version

Summary of AtREG564 (All List)

OrganismArabidopsis thaliana  
IDAtREG564  
SequenceGCGTTTTA  
Annotation  
PPDB MotifAAACG(C/G)  function unknown  
PLACE Motif 
Total Entry Count219  

Entry Sequences (219 entries)

LocusGene modelSequenceDescription
AT1G01650AT1G01650.1CAGCGTTTTAaspartic-type endopeptidase/ peptidase; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: protease-associated (PA) domain-containing protein (TAIR:AT1G63690.1); Has 1108 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 119; Metazoa - 534; Fungi - 104; Plants - 174; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT1G07400AT1G07400.1AGCCCATTATAGCCCATAAAACGC17.8 kDa class I heat shock protein (HSP17.8-CI); INVOLVED IN: response to oxidative stress, response to heat; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: 17.6 kDa class I heat shock protein (HSP17.6A-CI) (TAIR:AT1G59860.1); Has 4521 Blast hits to 4521 proteins in 968 species: Archae - 130; Bacteria - 2463; Metazoa - 119; Fungi - 227; Plants - 1004; Viruses - 0; Other Eukaryotes - 578 (source: NCBI BLink). 
AT1G08010AT1G08010.1TAAAACGCGTzinc finger (GATA type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, NHR/GATA-type (InterPro:IPR013088), Zinc finger, GATA-type (InterPro:IPR000679); BEST Arabidopsis thaliana protein match is: zinc finger (GATA type) family protein (TAIR:AT1G08000.2); Has 927 Blast hits to 903 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 38; Fungi - 418; Plants - 418; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT1G08010.2TAAAACGCGTzinc finger (GATA type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, NHR/GATA-type (InterPro:IPR013088), Zinc finger, GATA-type (InterPro:IPR000679); BEST Arabidopsis thaliana protein match is: zinc finger (GATA type) family protein (TAIR:AT1G08000.2); Has 927 Blast hits to 903 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 38; Fungi - 418; Plants - 418; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT1G09300AT1G09300.1GCGTTTTAmetallopeptidase M24 family protein; FUNCTIONS IN: metallopeptidase activity, manganese ion binding, metalloexopeptidase activity, aminopeptidase activity; INVOLVED IN: proteolysis, cellular process; LOCATED IN: mitochondrion; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (InterPro:IPR007865), Peptidase M24, structural domain (InterPro:IPR000994), Peptidase M24, methionine aminopeptidase (InterPro:IPR001714); BEST Arabidopsis thaliana protein match is: aminopeptidase/ manganese ion binding (TAIR:AT4G29490.1); Has 10472 Blast hits to 10446 proteins in 1515 species: Archae - 187; Bacteria - 5828; Metazoa - 520; Fungi - 371; Plants - 118; Viruses - 0; Other Eukaryotes - 3448 (source: NCBI BLink). 
AT1G09300.2GCGTTTTAmetallopeptidase M24 family protein; FUNCTIONS IN: metallopeptidase activity, manganese ion binding, metalloexopeptidase activity, aminopeptidase activity; INVOLVED IN: proteolysis, cellular process; LOCATED IN: mitochondrion; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (InterPro:IPR007865), Peptidase M24, structural domain (InterPro:IPR000994), Peptidase M24, methionine aminopeptidase (InterPro:IPR001714); BEST Arabidopsis thaliana protein match is: aminopeptidase/ manganese ion binding (TAIR:AT4G29490.1); Has 10472 Blast hits to 10446 proteins in 1515 species: Archae - 187; Bacteria - 5828; Metazoa - 520; Fungi - 371; Plants - 118; Viruses - 0; Other Eukaryotes - 3448 (source: NCBI BLink). 
AT1G09850AT1G09850.1TAAAACGCCArabidopsis thaliana papain-like cysteine peptidase 
AT1G10340AT1G10340.1GCGTTTTAankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT2G24600.3); Has 18692 Blast hits to 10007 proteins in 394 species: Archae - 19; Bacteria - 1110; Metazoa - 11135; Fungi - 977; Plants - 1495; Viruses - 133; Other Eukaryotes - 3823 (source: NCBI BLink). 
AT1G10340.2GCGTTTTAankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT2G24600.3); Has 18692 Blast hits to 10007 proteins in 394 species: Archae - 19; Bacteria - 1110; Metazoa - 11135; Fungi - 977; Plants - 1495; Viruses - 133; Other Eukaryotes - 3823 (source: NCBI BLink). 
AT1G12380AT1G12380.1TAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62870.1); Has 97 Blast hits to 97 proteins in 28 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 8; Plants - 48; Viruses - 6; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G13820AT1G13820.1CAGCGTTTTAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G39220.1); Has 5140 Blast hits to 5134 proteins in 762 species: Archae - 39; Bacteria - 3125; Metazoa - 236; Fungi - 50; Plants - 322; Viruses - 0; Other Eukaryotes - 1368 (source: NCBI BLink). 
AT1G13970AT1G13970.1TAAAACGCTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29180.1); Has 129 Blast hits to 129 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 114; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT1G16460AT1G16460.1GCGTTTTAencodes a cytoplasmic thiosulfate:cyanide sulfurtransferase, activity of which increased the rhodanese activity of transgenic yeast. Can also act as a mercaptopyruvate sulfurtransferase. 
AT1G16460.2GCGTTTTAencodes a cytoplasmic thiosulfate:cyanide sulfurtransferase, activity of which increased the rhodanese activity of transgenic yeast. Can also act as a mercaptopyruvate sulfurtransferase. 
AT1G16460.3GCGTTTTAencodes a cytoplasmic thiosulfate:cyanide sulfurtransferase, activity of which increased the rhodanese activity of transgenic yeast. Can also act as a mercaptopyruvate sulfurtransferase. 
AT1G16470AT1G16470.1TAAAACGCEncodes 20S proteasome subunit PAB1 (PAB1). 
AT1G16470.2TAAAACGCEncodes 20S proteasome subunit PAB1 (PAB1). 
AT1G17070AT1G17070.1GCGTTTTAD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink). 
AT1G18360AT1G18360.1GCGTTTTAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G73480.1); Has 3797 Blast hits to 3785 proteins in 942 species: Archae - 19; Bacteria - 2420; Metazoa - 132; Fungi - 101; Plants - 246; Viruses - 60; Other Eukaryotes - 819 (source: NCBI BLink). 
AT1G18850AT1G18850.1TAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G20810AT1G20810.1TAAAACGCimmunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative (TAIR:AT3G10060.1); Has 1226 Blast hits to 1216 proteins in 397 species: Archae - 0; Bacteria - 652; Metazoa - 72; Fungi - 47; Plants - 158; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink). 
AT1G22190AT1G22190.1TAAAACGCAP2 domain-containing transcription factor, putative; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor and ERF, DNA-binding (InterPro:IPR001471); BEST Arabidopsis thaliana protein match is: RAP2.4 (related to AP2 4); DNA binding / transcription factor (TAIR:AT1G78080.1); Has 3906 Blast hits to 3758 proteins in 206 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 3863; Viruses - 7; Other Eukaryotes - 34 (source: NCBI BLink). 
AT1G24040AT1G24040.1TCAAAACGCGGCGTTTTAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G24040.2TCAAAACGCGGCGTTTTAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G24050AT1G24050.1TAAAACGCCGCGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70220.1); Has 153 Blast hits to 153 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 73; Fungi - 34; Plants - 30; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT1G26670AT1G26670.1TAAAACGCmember of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles. 
AT1G26750AT1G26750.1CGGCGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G29060AT1G29060.1TAAAACGCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14600.1); Has 95 Blast hits to 95 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 15; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G29330AT1G29330.1TAAAACGCEncodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. 
AT1G30500AT1G30500.1TAAAACGCNUCLEAR FACTOR Y, SUBUNIT A7 (NF-YA7); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289); BEST Arabidopsis thaliana protein match is: NF-YA4 (NUCLEAR FACTOR Y, SUBUNIT A4); specific transcriptional repressor/ transcription factor (TAIR:AT2G34720.1); Has 441 Blast hits to 441 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 88; Plants - 215; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G30500.2TAAAACGCNUCLEAR FACTOR Y, SUBUNIT A7 (NF-YA7); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289); BEST Arabidopsis thaliana protein match is: NF-YA4 (NUCLEAR FACTOR Y, SUBUNIT A4); specific transcriptional repressor/ transcription factor (TAIR:AT2G34720.1); Has 441 Blast hits to 441 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 88; Plants - 215; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G30630AT1G30630.1AAAACGCGTTTTAcoatomer protein epsilon subunit family protein / COPE family protein; FUNCTIONS IN: protein transporter activity, protein binding, structural molecule activity, binding; INVOLVED IN: retrograde vesicle-mediated transport, Golgi to ER; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Coatomer, epsilon subunit (InterPro:IPR006822); BEST Arabidopsis thaliana protein match is: coatomer protein epsilon subunit family protein / COPE family protein (TAIR:AT2G34840.1); Has 326 Blast hits to 326 proteins in 131 species: Archae - 2; Bacteria - 5; Metazoa - 149; Fungi - 59; Plants - 65; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). 
AT1G32160AT1G32160.1TAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.2); Has 83 Blast hits to 83 proteins in 18 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT1G32530AT1G32530.1TAAAACGCTGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink). 
AT1G49950AT1G49950.1AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats. 
AT1G49950.1AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats. 
AT1G49950.2AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats. 
AT1G49950.2AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats. 
AT1G49950.3AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats. 
AT1G49950.3AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats. 
AT1G50410AT1G50410.1GCGTTTTASNF2 domain-containing protein / helicase domain-containing protein / RING finger domain-containing protein; FUNCTIONS IN: in 6 functions; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); BEST Arabidopsis thaliana protein match is: SNF2 domain-containing protein / helicase domain-containing protein / RING finger domain-containing protein (TAIR:AT3G20010.1); Has 17251 Blast hits to 10882 proteins in 1059 species: Archae - 56; Bacteria - 4149; Metazoa - 5282; Fungi - 3525; Plants - 1191; Viruses - 138; Other Eukaryotes - 2910 (source: NCBI BLink). 
AT1G52360AT1G52360.1GGCGTTTTAcoatomer protein complex, subunit beta 2 (beta prime), putative; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat, COPI vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Coatomer, WD associated region (InterPro:IPR006692), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat (InterPro:IPR001680), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), Coatomer, beta' subunit (InterPro:IPR016453), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: coatomer protein complex, subunit beta 2 (beta prime), putative (TAIR:AT3G15980.3); Has 57972 Blast hits to 24958 proteins in 644 species: Archae - 48; Bacteria - 5666; Metazoa - 27314; Fungi - 11164; Plants - 5401; Viruses - 42; Other Eukaryotes - 8337 (source: NCBI BLink). 
AT1G52510AT1G52510.1TAAAACGChydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G12830.1); Has 3440 Blast hits to 3440 proteins in 614 species: Archae - 16; Bacteria - 2126; Metazoa - 96; Fungi - 67; Plants - 194; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink). 
AT1G52510.2TAAAACGChydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G12830.1); Has 3440 Blast hits to 3440 proteins in 614 species: Archae - 16; Bacteria - 2126; Metazoa - 96; Fungi - 67; Plants - 194; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink). 
AT1G53620AT1G53620.1TAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53610.1); Has 5418 Blast hits to 2090 proteins in 300 species: Archae - 0; Bacteria - 1374; Metazoa - 2188; Fungi - 175; Plants - 1090; Viruses - 68; Other Eukaryotes - 523 (source: NCBI BLink). 
AT1G54140AT1G54140.1GCGTTTTAputative TATA binding protein associated factor 21kDa 
AT1G54150AT1G54150.1TAAAACGCzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 1572 Blast hits to 1571 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1041; Fungi - 23; Plants - 178; Viruses - 133; Other Eukaryotes - 197 (source: NCBI BLink). 
AT1G54780AT1G54780.1TAAAACGCCACGTCGthylakoid lumen 18.3 kDa protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF477 (InterPro:IPR007621); Has 159 Blast hits to 159 proteins in 71 species: Archae - 0; Bacteria - 103; Metazoa - 2; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). 
AT1G55080AT1G55080.1GAAACGACGGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29580.1); Has 64498 Blast hits to 23302 proteins in 980 species: Archae - 12; Bacteria - 3118; Metazoa - 24455; Fungi - 7046; Plants - 5363; Viruses - 296; Other Eukaryotes - 24208 (source: NCBI BLink). 
AT1G62600AT1G62600.1TAAAACGCAGCGTTTflavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960); BEST Arabidopsis thaliana protein match is: flavin-containing monooxygenase family protein / FMO family protein (TAIR:AT1G62620.1); Has 8846 Blast hits to 8478 proteins in 928 species: Archae - 35; Bacteria - 3635; Metazoa - 1030; Fungi - 886; Plants - 455; Viruses - 0; Other Eukaryotes - 2805 (source: NCBI BLink). 
AT1G65440AT1G65440.1TAAAACGCRelated to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly. 
AT1G65440.2TAAAACGCRelated to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly. 
AT1G69390AT1G69390.1TAAAACGCTGEncodes an Arabidopsis homologue of the bacterial MinE topological specificity factor ensuring correct division site placement. It is an essential integral component of the plastid division machinery. 
AT1G70610AT1G70610.1GAAACGACGCGTTTTAmember of TAP subfamily 
AT1G72040AT1G72040.1TAAAACGCdeoxynucleoside kinase family; FUNCTIONS IN: phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Deoxynucleoside kinase (InterPro:IPR002624); Has 1720 Blast hits to 1716 proteins in 345 species: Archae - 0; Bacteria - 621; Metazoa - 410; Fungi - 0; Plants - 41; Viruses - 60; Other Eukaryotes - 588 (source: NCBI BLink). 
AT1G72520AT1G72520.1CGCGTTTTAlipoxygenase, putative; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen, lipoxygenase activity, iron ion binding, metal ion binding; INVOLVED IN: growth, jasmonic acid biosynthetic process, response to wounding, defense response; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976), Lipoxygenase, C-terminal (InterPro:IPR013819), Lipoxygenase (InterPro:IPR000907), Lipoxygenase, plant (InterPro:IPR001246); BEST Arabidopsis thaliana protein match is: LOX3; electron carrier/ iron ion binding / lipoxygenase/ metal ion binding / oxidoreductase, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (TAIR:AT1G17420.1); Has 1119 Blast hits to 1103 proteins in 149 species: Archae - 0; Bacteria - 68; Metazoa - 485; Fungi - 38; Plants - 512; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT1G72650AT1G72650.1TAAAACGCArabidopsis thaliana myb family transcription factor (At1g72650) 
AT1G72650.2TAAAACGCArabidopsis thaliana myb family transcription factor (At1g72650) 
AT1G80580AT1G80580.1GCGTTTTAencodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. 
AT2G04280AT2G04280.1CGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12700.1); Has 74 Blast hits to 74 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT2G04650AT2G04650.1TAAAACGCADP-glucose pyrophosphorylase family protein; FUNCTIONS IN: transferase activity, nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004), Bacterial transferase hexapeptide repeat (InterPro:IPR001451), Nucleotidyl transferase (InterPro:IPR005835); BEST Arabidopsis thaliana protein match is: ADP-glucose pyrophosphorylase family protein (TAIR:AT1G74910.2); Has 7354 Blast hits to 7349 proteins in 1328 species: Archae - 421; Bacteria - 4278; Metazoa - 363; Fungi - 219; Plants - 282; Viruses - 0; Other Eukaryotes - 1791 (source: NCBI BLink). 
AT2G04660AT2G04660.1GCGTTTTAa highly conserved ubiquitin-protein ligase involved in cell cycle regulation 
AT2G05260AT2G05260.1TAAAACGCCGTCGTTTClipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT4G10955.1); Has 115 Blast hits to 115 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G05260.2TAAAACGCCGTCGTTTClipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT4G10955.1); Has 115 Blast hits to 115 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G21640AT2G21640.1TAAAACGCTGCGEncodes a protein of unknown function that is a marker for oxidative stress response. 
AT2G22970AT2G22970.1TAAAACGCCSERINE CARBOXYPEPTIDASE-LIKE 11 (SCPL11); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase S10 family protein (TAIR:AT2G22920.2); Has 2721 Blast hits to 2662 proteins in 326 species: Archae - 0; Bacteria - 303; Metazoa - 562; Fungi - 550; Plants - 980; Viruses - 0; Other Eukaryotes - 326 (source: NCBI BLink). 
AT2G22970.2TAAAACGCCSERINE CARBOXYPEPTIDASE-LIKE 11 (SCPL11); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase S10 family protein (TAIR:AT2G22920.2); Has 2721 Blast hits to 2662 proteins in 326 species: Archae - 0; Bacteria - 303; Metazoa - 562; Fungi - 550; Plants - 980; Viruses - 0; Other Eukaryotes - 326 (source: NCBI BLink). 
AT2G22970.3TAAAACGCCSERINE CARBOXYPEPTIDASE-LIKE 11 (SCPL11); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase S10 family protein (TAIR:AT2G22920.2); Has 2721 Blast hits to 2662 proteins in 326 species: Archae - 0; Bacteria - 303; Metazoa - 562; Fungi - 550; Plants - 980; Viruses - 0; Other Eukaryotes - 326 (source: NCBI BLink). 
AT2G29700AT2G29700.1TAAAACGCEncodes a protein containing one PH (pleckstrin homology) domain with a short N-terminal extension 
AT2G30280AT2G30280.1TAAAACGCCunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 44325 Blast hits to 17174 proteins in 814 species: Archae - 92; Bacteria - 12397; Metazoa - 14270; Fungi - 4388; Plants - 1716; Viruses - 607; Other Eukaryotes - 10855 (source: NCBI BLink). 
AT2G36885AT2G36885.1AAAACGGCAGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT2G36885.2AAAACGGCAGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT2G44065AT2G44065.1TAAAACGCribosomal protein L2 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding, transferase activity; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Translation protein SH3-like, subgroup (InterPro:IPR014722), Ribosomal protein L2, bacterial-type (InterPro:IPR005880), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG01310.1); Has 7469 Blast hits to 7469 proteins in 2227 species: Archae - 235; Bacteria - 3117; Metazoa - 361; Fungi - 186; Plants - 960; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink). 
AT2G44065.2TAAAACGCribosomal protein L2 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding, transferase activity; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Translation protein SH3-like, subgroup (InterPro:IPR014722), Ribosomal protein L2, bacterial-type (InterPro:IPR005880), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG01310.1); Has 7469 Blast hits to 7469 proteins in 2227 species: Archae - 235; Bacteria - 3117; Metazoa - 361; Fungi - 186; Plants - 960; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink). 
AT2G45770AT2G45770.1TAAAACGCchloroplast SRP receptor homolog, alpha subunit CPFTSY. Required for LHCP integration into isolated thylakoids. 
AT2G46060AT2G46060.1TAAAACGCTGtransmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G46060.2TAAAACGCTGtransmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G46900AT2G46900.1TAAAACGCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix, Nulp1-type (InterPro:IPR006994); Has 3014 Blast hits to 2357 proteins in 239 species: Archae - 2; Bacteria - 96; Metazoa - 1166; Fungi - 321; Plants - 100; Viruses - 47; Other Eukaryotes - 1282 (source: NCBI BLink). 
AT3G02630AT3G02630.1GCGTTTTAacyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT5G16240.1); Has 567 Blast hits to 564 proteins in 126 species: Archae - 0; Bacteria - 200; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT3G02790AT3G02790.1GCGTTTTAzinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT5G16470.1); Has 55 Blast hits to 55 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT3G04130AT3G04130.1TAAAACGCpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink). 
AT3G04130.2TAAAACGCpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink). 
AT3G04830AT3G04830.1TAAAACGCbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT3G04830.1TAAAACGCAGCGTTTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT3G04830.2TAAAACGCbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT3G04830.2TAAAACGCAGCGTTTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT3G05060AT3G05060.1GGCGTTTTASAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein 
AT3G05060.1TAAAACGCCSAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein 
AT3G05070AT3G05070.1GGCGTTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink). 
AT3G05070.1TAAAACGCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink). 
AT3G07020AT3G07020.1CAGCGTTTTAUDP-glucose:sterol glucosyltransferase (UGT80A2); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28 (InterPro:IPR004276), UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 1535 Blast hits to 1509 proteins in 402 species: Archae - 0; Bacteria - 841; Metazoa - 296; Fungi - 260; Plants - 77; Viruses - 3; Other Eukaryotes - 58 (source: NCBI BLink). 
AT3G07020.2CAGCGTTTTAUDP-glucose:sterol glucosyltransferase (UGT80A2); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28 (InterPro:IPR004276), UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 1535 Blast hits to 1509 proteins in 402 species: Archae - 0; Bacteria - 841; Metazoa - 296; Fungi - 260; Plants - 77; Viruses - 3; Other Eukaryotes - 58 (source: NCBI BLink). 
AT3G09090AT3G09090.1GCGTTTTAEncodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development. 
AT3G09090.2GCGTTTTAEncodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development. 
AT3G09740AT3G09740.1TAAAACGCsyntaxin of plants 71 (SYP71) 
AT3G09922AT3G09922.1TAAAACGCAF236376 Arabidopsis thaliana IPS1 mRNA, complete sequence 
AT3G10070AT3G10070.1AAACGCTGCGTTTTAEncodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. 
AT3G10270AT3G10270.1GCGTTTTAProtein targeting to mitochondria is influenced by UTR sequences. 
AT3G11450AT3G11450.1TAAAACGCDNAJ heat shock N-terminal domain-containing protein / cell division protein-related; FUNCTIONS IN: heat shock protein binding, DNA binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), MYB-like (InterPro:IPR017877), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT5G06110.1); Has 51717 Blast hits to 34681 proteins in 2122 species: Archae - 166; Bacteria - 8879; Metazoa - 19405; Fungi - 4515; Plants - 2164; Viruses - 194; Other Eukaryotes - 16394 (source: NCBI BLink). 
AT3G11830AT3G11830.1TAAAACGCTGCGTTTTAchaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, eta subunit (InterPro:IPR012720), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: ATTCP-1; ATP binding / protein binding / unfolded protein binding (TAIR:AT3G20050.1); Has 14866 Blast hits to 14802 proteins in 2423 species: Archae - 394; Bacteria - 5781; Metazoa - 1895; Fungi - 1006; Plants - 468; Viruses - 0; Other Eukaryotes - 5322 (source: NCBI BLink). 
AT3G11930AT3G11930.1GGCGTTTTAuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G58450.1); Has 734 Blast hits to 733 proteins in 134 species: Archae - 26; Bacteria - 262; Metazoa - 38; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT3G11930.2GGCGTTTTAuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G58450.1); Has 734 Blast hits to 733 proteins in 134 species: Archae - 26; Bacteria - 262; Metazoa - 38; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT3G11930.3GGCGTTTTAuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G58450.1); Has 734 Blast hits to 733 proteins in 134 species: Archae - 26; Bacteria - 262; Metazoa - 38; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT3G11930.4GGCGTTTTAuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G58450.1); Has 734 Blast hits to 733 proteins in 134 species: Archae - 26; Bacteria - 262; Metazoa - 38; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT3G14075AT3G14075.1TAAAACGClipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity, carboxylesterase activity; INVOLVED IN: lipid catabolic process, lipid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT4G16070.1); Has 687 Blast hits to 620 proteins in 137 species: Archae - 3; Bacteria - 35; Metazoa - 217; Fungi - 109; Plants - 144; Viruses - 28; Other Eukaryotes - 151 (source: NCBI BLink). 
AT3G14080AT3G14080.1GCGTTTTAsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G19120.1); Has 774 Blast hits to 773 proteins in 160 species: Archae - 46; Bacteria - 0; Metazoa - 325; Fungi - 215; Plants - 116; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). 
AT3G14080.2GCGTTTTAsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G19120.1); Has 774 Blast hits to 773 proteins in 160 species: Archae - 46; Bacteria - 0; Metazoa - 325; Fungi - 215; Plants - 116; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). 
AT3G15510AT3G15510.1GGCGTTTTANote of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. 
AT3G16580AT3G16580.1GGCGTTTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G14710.1); Has 659 Blast hits to 653 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 659; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G18950AT3G18950.1TAAAACGCCACGTGTCATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G49450.1); Has 22480 Blast hits to 12151 proteins in 451 species: Archae - 14; Bacteria - 3107; Metazoa - 9780; Fungi - 4621; Plants - 1980; Viruses - 0; Other Eukaryotes - 2978 (source: NCBI BLink). 
AT3G20970AT3G20970.1TAAAACGCGTEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU5 than to NFU1,2, and 3. Targeted to the mitochondrion. 
AT3G20970.2TAAAACGCGTEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU5 than to NFU1,2, and 3. Targeted to the mitochondrion. 
AT3G21295AT3G21295.1TAAAACGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G51745.1); Has 428 Blast hits to 314 proteins in 77 species: Archae - 0; Bacteria - 111; Metazoa - 87; Fungi - 55; Plants - 63; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink). 
AT3G23310AT3G23310.1TAAAACGCCprotein kinase, putative; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase, C-terminal (InterPro:IPR017892), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G14350.3); Has 79428 Blast hits to 78405 proteins in 2456 species: Archae - 57; Bacteria - 7287; Metazoa - 33281; Fungi - 7809; Plants - 14818; Viruses - 393; Other Eukaryotes - 15783 (source: NCBI BLink). 
AT3G25805AT3G25805.1AAACGGCGTTTTATAAGGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 32 species: Archae - 0; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G26330AT3G26330.1TAAAACGCputative cytochrome P450 
AT3G26560AT3G26560.1TAAAACGCAGCGTTTTAATP-dependent RNA helicase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cytosol, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Region of unknown function DUF1605 (InterPro:IPR011709), S1, RNA binding (InterPro:IPR003029), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 44749 Blast hits to 27526 proteins in 1894 species: Archae - 128; Bacteria - 7760; Metazoa - 17585; Fungi - 4781; Plants - 2372; Viruses - 1049; Other Eukaryotes - 11074 (source: NCBI BLink). 
AT3G44340AT3G44340.1TAAAACGCGhomologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. 
AT3G44340.2TAAAACGCGhomologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. 
AT3G47520AT3G47520.1TAAAACGCEncodes a protein with NAD-dependent malate dehydrogenase activity, located in chloroplasts. 
AT3G48830AT3G48830.1TAAAACGCTGCGpolynucleotide adenylyltransferase family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: polynucleotide adenylyltransferase activity, RNA binding, nucleotide binding, nucleic acid binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Polynucleotide adenylyltransferase region (InterPro:IPR002646), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 8005 Blast hits to 7486 proteins in 1487 species: Archae - 2; Bacteria - 3572; Metazoa - 1145; Fungi - 573; Plants - 347; Viruses - 8; Other Eukaryotes - 2358 (source: NCBI BLink). 
AT3G49720AT3G49720.1TAAAACGCTGTCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G49720.2TAAAACGCTGTCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G49750AT3G49750.1TAAAACGCGReceptor Like Protein 44 (AtRLP44); FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT5G65830.1); Has 37763 Blast hits to 9232 proteins in 488 species: Archae - 16; Bacteria - 1150; Metazoa - 1956; Fungi - 137; Plants - 32378; Viruses - 0; Other Eukaryotes - 2126 (source: NCBI BLink). 
AT3G51890AT3G51890.1TAAAACGCCprotein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: clathrin coat of trans-Golgi network vesicle, clathrin coat of coated pit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT2G40060.1); Has 258 Blast hits to 256 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 126; Fungi - 42; Plants - 56; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). 
AT3G52400AT3G52400.1AACCGCGTTTTAsyntaxin protein, involved in the negative regulation of defense pathways such as programmed cell death, salicylic acid signalling pathway, jasmonic acid signalling pathway 
AT3G52470AT3G52470.1TAAAACGCGharpin-induced family protein / HIN1 family protein / harpin-responsive family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: NHL12 (TAIR:AT2G35960.1); Has 615 Blast hits to 615 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 615; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G54190AT3G54190.1ACCCCTTAAACGCTGCGTTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38630.1); Has 77 Blast hits to 77 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT3G56150AT3G56150.1GCGTTTTAmember of eIF3c - eukaryotic initiation factor 3c 
AT3G56800AT3G56800.1GGCGTTTTAencodes a calmodulin 
AT3G61070AT3G61070.1AAACGCTGCGTTTTAmember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. 
AT3G61070.2AAACGCTGCGTTTTAmember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. 
AT3G63210AT3G63210.1TAAAACGCencodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 
AT4G02400AT4G02400.1CAGCGTTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: rRNA processing; LOCATED IN: small-subunit processome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small-subunit processome, Utp14 (InterPro:IPR006709); BEST Arabidopsis thaliana protein match is: U3 ribonucleoprotein (Utp) family protein (TAIR:AT5G08600.1); Has 7412 Blast hits to 4272 proteins in 301 species: Archae - 10; Bacteria - 517; Metazoa - 2926; Fungi - 722; Plants - 242; Viruses - 149; Other Eukaryotes - 2846 (source: NCBI BLink). 
AT4G02450AT4G02450.1TAAAACGCglycine-rich protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03773.1); Has 46378 Blast hits to 11178 proteins in 874 species: Archae - 70; Bacteria - 23566; Metazoa - 10100; Fungi - 1919; Plants - 4009; Viruses - 377; Other Eukaryotes - 6337 (source: NCBI BLink). 
AT4G02450.2TAAAACGCglycine-rich protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03773.1); Has 46378 Blast hits to 11178 proteins in 874 species: Archae - 70; Bacteria - 23566; Metazoa - 10100; Fungi - 1919; Plants - 4009; Viruses - 377; Other Eukaryotes - 6337 (source: NCBI BLink). 
AT4G02570AT4G02570.1TAAAACGCAGCGTEncodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response. 
AT4G02570.2TAAAACGCAGCGTEncodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response. 
AT4G02570.3TAAAACGCAGCGTEncodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response. 
AT4G08590AT4G08590.1TAAAACGCGORTHRUS-LIKE (ORTHL); FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; INVOLVED IN: protein ubiquitination; LOCATED IN: cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: SRA-YDG (InterPro:IPR003105), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: VIM1 (VARIANT IN METHYLATION 1); DNA binding / chromatin binding / double-stranded methylated DNA binding / histone binding / methyl-CpG binding / methyl-CpNpG binding / methyl-CpNpN binding / ubiquitin-protein ligase (TAIR:AT1G57820.2); Has 2130 Blast hits to 2080 proteins in 171 species: Archae - 0; Bacteria - 8; Metazoa - 1503; Fungi - 96; Plants - 328; Viruses - 5; Other Eukaryotes - 190 (source: NCBI BLink). 
AT4G08590.2TAAAACGCGORTHRUS-LIKE (ORTHL); FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; INVOLVED IN: protein ubiquitination; LOCATED IN: cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: SRA-YDG (InterPro:IPR003105), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: VIM1 (VARIANT IN METHYLATION 1); DNA binding / chromatin binding / double-stranded methylated DNA binding / histone binding / methyl-CpG binding / methyl-CpNpG binding / methyl-CpNpN binding / ubiquitin-protein ligase (TAIR:AT1G57820.2); Has 2130 Blast hits to 2080 proteins in 171 species: Archae - 0; Bacteria - 8; Metazoa - 1503; Fungi - 96; Plants - 328; Viruses - 5; Other Eukaryotes - 190 (source: NCBI BLink). 
AT4G12830AT4G12830.1TAAAACGCAGCGTTTTAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G52510.2); Has 8452 Blast hits to 8450 proteins in 913 species: Archae - 58; Bacteria - 5118; Metazoa - 591; Fungi - 124; Plants - 417; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT4G12880AT4G12880.1TAAAACGCplastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: apoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT5G15350.1); Has 714 Blast hits to 705 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 714; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G14315AT4G14315.1TAAAACGCTGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G14420AT4G14420.1CGCGTTTTAlesion inducing protein-related; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: HR-like lesion-inducer (InterPro:IPR008637); BEST Arabidopsis thaliana protein match is: lesion inducing protein-related (TAIR:AT1G04340.1); Has 95 Blast hits to 95 proteins in 17 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT4G14600AT4G14600.1TAAAACGCAGCGTTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G15470AT4G15470.1CAGCGTTTTAEXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0005 (InterPro:IPR006214); BEST Arabidopsis thaliana protein match is: glutamate binding (TAIR:AT1G03070.1); Has 4000 Blast hits to 3999 proteins in 955 species: Archae - 0; Bacteria - 1775; Metazoa - 750; Fungi - 92; Plants - 143; Viruses - 77; Other Eukaryotes - 1163 (source: NCBI BLink). 
AT4G17500AT4G17500.1TAAAACGCACGTGTTEncodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. 
AT4G20360AT4G20360.1TAAAACGCCACGARABIDOPSIS RAB GTPASE HOMOLOG E1B (ATRABE1B); FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; INVOLVED IN: peptidyl-cysteine S-nitrosylation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, bacterial and organelle (InterPro:IPR004541), Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor Tu, putative / EF-Tu, putative (TAIR:AT4G02930.1); Has 60789 Blast hits to 60738 proteins in 12836 species: Archae - 775; Bacteria - 22875; Metazoa - 13447; Fungi - 6921; Plants - 1294; Viruses - 5; Other Eukaryotes - 15472 (source: NCBI BLink). 
AT4G25130AT4G25130.1TAAAACGCpeptide methionine sulfoxide reductase, putative; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity, oxidoreductase activity, acting on sulfur group of donors, disulfide as acceptor; INVOLVED IN: protein modification process, protein metabolic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase A (InterPro:IPR002569); BEST Arabidopsis thaliana protein match is: PMSR1 (PEPTIDEMETHIONINE SULFOXIDE REDUCTASE 1); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor / peptide-methionine-(S)-S-oxide reductase (TAIR:AT5G61640.1); Has 7185 Blast hits to 7183 proteins in 1356 species: Archae - 86; Bacteria - 3332; Metazoa - 164; Fungi - 91; Plants - 129; Viruses - 1; Other Eukaryotes - 3382 (source: NCBI BLink). 
AT4G25140AT4G25140.1GCGTTTTAEncodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds. 
AT4G26430AT4G26430.1TAAAACGCone of two genes encoding subunit 6 of COP9 signalosome complex 
AT4G30570AT4G30570.1TAAAACGCTGGDP-mannose pyrophosphorylase, putative; FUNCTIONS IN: transferase activity, nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004), Bacterial transferase hexapeptide repeat (InterPro:IPR001451), Nucleotidyl transferase (InterPro:IPR005835); BEST Arabidopsis thaliana protein match is: CYT1 (CYTOKINESIS DEFECTIVE 1); mannose-1-phosphate guanylyltransferase/ nucleotidyltransferase (TAIR:AT2G39770.1); Has 12903 Blast hits to 12895 proteins in 1604 species: Archae - 523; Bacteria - 7994; Metazoa - 333; Fungi - 194; Plants - 189; Viruses - 0; Other Eukaryotes - 3670 (source: NCBI BLink). 
AT4G31360AT4G31360.1GCGTTTTAselenium binding; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenium binding (TAIR:AT2G24440.1); Has 199 Blast hits to 172 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 101; Fungi - 17; Plants - 36; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). 
AT4G32640AT4G32640.1GGCGTTTTAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular protein transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895), Gelsolin region (InterPro:IPR007123); BEST Arabidopsis thaliana protein match is: CEF (clone eighty-four); protein binding / transporter/ zinc ion binding (TAIR:AT3G44340.1); Has 78573 Blast hits to 39320 proteins in 1269 species: Archae - 50; Bacteria - 9353; Metazoa - 41001; Fungi - 10869; Plants - 6189; Viruses - 1516; Other Eukaryotes - 9595 (source: NCBI BLink). 
AT4G32640.2GGCGTTTTAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular protein transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895), Gelsolin region (InterPro:IPR007123); BEST Arabidopsis thaliana protein match is: CEF (clone eighty-four); protein binding / transporter/ zinc ion binding (TAIR:AT3G44340.1); Has 78573 Blast hits to 39320 proteins in 1269 species: Archae - 50; Bacteria - 9353; Metazoa - 41001; Fungi - 10869; Plants - 6189; Viruses - 1516; Other Eukaryotes - 9595 (source: NCBI BLink). 
AT4G32900AT4G32900.1TAAAACGCaminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 486 Blast hits to 486 proteins in 195 species: Archae - 103; Bacteria - 0; Metazoa - 148; Fungi - 84; Plants - 38; Viruses - 6; Other Eukaryotes - 107 (source: NCBI BLink). 
AT4G32900.2TAAAACGCaminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 486 Blast hits to 486 proteins in 195 species: Archae - 103; Bacteria - 0; Metazoa - 148; Fungi - 84; Plants - 38; Viruses - 6; Other Eukaryotes - 107 (source: NCBI BLink). 
AT4G35980AT4G35980.1GGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G36390AT4G36390.1AAACGCTGCGTTTTAradical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), tRNA-i(6)A37 modification enzyme MiaB (InterPro:IPR006463), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT1G72090.1); Has 10307 Blast hits to 10292 proteins in 1299 species: Archae - 219; Bacteria - 4582; Metazoa - 258; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 5193 (source: NCBI BLink). 
AT4G36400AT4G36400.1TAAAACGCAGCGTTTFAD linked oxidase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), FAD-linked oxidase, C-terminal (InterPro:IPR004113), FAD-linked oxidase-like, C-terminal (InterPro:IPR016164), FAD linked oxidase, N-terminal (InterPro:IPR006094), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167); BEST Arabidopsis thaliana protein match is: FAD linked oxidase family protein (TAIR:AT5G06580.1); Has 12154 Blast hits to 12076 proteins in 1151 species: Archae - 141; Bacteria - 6321; Metazoa - 332; Fungi - 395; Plants - 69; Viruses - 0; Other Eukaryotes - 4896 (source: NCBI BLink). 
AT4G36400.2TAAAACGCAGCGTTTFAD linked oxidase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), FAD-linked oxidase, C-terminal (InterPro:IPR004113), FAD-linked oxidase-like, C-terminal (InterPro:IPR016164), FAD linked oxidase, N-terminal (InterPro:IPR006094), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167); BEST Arabidopsis thaliana protein match is: FAD linked oxidase family protein (TAIR:AT5G06580.1); Has 12154 Blast hits to 12076 proteins in 1151 species: Archae - 141; Bacteria - 6321; Metazoa - 332; Fungi - 395; Plants - 69; Viruses - 0; Other Eukaryotes - 4896 (source: NCBI BLink). 
AT5G01270AT5G01270.1TAAAACGCEncodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses. 
AT5G02650AT5G02650.1TAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28260.2); Has 13 Blast hits to 13 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G03050AT5G03050.1TAAAACGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G03530AT5G03530.1TAAAACGCEncodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. CFP:RabC2a appears to co-localize with peroxisomes. 
AT5G03990AT5G03990.1TAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G51940.1); Has 212 Blast hits to 160 proteins in 36 species: Archae - 0; Bacteria - 16; Metazoa - 16; Fungi - 22; Plants - 31; Viruses - 2; Other Eukaryotes - 125 (source: NCBI BLink). 
AT5G04480AT5G04480.1TAAAACGCGTGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT4G01210.1); Has 241 Blast hits to 238 proteins in 81 species: Archae - 4; Bacteria - 156; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). 
AT5G04590AT5G04590.1GCGTTTTACGCGCTTA.thaliana gene encoding sulfite reductase. 
AT5G08160AT5G08160.1TAAAACGCEncodes a serine/threonine protein kinase. 
AT5G08160.2TAAAACGCEncodes a serine/threonine protein kinase. 
AT5G09390AT5G09390.1AAAACGGCGGCGTTTTACD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT5G09390.2AAAACGGCGGCGTTTTACD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT5G13200AT5G13200.1AACCGCGTTTTAGRAM domain-containing protein / ABA-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: GRAM (InterPro:IPR004182); BEST Arabidopsis thaliana protein match is: GEM (GL2-EXPRESSION MODULATOR) (TAIR:AT2G22475.1); Has 237 Blast hits to 237 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 235; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G13280AT5G13280.1TAAACGACAGCGTTTTAAsp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH). 
AT5G13810AT5G13810.1AACCGCGTTTTAglutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT3G57070.1); Has 425 Blast hits to 425 proteins in 66 species: Archae - 0; Bacteria - 21; Metazoa - 92; Fungi - 4; Plants - 202; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). 
AT5G14260AT5G14260.1GCGTTTTASET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT5G14260.2GCGTTTTASET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT5G14260.3GCGTTTTASET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT5G16150AT5G16150.1GCGTTTTAEncodes a putative plastidic glucose transporter. 
AT5G16150.2GCGTTTTAEncodes a putative plastidic glucose transporter. 
AT5G16150.3GCGTTTTAEncodes a putative plastidic glucose transporter. 
AT5G18380AT5G18380.1TAAAACGCTGCG40S ribosomal protein S16 (RPS16C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, chloroplast; EXPRESSED IN: fruit, guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16A) (TAIR:AT2G09990.1); Has 4941 Blast hits to 4941 proteins in 1533 species: Archae - 152; Bacteria - 2655; Metazoa - 264; Fungi - 126; Plants - 110; Viruses - 0; Other Eukaryotes - 1634 (source: NCBI BLink). 
AT5G18380.2TAAAACGCTGCG40S ribosomal protein S16 (RPS16C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, chloroplast; EXPRESSED IN: fruit, guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16A) (TAIR:AT2G09990.1); Has 4941 Blast hits to 4941 proteins in 1533 species: Archae - 152; Bacteria - 2655; Metazoa - 264; Fungi - 126; Plants - 110; Viruses - 0; Other Eukaryotes - 1634 (source: NCBI BLink). 
AT5G18390AT5G18390.1CGCAGCGTTTTApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G65820.1); Has 14680 Blast hits to 4971 proteins in 159 species: Archae - 2; Bacteria - 2; Metazoa - 244; Fungi - 162; Plants - 13880; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink). 
AT5G19830AT5G19830.1GCGTTTTAaminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, conserved site (InterPro:IPR018171), Peptidyl-tRNA hydrolase (InterPro:IPR001328); BEST Arabidopsis thaliana protein match is: peptidyl-tRNA hydrolase family protein (TAIR:AT5G16140.2); Has 5409 Blast hits to 5409 proteins in 1418 species: Archae - 0; Bacteria - 2886; Metazoa - 37; Fungi - 46; Plants - 76; Viruses - 0; Other Eukaryotes - 2364 (source: NCBI BLink). 
AT5G21920AT5G21920.1TAAAACGCYGGT family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function YGGT (InterPro:IPR003425); BEST Arabidopsis thaliana protein match is: YGGT family protein (TAIR:AT4G27990.1); Has 1060 Blast hits to 1060 proteins in 353 species: Archae - 0; Bacteria - 642; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 348 (source: NCBI BLink). 
AT5G21930AT5G21930.1GCGTTTTAP-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport 
AT5G21930.2GCGTTTTAP-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport 
AT5G23020AT5G23020.1GCGTTTTAmethylthioalkymalate synthase-like. Also known as 2-isopropylmalate synthase (IMS2). encodes a methylthioalkylmalate synthase involved in the biosynthesis of aliphatic glucosinolates which accepts all the omega-methylthio-2-oxoalkanoic acids needed to form the known C3 to C8 glucosinolates in Arabidopsis. 
AT5G25440AT5G25440.1TAAAACGCGTprotein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G11410.1); Has 37433 Blast hits to 37026 proteins in 1128 species: Archae - 24; Bacteria - 1745; Metazoa - 15094; Fungi - 1709; Plants - 13857; Viruses - 129; Other Eukaryotes - 4875 (source: NCBI BLink). 
AT5G25450AT5G25450.1ACGCGTTTTAubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT4G32470.1); Has 242 Blast hits to 242 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 160; Fungi - 25; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT5G25940AT5G25940.1GGCGTTTTAearly nodulin-related; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Early nodulin 93 ENOD93 protein (InterPro:IPR005050); Has 95 Blast hits to 95 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 95; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G27120AT5G27120.1GCGTTTTASAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein 
AT5G37770AT5G37770.1ACGCGTTTTAEncodes a protein with 40% similarity to calmodulin. Binds Ca(2+) and, as a consequence, undergoes conformational changes. CML24 expression occurs in all major organs, and transcript levels are increased from 2- to 15-fold in plants subjected to touch, darkness, heat, cold, hydrogen peroxide, abscisic acid (ABA), and indole-3-acetic acid. However, CML24 protein accumulation changes were not detectable. The putative CML24 regulatory region confers reporter expression at sites of predicted mechanical stress; in regions undergoing growth; in vascular tissues and various floral organs; and in stomata, trichomes, and hydathodes. CML24-underexpressing transgenics are resistant to ABA inhibition of germination and seedling growth, are defective in long-day induction of flowering, and have enhanced tolerance to CoCl(2), molybdic acid, ZnSO(4), and MgCl(2). 
AT5G40240AT5G40240.1CAGCGTTTTAnodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin-related (TAIR:AT5G40230.1); Has 1618 Blast hits to 1607 proteins in 311 species: Archae - 15; Bacteria - 735; Metazoa - 4; Fungi - 9; Plants - 626; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). 
AT5G40450AT5G40450.1TAAAACGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28770.1); Has 222145 Blast hits to 74171 proteins in 2066 species: Archae - 1478; Bacteria - 23379; Metazoa - 97811; Fungi - 22006; Plants - 7575; Viruses - 1468; Other Eukaryotes - 68428 (source: NCBI BLink). 
AT5G40450.2TAAAACGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28770.1); Has 222145 Blast hits to 74171 proteins in 2066 species: Archae - 1478; Bacteria - 23379; Metazoa - 97811; Fungi - 22006; Plants - 7575; Viruses - 1468; Other Eukaryotes - 68428 (source: NCBI BLink). 
AT5G41950AT5G41950.1TAAAACGCbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990); Has 4082 Blast hits to 2807 proteins in 401 species: Archae - 36; Bacteria - 931; Metazoa - 1006; Fungi - 261; Plants - 81; Viruses - 23; Other Eukaryotes - 1744 (source: NCBI BLink). 
AT5G42600AT5G42600.1TAAAACGCCEncodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. 
AT5G42740AT5G42740.1TAAAACGCCglucose-6-phosphate isomerase, cytosolic (PGIC); FUNCTIONS IN: glucose-6-phosphate isomerase activity; INVOLVED IN: response to cadmium ion, gluconeogenesis, glycolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglucose isomerase, conserved site (InterPro:IPR018189), Phosphoglucose isomerase (PGI) (InterPro:IPR001672); BEST Arabidopsis thaliana protein match is: PGI1 (PHOSPHOGLUCOSE ISOMERASE 1); glucose-6-phosphate isomerase (TAIR:AT4G24620.2); Has 7416 Blast hits to 7411 proteins in 2035 species: Archae - 34; Bacteria - 3763; Metazoa - 548; Fungi - 156; Plants - 870; Viruses - 0; Other Eukaryotes - 2045 (source: NCBI BLink). 
AT5G51300AT5G51300.1GCGTTTTAsplicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). 
AT5G51300.2GCGTTTTAsplicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). 
AT5G51300.3GCGTTTTAsplicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). 
AT5G54110AT5G54110.1TAAAACGCCEncodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking. 
AT5G55070AT5G55070.1TAAAACGC2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: response to oxidative stress, metabolic process; LOCATED IN: cytosolic ribosome, mitochondrion; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT4G26910.2); Has 20861 Blast hits to 17461 proteins in 1458 species: Archae - 93; Bacteria - 9038; Metazoa - 1182; Fungi - 580; Plants - 756; Viruses - 230; Other Eukaryotes - 8982 (source: NCBI BLink). 
AT5G55210AT5G55210.1TAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22320.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G55210.1TAAAACGCCGCGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22320.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G55210.1TAAAACGCTGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22320.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G55220AT5G55220.1CGCAGCGTTTTAtrigger factor type chaperone family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, protein transport; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Trigger factor, C-terminal, bacterial (InterPro:IPR008880), Trigger factor, ribosome-binding, bacterial (InterPro:IPR008881), Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); Has 4453 Blast hits to 4437 proteins in 1318 species: Archae - 0; Bacteria - 2754; Metazoa - 39; Fungi - 3; Plants - 24; Viruses - 2; Other Eukaryotes - 1631 (source: NCBI BLink). 
AT5G55220.1GCGTTTTAtrigger factor type chaperone family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, protein transport; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Trigger factor, C-terminal, bacterial (InterPro:IPR008880), Trigger factor, ribosome-binding, bacterial (InterPro:IPR008881), Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); Has 4453 Blast hits to 4437 proteins in 1318 species: Archae - 0; Bacteria - 2754; Metazoa - 39; Fungi - 3; Plants - 24; Viruses - 2; Other Eukaryotes - 1631 (source: NCBI BLink). 
AT5G55220.1TCAAAACGCGGCGTTTTAtrigger factor type chaperone family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, protein transport; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Trigger factor, C-terminal, bacterial (InterPro:IPR008880), Trigger factor, ribosome-binding, bacterial (InterPro:IPR008881), Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); Has 4453 Blast hits to 4437 proteins in 1318 species: Archae - 0; Bacteria - 2754; Metazoa - 39; Fungi - 3; Plants - 24; Viruses - 2; Other Eukaryotes - 1631 (source: NCBI BLink). 
AT5G59613AT5G59613.1CGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial respiratory chain complex III; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46430.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G59880AT5G59880.1TAAAACGCEncodes actin depolymerizing factor 3 (ADF3). 
AT5G59880.2TAAAACGCEncodes actin depolymerizing factor 3 (ADF3). 
AT5G63000AT5G63000.1GCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G65770AT5G65770.1TAAAACGCCGTCGTTTGGGCLITTLE NUCLEI4 (LINC4); EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LINC1 (LITTLE NUCLEI1) (TAIR:AT1G67230.1). 
AT5G65770.2TAAAACGCCGTCGTTTGGGCLITTLE NUCLEI4 (LINC4); EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LINC1 (LITTLE NUCLEI1) (TAIR:AT1G67230.1). 
AT5G66650AT5G66650.1GCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23790.1); Has 272 Blast hits to 270 proteins in 89 species: Archae - 2; Bacteria - 0; Metazoa - 132; Fungi - 36; Plants - 70; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.