archae - 0; Bacteria - 1382; Metazoa - 220; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 1742 (source: NCBI BLink).  | |
AT4G21530 | AT4G21530.1 | AAAACCGGAT | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: SPHK1 (SPHINGOSINE KINASE 1); D-erythro-sphingosine kinase/ diacylglycerol kinase/ sphinganine kinase (TAIR:AT4G21540.1); Has 1806 Blast hits to 1423 proteins in 191 species: Archae - 0; Bacteria - 606; Metazoa - 583; Fungi - 291; Plants - 111; Viruses - 0; Other Eukaryotes - 215 (source: NCBI BLink).  |
AT4G22235 | AT4G22235.1 | GAACCGGAT | Encodes a defensin-like (DEFL) family protein.  |
AT4G22235.2 | GAACCGGAT | Encodes a defensin-like (DEFL) family protein.  | |
AT4G22756 | AT4G22756.1 | ATCCGGTTCAA | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha- methyl oxidase.  |
AT4G22890 | AT4G22890.1 | AAAACCGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I).  |
AT4G22890.2 | AAAACCGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I).  | |
AT4G22890.3 | AAAACCGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I).  | |
AT4G22890.4 | AAAACCGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I).  | |
AT4G22890.5 | AAAACCGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I).  | |
AT4G24880 | AT4G24880.1 | CCAAACCGATCCGGTTCA | unknown protein; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; Has 140 Blast hits to 140 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink).  |
AT4G25850 | AT4G25850.1 | CCAAACCGGAT | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4B (ORP4B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: ORP4A (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4A); oxysterol binding (TAIR:AT4G25860.1); Has 1645 Blast hits to 1644 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 908; Fungi - 430; Plants - 143; Viruses - 0; Other Eukaryotes - 164 (source: NCBI BLink).  |
AT4G26555 | AT4G26555.1 | CGAACCGGAT | immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT4G19830.1); Has 2159 Blast hits to 2148 proteins in 673 species: Archae - 12; Bacteria - 1209; Metazoa - 160; Fungi - 145; Plants - 239; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink).  |
AT4G29350 | AT4G29350.1 | TTTAACCGGAT | Encodes profilin2, a low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Expressed in vegetative organs. The first intron of PRF2 enhances gene expression.  |
AT4G30310 | AT4G30310.1 | ATCCGGTTAT | ribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink).  |
AT4G30310.2 | ATCCGGTTAT | ribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink).  | |
AT4G30310.3 | ATCCGGTTAT | ribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink).  | |
AT4G30800 | AT4G30800.1 | CGGTTCAACCGGAT | 40S ribosomal protein S11 (RPS11B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: EMB1080 (embryo defective 1080); structural constituent of ribosome (TAIR:AT3G48930.1); Has 1016 Blast hits to 1014 proteins in 353 species: Archae - 160; Bacteria - 205; Metazoa - 241; Fungi - 98; Plants - 98; Viruses - 0; Other Eukaryotes - 214 (source: NCBI BLink).  |
AT4G33140 | AT4G33140.1 | AAAACCGGAT | unknown protein; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 138 Blast hits to 138 proteins in 40 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 8; Plants - 25; Viruses - 2; Other Eukaryotes - 56 (source: NCBI BLink).  |
AT4G33460 | AT4G33460.1 | AAACCGAACCGGAT | member of NAP subfamily  |
AT4G33530 | AT4G33530.1 | ATCCGGTTTAC | potassium transporter  |
AT4G33540 | AT4G33540.1 | GTAAACCGGAT | metallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: response to arsenic, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 1070 Blast hits to 1070 proteins in 241 species: Archae - 64; Bacteria - 439; Metazoa - 27; Fungi - 6; Plants - 47; Viruses - 0; Other Eukaryotes - 487 (source: NCBI BLink).  |
AT4G33640 | AT4G33640.1 | AACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 141 Blast hits to 141 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT4G33680 | AT4G33680.1 | AAACCGAACCGGAACAAACCGGAT | Involved in disease resistance against Pseudomonas syringae. mutants have elevated SA levels, a low level of spontaneous cell death, callose deposition, and enlarged cells in leaves. genetically maps on chr 4 between L23H3 and nga1139.  |
AT4G33690 | AT4G33690.1 | ATCCGGTTTGTTCCGGTTCGGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: pollen tube; Has 499 Blast hits to 464 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 283; Fungi - 48; Plants - 38; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink).  |
AT4G34490 | AT4G34490.1 | ATCCGGTTTGG | CYCLASE ASSOCIATED PROTEIN  |
AT4G36440 | AT4G36440.1 | TATACCGGATCCGGTTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G39610 | AT4G39610.1 | CTTAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G21990.1); Has 140 Blast hits to 140 proteins in 8 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G39960 | AT4G39960.1 | CAAACCGGAT | DNAJ heat shock family protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G22360.1); Has 21244 Blast hits to 20540 proteins in 2111 species: Archae - 132; Bacteria - 6466; Metazoa - 3849; Fungi - 1680; Plants - 1445; Viruses - 25; Other Eukaryotes - 7647 (source: NCBI BLink).  |
AT5G01110 | AT5G01110.1 | TCAGCCCAATTAAAACCGGAT | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05670.2); Has 28807 Blast hits to 6228 proteins in 193 species: Archae - 4; Bacteria - 24; Metazoa - 956; Fungi - 844; Plants - 25427; Viruses - 0; Other Eukaryotes - 1552 (source: NCBI BLink).  |
AT5G02040 | AT5G02040.1 | AAAACCGGAT | PRENYLATED RAB ACCEPTOR 1.A1 (PRA1.A1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A2 (PRENYLATED RAB ACCEPTOR 1.A2) (TAIR:AT5G05987.1); Has 165 Blast hits to 165 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 8; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G02040.2 | AAAACCGGAT | PRENYLATED RAB ACCEPTOR 1.A1 (PRA1.A1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A2 (PRENYLATED RAB ACCEPTOR 1.A2) (TAIR:AT5G05987.1); Has 165 Blast hits to 165 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 8; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G02100 | AT5G02100.1 | ATCCGGTTTGGTTCGGTT | Encodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent.  |
AT5G02520 | AT5G02520.1 | CTAAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216); BEST Arabidopsis thaliana protein match is: EMB1674 (EMBRYO DEFECTIVE 1674) (TAIR:AT1G58210.1); Has 41 Blast hits to 40 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 2; Plants - 4; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT5G02710 | AT5G02710.1 | TGAACCGGAT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0153 (InterPro:IPR005358); Has 211 Blast hits to 211 proteins in 60 species: Archae - 8; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).  |
AT5G02710.1 | TGAACCGGAT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0153 (InterPro:IPR005358); Has 211 Blast hits to 211 proteins in 60 species: Archae - 8; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).  | |
AT5G03290 | AT5G03290.1 | AAACCGAATCCGGTTTG | isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink).  |
AT5G03290.1 | CTAAACCGGAT | isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink).  | |
AT5G03520 | AT5G03520.1 | GTAAACCGGAT | ATRAB8C; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRABE1E (ARABIDOPSIS RAB GTPASE HOMOLOG E1E); GTP binding (TAIR:AT3G09900.1); Has 23746 Blast hits to 23700 proteins in 659 species: Archae - 15; Bacteria - 122; Metazoa - 13274; Fungi - 2886; Plants - 2178; Viruses - 19; Other Eukaryotes - 5252 (source: NCBI BLink).  |
AT5G03520.2 | GTAAACCGGAT | ATRAB8C; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRABE1E (ARABIDOPSIS RAB GTPASE HOMOLOG E1E); GTP binding (TAIR:AT3G09900.1); Has 23746 Blast hits to 23700 proteins in 659 species: Archae - 15; Bacteria - 122; Metazoa - 13274; Fungi - 2886; Plants - 2178; Viruses - 19; Other Eukaryotes - 5252 (source: NCBI BLink).  | |
AT5G03660 | AT5G03660.1 | ATCCGGTTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09980.1); Has 5235 Blast hits to 3832 proteins in 426 species: Archae - 74; Bacteria - 462; Metazoa - 2482; Fungi - 239; Plants - 192; Viruses - 22; Other Eukaryotes - 1764 (source: NCBI BLink).  |
AT5G03900 | AT5G03900.1 | TAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FeS cluster biogenesis (InterPro:IPR000361); Has 104 Blast hits to 104 proteins in 40 species: Archae - 0; Bacteria - 55; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT5G03900.2 | TAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FeS cluster biogenesis (InterPro:IPR000361); Has 104 Blast hits to 104 proteins in 40 species: Archae - 0; Bacteria - 55; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  | |
AT5G03970 | AT5G03970.1 | ATCCGGTTA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G03970.2 | ATCCGGTTA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT5G04140 | AT5G04140.1 | ATCCGGTTTAA | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation.  |
AT5G04140.2 | ATCCGGTTTAA | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation.  | |
AT5G06460 | AT5G06460.1 | ATCCGGTTCAA | Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined.  |
AT5G06830 | AT5G06830.1 | ATAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF773 (InterPro:IPR008491); Has 301 Blast hits to 298 proteins in 82 species: Archae - 7; Bacteria - 7; Metazoa - 191; Fungi - 5; Plants - 24; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
AT5G06850 | AT5G06850.1 | GAACCGGAT | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: tryptophan biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Phosphoribosyltransferase C-terminal, plant (InterPro:IPR013583), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT5G48060.1); Has 1175 Blast hits to 999 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 573; Fungi - 10; Plants - 560; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT5G07230 | AT5G07230.1 | AACCGGAT | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, sepal, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G62080.1); Has 76 Blast hits to 76 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G07230.1 | TAACCGGAT | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, sepal, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G62080.1); Has 76 Blast hits to 76 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G10150 | AT5G10150.1 | TTGAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF966 (InterPro:IPR010369); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59790.1); Has 96 Blast hits to 96 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 88; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT5G10200 | AT5G10200.1 | ACCGAACCGGACTTAAACCGGAT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: tetratricopeptide repeat (TPR)-containing protein (TAIR:AT5G43120.1); Has 1566 Blast hits to 1469 proteins in 175 species: Archae - 0; Bacteria - 3; Metazoa - 907; Fungi - 260; Plants - 202; Viruses - 4; Other Eukaryotes - 190 (source: NCBI BLink).  |
AT5G12030 | AT5G12030.1 | CCAAACCGGAT | Encodes a cytosolic small heat shock protein with chaperone activity that is induced by heat and osmotic stress and is also expressed late in seed development.  |
AT5G12040 | AT5G12040.1 | ATCCGGTTTGG | carbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink).  |
AT5G12040.2 | ATCCGGTTTGG | carbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink).  | |
AT5G12200 | AT5G12200.1 | ATCCGGTTTAA | dihydropyrimidinase / DHPase / dihydropyrimidine amidohydrolase / hydantoinase (PYD2); FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, dihydropyrimidinase activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-hydantoinase (InterPro:IPR011778), Amidohydrolase 1 (InterPro:IPR006680), Metal-dependent hydrolase, composite (InterPro:IPR011059); BEST Arabidopsis thaliana protein match is: ATALN (Arabidopsis allantoinase); allantoinase/ hydrolase (TAIR:AT4G04955.1); Has 7799 Blast hits to 7784 proteins in 1206 species: Archae - 191; Bacteria - 3354; Metazoa - 592; Fungi - 130; Plants - 44; Viruses - 0; Other Eukaryotes - 3488 (source: NCBI BLink).  |
AT5G14590 | AT5G14590.1 | ATCCGGTTTGG | isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NADP+) activity, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor; INVOLVED IN: isocitrate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NADP-dependent, eukaryotic (InterPro:IPR004790); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative (TAIR:AT1G65930.1); Has 4142 Blast hits to 4125 proteins in 584 species: Archae - 19; Bacteria - 563; Metazoa - 433; Fungi - 160; Plants - 265; Viruses - 0; Other Eukaryotes - 2702 (source: NCBI BLink).  |
AT5G14600 | AT5G14600.1 | CCAAACCGGAT | tRNA (adenine-N1-)-methyltransferase; FUNCTIONS IN: tRNA (adenine-N1-)-methyltransferase activity; INVOLVED IN: tRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: tRNA methyltransferase complex GCD14 subunit (InterPro:IPR014816); Has 1145 Blast hits to 1142 proteins in 382 species: Archae - 132; Bacteria - 313; Metazoa - 135; Fungi - 115; Plants - 30; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink).  |
AT5G15610 | AT5G15610.1 | ATCCGGTTCAA | proteasome family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT3G02200.2); Has 290 Blast hits to 290 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 68; Plants - 36; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).  |
AT5G15610.2 | ATCCGGTTCAA | proteasome family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT3G02200.2); Has 290 Blast hits to 290 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 68; Plants - 36; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).  | |
AT5G16640 | AT5G16640.1 | ATCCGGTTTG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: F mature embryo stage, 4 leaf senescence stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62680.1); Has 27324 Blast hits to 6063 proteins in 188 species: Archae - 4; Bacteria - 18; Metazoa - 819; Fungi - 570; Plants - 24583; Viruses - 0; Other Eukaryotes - 1330 (source: NCBI BLink).  |
AT5G17270 | AT5G17270.1 | CCAAACCGGAT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G37130.1); Has 5379 Blast hits to 3587 proteins in 480 species: Archae - 397; Bacteria - 1752; Metazoa - 604; Fungi - 281; Plants - 148; Viruses - 0; Other Eukaryotes - 2197 (source: NCBI BLink).  |
AT5G18100 | AT5G18100.1 | ATCCGGTTTG | A putative peroxisomal CuZnSOD inducible by a high-light pulse.  |
AT5G18100.1 | ATCCGGTTTGG | A putative peroxisomal CuZnSOD inducible by a high-light pulse.  | |
AT5G18100.2 | ATCCGGTTTG | A putative peroxisomal CuZnSOD inducible by a high-light pulse.  | |
AT5G18100.2 | ATCCGGTTTGG | A putative peroxisomal CuZnSOD inducible by a high-light pulse.  | |
AT5G18475 | AT5G18475.1 | AACCGAACCGGAT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19623 Blast hits to 5874 proteins in 176 species: Archae - 4; Bacteria - 16; Metazoa - 456; Fungi - 363; Plants - 18095; Viruses - 0; Other Eukaryotes - 689 (source: NCBI BLink).  |
AT5G19690 | AT5G19690.1 | AAAACCGGAT | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions  |
AT5G19770 | AT5G19770.1 | TTAAACCGGAT | tubulin 3  |
AT5G19780 | AT5G19780.1 | TTGAACCGGAT | Encodes an isoform of alpha tubulin. Closely related to adjacent gene TUA3 suggesting recent duplication.  |
AT5G22360 | AT5G22360.1 | CGAACCGAACCGGAT | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family.  |
AT5G24080 | AT5G24080.1 | ATCCGGTTC | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: S-locus lectin protein kinase family protein (TAIR:AT2G19130.1); Has 83012 Blast hits to 81933 proteins in 3234 species: Archae - 50; Bacteria - 7141; Metazoa - 37012; Fungi - 6145; Plants - 18411; Viruses - 299; Other Eukaryotes - 13954 (source: NCBI BLink).  |
AT5G24360 | AT5G24360.1 | TTTAACCGATCCGGTTAT | INOSITOL REQUIRING 1-1 (IRE1-1); FUNCTIONS IN: endoribonuclease activity, producing 5'-phosphomonoesters, protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, mRNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyrrolo-quinoline quinone beta-propeller repeat (InterPro:IPR018391), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Ribonuclease L (InterPro:IPR010513), PUG (InterPro:IPR006567), Quinonprotein alcohol dehydrogenase-like (InterPro:IPR011047); BEST Arabidopsis thaliana protein match is: IRE1A; endoribonuclease/ kinase (TAIR:AT2G17520.1); Has 75799 Blast hits to 75146 proteins in 2975 species: Archae - 53; Bacteria - 6775; Metazoa - 33392; Fungi - 6711; Plants - 14901; Viruses - 376; Other Eukaryotes - 13591 (source: NCBI BLink).  |
AT5G25757 | AT5G25757.1 | AAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25754.1); Has 298 Blast hits to 292 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 59; Plants - 28; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  |
AT5G25757.1 | ATAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25754.1); Has 298 Blast hits to 292 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 59; Plants - 28; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  | |
AT5G25800 | AT5G25800.1 | ATCCGGTTCGG | exonuclease family protein; FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: SDN1 (SMALL RNA DEGRADING NUCLEASE 1); 3'-5' exonuclease/ exonuclease (TAIR:AT3G50100.1); Has 1347 Blast hits to 1319 proteins in 179 species: Archae - 0; Bacteria - 4; Metazoa - 658; Fungi - 453; Plants - 109; Viruses - 2; Other Eukaryotes - 121 (source: NCBI BLink).  |
AT5G26180 | AT5G26180.1 | ATCCGGTTTAA | NOL1/NOP2/sun family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 5353 Blast hits to 5300 proteins in 1252 species: Archae - 211; Bacteria - 3160; Metazoa - 580; Fungi - 261; Plants - 117; Viruses - 1; Other Eukaryotes - 1023 (source: NCBI BLink).  |
AT5G26180.2 | ATCCGGTTTAA | NOL1/NOP2/sun family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 5353 Blast hits to 5300 proteins in 1252 species: Archae - 211; Bacteria - 3160; Metazoa - 580; Fungi - 261; Plants - 117; Viruses - 1; Other Eukaryotes - 1023 (source: NCBI BLink).  | |
AT5G27270 | AT5G27270.1 | TTTAACCGGAT | EMBRYO DEFECTIVE 976 (EMB976); INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 29581 Blast hits to 5939 proteins in 208 species: Archae - 4; Bacteria - 59; Metazoa - 599; Fungi - 472; Plants - 27208; Viruses - 0; Other Eukaryotes - 1239 (source: NCBI BLink).  |
AT5G27980 | AT5G27980.1 | CTAAACCGGAT | seed maturation family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: multicellular organismal development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Seed maturation protein (InterPro:IPR007011); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G22490.1); Has 103 Blast hits to 86 proteins in 19 species: Archae - 0; Bacteria - 11; Metazoa - 2; Fungi - 0; Plants - 88; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G28500 | AT5G28500.1 | CCAAACCGGTTTAAATCCGGTTCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04550.1); Has 79 Blast hits to 79 proteins in 36 species: Archae - 0; Bacteria - 52; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G35790 | AT5G35790.1 | ATCCGGTTAAG | Encodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is more prevalent in developing organs but absent in the root.  |
AT5G39590 | AT5G39590.1 | CGAACCGGAACCGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571); Has 144 Blast hits to 144 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 9; Plants - 26; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  |
AT5G42540 | AT5G42540.1 | ATCCGGTTCG | Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN2 acts as a suppressor of posttranscriptional gene silencing.  |
AT5G43190 | AT5G43190.1 | ATCCGGTTTAA | F-box family protein (FBX6); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 2 (InterPro:IPR011498), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G15710.1); Has 336 Blast hits to 336 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 332; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G43430 | AT5G43430.1 | CTAAACCGGATTAAACCGAA | Encodes the electron transfer flavoprotein ETF beta, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation.  |
AT5G43430.2 | CTAAACCGGATTAAACCGAA | Encodes the electron transfer flavoprotein ETF beta, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation.  | |
AT5G43430.3 | CTAAACCGGATTAAACCGAA | Encodes the electron transfer flavoprotein ETF beta, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation.  | |
AT5G44070 | AT5G44070.1 | CCAAACCGGAT | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+.  |
AT5G49540 | AT5G49540.1 | ATCCGGTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF786 (InterPro:IPR008504); Has 172 Blast hits to 172 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 27; Plants - 15; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
AT5G50330 | AT5G50330.1 | CCGAACCGGAT | ATP binding / protein kinase; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G24810.2); Has 6935 Blast hits to 6926 proteins in 1103 species: Archae - 67; Bacteria - 2625; Metazoa - 354; Fungi - 354; Plants - 343; Viruses - 14; Other Eukaryotes - 3178 (source: NCBI BLink).  |
AT5G50330.2 | CCGAACCGGAT | ATP binding / protein kinase; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G24810.2); Has 6935 Blast hits to 6926 proteins in 1103 species: Archae - 67; Bacteria - 2625; Metazoa - 354; Fungi - 354; Plants - 343; Viruses - 14; Other Eukaryotes - 3178 (source: NCBI BLink).  | |
AT5G50430 | AT5G50430.1 | ATCCGGTTAAA | ubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink).  |
AT5G50430.2 | ATCCGGTTAAA | ubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink).  | |
AT5G50430.3 | ATCCGGTTAAA | ubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink).  | |
AT5G51760 | AT5G51760.1 | AAAACCGGAT | Encodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination.  |
AT5G52882 | AT5G52882.1 | ATCCGGTTA | ATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT4G28000.1); Has 27413 Blast hits to 25805 proteins in 1860 species: Archae - 929; Bacteria - 10210; Metazoa - 4036; Fungi - 2467; Plants - 1717; Viruses - 25; Other Eukaryotes - 8029 (source: NCBI BLink).  |
AT5G52975 | AT5G52975.1 | ATAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52965.1); Has 87 Blast hits to 82 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G53620 | AT5G53620.1 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).  |
AT5G53620.2 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).  | |
AT5G53620.3 | CCAAACCGGATTAAATGGGTCAAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).  | |
AT5G54310 | AT5G54310.1 | AAAACCGGAT | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  |
AT5G56140 | AT5G56140.1 | GTAAACCGGAT | KH domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 4346 Blast hits to 2291 proteins in 261 species: Archae - 6; Bacteria - 444; Metazoa - 2561; Fungi - 214; Plants - 674; Viruses - 13; Other Eukaryotes - 434 (source: NCBI BLink).  |
AT5G56730 | AT5G56730.1 | CAAACCGGAT | peptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: mitochondrion, chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: metalloendopeptidase (TAIR:AT5G42390.1); Has 5686 Blast hits to 5644 proteins in 1211 species: Archae - 12; Bacteria - 3644; Metazoa - 517; Fungi - 231; Plants - 159; Viruses - 3; Other Eukaryotes - 1120 (source: NCBI BLink).  |
AT5G57260 | AT5G57260.1 | ATCCGGTTTAT | putative cytochrome P450  |
AT5G57270 | AT5G57270.1 | ATCCGGTTA | unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25870.1); Has 336 Blast hits to 336 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
AT5G57270.2 | ATCCGGTTA | unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25870.1); Has 336 Blast hits to 336 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  | |
AT5G57270.3 | ATCCGGTTA | unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25870.1); Has 336 Blast hits to 336 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  | |
AT5G59600 | AT5G59600.1 | ATCCGGTTTT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2758 (embryo defective 2758) (TAIR:AT4G33990.1); Has 16346 Blast hits to 5424 proteins in 162 species: Archae - 0; Bacteria - 5; Metazoa - 170; Fungi - 149; Plants - 15583; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink).  |
AT5G60410 | AT5G60410.1 | TTAAACCGGAT | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  |
AT5G60410.2 | TTAAACCGGAT | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  | |
AT5G60410.3 | TTAAACCGGAT | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  | |
AT5G60410.4 | TTAAACCGGAT | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  | |
AT5G60410.5 | TTAAACCGGAT | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  | |
AT5G61228 | AT5G61228.1 | GAACCGGAT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF15 represents a conserved upstream opening reading frame relative to major ORF AT5G61230.1  |
AT5G61330 | AT5G61330.1 | TTAAACCGGAT | rRNA processing protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAUB (InterPro:IPR012617); Has 79462 Blast hits to 32481 proteins in 1301 species: Archae - 395; Bacteria - 15286; Metazoa - 26196; Fungi - 9575; Plants - 3170; Viruses - 1014; Other Eukaryotes - 23826 (source: NCBI BLink).  |
AT5G62200 | AT5G62200.1 | ATCCGGTTTAT | embryo-specific protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976), Embryo-specific 3 (InterPro:IPR010417); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41475.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G62390 | AT5G62390.1 | CCAAACCGGAT | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development.  |
AT5G63440 | AT5G63440.1 | ATCCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF167 (InterPro:IPR003746); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G49170.1); Has 564 Blast hits to 564 proteins in 221 species: Archae - 12; Bacteria - 262; Metazoa - 198; Fungi - 8; Plants - 41; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  |
AT5G63440.2 | ATCCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF167 (InterPro:IPR003746); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G49170.1); Has 564 Blast hits to 564 proteins in 221 species: Archae - 12; Bacteria - 262; Metazoa - 198; Fungi - 8; Plants - 41; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  | |
AT5G63440.3 | ATCCGGTTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF167 (InterPro:IPR003746); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G49170.1); Has 564 Blast hits to 564 proteins in 221 species: Archae - 12; Bacteria - 262; Metazoa - 198; Fungi - 8; Plants - 41; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  | |
AT5G63910 | AT5G63910.1 | ATCCGGTTA | encodes for a farnesylcysteine lyase (EC 1.8.3.5 - prenylcysteine oxidase) involved in a salvage pathway of farnesyl diphosphate.  |
AT5G64160 | AT5G64160.1 | ATCCGGTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 24 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 20; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G64160.1 | CTAAACCGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 24 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 20; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT5G64200 | AT5G64200.1 | ATCCGGTTCG | encodes an SC35-like splicing factor of 35 kD localized to the nuclear specks.  |
AT5G64200.2 | ATCCGGTTCG | encodes an SC35-like splicing factor of 35 kD localized to the nuclear specks.  | |
AT5G64813 | AT5G64813.1 | ATCCGGTTTT | The LIP1 gene encodes a small GTPase that influences the light input pathway of the plant circadian network. An MBP:LIP1 fusion protein has GTP hydrolyzing abilities in vitro. In plants, LIP1 seems to play a negative role in regulating circadian period that can be suppressed by light. LIP1 also seems to negatively affect light-pulse-dependent resetting of the clock, especially during the first portion of the subjective evening. LIP1 expression levels are not significantly affected by the circadian clock in seedlings grown under LL conditions. The levels of the YFP:LIP1 protein expressed under the control of the 35S promoter, shows a low amplitude variation, with protein levels peaking near the beginning of subjective night under LL conditions. In hypocotyl epidermal cells of dark and light-grown seedlings, a YFP:LIP1 fusion protein can be seen in the cytoplasm and the nucleus, and does not cluster in nuclear speckles. LIP1 may also be involved in photomorphogenesis.  |
AT5G66510 | AT5G66510.1 | TGAACCGGAT | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex.  |
AT5G66510.2 | TGAACCGGAT | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex.  | |
AT5G66520 | AT5G66520.1 | ATCCGGTTCA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G06540.1); Has 14737 Blast hits to 5344 proteins in 184 species: Archae - 1; Bacteria - 4; Metazoa - 109; Fungi - 73; Plants - 14158; Viruses - 0; Other Eukaryotes - 392 (source: NCBI BLink).  |
ATCG00490 | ATCG00490.1 | ATCCGGTTAT | large subunit of RUBISCO. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.  |