| Locus | Gene model | Sequence | Description |
| AT1G01500 | AT1G01500.1 | AGGGTATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02010 | AT1G02010.1 | TAAGGGTATT | member of KEULE Gene Family |
| AT1G02390 | AT1G02390.1 | AAGGGTATTT | Encodes a member of a family of proteins with glycerol-3-phosphate acyltransferase activity. |
| AT1G03370 | AT1G03370.1 | AAATACCCT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), GRAM (InterPro:IPR004182), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G03000.2); Has 36666 Blast hits to 23729 proteins in 1173 species: Archae - 306; Bacteria - 2687; Metazoa - 20823; Fungi - 2509; Plants - 2020; Viruses - 91; Other Eukaryotes - 8230 (source: NCBI BLink). |
| AT1G04930 | AT1G04930.1 | AATACCCTCAGGCCCAGATCGGCCCAAAA | hydroxyproline-rich glycoprotein family protein; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT2G32840.1); Has 1563 Blast hits to 1268 proteins in 183 species: Archae - 0; Bacteria - 127; Metazoa - 510; Fungi - 165; Plants - 332; Viruses - 182; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT1G04940 | AT1G04940.1 | TTTTGGGCCGATCTGGGCCTGAGGGTATT | Tic20 is believed to function as a component of the protein-conducting channel at the inner envelope membrane. Genes AT1G04940 and AT1G04945 were switched for the TAIR7 genome release to give consistency with MIPs annotation. |
| AT1G06290 | AT1G06290.1 | AAGGGTATTT | Encodes an acyl-CoA oxidase with specificity for medium chain fatty acids. |
| AT1G06410 | AT1G06410.1 | AAGGGTATT | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G07910 | AT1G07910.1 | AGGGTATTT | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains — an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component— that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo. |
| AT1G07910.2 | AGGGTATTT | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains — an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component— that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo. |
| AT1G12000 | AT1G12000.1 | AAATACCCTT | pyrophosphate--fructose-6-phosphate 1-phosphotransferase beta subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, beta-subunit complex, cell wall, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: MEE51 (maternal effect embryo arrest 51); diphosphate-fructose-6-phosphate 1-phosphotransferase (TAIR:AT4G04040.1); Has 3585 Blast hits to 3515 proteins in 1006 species: Archae - 20; Bacteria - 2321; Metazoa - 52; Fungi - 90; Plants - 237; Viruses - 2; Other Eukaryotes - 863 (source: NCBI BLink). |
| AT1G12440 | AT1G12440.1 | AAGGGTATTT | zinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G12040.2); Has 773 Blast hits to 766 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 388; Fungi - 2; Plants - 269; Viruses - 6; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G12440.2 | AAGGGTATTT | zinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G12040.2); Has 773 Blast hits to 766 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 388; Fungi - 2; Plants - 269; Viruses - 6; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G12640 | AT1G12640.1 | AGGGTATTT | membrane bound O-acyl transferase (MBOAT) family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane bound O-acyl transferase, MBOAT (InterPro:IPR004299); BEST Arabidopsis thaliana protein match is: membrane bound O-acyl transferase (MBOAT) family protein (TAIR:AT1G63050.1); Has 864 Blast hits to 862 proteins in 168 species: Archae - 0; Bacteria - 109; Metazoa - 536; Fungi - 94; Plants - 27; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT1G14380 | AT1G14380.1 | AGGGTATTT | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G14380.2 | AGGGTATTT | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G14380.3 | AGGGTATTT | IQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). |
| AT1G15230 | AT1G15230.1 | AATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G15240 | AT1G15240.1 | TAAGGGTATT | phox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: PX-associated, sorting nexin 13 (InterPro:IPR013996), Sorting nexin, C-terminal (InterPro:IPR013937), Phox-like (InterPro:IPR001683), Phox-associated domain (InterPro:IPR003114); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G15900.1). |
| AT1G15240.2 | TAAGGGTATT | phox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: PX-associated, sorting nexin 13 (InterPro:IPR013996), Sorting nexin, C-terminal (InterPro:IPR013937), Phox-like (InterPro:IPR001683), Phox-associated domain (InterPro:IPR003114); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G15900.1). |
| AT1G15350 | AT1G15350.1 | AATACCCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25360.1); Has 74 Blast hits to 74 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G15350.2 | AATACCCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25360.1); Has 74 Blast hits to 74 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G15350.3 | AATACCCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25360.1); Has 74 Blast hits to 74 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G18800 | AT1G18800.1 | AAATACCCTT | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP1. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. |
| AT1G20980 | AT1G20980.1 | AAATACCCT | Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. |
| AT1G22410 | AT1G22410.1 | AATACCCTTA | 2-dehydro-3-deoxyphosphoheptonate aldolase, putative / 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase, putative / DAHP synthetase, putative; FUNCTIONS IN: 3-deoxy-7-phosphoheptulonate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DAHP synthetase, class II (InterPro:IPR002480); BEST Arabidopsis thaliana protein match is: DHS1 (3-DEOXY-D-ARABINO-HEPTULOSONATE 7-PHOSPHATE SYNTHASE 1); 3-deoxy-7-phosphoheptulonate synthase (TAIR:AT4G39980.1); Has 3140 Blast hits to 3125 proteins in 395 species: Archae - 0; Bacteria - 662; Metazoa - 0; Fungi - 68; Plants - 129; Viruses - 0; Other Eukaryotes - 2281 (source: NCBI BLink). |
| AT1G24530 | AT1G24530.1 | AATACCCTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G24130.1); Has 34934 Blast hits to 16363 proteins in 585 species: Archae - 32; Bacteria - 4633; Metazoa - 14827; Fungi - 7171; Plants - 3064; Viruses - 0; Other Eukaryotes - 5207 (source: NCBI BLink). |
| AT1G26450 | AT1G26450.1 | AGGGTATT | beta-1,3-glucanase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946); BEST Arabidopsis thaliana protein match is: PDCB4 (PLASMODESMATA CALLOSE-BINDING PROTEIN 4); callose binding / polysaccharide binding (TAIR:AT1G69295.1); Has 10543 Blast hits to 2817 proteins in 330 species: Archae - 10; Bacteria - 555; Metazoa - 2513; Fungi - 887; Plants - 692; Viruses - 195; Other Eukaryotes - 5691 (source: NCBI BLink). |
| AT1G27090 | AT1G27090.1 | AAATACCCT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G24690.1); Has 12562 Blast hits to 6645 proteins in 564 species: Archae - 0; Bacteria - 1771; Metazoa - 5560; Fungi - 1132; Plants - 2457; Viruses - 75; Other Eukaryotes - 1567 (source: NCBI BLink). |
| AT1G27360 | AT1G27360.1 | AATACCCTT | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27360.2 | AATACCCTT | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27360.3 | AATACCCTT | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27360.4 | AATACCCTT | squamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27460 | AT1G27460.1 | AGGGTATTT | encodes a calmodulin-binding protein that is expressed in pollen, suspension culture cells, flowers, and fruits. |
| AT1G29418 | AT1G29418.1 | AATACCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT1G30130 | AT1G30130.1 | AAATACCCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1365 (InterPro:IPR010775); Has 1416 Blast hits to 1416 proteins in 265 species: Archae - 0; Bacteria - 477; Metazoa - 0; Fungi - 4; Plants - 20; Viruses - 0; Other Eukaryotes - 915 (source: NCBI BLink). |
| AT1G30130.2 | AAATACCCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1365 (InterPro:IPR010775); Has 1416 Blast hits to 1416 proteins in 265 species: Archae - 0; Bacteria - 477; Metazoa - 0; Fungi - 4; Plants - 20; Viruses - 0; Other Eukaryotes - 915 (source: NCBI BLink). |
| AT1G30880 | AT1G30880.1 | AAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G30890 | AT1G30890.1 | AATACCCTT | integral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT1G30890.2 | AATACCCTT | integral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). |
| AT1G34350 | AT1G34350.1 | TAAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 140 Blast hits to 140 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT1G49032 | AT1G49032.1 | AGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G51140 | AT1G51140.1 | AAGGGTATTT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42280.1); Has 1045 Blast hits to 1045 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 3; Plants - 1030; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT1G51160 | AT1G51160.1 | AGGGTATT | synbindin, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: cis-Golgi network; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sybindin-like protein (InterPro:IPR007233), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: synbindin, putative (TAIR:AT5G02280.1); Has 509 Blast hits to 509 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 149; Plants - 57; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink). |
| AT1G51160.2 | AGGGTATT | synbindin, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: cis-Golgi network; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sybindin-like protein (InterPro:IPR007233), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: synbindin, putative (TAIR:AT5G02280.1); Has 509 Blast hits to 509 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 149; Plants - 57; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink). |
| AT1G54970 | AT1G54970.1 | AATACCCT | encodes a proline-rich protein that is specifically expressed in the root. |
| AT1G55930 | AT1G55930.1 | TAAGGGTATT | CBS domain-containing protein / transporter associated domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Transporter-associated region (InterPro:IPR005170), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein / transporter associated domain-containing protein (TAIR:AT3G13070.1); Has 10142 Blast hits to 10142 proteins in 1411 species: Archae - 80; Bacteria - 6182; Metazoa - 215; Fungi - 97; Plants - 96; Viruses - 0; Other Eukaryotes - 3472 (source: NCBI BLink). |
| AT1G57790 | AT1G57790.1 | TAAGGGTATTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G56470.1); Has 329 Blast hits to 324 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 329; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G60550 | AT1G60550.1 | AAGGGTATTT | ENOYL-COA HYDRATASE/ISOMERASE D (ECHID); FUNCTIONS IN: naphthoate synthase activity, catalytic activity; INVOLVED IN: vitamin K biosynthetic process, metabolic process, menaquinone biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Enoyl-CoA hydratase/isomerase, conserved site (InterPro:IPR018376), Naphthoate synthase (InterPro:IPR010198), Crotonase, core (InterPro:IPR001753); BEST Arabidopsis thaliana protein match is: ECHIA (ENOYL-COA HYDRATASE/ISOMERASE A); catalytic (TAIR:AT4G16210.1); Has 24987 Blast hits to 24986 proteins in 1283 species: Archae - 197; Bacteria - 14016; Metazoa - 1333; Fungi - 490; Plants - 307; Viruses - 0; Other Eukaryotes - 8644 (source: NCBI BLink). |
| AT1G61010 | AT1G61010.1 | AAGGGTATTT | CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I (CPSF73-I); FUNCTIONS IN: protein binding; INVOLVED IN: mRNA polyadenylation; LOCATED IN: mRNA cleavage and polyadenylation specificity factor complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-metabolising metallo-beta-lactamase (InterPro:IPR011108), Beta-lactamase-like (InterPro:IPR001279); BEST Arabidopsis thaliana protein match is: ATCPSF73-II (cleavage and polyadenylation specificity factor 73 kDa subunit-II); catalytic/ protein binding (TAIR:AT2G01730.1); Has 3417 Blast hits to 3370 proteins in 847 species: Archae - 282; Bacteria - 1473; Metazoa - 527; Fungi - 183; Plants - 91; Viruses - 2; Other Eukaryotes - 859 (source: NCBI BLink). |
| AT1G61010.2 | AAGGGTATTT | CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I (CPSF73-I); FUNCTIONS IN: protein binding; INVOLVED IN: mRNA polyadenylation; LOCATED IN: mRNA cleavage and polyadenylation specificity factor complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-metabolising metallo-beta-lactamase (InterPro:IPR011108), Beta-lactamase-like (InterPro:IPR001279); BEST Arabidopsis thaliana protein match is: ATCPSF73-II (cleavage and polyadenylation specificity factor 73 kDa subunit-II); catalytic/ protein binding (TAIR:AT2G01730.1); Has 3417 Blast hits to 3370 proteins in 847 species: Archae - 282; Bacteria - 1473; Metazoa - 527; Fungi - 183; Plants - 91; Viruses - 2; Other Eukaryotes - 859 (source: NCBI BLink). |
| AT1G61010.3 | AAGGGTATTT | CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I (CPSF73-I); FUNCTIONS IN: protein binding; INVOLVED IN: mRNA polyadenylation; LOCATED IN: mRNA cleavage and polyadenylation specificity factor complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-metabolising metallo-beta-lactamase (InterPro:IPR011108), Beta-lactamase-like (InterPro:IPR001279); BEST Arabidopsis thaliana protein match is: ATCPSF73-II (cleavage and polyadenylation specificity factor 73 kDa subunit-II); catalytic/ protein binding (TAIR:AT2G01730.1); Has 3417 Blast hits to 3370 proteins in 847 species: Archae - 282; Bacteria - 1473; Metazoa - 527; Fungi - 183; Plants - 91; Viruses - 2; Other Eukaryotes - 859 (source: NCBI BLink). |
| AT1G61780 | AT1G61780.1 | AAGGGTATTTGCCGTTTACCGGAAA | postsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G63050 | AT1G63050.1 | AGGGTATT | membrane bound O-acyl transferase (MBOAT) family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Membrane bound O-acyl transferase, MBOAT (InterPro:IPR004299); BEST Arabidopsis thaliana protein match is: membrane bound O-acyl transferase (MBOAT) family protein (TAIR:AT1G12640.1); Has 817 Blast hits to 815 proteins in 154 species: Archae - 0; Bacteria - 65; Metazoa - 540; Fungi - 94; Plants - 27; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). |
| AT1G64585 | AT1G64585.1 | AGGGTATT | ROTUNDIFOLIA LIKE 22 (RTFL22); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: shoot development; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DVL (InterPro:IPR012552); Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G66070 | AT1G66070.1 | AATACCCTT | translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor eIF3 subunit (InterPro:IPR013906); BEST Arabidopsis thaliana protein match is: translation initiation factor-related (TAIR:AT5G37475.1); Has 336 Blast hits to 334 proteins in 124 species: Archae - 2; Bacteria - 9; Metazoa - 148; Fungi - 90; Plants - 45; Viruses - 1; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G67230 | AT1G67230.1 | AGGGTATTT | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. |
| AT1G67620 | AT1G67620.1 | TAAGGGTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Iojap-related protein (InterPro:IPR004394); Has 3104 Blast hits to 3104 proteins in 983 species: Archae - 0; Bacteria - 1779; Metazoa - 74; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink). |
| AT1G68340 | AT1G68340.1 | AAATACCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25370.1); Has 137 Blast hits to 137 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 135; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G69450 | AT1G69450.1 | AAATACCCT | LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: HYP1 (HYPOTHETICAL PROTEIN 1) (TAIR:AT3G01100.1); Has 911 Blast hits to 825 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 442; Plants - 243; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G72410 | AT1G72410.1 | AGGGTATT | COP1-interacting protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G17360.1); Has 12658 Blast hits to 8688 proteins in 500 species: Archae - 14; Bacteria - 773; Metazoa - 6078; Fungi - 1243; Plants - 387; Viruses - 26; Other Eukaryotes - 4137 (source: NCBI BLink). |
| AT1G73480 | AT1G73480.1 | TCTAGGGTATTT | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G18360.1); Has 3768 Blast hits to 3754 proteins in 932 species: Archae - 19; Bacteria - 2393; Metazoa - 125; Fungi - 106; Plants - 246; Viruses - 60; Other Eukaryotes - 819 (source: NCBI BLink). |
| AT1G74510 | AT1G74510.1 | AAATACCCTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT2G02870.3); Has 6157 Blast hits to 3278 proteins in 180 species: Archae - 4; Bacteria - 239; Metazoa - 4985; Fungi - 29; Plants - 576; Viruses - 33; Other Eukaryotes - 291 (source: NCBI BLink). |
| AT1G74510.2 | AAATACCCTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT2G02870.3); Has 6157 Blast hits to 3278 proteins in 180 species: Archae - 4; Bacteria - 239; Metazoa - 4985; Fungi - 29; Plants - 576; Viruses - 33; Other Eukaryotes - 291 (source: NCBI BLink). |
| AT1G75280 | AT1G75280.1 | TAAGGGTATT | isoflavone reductase, putative, identical to SP:P52577 Isoflavone reductase homolog P3 (EC 1.3.1.-) {Arabidopsis thaliana}; contains Pfam profile PF02716: isoflavone reductase. Involved in response to oxidative stress. |
| AT1G76480 | AT1G76480.1 | TAAGGGTATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20890.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G78570 | AT1G78570.1 | AAGGGTATTT | Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in <i>E. coli</i>. |
| AT2G02230 | AT2G02230.1 | TAAGGGTATT | Phloem protein 2-B1 (AtPP2-B1); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: MEE66 (maternal effect embryo arrest 66) (TAIR:AT2G02240.1); Has 319 Blast hits to 306 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 319; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G02960 | AT2G02960.1 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.2 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.3 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.4 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G02960.5 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT2G05840 | AT2G05840.1 | AAGGGTATTT | Encodes 20S proteasome subunit PAA2 (PAA2). |
| AT2G05840.2 | AAGGGTATTT | Encodes 20S proteasome subunit PAA2 (PAA2). |
| AT2G18770 | AT2G18770.1 | AAATACCCTT | signal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT5G05670.2); Has 734 Blast hits to 734 proteins in 177 species: Archae - 2; Bacteria - 55; Metazoa - 350; Fungi - 108; Plants - 88; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). |
| AT2G22000 | AT2G22000.1 | AAGGGTATTT | Elicitor peptide 6 precursor (PROPEP6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 10 Blast hits to 10 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G22670 | AT2G22670.1 | AATACCCTTA | IAA8 (IAA8) gene is auxin inducible. |
| AT2G22670.2 | AATACCCTTA | IAA8 (IAA8) gene is auxin inducible. |
| AT2G22670.3 | AATACCCTTA | IAA8 (IAA8) gene is auxin inducible. |
| AT2G24240 | AT2G24240.1 | AATACCCTT | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT4G30940.1); Has 748 Blast hits to 733 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 614; Fungi - 2; Plants - 67; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). |
| AT2G26140 | AT2G26140.1 | AAGGGTATTT | encodes an FtsH protease that is localized to the mitochondrion |
| AT2G28790 | AT2G28790.1 | AAGGGTATTT | osmotin-like protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G75800.1); Has 1026 Blast hits to 1010 proteins in 136 species: Archae - 0; Bacteria - 12; Metazoa - 47; Fungi - 55; Plants - 906; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT2G29580 | AT2G29580.1 | AGGGTATTT | zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT1G07360.1); Has 10655 Blast hits to 8392 proteins in 419 species: Archae - 8; Bacteria - 299; Metazoa - 5085; Fungi - 2309; Plants - 1897; Viruses - 119; Other Eukaryotes - 938 (source: NCBI BLink). |
| AT2G33480 | AT2G33480.1 | AATACCCT | Arabidopsis NAC domain containing protein 41 (ANAC041); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ANAC083 (ARABIDOPSIS NAC DOMAIN CONTAINING PROTEIN 83); transcription factor (TAIR:AT5G13180.1); Has 1670 Blast hits to 1660 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 2; Plants - 1622; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT2G33480.2 | AATACCCT | Arabidopsis NAC domain containing protein 41 (ANAC041); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ANAC083 (ARABIDOPSIS NAC DOMAIN CONTAINING PROTEIN 83); transcription factor (TAIR:AT5G13180.1); Has 1670 Blast hits to 1660 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 39; Fungi - 2; Plants - 1622; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT2G34250 | AT2G34250.1 | AATACCCT | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). |
| AT2G34250.2 | AATACCCT | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). |
| AT2G35020 | AT2G35020.1 | AAGGGTATT | UTP--glucose-1-phosphate uridylyltransferase family protein; FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UTP--glucose-1-phosphate uridylyltransferase (InterPro:IPR002618); BEST Arabidopsis thaliana protein match is: UDP-N-acetylglucosamine pyrophosphorylase-related (TAIR:AT1G31070.2); Has 1002 Blast hits to 999 proteins in 241 species: Archae - 0; Bacteria - 147; Metazoa - 371; Fungi - 175; Plants - 144; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink). |
| AT2G39570 | AT2G39570.1 | AATACCCT | ACT domain-containing protein; FUNCTIONS IN: amino acid binding; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: ACT domain-containing protein (TAIR:AT2G36840.1); Has 256 Blast hits to 222 proteins in 28 species: Archae - 0; Bacteria - 28; Metazoa - 0; Fungi - 0; Plants - 199; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT2G39780 | AT2G39780.1 | AAATACCCTTA | S-like ribonuclease |
| AT2G39780.2 | AAATACCCTTA | S-like ribonuclease |
| AT2G41410 | AT2G41410.1 | CCCATTTAATACCCT | calmodulin, putative; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT3G10190.1); Has 10198 Blast hits to 7608 proteins in 1056 species: Archae - 0; Bacteria - 38; Metazoa - 4396; Fungi - 1728; Plants - 2446; Viruses - 0; Other Eukaryotes - 1590 (source: NCBI BLink). |
| AT2G43710 | AT2G43710.1 | AAGGGTATTT | Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. |
| AT2G43710.2 | AAGGGTATTT | Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. |
| AT2G45720 | AT2G45720.1 | AAGGGTATT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT1G01830.3); Has 1636 Blast hits to 1049 proteins in 150 species: Archae - 2; Bacteria - 16; Metazoa - 365; Fungi - 196; Plants - 864; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). |
| AT2G45720.2 | AAGGGTATT | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT1G01830.3); Has 1636 Blast hits to 1049 proteins in 150 species: Archae - 2; Bacteria - 16; Metazoa - 365; Fungi - 196; Plants - 864; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). |
| AT2G47030 | AT2G47030.1 | AAATACCCTTA | VGDH1; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: male gametophyte, flower, pollen tube; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: VGD1 (VANGUARD1); enzyme inhibitor/ pectinesterase (TAIR:AT2G47040.1); Has 1439 Blast hits to 1399 proteins in 267 species: Archae - 0; Bacteria - 422; Metazoa - 1; Fungi - 130; Plants - 885; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G01330 | AT3G01330.1 | AGGGTATTT | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. |
| AT3G01450 | AT3G01450.1 | AGGGTATTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G14790.1); Has 188 Blast hits to 188 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 97; Fungi - 6; Plants - 61; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT3G05010 | AT3G05010.1 | AATACCCTT | transmembrane protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function, transmembrane-40 (InterPro:IPR018781); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G27210.1); Has 103 Blast hits to 103 proteins in 34 species: Archae - 0; Bacteria - 4; Metazoa - 71; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G06670 | AT3G06670.1 | TAAGGGTATT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Protein of unknown function DUF625 (InterPro:IPR006887); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49390.1); Has 2798 Blast hits to 2244 proteins in 244 species: Archae - 0; Bacteria - 63; Metazoa - 1367; Fungi - 471; Plants - 155; Viruses - 18; Other Eukaryotes - 724 (source: NCBI BLink). |
| AT3G07650 | AT3G07650.1 | GGGACCCACAATACCCT | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. |
| AT3G07650.2 | GGGACCCACAATACCCT | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. |
| AT3G07650.3 | GGGACCCACAATACCCT | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. |
| AT3G07650.4 | GGGACCCACAATACCCT | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. |
| AT3G09720 | AT3G09720.1 | AATACCCTTA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ethylene-responsive DEAD box RNA helicase, putative (RH30) (TAIR:AT5G63120.2); Has 31352 Blast hits to 30822 proteins in 1800 species: Archae - 599; Bacteria - 13582; Metazoa - 5089; Fungi - 3376; Plants - 1453; Viruses - 31; Other Eukaryotes - 7222 (source: NCBI BLink). |
| AT3G11510 | AT3G11510.1 | AGGGTATTT | 40S ribosomal protein S14 (RPS14B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971), Ribosomal S11, conserved site (InterPro:IPR018102); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S14 (RPS14A) (TAIR:AT2G36160.1); Has 6246 Blast hits to 6246 proteins in 1750 species: Archae - 169; Bacteria - 2829; Metazoa - 487; Fungi - 108; Plants - 517; Viruses - 0; Other Eukaryotes - 2136 (source: NCBI BLink). |
| AT3G12630 | AT3G12630.1 | AGGGTATT | zinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT1G51200.2); Has 750 Blast hits to 747 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 367; Fungi - 2; Plants - 264; Viruses - 6; Other Eukaryotes - 111 (source: NCBI BLink). |
| AT3G12830 | AT3G12830.1 | AAATACCCT | auxin-responsive family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive family protein (TAIR:AT1G56150.1); Has 606 Blast hits to 604 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 605; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G13750 | AT3G13750.1 | AATACCCT | beta-galactosidase, glycosyl hydrolase family 35 |
| AT3G14050 | AT3G14050.1 | AAGGGTATTT | RELA-SPOT HOMOLOG 2 (RSH2); FUNCTIONS IN: GTP diphosphokinase activity; INVOLVED IN: response to abscisic acid stimulus, response to wounding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674), Metal-dependent phosphohydrolase, HD region (InterPro:IPR003607), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH3 (RELA/SPOT HOMOLOG 3); GTP diphosphokinase (TAIR:AT1G54130.1); Has 8188 Blast hits to 8061 proteins in 1323 species: Archae - 2; Bacteria - 4464; Metazoa - 186; Fungi - 38; Plants - 129; Viruses - 2; Other Eukaryotes - 3367 (source: NCBI BLink). |
| AT3G14172 | AT3G14172.1 | AAGGGTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 2665 Blast hits to 1956 proteins in 215 species: Archae - 2; Bacteria - 189; Metazoa - 878; Fungi - 141; Plants - 132; Viruses - 5; Other Eukaryotes - 1318 (source: NCBI BLink). |
| AT3G15380 | AT3G15380.1 | AAATACCCTT | choline transporter-related; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF580 (InterPro:IPR007603); BEST Arabidopsis thaliana protein match is: choline transporter-related (TAIR:AT4G38640.1); Has 687 Blast hits to 679 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 406; Fungi - 83; Plants - 66; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT3G15620 | AT3G15620.1 | AAATACCCTTA | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
| AT3G15620.2 | AAATACCCTTA | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
| AT3G15630 | AT3G15630.1 | AAATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52720.1); Has 35 Blast hits to 35 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G17330 | AT3G17330.1 | AAGGGTATTT | evolutionarily conserved C-terminal region 6 (ECT6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT7 (evolutionarily conserved C-terminal region 7) (TAIR:AT1G48110.2); Has 715 Blast hits to 696 proteins in 119 species: Archae - 0; Bacteria - 2; Metazoa - 345; Fungi - 82; Plants - 210; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT3G19790 | AT3G19790.1 | AAATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G19790.2 | AAATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G20670 | AT3G20670.1 | AAGGGTATTT | Encodes HTA13, a histone H2A protein. |
| AT3G23230 | AT3G23230.1 | AAGGGTATT | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT3G25470 | AT3G25470.1 | TCTAGGGTATT | bacterial hemolysin-related; FUNCTIONS IN: RNA binding; INVOLVED IN: hemolysis by symbiont of host erythrocytes; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding S4 (InterPro:IPR002942), Ribosomal RNA methyltransferase RrmJ/FtsJ (InterPro:IPR002877), Haemolysin A (InterPro:IPR004538); Has 2208 Blast hits to 2200 proteins in 804 species: Archae - 6; Bacteria - 1525; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 657 (source: NCBI BLink). |
| AT3G26580 | AT3G26580.1 | AGGGTATTT | INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide region (InterPro:IPR013026); Has 2147 Blast hits to 1154 proteins in 168 species: Archae - 2; Bacteria - 99; Metazoa - 1301; Fungi - 180; Plants - 105; Viruses - 57; Other Eukaryotes - 403 (source: NCBI BLink). |
| AT3G27060 | AT3G27060.1 | AATACCCTT | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT3G52340 | AT3G52340.1 | AAGGGTATT | sucrose-phosphatase (SPP2) |
| AT3G52340.2 | AAGGGTATT | sucrose-phosphatase (SPP2) |
| AT3G52340.3 | AAGGGTATT | sucrose-phosphatase (SPP2) |
| AT3G56200 | AT3G56200.1 | AAGGGTATTT | Encodes a putative amino acid transporter. |
| AT3G59540 | AT3G59540.1 | AAATACCCTT | 60S ribosomal protein L38 (RPL38B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L38e (InterPro:IPR002675); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L38 (RPL38A) (TAIR:AT2G43460.1); Has 458 Blast hits to 458 proteins in 191 species: Archae - 3; Bacteria - 0; Metazoa - 220; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT3G59660 | AT3G59660.1 | AAGGGTATTT | C2 domain-containing protein / GRAM domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), GRAM (InterPro:IPR004182), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: VAD1 (VASCULAR ASSOCIATED DEATH1) (TAIR:AT1G02120.1); Has 2203 Blast hits to 1975 proteins in 157 species: Archae - 0; Bacteria - 0; Metazoa - 1394; Fungi - 230; Plants - 395; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G60860 | AT3G60860.1 | AAGGGTATTT | guanine nucleotide exchange family protein; FUNCTIONS IN: binding, ARF guanyl-nucleotide exchange factor activity, guanyl-nucleotide exchange factor activity; INVOLVED IN: regulation of ARF protein signal transduction; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SEC7-like (InterPro:IPR000904), Armadillo-type fold (InterPro:IPR016024), Protein of unknown function DUF1981, SEC7 associated (InterPro:IPR015403); BEST Arabidopsis thaliana protein match is: EDA10 (embryo sac development arrest 10); ARF guanyl-nucleotide exchange factor/ binding / guanyl-nucleotide exchange factor (TAIR:AT1G01960.1); Has 2220 Blast hits to 2027 proteins in 177 species: Archae - 0; Bacteria - 24; Metazoa - 1229; Fungi - 446; Plants - 144; Viruses - 0; Other Eukaryotes - 377 (source: NCBI BLink). |
| AT4G02715 | AT4G02715.1 | AAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 22 Blast hits to 22 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G03000 | AT4G03000.1 | AAATACCCT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G03370.1); Has 39923 Blast hits to 24215 proteins in 1366 species: Archae - 304; Bacteria - 4238; Metazoa - 19569; Fungi - 2590; Plants - 1247; Viruses - 219; Other Eukaryotes - 11756 (source: NCBI BLink). |
| AT4G03000.2 | AAATACCCT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G03370.1); Has 39923 Blast hits to 24215 proteins in 1366 species: Archae - 304; Bacteria - 4238; Metazoa - 19569; Fungi - 2590; Plants - 1247; Viruses - 219; Other Eukaryotes - 11756 (source: NCBI BLink). |
| AT4G09000 | AT4G09000.1 | AAATACCCTT | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G09000.2 | AAATACCCTT | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G10310 | AT4G10310.1 | AAATACCCTT | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
| AT4G10925 | AT4G10925.1 | AATACCCTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G10925.2 | AATACCCTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G13100 | AT4G13100.1 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, calmodulin binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G25030.2); Has 401 Blast hits to 397 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 12; Plants - 97; Viruses - 14; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G13100.3 | AAATACCCTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, calmodulin binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G25030.2); Has 401 Blast hits to 397 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 12; Plants - 97; Viruses - 14; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G13830 | AT4G13830.1 | AAATACCCTT | DnaJ-like protein (J20); nuclear gene |
| AT4G13830.2 | AAATACCCTT | DnaJ-like protein (J20); nuclear gene |
| AT4G16070 | AT4G16070.1 | AATACCCTT | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity, carboxylesterase activity; INVOLVED IN: lipid catabolic process, lipid metabolic process; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT3G14075.1); Has 2035 Blast hits to 1241 proteins in 172 species: Archae - 0; Bacteria - 55; Metazoa - 1126; Fungi - 205; Plants - 189; Viruses - 42; Other Eukaryotes - 418 (source: NCBI BLink). |
| AT4G16410 | AT4G16410.1 | AAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF751 (InterPro:IPR008470); Has 136 Blast hits to 136 proteins in 35 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT4G22300 | AT4G22300.1 | AGGGTATTT | encodes a carboxylesterase that inhibits AvrBsT-triggered phenotypes in Arabidopsis |
| AT4G22310 | AT4G22310.1 | AAATACCCT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14695.1); Has 630 Blast hits to 630 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 302; Fungi - 164; Plants - 96; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT4G22350 | AT4G22350.1 | AGGGTATT | ubiquitin carboxyl-terminal hydrolase family protein; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase/ zinc ion binding (TAIR:AT4G22285.1); Has 2784 Blast hits to 2384 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1738; Fungi - 374; Plants - 244; Viruses - 0; Other Eukaryotes - 428 (source: NCBI BLink). |
| AT4G22360 | AT4G22360.1 | AATACCCT | SWIB complex BAF60b domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121), DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: SWIB complex BAF60b domain-containing protein (TAIR:AT3G19080.1); Has 1341 Blast hits to 971 proteins in 185 species: Archae - 0; Bacteria - 229; Metazoa - 293; Fungi - 295; Plants - 306; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink). |
| AT4G23300 | AT4G23300.1 | AGGGTATT | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF26 (InterPro:IPR002902), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G23210.3); Has 74876 Blast hits to 74108 proteins in 2144 species: Archae - 39; Bacteria - 6131; Metazoa - 33159; Fungi - 5443; Plants - 17687; Viruses - 303; Other Eukaryotes - 12114 (source: NCBI BLink). |
| AT4G23330 | AT4G23330.1 | AAGGGTATT | eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: EIF3A (EUKARYOTIC TRANSLATION INITIATION FACTOR 3A); translation initiation factor (TAIR:AT4G11420.1); Has 31 Blast hits to 25 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G26780 | AT4G26780.1 | AATACCCT | unknown function |
| AT4G28880 | AT4G28880.1 | AAATACCCT | Casein Kinase I-like 3 (ckl3); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl4 (Casein Kinase I-like 4); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28860.1); Has 47686 Blast hits to 47386 proteins in 1403 species: Archae - 19; Bacteria - 6033; Metazoa - 20862; Fungi - 4890; Plants - 5655; Viruses - 307; Other Eukaryotes - 9920 (source: NCBI BLink). |
| AT4G31990 | AT4G31990.1 | AAGGGTATT | encodes a plastid-localized aspartate aminotransferase |
| AT4G31990.2 | AAGGGTATT | encodes a plastid-localized aspartate aminotransferase |
| AT4G31990.3 | AAGGGTATT | encodes a plastid-localized aspartate aminotransferase |
| AT4G32350 | AT4G32350.1 | AAATACCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G79910.1); Has 2466 Blast hits to 1931 proteins in 180 species: Archae - 0; Bacteria - 43; Metazoa - 915; Fungi - 124; Plants - 233; Viruses - 5; Other Eukaryotes - 1146 (source: NCBI BLink). |
| AT4G34412 | AT4G34412.1 | AATACCCT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Kinase binding protein CGI-121 (InterPro:IPR013926); Has 194 Blast hits to 194 proteins in 96 species: Archae - 0; Bacteria - 4; Metazoa - 78; Fungi - 77; Plants - 19; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT4G36690 | AT4G36690.1 | AAATACCCT | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). |
| AT4G36690.2 | AAATACCCT | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). |
| AT4G36690.3 | AAATACCCT | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). |
| AT4G37420 | AT4G37420.1 | TAAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27200.1); Has 141 Blast hits to 141 proteins in 46 species: Archae - 0; Bacteria - 74; Metazoa - 0; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT4G39235 | AT4G39235.1 | AATACCCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G05570.1); Has 39 Blast hits to 39 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G39950 | AT4G39950.1 | TAAGGGTATT | Belongs to cytochrome P450 and is involved in tryptophan metabolism. Converts Trp to indo-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. |
| AT5G01820 | AT5G01820.1 | AAATACCCT | Encodes a CBL-interacting serine/threonine protein kinase. |
| AT5G02870 | AT5G02870.1 | AATACCCTT | 60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT5G02870.2 | AATACCCTT | 60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT5G04140 | AT5G04140.1 | AAATACCCTT | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. |
| AT5G04140.2 | AAATACCCTT | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. |
| AT5G05200 | AT5G05200.1 | TAAGGGTATTT | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink). |
| AT5G05210 | AT5G05210.1 | AAATACCCTTA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). |
| AT5G05210.2 | AAATACCCTTA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). |
| AT5G09540 | AT5G09540.1 | AAATACCCTTA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding, response to salt stress; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G64360.4); Has 752 Blast hits to 732 proteins in 227 species: Archae - 8; Bacteria - 304; Metazoa - 100; Fungi - 51; Plants - 254; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT5G12900 | AT5G12900.1 | AGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G12330.1); Has 278 Blast hits to 272 proteins in 46 species: Archae - 0; Bacteria - 26; Metazoa - 55; Fungi - 10; Plants - 146; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT5G14910 | AT5G14910.1 | AAGGGTATTT | heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G16400 | AT5G16400.1 | AGGGTATT | Encodes an f-type thioredoxin (Trx-f2) localized in chloroplast stroma. |
| AT5G18630 | AT5G18630.1 | AATACCCTT | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT5G18630.2 | AATACCCTT | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT5G18630.3 | AATACCCTT | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT5G19140 | AT5G19140.1 | AAATACCCT | AILP1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to aluminum ion, response to auxin stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43830.1); Has 1128 Blast hits to 1128 proteins in 380 species: Archae - 4; Bacteria - 553; Metazoa - 42; Fungi - 34; Plants - 256; Viruses - 3; Other Eukaryotes - 236 (source: NCBI BLink). |
| AT5G19140.2 | AAATACCCT | AILP1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to aluminum ion, response to auxin stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43830.1); Has 1128 Blast hits to 1128 proteins in 380 species: Archae - 4; Bacteria - 553; Metazoa - 42; Fungi - 34; Plants - 256; Viruses - 3; Other Eukaryotes - 236 (source: NCBI BLink). |
| AT5G19380 | AT5G19380.1 | AAATACCCTT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12170.2). |
| AT5G19380.2 | AAATACCCTT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12170.2). |
| AT5G26690 | AT5G26690.1 | AAATACCCT | heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT3G05920.1); Has 427 Blast hits to 409 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 427; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G27740 | AT5G27740.1 | AATACCCTTA | EMBRYO DEFECTIVE 2775 (EMB2775); FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding; INVOLVED IN: DNA replication; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA polymerase III clamp loader subunit, C-terminal (InterPro:IPR008921); BEST Arabidopsis thaliana protein match is: emb1968 (embryo defective 1968); ATP binding / ATPase/ DNA binding / DNA clamp loader/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT1G21690.1); Has 8053 Blast hits to 8003 proteins in 1440 species: Archae - 377; Bacteria - 2705; Metazoa - 463; Fungi - 373; Plants - 162; Viruses - 67; Other Eukaryotes - 3906 (source: NCBI BLink). |
| AT5G41020 | AT5G41020.1 | AAATACCCT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), MYB-like (InterPro:IPR017877), Myb transcription factor (InterPro:IPR015495); Has 98187 Blast hits to 47692 proteins in 1520 species: Archae - 162; Bacteria - 7831; Metazoa - 42063; Fungi - 10642; Plants - 4096; Viruses - 488; Other Eukaryotes - 32905 (source: NCBI BLink). |
| AT5G41030 | AT5G41030.1 | AGGGTATTT | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: AT-TCP20; transcription factor (TAIR:AT3G27010.1); Has 186 Blast hits to 186 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 185; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G46440 | AT5G46440.1 | GGCCTAAGGGTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46460.1); Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G47120 | AT5G47120.1 | TAAGGGTATT | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. |
| AT5G47310 | AT5G47310.1 | AATACCCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17486.1); Has 573 Blast hits to 573 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 193; Fungi - 56; Plants - 187; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). |
| AT5G47620 | AT5G47620.1 | AAATACCCT | heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative (TAIR:AT3G07810.2); Has 23293 Blast hits to 15299 proteins in 650 species: Archae - 8; Bacteria - 2009; Metazoa - 12878; Fungi - 2200; Plants - 3758; Viruses - 0; Other Eukaryotes - 2440 (source: NCBI BLink). |
| AT5G47620.2 | AAATACCCT | heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative (TAIR:AT3G07810.2); Has 23293 Blast hits to 15299 proteins in 650 species: Archae - 8; Bacteria - 2009; Metazoa - 12878; Fungi - 2200; Plants - 3758; Viruses - 0; Other Eukaryotes - 2440 (source: NCBI BLink). |
| AT5G47620.3 | AAATACCCT | heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative (TAIR:AT3G07810.2); Has 23293 Blast hits to 15299 proteins in 650 species: Archae - 8; Bacteria - 2009; Metazoa - 12878; Fungi - 2200; Plants - 3758; Viruses - 0; Other Eukaryotes - 2440 (source: NCBI BLink). |
| AT5G47720 | AT5G47720.1 | AGGGTATTT | acetyl-CoA C-acyltransferase, putative / 3-ketoacyl-CoA thiolase, putative; FUNCTIONS IN: acetyl-CoA C-acetyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase-like (InterPro:IPR016039), Thiolase (InterPro:IPR002155), Thiolase-like, subgroup (InterPro:IPR016038); BEST Arabidopsis thaliana protein match is: ACAT2 (ACETOACETYL-COA THIOLASE 2); acetyl-CoA C-acetyltransferase/ catalytic (TAIR:AT5G48230.2); Has 16032 Blast hits to 16016 proteins in 1334 species: Archae - 254; Bacteria - 8419; Metazoa - 813; Fungi - 434; Plants - 145; Viruses - 0; Other Eukaryotes - 5967 (source: NCBI BLink). |
| AT5G47720.2 | AGGGTATTT | acetyl-CoA C-acyltransferase, putative / 3-ketoacyl-CoA thiolase, putative; FUNCTIONS IN: acetyl-CoA C-acetyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase-like (InterPro:IPR016039), Thiolase (InterPro:IPR002155), Thiolase-like, subgroup (InterPro:IPR016038); BEST Arabidopsis thaliana protein match is: ACAT2 (ACETOACETYL-COA THIOLASE 2); acetyl-CoA C-acetyltransferase/ catalytic (TAIR:AT5G48230.2); Has 16032 Blast hits to 16016 proteins in 1334 species: Archae - 254; Bacteria - 8419; Metazoa - 813; Fungi - 434; Plants - 145; Viruses - 0; Other Eukaryotes - 5967 (source: NCBI BLink). |
| AT5G47720.3 | AGGGTATTT | acetyl-CoA C-acyltransferase, putative / 3-ketoacyl-CoA thiolase, putative; FUNCTIONS IN: acetyl-CoA C-acetyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase-like (InterPro:IPR016039), Thiolase (InterPro:IPR002155), Thiolase-like, subgroup (InterPro:IPR016038); BEST Arabidopsis thaliana protein match is: ACAT2 (ACETOACETYL-COA THIOLASE 2); acetyl-CoA C-acetyltransferase/ catalytic (TAIR:AT5G48230.2); Has 16032 Blast hits to 16016 proteins in 1334 species: Archae - 254; Bacteria - 8419; Metazoa - 813; Fungi - 434; Plants - 145; Viruses - 0; Other Eukaryotes - 5967 (source: NCBI BLink). |
| AT5G47720.4 | AGGGTATTT | acetyl-CoA C-acyltransferase, putative / 3-ketoacyl-CoA thiolase, putative; FUNCTIONS IN: acetyl-CoA C-acetyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase-like (InterPro:IPR016039), Thiolase (InterPro:IPR002155), Thiolase-like, subgroup (InterPro:IPR016038); BEST Arabidopsis thaliana protein match is: ACAT2 (ACETOACETYL-COA THIOLASE 2); acetyl-CoA C-acetyltransferase/ catalytic (TAIR:AT5G48230.2); Has 16032 Blast hits to 16016 proteins in 1334 species: Archae - 254; Bacteria - 8419; Metazoa - 813; Fungi - 434; Plants - 145; Viruses - 0; Other Eukaryotes - 5967 (source: NCBI BLink). |
| AT5G47720.5 | AGGGTATTT | acetyl-CoA C-acyltransferase, putative / 3-ketoacyl-CoA thiolase, putative; FUNCTIONS IN: acetyl-CoA C-acetyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase-like (InterPro:IPR016039), Thiolase (InterPro:IPR002155), Thiolase-like, subgroup (InterPro:IPR016038); BEST Arabidopsis thaliana protein match is: ACAT2 (ACETOACETYL-COA THIOLASE 2); acetyl-CoA C-acetyltransferase/ catalytic (TAIR:AT5G48230.2); Has 16032 Blast hits to 16016 proteins in 1334 species: Archae - 254; Bacteria - 8419; Metazoa - 813; Fungi - 434; Plants - 145; Viruses - 0; Other Eukaryotes - 5967 (source: NCBI BLink). |
| AT5G48460 | AT5G48460.1 | AAATACCCT | fimbrin-like protein, putative; FUNCTIONS IN: actin binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Actinin-type, actin-binding, conserved site (InterPro:IPR001589), Calponin-homology (InterPro:IPR016146), Calponin-like actin-binding (InterPro:IPR001715); BEST Arabidopsis thaliana protein match is: FIM2 (FIMBRIN-LIKE PROTEIN 2); actin binding (TAIR:AT5G35700.1); Has 2573 Blast hits to 1976 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 2069; Fungi - 216; Plants - 75; Viruses - 0; Other Eukaryotes - 213 (source: NCBI BLink). |
| AT5G48490 | AT5G48490.1 | AATACCCT | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: DIR1 (DEFECTIVE IN INDUCED RESISTANCE 1); lipid binding / lipid transporter (TAIR:AT5G48485.1); Has 118 Blast hits to 118 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 118; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G51160 | AT5G51160.1 | AAATACCCT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.2); Has 19441 Blast hits to 9219 proteins in 402 species: Archae - 30; Bacteria - 1030; Metazoa - 11449; Fungi - 756; Plants - 1298; Viruses - 45; Other Eukaryotes - 4833 (source: NCBI BLink). |
| AT5G55640 | AT5G55640.1 | TAAGGGTATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 59 Blast hits to 59 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G57050 | AT5G57050.1 | AAATACCCTT | Encodes a protein phosphatase 2C and is involved in ABA signal transduction. Binds fibrillin preprotein in vitro and in vivo. |
| AT5G57050.2 | AAATACCCTT | Encodes a protein phosphatase 2C and is involved in ABA signal transduction. Binds fibrillin preprotein in vitro and in vivo. |
| AT5G58420 | AT5G58420.1 | ATAAGCCCATAATACCCT | 40S ribosomal protein S4 (RPS4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 941 Blast hits to 941 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). |
| AT5G60160 | AT5G60160.1 | AAGGGTATTT | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: response to cadmium ion, proteolysis; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G04710.1); Has 1278 Blast hits to 1277 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 41; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT5G62500 | AT5G62500.1 | AATACCCT | encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
| AT5G63310 | AT5G63310.1 | AAGGGTATTT | Maintains intracellular dNTP levels except ATP. Plays a role in response to oxidative stress and UV. Involved in phytochrome-mediated light signaling. Participates in auxin-regulated processes, partly through the modulation of auxin transport. H-bonding with His-197 inside the nucleotide-binding pocket is critical for NDPK2 functioning. |
| AT5G63810 | AT5G63810.1 | AAGGGTATTT | member of Glycoside Hydrolase Family 35 |
| AT5G65830 | AT5G65830.1 | AATACCCTTA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP44 (Receptor Like Protein 44); protein binding (TAIR:AT3G49750.1); Has 35662 Blast hits to 8354 proteins in 444 species: Archae - 26; Bacteria - 823; Metazoa - 1315; Fungi - 106; Plants - 31516; Viruses - 0; Other Eukaryotes - 1876 (source: NCBI BLink). |