version

Summary of AtREG565 (All List)

OrganismArabidopsis thaliana  
IDAtREG565  
SequenceGTCGTTTA  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count283  

Entry Sequences (283 entries)

LocusGene modelSequenceDescription
AT1G01510AT1G01510.1ACGGCGTCGTTTAEncodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. 
AT1G02370AT1G02370.1TAAACGACApentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G01990.1); Has 3083 Blast hits to 1840 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 43; Fungi - 27; Plants - 2899; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink). 
AT1G02660AT1G02660.1TAAACGACGACGTlipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT3G62590.1); Has 601 Blast hits to 595 proteins in 116 species: Archae - 0; Bacteria - 17; Metazoa - 188; Fungi - 136; Plants - 92; Viruses - 14; Other Eukaryotes - 154 (source: NCBI BLink). 
AT1G03280AT1G03280.1TGTCGTTTAtranscription initiation factor IIE (TFIIE) alpha subunit family protein / general transcription factor TFIIE family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription initiation factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: endomembrane system, transcription factor TFIIE complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Transcription factor TFIIE, alpha subunit (InterPro:IPR002853), Transcription factor TFE/TFIIEalpha, HTH domain (InterPro:IPR017919); BEST Arabidopsis thaliana protein match is: RNA polymerase II transcription factor/ transcription initiation factor (TAIR:AT4G20340.1); Has 683 Blast hits to 606 proteins in 133 species: Archae - 3; Bacteria - 10; Metazoa - 347; Fungi - 130; Plants - 70; Viruses - 11; Other Eukaryotes - 112 (source: NCBI BLink). 
AT1G04710AT1G04710.1ACGACGTCGTTTAEC2.3.1.16 thiolase. 
AT1G06580AT1G06580.1GTCGTTTApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: stem, embryo, flower, seed; EXPRESSED DURING: F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G64580.1); Has 24093 Blast hits to 5935 proteins in 175 species: Archae - 4; Bacteria - 16; Metazoa - 695; Fungi - 411; Plants - 21894; Viruses - 0; Other Eukaryotes - 1073 (source: NCBI BLink). 
AT1G06700AT1G06700.1TGTCGTTTAserine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink). 
AT1G06700.2TGTCGTTTAserine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink). 
AT1G08110AT1G08110.1AACGACGTCGTTTAlactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). 
AT1G08110.2AACGACGTCGTTTAlactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). 
AT1G08110.3AACGACGTCGTTTAlactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). 
AT1G08110.4AACGACGTCGTTTAlactoylglutathione lyase, putative / glyoxalase I, putative; FUNCTIONS IN: calmodulin binding, lactoylglutathione lyase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase I (InterPro:IPR004361), Glyoxalase I, conserved site (InterPro:IPR018146), Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase, putative / glyoxalase I, putative (TAIR:AT1G67280.2); Has 3289 Blast hits to 3095 proteins in 883 species: Archae - 16; Bacteria - 1642; Metazoa - 143; Fungi - 259; Plants - 164; Viruses - 0; Other Eukaryotes - 1065 (source: NCBI BLink). 
AT1G08450AT1G08450.1TAAACGACEncodes calreticulin CRT3. 
AT1G08450.2TAAACGACEncodes calreticulin CRT3. 
AT1G11310AT1G11310.1TAAACGACA member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. 
AT1G11310.2TAAACGACA member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. 
AT1G11475AT1G11475.1ACGACGTCGTTTANon-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB10. 
AT1G11940AT1G11940.1ACGTGTACGTGGCTTACGACGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62305.1); Has 329 Blast hits to 329 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 304; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). 
AT1G12030AT1G12030.1TGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: pollen tube, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62420.1); Has 213 Blast hits to 213 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 211; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G12760AT1G12760.1TAAACGACprotein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink). 
AT1G12760.2TAAACGACprotein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink). 
AT1G13120AT1G13120.1TAAACGACATCGembryo defective 1745 (emb1745); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nuclear pore; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GLE1-like (InterPro:IPR012476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G05523.1); Has 32122 Blast hits to 20275 proteins in 1392 species: Archae - 166; Bacteria - 5743; Metazoa - 12337; Fungi - 2633; Plants - 1041; Viruses - 221; Other Eukaryotes - 9981 (source: NCBI BLink). 
AT1G13900AT1G13900.1ACGTCGTCGTTTAcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity, metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP9 (PURPLE ACID PHOSPHATASE 9); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G03450.1); Has 1052 Blast hits to 1042 proteins in 232 species: Archae - 0; Bacteria - 259; Metazoa - 179; Fungi - 58; Plants - 399; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). 
AT1G13910AT1G13910.1TAAACGACGACGTleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT5G61240.1); Has 54187 Blast hits to 17810 proteins in 751 species: Archae - 26; Bacteria - 3393; Metazoa - 14506; Fungi - 646; Plants - 32565; Viruses - 0; Other Eukaryotes - 3051 (source: NCBI BLink). 
AT1G15880AT1G15880.1CGATGTCGTTTAGolgi SNARE 11 protein (GOS11) 
AT1G15890AT1G15890.1TAAACGACATCGdisease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation, defense response, apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G43730.1); Has 12716 Blast hits to 11782 proteins in 513 species: Archae - 12; Bacteria - 543; Metazoa - 2689; Fungi - 133; Plants - 9121; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink). 
AT1G16560AT1G16560.1ACGTCGTTTAPer1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G16560.2ACGTCGTTTAPer1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G16560.3ACGTCGTTTAPer1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G16560.4ACGTCGTTTAPer1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G16890AT1G16890.1TGTCGTTTAUBC36/UBC13B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair. It can bind to the MMZ/UEV1 proteins in vitro. 
AT1G16890.2TGTCGTTTAUBC36/UBC13B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair. It can bind to the MMZ/UEV1 proteins in vitro. 
AT1G18570AT1G18570.1TAAACGACGACGTEncodes a member of the R2R3-MYB transcription family. Involved in indole glucosinolate biosynthesis. 
AT1G18710AT1G18710.1TGTCGTTTAMember of the R2R3 factor gene family. 
AT1G19990AT1G19990.1TAAACGACGCCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11600.1); Has 10416 Blast hits to 6328 proteins in 368 species: Archae - 4; Bacteria - 381; Metazoa - 4559; Fungi - 839; Plants - 384; Viruses - 34; Other Eukaryotes - 4215 (source: NCBI BLink). 
AT1G20300AT1G20300.1TAAACGACGCCpentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G77360.1); Has 19529 Blast hits to 6019 proteins in 192 species: Archae - 5; Bacteria - 22; Metazoa - 563; Fungi - 464; Plants - 17637; Viruses - 0; Other Eukaryotes - 838 (source: NCBI BLink). 
AT1G22140AT1G22140.1TGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 27 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G22140.2TGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 27 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G22860AT1G22860.1TAAACGACAGCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 284 Blast hits to 266 proteins in 98 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT1G24180AT1G24180.1TAAACGACGCArabidopsis thaliana pyruvate dehydrogenase E1a-like subunit. 81% identical to a previously characterized Arabidopsis mitochondrial PDH E1a-subunit, At1g59900 
AT1G26340AT1G26340.1TAAACGACGTCGTTencodes a member of the cytochromes b5 family of proteins that localizes to the outer envelope of the chloroplast. The C-terminal portion of the protein appears to be capable of inserting into a plant microsomal membrane in vitro. 
AT1G29390AT1G29390.1TAAACGACTGTCGTTTTencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane. 
AT1G29390.2TAAACGACTGTCGTTTTencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane. 
AT1G32210AT1G32210.1TAAACGACGTEncodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation. 
AT1G32220AT1G32220.1GATGACGTCGTTTAbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). 
AT1G32220.1GTCGTTTAbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). 
AT1G34570AT1G34570.1TAAACGACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15750.1); Has 88 Blast hits to 88 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 44; Fungi - 7; Plants - 32; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G35580AT1G35580.1TCGTCGTTTAGTCCACGTAGEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. 
AT1G35580.2TCGTCGTTTAGTCCACGTAGEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. 
AT1G35580.3TCGTCGTTTAGTCCACGTAGEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. 
AT1G43245AT1G43245.1AACGACGTCGTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214); Has 432 Blast hits to 430 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 212; Fungi - 80; Plants - 47; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink). 
AT1G48410AT1G48410.1TAAACGACAEncodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. 
AT1G48410.2TAAACGACAEncodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. 
AT1G51690AT1G51690.1GTCGTTTA55 kDa B regulatory subunit of phosphatase 2A mRNA, 
AT1G51690.2GTCGTTTA55 kDa B regulatory subunit of phosphatase 2A mRNA, 
AT1G52510AT1G52510.1TAAACGACAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G12830.1); Has 3440 Blast hits to 3440 proteins in 614 species: Archae - 16; Bacteria - 2126; Metazoa - 96; Fungi - 67; Plants - 194; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink). 
AT1G52510.2TAAACGACAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G12830.1); Has 3440 Blast hits to 3440 proteins in 614 species: Archae - 16; Bacteria - 2126; Metazoa - 96; Fungi - 67; Plants - 194; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink). 
AT1G53165AT1G53165.1GTCGTTTAATMAP4K ALPHA1; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response, response to wounding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G15220.1); Has 96724 Blast hits to 95040 proteins in 2970 species: Archae - 80; Bacteria - 8655; Metazoa - 42218; Fungi - 8499; Plants - 18630; Viruses - 533; Other Eukaryotes - 18109 (source: NCBI BLink). 
AT1G53165.2GTCGTTTAATMAP4K ALPHA1; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response, response to wounding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G15220.1); Has 96724 Blast hits to 95040 proteins in 2970 species: Archae - 80; Bacteria - 8655; Metazoa - 42218; Fungi - 8499; Plants - 18630; Viruses - 533; Other Eukaryotes - 18109 (source: NCBI BLink). 
AT1G53520AT1G53520.1TAAACGACACCchalcone-flavanone isomerase-related; FUNCTIONS IN: chalcone isomerase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chalcone isomerase, subgroup (InterPro:IPR003466), Chalcone isomerase, 3-layer sandwich (InterPro:IPR016088), Chalcone isomerase (InterPro:IPR016087); Has 294 Blast hits to 294 proteins in 53 species: Archae - 0; Bacteria - 3; Metazoa - 0; Fungi - 2; Plants - 284; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G55250AT1G55250.1CGATGTCGTTTAEncodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. 
AT1G56190AT1G56190.1TAAACGACGTphosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). 
AT1G56190.2TAAACGACGTphosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). 
AT1G57620AT1G57620.1TAAACGACAemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G09580.1); Has 1360 Blast hits to 1358 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 707; Fungi - 343; Plants - 152; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). 
AT1G58190AT1G58190.1CGATGTCGTTTAReceptor Like Protein 9 (AtRLP9); FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP14 (Receptor Like Protein 14); protein binding (TAIR:AT1G74180.1); Has 147042 Blast hits to 23181 proteins in 886 species: Archae - 108; Bacteria - 9080; Metazoa - 49718; Fungi - 1830; Plants - 74982; Viruses - 105; Other Eukaryotes - 11219 (source: NCBI BLink). 
AT1G61010AT1G61010.1GTCGTTTACLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I (CPSF73-I); FUNCTIONS IN: protein binding; INVOLVED IN: mRNA polyadenylation; LOCATED IN: mRNA cleavage and polyadenylation specificity factor complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-metabolising metallo-beta-lactamase (InterPro:IPR011108), Beta-lactamase-like (InterPro:IPR001279); BEST Arabidopsis thaliana protein match is: ATCPSF73-II (cleavage and polyadenylation specificity factor 73 kDa subunit-II); catalytic/ protein binding (TAIR:AT2G01730.1); Has 3417 Blast hits to 3370 proteins in 847 species: Archae - 282; Bacteria - 1473; Metazoa - 527; Fungi - 183; Plants - 91; Viruses - 2; Other Eukaryotes - 859 (source: NCBI BLink). 
AT1G61010.2GTCGTTTACLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I (CPSF73-I); FUNCTIONS IN: protein binding; INVOLVED IN: mRNA polyadenylation; LOCATED IN: mRNA cleavage and polyadenylation specificity factor complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-metabolising metallo-beta-lactamase (InterPro:IPR011108), Beta-lactamase-like (InterPro:IPR001279); BEST Arabidopsis thaliana protein match is: ATCPSF73-II (cleavage and polyadenylation specificity factor 73 kDa subunit-II); catalytic/ protein binding (TAIR:AT2G01730.1); Has 3417 Blast hits to 3370 proteins in 847 species: Archae - 282; Bacteria - 1473; Metazoa - 527; Fungi - 183; Plants - 91; Viruses - 2; Other Eukaryotes - 859 (source: NCBI BLink). 
AT1G61010.3GTCGTTTACLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I (CPSF73-I); FUNCTIONS IN: protein binding; INVOLVED IN: mRNA polyadenylation; LOCATED IN: mRNA cleavage and polyadenylation specificity factor complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-metabolising metallo-beta-lactamase (InterPro:IPR011108), Beta-lactamase-like (InterPro:IPR001279); BEST Arabidopsis thaliana protein match is: ATCPSF73-II (cleavage and polyadenylation specificity factor 73 kDa subunit-II); catalytic/ protein binding (TAIR:AT2G01730.1); Has 3417 Blast hits to 3370 proteins in 847 species: Archae - 282; Bacteria - 1473; Metazoa - 527; Fungi - 183; Plants - 91; Viruses - 2; Other Eukaryotes - 859 (source: NCBI BLink). 
AT1G62420AT1G62420.1TGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G12030.1); Has 217 Blast hits to 217 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 215; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G62760AT1G62760.1GTCGTTTAinvertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; EXPRESSED IN: stem, male gametophyte, sepal, carpel, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT4G25260.1); Has 138281 Blast hits to 57115 proteins in 1858 species: Archae - 182; Bacteria - 16404; Metazoa - 56481; Fungi - 22217; Plants - 15710; Viruses - 4073; Other Eukaryotes - 23214 (source: NCBI BLink). 
AT1G63880AT1G63880.1TAAACGACAEncodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. 
AT1G64360AT1G64360.1TAAACGACACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 9 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G65280AT1G65280.1GTCGTTTAheat shock protein binding; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G22080.1); Has 22647 Blast hits to 16088 proteins in 1412 species: Archae - 102; Bacteria - 2761; Metazoa - 9875; Fungi - 2142; Plants - 1453; Viruses - 33; Other Eukaryotes - 6281 (source: NCBI BLink). 
AT1G65280.1TAAACGACGCheat shock protein binding; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G22080.1); Has 22647 Blast hits to 16088 proteins in 1412 species: Archae - 102; Bacteria - 2761; Metazoa - 9875; Fungi - 2142; Plants - 1453; Viruses - 33; Other Eukaryotes - 6281 (source: NCBI BLink). 
AT1G69330AT1G69330.1TGTCGTTTAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ubiquitin-protein ligase (TAIR:AT3G29270.2); Has 225 Blast hits to 225 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 95; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT1G69340AT1G69340.1TAAACGACAappr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT2G40600.1); Has 2230 Blast hits to 2187 proteins in 671 species: Archae - 43; Bacteria - 984; Metazoa - 848; Fungi - 95; Plants - 99; Viruses - 7; Other Eukaryotes - 154 (source: NCBI BLink). 
AT1G69390AT1G69390.1GCCTTTAAACGACAGCGTTTEncodes an Arabidopsis homologue of the bacterial MinE topological specificity factor ensuring correct division site placement. It is an essential integral component of the plastid division machinery. 
AT1G69490AT1G69490.1TAAACGACAEncodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. 
AT1G71840AT1G71840.1AAACGACGTCGTTTAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 67893 Blast hits to 26212 proteins in 696 species: Archae - 58; Bacteria - 6808; Metazoa - 32655; Fungi - 12563; Plants - 6168; Viruses - 0; Other Eukaryotes - 9641 (source: NCBI BLink). 
AT1G71840.1GCGTCGTTTAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 67893 Blast hits to 26212 proteins in 696 species: Archae - 58; Bacteria - 6808; Metazoa - 32655; Fungi - 12563; Plants - 6168; Viruses - 0; Other Eukaryotes - 9641 (source: NCBI BLink). 
AT1G74680AT1G74680.1GTGTCGTTTAexostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT3G45400.1); Has 661 Blast hits to 657 proteins in 45 species: Archae - 0; Bacteria - 4; Metazoa - 35; Fungi - 4; Plants - 564; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). 
AT1G76670AT1G76670.1TAAACGACACGCGTtransporter-related; INVOLVED IN: response to nematode; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: transporter-related (TAIR:AT1G21070.1); Has 1259 Blast hits to 1249 proteins in 161 species: Archae - 0; Bacteria - 14; Metazoa - 296; Fungi - 205; Plants - 598; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). 
AT2G01110AT2G01110.1AACGACGTCGTTTAmutant is Albino and pale green; Chloroplast Protein Translocation (tatC). Core subunit of the chloroplast Tat translocase. Integral chloroplast thylakoid membrane protein. 
AT2G01120AT2G01120.1TAAACGACGTCGTTOrigin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. 
AT2G04690AT2G04690.1TAAACGACAcellular repressor of E1A-stimulated genes (CREG) family; FUNCTIONS IN: FMN binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular repressor of E1A-stimulated genes (CREG) (InterPro:IPR014631), FMN-binding split barrel (InterPro:IPR012349), FMN-binding split barrel, related (InterPro:IPR009002); Has 336 Blast hits to 336 proteins in 88 species: Archae - 0; Bacteria - 72; Metazoa - 145; Fungi - 2; Plants - 50; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT2G04690.2TAAACGACAcellular repressor of E1A-stimulated genes (CREG) family; FUNCTIONS IN: FMN binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular repressor of E1A-stimulated genes (CREG) (InterPro:IPR014631), FMN-binding split barrel (InterPro:IPR012349), FMN-binding split barrel, related (InterPro:IPR009002); Has 336 Blast hits to 336 proteins in 88 species: Archae - 0; Bacteria - 72; Metazoa - 145; Fungi - 2; Plants - 50; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT2G04850AT2G04850.1GAAACGACGTCGTTTAauxin-responsive protein-related; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive family protein (TAIR:AT3G25290.2); Has 374 Blast hits to 374 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 72; Fungi - 47; Plants - 246; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT2G18050AT2G18050.1TAAACGACACGTGTACencodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA. 
AT2G18050.2TAAACGACACGTGTACencodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA. 
AT2G20450AT2G20450.1TAAACGACGTC60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). 
AT2G20760AT2G20760.1TAAACGACAprotein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT3G51890.1); Has 1552 Blast hits to 1056 proteins in 209 species: Archae - 0; Bacteria - 461; Metazoa - 500; Fungi - 90; Plants - 101; Viruses - 0; Other Eukaryotes - 400 (source: NCBI BLink). 
AT2G20820AT2G20820.1ACGGCGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 28 Blast hits to 28 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G20820.2ACGGCGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 28 Blast hits to 28 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G21250AT2G21250.1TAAACGACGTmannose 6-phosphate reductase (NADPH-dependent), putative; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: cultured cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: mannose 6-phosphate reductase (NADPH-dependent), putative (TAIR:AT2G21260.1); Has 13388 Blast hits to 13358 proteins in 1330 species: Archae - 187; Bacteria - 7678; Metazoa - 1798; Fungi - 1191; Plants - 907; Viruses - 0; Other Eukaryotes - 1627 (source: NCBI BLink). 
AT2G21250.2TAAACGACGTmannose 6-phosphate reductase (NADPH-dependent), putative; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: cultured cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: mannose 6-phosphate reductase (NADPH-dependent), putative (TAIR:AT2G21260.1); Has 13388 Blast hits to 13358 proteins in 1330 species: Archae - 187; Bacteria - 7678; Metazoa - 1798; Fungi - 1191; Plants - 907; Viruses - 0; Other Eukaryotes - 1627 (source: NCBI BLink). 
AT2G21970AT2G21970.1TAAACGACACGACGTGTACstress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein 
AT2G22125AT2G22125.1GTCGTTTAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Armadillo (InterPro:IPR000225), C2 membrane targeting protein (InterPro:IPR018029), Armadillo-type fold (InterPro:IPR016024), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77460.1); Has 4878 Blast hits to 2097 proteins in 211 species: Archae - 4; Bacteria - 40; Metazoa - 1542; Fungi - 619; Plants - 2223; Viruses - 0; Other Eukaryotes - 450 (source: NCBI BLink). 
AT2G23080AT2G23080.1CGATGTCGTTTAcasein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink). 
AT2G23080.2CGATGTCGTTTAcasein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink). 
AT2G23090AT2G23090.1GTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1909 (InterPro:IPR015023); Has 104 Blast hits to 104 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 33; Plants - 46; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). 
AT2G26780AT2G26780.1ACGACGTCGTTTAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 325 Blast hits to 275 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 149; Fungi - 125; Plants - 34; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). 
AT2G30520AT2G30520.1TAAACGACGAlight inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis 
AT2G30520.2TAAACGACGAlight inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis 
AT2G30520.3TAAACGACGAlight inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis 
AT2G31670AT2G31670.1TCGTCGTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisome, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Stress responsive alpha-beta barrel (InterPro:IPR013097), Dimeric alpha-beta barrel (InterPro:IPR011008); BEST Arabidopsis thaliana protein match is: DABB1 (DIMERIC A/B BARREL DOMAINS-PROTEIN 1) (TAIR:AT1G51360.1); Has 138 Blast hits to 135 proteins in 38 species: Archae - 0; Bacteria - 51; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT2G33150AT2G33150.1GTCGTTTAEncodes an organellar (peroxisome, glyoxysome) 3-ketoacyl-CoA thiolase, involved in fatty acid b-oxidation during germination and subsequent seedling growth. Mutants have defects in glyoxysomal fatty acid beta-oxidation. EC2.3.1.16 thiolase. 
AT2G34250AT2G34250.1GTCGTTTAprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). 
AT2G34250.2GTCGTTTAprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). 
AT2G35320AT2G35320.1TAAACGACGCChomologue of the animal Eyes Absent genes. encodes a tyrosine-specific phosphatase. the protein sequence lacks the cys-containing signature of the classical tyrosine phosphatases. belongs to the aspartate-based phosphatases. The enzyme activity is strictly metal-dependent. 
AT2G38040AT2G38040.1TAAACGACACCencodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis 
AT2G38040.2TAAACGACACCencodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis 
AT2G38560AT2G38560.1GTCGTTTAEncodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy. 
AT2G39450AT2G39450.1GTCGTTTAEncodes a Golgi-localized manganese transporter that is involved in Mn tolerance. When expressed into yeast cells, this gene confer Mn<sup>2+</sup> and Cu<sup>2+</sup> tolerance. 
AT2G46490AT2G46490.1AACGGCGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35110.1); Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G01280AT3G01280.1TAAACGACGCCGTTTAEncodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. 
AT3G02080AT3G02080.1GGTGTCGTTTA40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae - 134; Bacteria - 4; Metazoa - 345; Fungi - 96; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT3G02090AT3G02090.1TAAACGACACCMPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT3G02090.2TAAACGACACCMPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT3G02700AT3G02700.1GGTGTCGTTTANC domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein (TAIR:AT5G16330.1); Has 105 Blast hits to 104 proteins in 28 species: Archae - 0; Bacteria - 23; Metazoa - 12; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT3G02710AT3G02710.1TAAACGACACCEncodes a protein with a putative role in mRNA splicing. 
AT3G02880AT3G02880.1GTCGTTTAleucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: anchored to plasma membrane, cell wall, plasma membrane, membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Transmembrane protein SKG6 (InterPro:IPR014805), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: LRR1; ATP binding / kinase/ protein serine/threonine kinase (TAIR:AT5G16590.1); Has 94595 Blast hits to 73516 proteins in 2606 species: Archae - 48; Bacteria - 5811; Metazoa - 32324; Fungi - 4897; Plants - 38717; Viruses - 264; Other Eukaryotes - 12534 (source: NCBI BLink). 
AT3G03040AT3G03040.1GTCGTTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G03030.1); Has 1188 Blast hits to 1151 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G04070AT3G04070.1TAAACGACAArabidopsis NAC domain containing protein 47 (anac047); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAM (NO APICAL MERISTEM); transcription factor (TAIR:AT1G52880.1); Has 1636 Blast hits to 1633 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1636; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G04070.2TAAACGACAArabidopsis NAC domain containing protein 47 (anac047); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAM (NO APICAL MERISTEM); transcription factor (TAIR:AT1G52880.1); Has 1636 Blast hits to 1633 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1636; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G07090AT3G07090.1TAAACGACGTCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25170.1); Has 596 Blast hits to 596 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 84; Plants - 173; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). 
AT3G07680AT3G07680.1GACGTCGTTTAemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 protein-related (TAIR:AT3G22845.1); Has 672 Blast hits to 672 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 151; Plants - 95; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). 
AT3G09690AT3G09690.1TAAACGACAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT3G09690.2TAAACGACAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT3G13190AT3G13190.1TAAACGACmyosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink). 
AT3G13190.2TAAACGACmyosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink). 
AT3G13190.3TAAACGACmyosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink). 
AT3G15150AT3G15150.1TGTCGTTTAzinc ion binding; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, MIZ-type (InterPro:IPR004181); Has 205 Blast hits to 205 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 36; Plants - 24; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT3G15160AT3G15160.1TAAACGACAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 67 Blast hits to 65 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT3G16750AT3G16750.1ACGGCGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4694 Blast hits to 1384 proteins in 164 species: Archae - 36; Bacteria - 1175; Metazoa - 1347; Fungi - 379; Plants - 64; Viruses - 23; Other Eukaryotes - 1670 (source: NCBI BLink). 
AT3G22430AT3G22430.1TAAACGACACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 493 Blast hits to 438 proteins in 88 species: Archae - 2; Bacteria - 43; Metazoa - 185; Fungi - 27; Plants - 37; Viruses - 4; Other Eukaryotes - 195 (source: NCBI BLink). 
AT3G23940AT3G23940.1TAAACGACAGCGTTTdehydratase family; FUNCTIONS IN: catalytic activity, dihydroxy-acid dehydratase activity; INVOLVED IN: branched chain family amino acid biosynthetic process, isoleucine biosynthetic process, metabolic process, valine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dihydroxy-acid dehydratase (InterPro:IPR004404), Dihydroxy-acid and 6-phosphogluconate dehydratase (InterPro:IPR000581); Has 10437 Blast hits to 10433 proteins in 1298 species: Archae - 138; Bacteria - 4265; Metazoa - 2; Fungi - 197; Plants - 21; Viruses - 0; Other Eukaryotes - 5814 (source: NCBI BLink). 
AT3G24140AT3G24140.1GTCGTTTAEncodes a basic helix-loop-helix transcription factor whose activity is required to promote differentiation of stomatal guard cells and to halt proliferative divisions in their immediate precursors. Both transcript and protein are expressed in and are required for halting divisions at the end of the stomatal lineage. It also has a role in the promotion of guard cell fate and in controlling the transition from guard mother cell to guard cell. 
AT3G24150AT3G24150.1TAAACGACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32295.1); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G24160AT3G24160.1TGTCGTTTAEncodes a putative Type 1 membrane protein (PMP). 
AT3G25920AT3G25920.1CGATGTCGTTTAencodes a plastid ribosomal protein CL15, a constituent of the large subunit of the ribosomal complex 
AT3G26580AT3G26580.1TAAACGACATCGINVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide region (InterPro:IPR013026); Has 2147 Blast hits to 1154 proteins in 168 species: Archae - 2; Bacteria - 99; Metazoa - 1301; Fungi - 180; Plants - 105; Viruses - 57; Other Eukaryotes - 403 (source: NCBI BLink). 
AT3G27020AT3G27020.1TAAACGACArabidopsis thaliana metal-nicotianamine transporter YSL6 
AT3G27060AT3G27060.1TGTCGTTTATACCCTTAEncodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development. 
AT3G48440AT3G48440.1TAAACGACAzinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT5G63260.1); Has 1145 Blast hits to 712 proteins in 117 species: Archae - 0; Bacteria - 0; Metazoa - 339; Fungi - 164; Plants - 533; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). 
AT3G49670AT3G49670.1TAAACGACEncodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM1,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM2 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. 
AT3G50590AT3G50590.1TTAAAGCCCATTTAGGCCCATTAAACGACAnucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink). 
AT3G51040AT3G51040.1TGTCGTTTAEncodes a protein of 231 amino acids with 51% identity to RTE1 over 209 amino acids. 
AT3G51040.2TGTCGTTTAEncodes a protein of 231 amino acids with 51% identity to RTE1 over 209 amino acids. 
AT3G51040.3TGTCGTTTAEncodes a protein of 231 amino acids with 51% identity to RTE1 over 209 amino acids. 
AT3G51050AT3G51050.1TAAACGACAFG-GAP repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell-matrix adhesion; LOCATED IN: integrin complex, integral to membrane, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FG-GAP (InterPro:IPR013517); Has 68 Blast hits to 63 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT3G51510AT3G51510.1TGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G51840AT3G51840.1TGTCGTTTAEncodes a short-chain acyl-CoA oxidase, which catalyzes the first step of peroxisomal fatty acid beta-oxidation during early, post-germinative growth in oilseed species. Null mutants virtually lack short-chain acyl-CoA and are resistant to 2,4-dichlorophenoxybutyric acid, which is converted to the herbicide and auxin analogue 2,4-dichlorophenoxyacetic acid by beta-oxidation. Despite the almost complete loss of short-chain activity, lipid catabolism and seedling growth and establishment was unaltered in the acx4 mutant. However, double mutants in acx3acx4 (acx3 encodes medium chain acyl CoA oxidase) were not viable and arrested during embryogenesis. 
AT3G56140AT3G56140.1TAAACGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF399 (InterPro:IPR007314); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40400.2); Has 354 Blast hits to 354 proteins in 86 species: Archae - 0; Bacteria - 111; Metazoa - 36; Fungi - 6; Plants - 172; Viruses - 6; Other Eukaryotes - 23 (source: NCBI BLink). 
AT3G57340AT3G57340.1TGTCGTTTADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink). 
AT3G57340.2TGTCGTTTADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink). 
AT3G60690AT3G60690.1GTCGTTTAauxin-responsive family protein; INVOLVED IN: response to auxin stimulus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein-related (TAIR:AT2G45210.1); Has 696 Blast hits to 685 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 695; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G61460AT3G61460.1ACGACACGATGTCGTTTAEncodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. 
AT3G62110AT3G62110.1TAAACGACAGCGTTTglycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT4G33440.1); Has 2594 Blast hits to 2590 proteins in 344 species: Archae - 2; Bacteria - 575; Metazoa - 8; Fungi - 1060; Plants - 840; Viruses - 2; Other Eukaryotes - 107 (source: NCBI BLink). 
AT3G63140AT3G63140.1TAAACGACGEncodes a protein with ribonuclease activity that is involved in plastid rRNA maturation. 
AT4G00530AT4G00530.1GGTGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G00530.1GTGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G01560AT4G01560.1ACGGCGTCGTTTAmaternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 218; Fungi - 225; Plants - 59; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT4G02210AT4G02210.1CGATGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 475 Blast hits to 288 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 463; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G02220AT4G02220.1TAAACGACAzinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320), Zinc finger, MYND-type (InterPro:IPR002893); BEST Arabidopsis thaliana protein match is: programmed cell death 2 C-terminal domain-containing protein (TAIR:AT5G64830.1); Has 702 Blast hits to 666 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 368; Fungi - 111; Plants - 110; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink). 
AT4G03430AT4G03430.1AAACGACGTCGTTTAEncodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. 
AT4G04190AT4G04190.1TAAACGACGTCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G04190.2TAAACGACGTCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G09040AT4G09040.1TAAACGACGTCRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). 
AT4G09040.2TAAACGACGTCRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink). 
AT4G10480AT4G10480.1TAAACGACnascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). 
AT4G10480.2TAAACGACnascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). 
AT4G10925AT4G10925.1TAAACGACGAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT4G10925.2TAAACGACGAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT4G12650AT4G12650.1CGTCGTTTALOCATED IN: integral to membrane, Golgi apparatus, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35160.1); Has 983 Blast hits to 980 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 434; Fungi - 144; Plants - 228; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT4G12720AT4G12720.1TAAACGACEncodes a protein with ADP-ribose hydrolase activity. Negatively regulates EDS1-conditioned plant defense and programmed cell death. 
AT4G12720.2TAAACGACEncodes a protein with ADP-ribose hydrolase activity. Negatively regulates EDS1-conditioned plant defense and programmed cell death. 
AT4G12720.3TAAACGACEncodes a protein with ADP-ribose hydrolase activity. Negatively regulates EDS1-conditioned plant defense and programmed cell death. 
AT4G14200AT4G14200.1TCGTCGTTTAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; Has 1311 Blast hits to 831 proteins in 209 species: Archae - 4; Bacteria - 342; Metazoa - 470; Fungi - 179; Plants - 56; Viruses - 0; Other Eukaryotes - 260 (source: NCBI BLink). 
AT4G14540AT4G14540.1TAAACGACANUCLEAR FACTOR Y, SUBUNIT B3 (NF-YB3); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB2 (NUCLEAR FACTOR Y, SUBUNIT B2); transcription factor (TAIR:AT5G47640.1); Has 1011 Blast hits to 1011 proteins in 186 species: Archae - 0; Bacteria - 1; Metazoa - 394; Fungi - 233; Plants - 298; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT4G14600AT4G14600.1TAAACGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G14780AT4G14780.1TGTCGTTTAprotein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G22750.1); Has 94189 Blast hits to 93089 proteins in 3475 species: Archae - 71; Bacteria - 8027; Metazoa - 41718; Fungi - 7876; Plants - 19036; Viruses - 588; Other Eukaryotes - 16873 (source: NCBI BLink). 
AT4G16710AT4G16710.1TAAACGACAGCGTTTglycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). 
AT4G16710.2TAAACGACAGCGTTTglycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). 
AT4G18130AT4G18130.1GTCGTTTAmember of Histidine Kinase 
AT4G18593AT4G18593.1TAAACGACAdual specificity protein phosphatase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 272 Blast hits to 272 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 76; Plants - 42; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). 
AT4G18970AT4G18970.1GTCGTTTAGDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT5G45670.1); Has 1923 Blast hits to 1908 proteins in 190 species: Archae - 0; Bacteria - 280; Metazoa - 1; Fungi - 53; Plants - 1568; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT4G19040AT4G19040.1GTCGTTTAEncodes a PH and START domain-containing protein that mediates resistance to pathogenic fungi. Resistance requires salicylic acid signalling. Mutants are resistant to E. cichoracearum. Expressed throughout plant tissues and possibly localized to membranes /mitochondrion. 
AT4G19040.2GTCGTTTAEncodes a PH and START domain-containing protein that mediates resistance to pathogenic fungi. Resistance requires salicylic acid signalling. Mutants are resistant to E. cichoracearum. Expressed throughout plant tissues and possibly localized to membranes /mitochondrion. 
AT4G20360AT4G20360.1TGTCGTTTAARABIDOPSIS RAB GTPASE HOMOLOG E1B (ATRABE1B); FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; INVOLVED IN: peptidyl-cysteine S-nitrosylation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, bacterial and organelle (InterPro:IPR004541), Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor Tu, putative / EF-Tu, putative (TAIR:AT4G02930.1); Has 60789 Blast hits to 60738 proteins in 12836 species: Archae - 775; Bacteria - 22875; Metazoa - 13447; Fungi - 6921; Plants - 1294; Viruses - 5; Other Eukaryotes - 15472 (source: NCBI BLink). 
AT4G22235AT4G22235.1TAAACGACGAEncodes a defensin-like (DEFL) family protein. 
AT4G22235.2TAAACGACGAEncodes a defensin-like (DEFL) family protein. 
AT4G22720AT4G22720.1TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTAglycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). 
AT4G22720.2TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTAglycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). 
AT4G25000AT4G25000.1CGTGTCGTTTAPredicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). 
AT4G25570AT4G25570.1GTCGTTTAEncodes cytochrome b561. 
AT4G27340AT4G27340.1GAAACGACGTCGTTTAMet-10+ like family protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function Met10 (InterPro:IPR003402); BEST Arabidopsis thaliana protein match is: Met-10+ like family protein (TAIR:AT3G56120.1); Has 1006 Blast hits to 996 proteins in 336 species: Archae - 244; Bacteria - 250; Metazoa - 158; Fungi - 92; Plants - 67; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink). 
AT4G27390AT4G27390.1TAAACGACGCGTTTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 63 Blast hits to 63 proteins in 30 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G27440AT4G27440.1TAAACGACGACGTGGCAGlight-dependent NADPH:protochlorophyllide oxidoreductase B 
AT4G27440.2TAAACGACGACGTGGCAGlight-dependent NADPH:protochlorophyllide oxidoreductase B 
AT4G27960AT4G27960.1TAAACGACGAubiquitin conjugating enzyme 
AT4G27960.2TAAACGACGAubiquitin conjugating enzyme 
AT4G29420AT4G29420.1GTCGTTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 44 Blast hits to 42 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT4G29430AT4G29430.1TAAACGACribosomal protein S15A E (rps15ae); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, mitochondrion, cytosolic ribosome, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: rps15ab (ribosomal protein S15A B); structural constituent of ribosome (TAIR:AT2G19720.1); Has 2257 Blast hits to 2257 proteins in 736 species: Archae - 184; Bacteria - 865; Metazoa - 322; Fungi - 130; Plants - 184; Viruses - 0; Other Eukaryotes - 572 (source: NCBI BLink). 
AT4G29860AT4G29860.1TAAACGACACGTAEncodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development. 
AT4G29870AT4G29870.1TACGTGTCGTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: membrane protein, putative (TAIR:AT2G19340.2); Has 163 Blast hits to 163 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT4G30260AT4G30260.1GAAACGACGTCGTTTAintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT2G18840.1); Has 733 Blast hits to 718 proteins in 145 species: Archae - 0; Bacteria - 8; Metazoa - 377; Fungi - 147; Plants - 99; Viruses - 4; Other Eukaryotes - 98 (source: NCBI BLink). 
AT4G30480AT4G30480.1ACGTCGTCGTTTAtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). 
AT4G30480.2ACGTCGTCGTTTAtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). 
AT4G30480.3ACGTCGTCGTTTAtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). 
AT4G32060AT4G32060.1TAAACGACGCCGTcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); Has 902 Blast hits to 878 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 729; Fungi - 55; Plants - 46; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). 
AT4G32060.2TAAACGACGCCGTcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); Has 902 Blast hits to 878 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 729; Fungi - 55; Plants - 46; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). 
AT4G32960AT4G32960.1TAAACGACGACGTCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32970.1); Has 78 Blast hits to 78 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT4G33880AT4G33880.1TAAACGACAAACGACAbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix protein / bHLH protein (TAIR:AT2G14760.1); Has 1879 Blast hits to 1802 proteins in 134 species: Archae - 0; Bacteria - 9; Metazoa - 175; Fungi - 34; Plants - 1499; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink). 
AT4G36945AT4G36945.1TAAACGACphospholipase C/ phosphoric diester hydrolase; FUNCTIONS IN: phospholipase C activity, phosphoric diester hydrolase activity; INVOLVED IN: intracellular signaling cascade, lipid metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Phospholipase C, phosphatidylinositol-specific , X region (InterPro:IPR000909), PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946); BEST Arabidopsis thaliana protein match is: phospholipase C/ phosphoric diester hydrolase (TAIR:AT3G19310.1); Has 282 Blast hits to 280 proteins in 57 species: Archae - 0; Bacteria - 36; Metazoa - 8; Fungi - 111; Plants - 78; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). 
AT4G37340AT4G37340.1TAAACGACTAATGGGCmember of CYP81D 
AT5G01110AT5G01110.1ACGTCGTCGTTTApentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05670.2); Has 28807 Blast hits to 6228 proteins in 193 species: Archae - 4; Bacteria - 24; Metazoa - 956; Fungi - 844; Plants - 25427; Viruses - 0; Other Eukaryotes - 1552 (source: NCBI BLink). 
AT5G01850AT5G01850.1TGACACGTGTCGTTTAprotein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Tyrosine-protein kinase, ATN1-like (InterPro:IPR015784); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT5G50180.1); Has 95530 Blast hits to 94330 proteins in 3583 species: Archae - 82; Bacteria - 8364; Metazoa - 42500; Fungi - 8087; Plants - 19045; Viruses - 483; Other Eukaryotes - 16969 (source: NCBI BLink). 
AT5G02502AT5G02502.1AAAACGACGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12587.1); Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G02740AT5G02740.1AAACGCTGTCGTTTAnucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G02740.2AAACGCTGTCGTTTAnucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G03230AT5G03230.1TGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G60680.1); Has 199 Blast hits to 199 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 195; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G03380AT5G03380.1ACGTCGTCGTTTAheavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink). 
AT5G03380.2ACGTCGTCGTTTAheavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink). 
AT5G03570AT5G03570.1TAAACGACGAEncodes a tonoplast localized nickel transport protein. 
AT5G05750AT5G05750.1TAAACGACACDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Tetratricopeptide region (InterPro:IPR013026), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT3G57340.2); Has 16636 Blast hits to 16631 proteins in 1960 species: Archae - 118; Bacteria - 5128; Metazoa - 3676; Fungi - 1518; Plants - 1246; Viruses - 21; Other Eukaryotes - 4929 (source: NCBI BLink). 
AT5G06160AT5G06160.1TAAACGACEncodes a protein with similarity to pre-mRNA splicing factor SF3a60 that is involved in gametic cell fate determination. Loss of function results in the ectopic expression of egg cell makers suggesting a role in restriction of gametic cell fate. Expressed strongly in gametophytes and weakly in sporophytes. 
AT5G09590AT5G09590.1TAAACGACGTCGTTTCheat shock protein 70 (Hsc70-5); nuclear 
AT5G11270AT5G11270.1TAAACGACACGEncodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance. 
AT5G11270.1TAAACGACGTCGTTTAEncodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance. 
AT5G11280AT5G11280.1TAAACGACGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80200.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G13280AT5G13280.1TAAACGACAGCGTTTTAAsp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH). 
AT5G13610AT5G13610.1TGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF155 (InterPro:IPR003734); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69380.1); Has 361 Blast hits to 361 proteins in 152 species: Archae - 0; Bacteria - 121; Metazoa - 21; Fungi - 154; Plants - 33; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). 
AT5G13810AT5G13810.1TAAACGACglutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT3G57070.1); Has 425 Blast hits to 425 proteins in 66 species: Archae - 0; Bacteria - 21; Metazoa - 92; Fungi - 4; Plants - 202; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). 
AT5G14440AT5G14440.1TAAACGACGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). 
AT5G14440.2TAAACGACGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). 
AT5G14920AT5G14920.1TAAACGACAgibberellin-regulated family protein; INVOLVED IN: response to gibberellin stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gibberellin regulated protein (InterPro:IPR003854); BEST Arabidopsis thaliana protein match is: GASA1 (GAST1 PROTEIN HOMOLOG 1) (TAIR:AT1G75750.1); Has 151936 Blast hits to 53318 proteins in 1948 species: Archae - 727; Bacteria - 29184; Metazoa - 60097; Fungi - 18534; Plants - 16149; Viruses - 5950; Other Eukaryotes - 21295 (source: NCBI BLink). 
AT5G14920.2TAAACGACAgibberellin-regulated family protein; INVOLVED IN: response to gibberellin stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gibberellin regulated protein (InterPro:IPR003854); BEST Arabidopsis thaliana protein match is: GASA1 (GAST1 PROTEIN HOMOLOG 1) (TAIR:AT1G75750.1); Has 151936 Blast hits to 53318 proteins in 1948 species: Archae - 727; Bacteria - 29184; Metazoa - 60097; Fungi - 18534; Plants - 16149; Viruses - 5950; Other Eukaryotes - 21295 (source: NCBI BLink). 
AT5G15400AT5G15400.1TAAACGACGTCGTTU-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 761 Blast hits to 744 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 440; Fungi - 133; Plants - 86; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). 
AT5G15450AT5G15450.1GGCGTCGTTTAEncodes a chloroplast-targeted Hsp101 homologue. Functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. APG6 expression is upregulated in response to heat shock in various organs, but not in response to other abiotic stresses. Apg6 mutants have a pale-green phenotype. 
AT5G16240AT5G16240.1GTCGTTTAacyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT3G02630.1); Has 575 Blast hits to 572 proteins in 129 species: Archae - 0; Bacteria - 208; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G18760AT5G18760.1TAAACGACAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G06330.1); Has 907 Blast hits to 907 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 439; Fungi - 68; Plants - 331; Viruses - 4; Other Eukaryotes - 65 (source: NCBI BLink). 
AT5G19860AT5G19860.1TAAACGACunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55265.1); Has 347 Blast hits to 347 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 346; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G20580AT5G20580.1TGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G06005.1); Has 124 Blast hits to 124 proteins in 54 species: Archae - 0; Bacteria - 16; Metazoa - 46; Fungi - 23; Plants - 24; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). 
AT5G20580.2TGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G06005.1); Has 124 Blast hits to 124 proteins in 54 species: Archae - 0; Bacteria - 16; Metazoa - 46; Fungi - 23; Plants - 24; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). 
AT5G20680AT5G20680.1TAAACGACunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64020.1); Has 994 Blast hits to 929 proteins in 72 species: Archae - 0; Bacteria - 4; Metazoa - 65; Fungi - 20; Plants - 706; Viruses - 7; Other Eukaryotes - 192 (source: NCBI BLink). 
AT5G20680.3TAAACGACunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64020.1); Has 994 Blast hits to 929 proteins in 72 species: Archae - 0; Bacteria - 4; Metazoa - 65; Fungi - 20; Plants - 706; Viruses - 7; Other Eukaryotes - 192 (source: NCBI BLink). 
AT5G23080AT5G23080.1GTCGTTTAInteracts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. 
AT5G23080.2GTCGTTTAInteracts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. 
AT5G23900AT5G23900.1CGATGTCGTTTA60S ribosomal protein L13 (RPL13D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13e, conserved site (InterPro:IPR018256), Ribosomal protein L13e (InterPro:IPR001380); BEST Arabidopsis thaliana protein match is: ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1); structural constituent of ribosome (TAIR:AT3G49010.3); Has 546 Blast hits to 546 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 113; Plants - 98; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT5G25630AT5G25630.1TGTCGTTTApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G21222.1); Has 19068 Blast hits to 5732 proteins in 184 species: Archae - 3; Bacteria - 21; Metazoa - 595; Fungi - 399; Plants - 17210; Viruses - 0; Other Eukaryotes - 840 (source: NCBI BLink). 
AT5G27120AT5G27120.1ACGACGTCGTTTASAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein 
AT5G27620AT5G27620.1TAAACGACATCGcore cell cycle genes 
AT5G38410AT5G38410.1TAAACGACGTribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT5G38410.2TAAACGACGTribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT5G38410.3TAAACGACGTribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT5G39950AT5G39950.1TAAACGACACGencodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. 
AT5G41150AT5G41150.1TAAACGACGCCGTTTTGAConfers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins 
AT5G41150.2TAAACGACGCCGTTTTGAConfers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins 
AT5G41940AT5G41940.1TAAACGACRabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1); Has 3483 Blast hits to 2868 proteins in 186 species: Archae - 2; Bacteria - 83; Metazoa - 1894; Fungi - 490; Plants - 337; Viruses - 5; Other Eukaryotes - 672 (source: NCBI BLink). 
AT5G42990AT5G42990.1TAAACGACACGTGTGAubiquitin-conjugating enzyme 18 (UBC18); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ATUBC2-1; ubiquitin-protein ligase (TAIR:AT1G45050.1); Has 6584 Blast hits to 6583 proteins in 298 species: Archae - 0; Bacteria - 0; Metazoa - 3149; Fungi - 1325; Plants - 1019; Viruses - 16; Other Eukaryotes - 1075 (source: NCBI BLink). 
AT5G43070AT5G43070.1TAAACGACACCWPP family members contains an NE targeting domain. This domain, called the WPP domain after a highly conserved Trp-Pro-Pro motif, is necessary and sufficient for NE targeting of WPP1. RNAi suppression of WPP1 resulted in reduced mitotic activity. 
AT5G47500AT5G47500.1TAAACGACpectinesterase family protein; FUNCTIONS IN: pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT5G19730.1); Has 1217 Blast hits to 1190 proteins in 176 species: Archae - 0; Bacteria - 260; Metazoa - 1; Fungi - 128; Plants - 828; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G50320AT5G50320.1CGATGTCGTTTAA subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Two lines with RNAi constructs directed against HAG3 grow normally and can produce root calli, but have defects in agrobacterium-mediated transformation. 
AT5G51720AT5G51720.1ACGACGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 215 Blast hits to 215 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT5G51760AT5G51760.1TAAACGACEncodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination. 
AT5G51810AT5G51810.1TGTCGTTTAEncodes gibberellin 20-oxidase. Involved in gibberellin biosynthesis. Up-regulated by far red light in elongating petioles. Not regulated by a circadian clock. 
AT5G54600AT5G54600.1GTGTCGTTTA50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). 
AT5G54600.2GTGTCGTTTA50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). 
AT5G55140AT5G55140.1CAAAACGCTGTCGTTTAribosomal protein L30 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L30, bacterial-type (InterPro:IPR005996), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); Has 388 Blast hits to 388 proteins in 155 species: Archae - 0; Bacteria - 328; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). 
AT5G55310AT5G55310.1TAAACGACGTCEncodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality. 
AT5G55670AT5G55670.1GTCGTTTARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT1G13190.1); Has 39714 Blast hits to 21553 proteins in 936 species: Archae - 21; Bacteria - 7210; Metazoa - 18978; Fungi - 3959; Plants - 3841; Viruses - 192; Other Eukaryotes - 5513 (source: NCBI BLink). 
AT5G57030AT5G57030.1TGTCGTTTALutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase 
AT5G57460AT5G57460.1TAAACGACATCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to 121 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT5G59850AT5G59850.1TAAACGACG40S ribosomal protein S15A (RPS15aF); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: RPS15A (ribosomal protein s15a); structural constituent of ribosome (TAIR:AT1G07770.2); Has 2190 Blast hits to 2190 proteins in 758 species: Archae - 184; Bacteria - 927; Metazoa - 327; Fungi - 130; Plants - 162; Viruses - 0; Other Eukaryotes - 460 (source: NCBI BLink). 
AT5G61410AT5G61410.1TAAACGACAArabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA 
AT5G61410.2TAAACGACAArabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA 
AT5G61900AT5G61900.1ACGTCGTTTAEncodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. 
AT5G61900.3ACGTCGTTTAEncodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. 
AT5G63630AT5G63630.1TGTCGTTTAACGGDEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase (RH26) (TAIR:AT5G08610.1); Has 27043 Blast hits to 26460 proteins in 1692 species: Archae - 431; Bacteria - 10802; Metazoa - 5031; Fungi - 3249; Plants - 1370; Viruses - 10; Other Eukaryotes - 6150 (source: NCBI BLink). 
AT5G64300AT5G64300.1TAAACGACGAencodes GTP cyclohydrolase II that can functionally complement E. coli mutant deficient in this gene. It also has 3,4-dihydroxy-2-butanone-4-phosphate synthase activity which makes it a bifunctional enzyme involved in the formation of the pyrimidine and of the carbohydrate from GTP and ribulose-5-phosphate, respectively 
AT5G65430AT5G65430.1AACGACGTCGTTTAmember of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 
AT5G65430.2AACGACGTCGTTTAmember of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 
ATCG00540ATCG00540.1TAAACGACEncodes cytochrome f apoprotein; involved in photosynthetic electron transport chain; encoded by the chloroplast genome and is transcriptionally repressed by a nuclear gene HCF2. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.