version

Summary of AtREG568 (All List)

OrganismArabidopsis thaliana  
IDAtREG568  
SequenceAAACCGAA  
Annotation  
PPDB MotifAACCG(G/A)  overlapping GT1 box  
PLACE Motif 
Total Entry Count859  

Entry Sequences (859 entries)

LocusGene modelSequenceDescription
AT1G03040AT1G03040.1AAACCGAAbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, acetyl-CoA biosynthetic process from pyruvate; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: UNE12 (unfertilized embryo sac 12); DNA binding / transcription factor (TAIR:AT4G02590.2); Has 1617 Blast hits to 1617 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 0; Plants - 1602; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G04340AT1G04340.1CGGTTCAATTCGGTTTAGlesion inducing protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HR-like lesion-inducer (InterPro:IPR008637); BEST Arabidopsis thaliana protein match is: lesion inducing protein-related (TAIR:AT5G43460.1); Has 99 Blast hits to 99 proteins in 21 species: Archae - 0; Bacteria - 13; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G04340.1TTCGGTTTAAlesion inducing protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HR-like lesion-inducer (InterPro:IPR008637); BEST Arabidopsis thaliana protein match is: lesion inducing protein-related (TAIR:AT5G43460.1); Has 99 Blast hits to 99 proteins in 21 species: Archae - 0; Bacteria - 13; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G04350AT1G04350.1TTAAACCGAAencodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase 
AT1G04530AT1G04530.1TTAAACCGAAbinding; FUNCTIONS IN: binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G17940.1); Has 445 Blast hits to 236 proteins in 47 species: Archae - 10; Bacteria - 76; Metazoa - 30; Fungi - 6; Plants - 278; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). 
AT1G04820AT1G04820.1TTCGGTTTACEncodes an alpha tubulin isoform that is expressed in roots, leaves and flowers. 
AT1G04900AT1G04900.1AAACCGAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF185 (InterPro:IPR003788); Has 159 Blast hits to 155 proteins in 81 species: Archae - 0; Bacteria - 35; Metazoa - 2; Fungi - 68; Plants - 25; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT1G05205AT1G05205.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G05270AT1G05270.1GTAAACCGAATraB family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pheromone shutdown-related, TraB (InterPro:IPR002816); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32340.1); Has 515 Blast hits to 497 proteins in 174 species: Archae - 89; Bacteria - 148; Metazoa - 111; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). 
AT1G05360AT1G05360.1ATAACCGGTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT1G05430AT1G05430.1GTTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G05430.1GTTCGGTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G05805AT1G05805.1TTCGGTTTAAbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT2G43140.1); Has 2445 Blast hits to 1444 proteins in 113 species: Archae - 2; Bacteria - 55; Metazoa - 778; Fungi - 140; Plants - 840; Viruses - 0; Other Eukaryotes - 630 (source: NCBI BLink). 
AT1G05830AT1G05830.1ATAAACCGAAEncodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1. 
AT1G05830.2ATAAACCGAAEncodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1. 
AT1G06130AT1G06130.1TTCGGTTTAGglyoxalase 2-4 (GLX2-4); FUNCTIONS IN: hydrolase activity, hydroxyacylglutathione hydrolase activity, zinc ion binding; INVOLVED IN: methylglyoxal catabolic process to D-lactate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279), Hydroxyacylglutathione hydrolase (InterPro:IPR017782); BEST Arabidopsis thaliana protein match is: GLX2-5 (GLYOXALASE 2-5); hydroxyacylglutathione hydrolase/ iron ion binding / zinc ion binding (TAIR:AT2G31350.1); Has 10413 Blast hits to 10412 proteins in 1392 species: Archae - 227; Bacteria - 5412; Metazoa - 429; Fungi - 200; Plants - 123; Viruses - 0; Other Eukaryotes - 4022 (source: NCBI BLink). 
AT1G06130.2TTCGGTTTAGglyoxalase 2-4 (GLX2-4); FUNCTIONS IN: hydrolase activity, hydroxyacylglutathione hydrolase activity, zinc ion binding; INVOLVED IN: methylglyoxal catabolic process to D-lactate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279), Hydroxyacylglutathione hydrolase (InterPro:IPR017782); BEST Arabidopsis thaliana protein match is: GLX2-5 (GLYOXALASE 2-5); hydroxyacylglutathione hydrolase/ iron ion binding / zinc ion binding (TAIR:AT2G31350.1); Has 10413 Blast hits to 10412 proteins in 1392 species: Archae - 227; Bacteria - 5412; Metazoa - 429; Fungi - 200; Plants - 123; Viruses - 0; Other Eukaryotes - 4022 (source: NCBI BLink). 
AT1G06190AT1G06190.1TTAAACCGAACCGGATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink). 
AT1G06190.1TTCGGTTTGGATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink). 
AT1G06190.2TTAAACCGAACCGGATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink). 
AT1G06190.2TTCGGTTTGGATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink). 
AT1G06650AT1G06650.1TTCGGTTTAGencodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase 
AT1G06650.2TTCGGTTTAGencodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase 
AT1G06790AT1G06790.1GTTCGGTTCGGTTTATRNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G06790.2GTTCGGTTCGGTTTATRNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G07740AT1G07740.1TTCGGTTTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G16420.1); Has 17393 Blast hits to 5340 proteins in 166 species: Archae - 2; Bacteria - 16; Metazoa - 507; Fungi - 290; Plants - 15901; Viruses - 0; Other Eukaryotes - 677 (source: NCBI BLink). 
AT1G07770AT1G07770.1TTCGGTTTACEncodes cytoplasmic ribosomal protein S15a. 
AT1G07770.2TTCGGTTTACEncodes cytoplasmic ribosomal protein S15a. 
AT1G08030AT1G08030.1TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 11 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G08580AT1G08580.1AAACCGAACCGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G08700AT1G08700.1AAACCGAAEncodes a protein similar to animal presenilin whose expression is increased in response to potassium (K+) deprivation. 
AT1G08710AT1G08710.1TTCGGTTTF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT1G08710.2TTCGGTTTF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT1G08890AT1G08890.1TTCGGTTTsugar transporter family protein; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: carbohydrate transmembrane transporter (TAIR:AT1G08900.2); Has 14806 Blast hits to 14481 proteins in 1001 species: Archae - 203; Bacteria - 3991; Metazoa - 4226; Fungi - 4106; Plants - 1396; Viruses - 0; Other Eukaryotes - 884 (source: NCBI BLink). 
AT1G09280AT1G09280.1CGGTTCAATTCGGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763), Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT2G40760.1); Has 4342 Blast hits to 4339 proteins in 940 species: Archae - 0; Bacteria - 1695; Metazoa - 138; Fungi - 282; Plants - 108; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). 
AT1G09280.1GGTTCGGTTTGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763), Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT2G40760.1); Has 4342 Blast hits to 4339 proteins in 940 species: Archae - 0; Bacteria - 1695; Metazoa - 138; Fungi - 282; Plants - 108; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). 
AT1G09420AT1G09420.1CGGTTCGGTTTAGEncodes a protein similar to glucose-6-phosphate dehydrogenase but, based on amino acid differences in the active site and lack of activity, does not encode a functional G6PDH. The amino acid sequence for the consensus sequence of the G6PDH active site (DHYLGKE) differs in three places in this protein. gc exon splice site at 20574 is based on protein alignment, and is not confirmed experimentally. 
AT1G09430AT1G09430.1CTAAACCGAACCGEncodes subunit A of the heteromeric enzyme ATP citrate lyase (ACL). In animals, ACL is encoded by a single gene; ACL in Arabidopsis is composed of two polypeptides, ACLA (encoded by 3 genes) and ACLB (encoded by 2 genes). The holoenzyme has an A(4)B(4)stoichiometry. Expression of both ACLA and ACLB but not of either of the subunits alone results in ACL activity. 
AT1G09800AT1G09800.1CTAAACCGAAtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT3G06950.1); Has 6844 Blast hits to 5672 proteins in 1445 species: Archae - 71; Bacteria - 3683; Metazoa - 118; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2917 (source: NCBI BLink). 
AT1G10150AT1G10150.1AAACCGAACCGcarbohydrate binding; FUNCTIONS IN: carbohydrate binding; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: CF9 (TAIR:AT1G59510.1); Has 58 Blast hits to 58 proteins in 12 species: Archae - 0; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G10430AT1G10430.1AAACCGAACCTTAACCGGGTCEncodes one of two isoforms of the catalytic subunit of protein phosphatase 2A. 
AT1G10490AT1G10490.1TTCGGTTTunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1726 (InterPro:IPR013562), Protein of unknown function DUF699, ATPase putative (InterPro:IPR007807); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57940.1); Has 887 Blast hits to 850 proteins in 389 species: Archae - 76; Bacteria - 411; Metazoa - 160; Fungi - 89; Plants - 21; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). 
AT1G10700AT1G10700.1TTAAACCGAAribose-phosphate pyrophosphokinase 3 / phosphoribosyl diphosphate synthetase 3 (PRS3); FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 4 / phosphoribosyl diphosphate synthetase 4 (PRS4) (TAIR:AT2G42910.1); Has 6424 Blast hits to 6423 proteins in 1522 species: Archae - 142; Bacteria - 3196; Metazoa - 415; Fungi - 221; Plants - 120; Viruses - 5; Other Eukaryotes - 2325 (source: NCBI BLink). 
AT1G10865AT1G10865.1TTAAACCGAACCAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT1G10865.2TTAAACCGAACCAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT1G11280AT1G11280.1TTCGGTTTATS-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Apple-like (InterPro:IPR003609), PAN-like, type 2 (InterPro:IPR013227), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus protein kinase, putative (TAIR:AT1G61480.1); Has 86509 Blast hits to 85214 proteins in 3061 species: Archae - 49; Bacteria - 7411; Metazoa - 37923; Fungi - 6582; Plants - 19583; Viruses - 392; Other Eukaryotes - 14569 (source: NCBI BLink). 
AT1G11280.2TTCGGTTTATS-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Apple-like (InterPro:IPR003609), PAN-like, type 2 (InterPro:IPR013227), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus protein kinase, putative (TAIR:AT1G61480.1); Has 86509 Blast hits to 85214 proteins in 3061 species: Archae - 49; Bacteria - 7411; Metazoa - 37923; Fungi - 6582; Plants - 19583; Viruses - 392; Other Eukaryotes - 14569 (source: NCBI BLink). 
AT1G11280.3TTCGGTTTATS-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Apple-like (InterPro:IPR003609), PAN-like, type 2 (InterPro:IPR013227), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus protein kinase, putative (TAIR:AT1G61480.1); Has 86509 Blast hits to 85214 proteins in 3061 species: Archae - 49; Bacteria - 7411; Metazoa - 37923; Fungi - 6582; Plants - 19583; Viruses - 392; Other Eukaryotes - 14569 (source: NCBI BLink). 
AT1G11280.4TTCGGTTTATS-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Apple-like (InterPro:IPR003609), PAN-like, type 2 (InterPro:IPR013227), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus protein kinase, putative (TAIR:AT1G61480.1); Has 86509 Blast hits to 85214 proteins in 3061 species: Archae - 49; Bacteria - 7411; Metazoa - 37923; Fungi - 6582; Plants - 19583; Viruses - 392; Other Eukaryotes - 14569 (source: NCBI BLink). 
AT1G11500AT1G11500.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21310.1); Has 50 Blast hits to 50 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G11750AT1G11750.1GGTTCGGTTTAAOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). 
AT1G11800AT1G11800.1TTCGGTTTendonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: hydrolase activity, zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135), Zinc finger, RanBP2-type (InterPro:IPR001876); Has 273 Blast hits to 263 proteins in 68 species: Archae - 0; Bacteria - 12; Metazoa - 134; Fungi - 10; Plants - 55; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT1G11915AT1G11915.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17350.1); Has 109 Blast hits to 109 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 109; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G12450AT1G12450.1AAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22850.1); Has 1233 Blast hits to 1230 proteins in 347 species: Archae - 2; Bacteria - 557; Metazoa - 104; Fungi - 72; Plants - 132; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink). 
AT1G12880AT1G12880.1TTCGGTTTArabidopsis thaliana Nudix hydrolase homolog 12 (atnudt12); FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX13 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 13); bis(5'-adenosyl)-pentaphosphatase/ hydrolase (TAIR:AT3G26690.2); Has 834 Blast hits to 832 proteins in 229 species: Archae - 0; Bacteria - 307; Metazoa - 225; Fungi - 72; Plants - 132; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). 
AT1G14060AT1G14060.1GTTCGGTTTGGTCCGGTTTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: GCK (InterPro:IPR012891); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G02210.1); Has 243 Blast hits to 215 proteins in 60 species: Archae - 0; Bacteria - 2; Metazoa - 93; Fungi - 27; Plants - 49; Viruses - 2; Other Eukaryotes - 70 (source: NCBI BLink). 
AT1G16020AT1G16020.1TTCGGTTTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G16020.2TTCGGTTTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G16610AT1G16610.1TTCGGTTTAASR spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP. 
AT1G16610.2TTCGGTTTAASR spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP. 
AT1G17280AT1G17280.1GTTCGGTTTAGubiquitin-conjugating enzyme 34 (UBC34); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC33 (ubiquitin-conjugating enzyme 33); ubiquitin-protein ligase (TAIR:AT5G50430.2); Has 5548 Blast hits to 5545 proteins in 288 species: Archae - 0; Bacteria - 0; Metazoa - 2617; Fungi - 1060; Plants - 889; Viruses - 16; Other Eukaryotes - 966 (source: NCBI BLink). 
AT1G17280.2GTTCGGTTTAGubiquitin-conjugating enzyme 34 (UBC34); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC33 (ubiquitin-conjugating enzyme 33); ubiquitin-protein ligase (TAIR:AT5G50430.2); Has 5548 Blast hits to 5545 proteins in 288 species: Archae - 0; Bacteria - 0; Metazoa - 2617; Fungi - 1060; Plants - 889; Viruses - 16; Other Eukaryotes - 966 (source: NCBI BLink). 
AT1G17650AT1G17650.1GTTCGGTTTGlyoxylate reductase located in chloroplasts. 
AT1G17650.1TTAAACCGAAGlyoxylate reductase located in chloroplasts. 
AT1G17650.1TTCGGTTTATGlyoxylate reductase located in chloroplasts. 
AT1G17980AT1G17980.1AAACCGAAnucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.9); Has 591 Blast hits to 589 proteins in 160 species: Archae - 0; Bacteria - 11; Metazoa - 239; Fungi - 130; Plants - 103; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT1G18030AT1G18030.1AAACCGAAprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT2G25620.1); Has 4082 Blast hits to 4070 proteins in 241 species: Archae - 3; Bacteria - 20; Metazoa - 1276; Fungi - 498; Plants - 1296; Viruses - 9; Other Eukaryotes - 980 (source: NCBI BLink). 
AT1G18030.2AAACCGAAprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT2G25620.1); Has 4082 Blast hits to 4070 proteins in 241 species: Archae - 3; Bacteria - 20; Metazoa - 1276; Fungi - 498; Plants - 1296; Viruses - 9; Other Eukaryotes - 980 (source: NCBI BLink). 
AT1G18060AT1G18060.1AAACCGAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 16 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G18260AT1G18260.1CCAAACCGAAsuppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G73570.1); Has 15581 Blast hits to 5419 proteins in 820 species: Archae - 0; Bacteria - 9844; Metazoa - 747; Fungi - 658; Plants - 84; Viruses - 27; Other Eukaryotes - 4221 (source: NCBI BLink). 
AT1G18260.1TTAAACCGAAsuppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G73570.1); Has 15581 Blast hits to 5419 proteins in 820 species: Archae - 0; Bacteria - 9844; Metazoa - 747; Fungi - 658; Plants - 84; Viruses - 27; Other Eukaryotes - 4221 (source: NCBI BLink). 
AT1G18300AT1G18300.1CCAAACCGAACArabidopsis thaliana Nudix hydrolase homolog 4 (atnudt4); FUNCTIONS IN: hydrolase activity; LOCATED IN: cytosol; EXPRESSED IN: stem, root, leaf; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt21 (Arabidopsis thaliana Nudix hydrolase homolog 21); hydrolase (TAIR:AT1G73540.1); Has 801 Blast hits to 799 proteins in 226 species: Archae - 1; Bacteria - 254; Metazoa - 216; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). 
AT1G18440AT1G18440.1TTCGGTTTpeptidyl-tRNA hydrolase family protein; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, conserved site (InterPro:IPR018171), Peptidyl-tRNA hydrolase (InterPro:IPR001328); BEST Arabidopsis thaliana protein match is: peptidyl-tRNA hydrolase family protein (TAIR:AT5G16140.2); Has 5517 Blast hits to 5515 proteins in 1423 species: Archae - 0; Bacteria - 2880; Metazoa - 37; Fungi - 63; Plants - 75; Viruses - 0; Other Eukaryotes - 2462 (source: NCBI BLink). 
AT1G18450AT1G18450.1TGGTTCGGTTTAGEncodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes. 
AT1G19650AT1G19650.1AAACCGAASEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: phosphatidylinositol transporter activity, transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphatidylinositol transfer-like protein, putative (TAIR:AT1G75370.1); Has 1786 Blast hits to 1782 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 645; Fungi - 360; Plants - 459; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink). 
AT1G19650.2AAACCGAASEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: phosphatidylinositol transporter activity, transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphatidylinositol transfer-like protein, putative (TAIR:AT1G75370.1); Has 1786 Blast hits to 1782 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 645; Fungi - 360; Plants - 459; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink). 
AT1G21700AT1G21700.1AAACCGAAa member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003). 
AT1G21700.1TTCGGTTTa member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003). 
AT1G21710AT1G21710.1AAACCGAAEncodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme. 
AT1G21710.1TTCGGTTTEncodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme. 
AT1G21780AT1G21780.1TTCGGTTTBTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B. 
AT1G21780.2TTCGGTTTBTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B. 
AT1G23740AT1G23740.1AAACCGAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G13010.1); Has 25735 Blast hits to 25635 proteins in 1642 species: Archae - 321; Bacteria - 14032; Metazoa - 1331; Fungi - 2499; Plants - 781; Viruses - 3; Other Eukaryotes - 6768 (source: NCBI BLink). 
AT1G24450AT1G24450.1AAACCGAANUCLEAR FUSION DEFECTIVE 2 (NFD2); FUNCTIONS IN: RNA binding, ribonuclease III activity; INVOLVED IN: RNA processing; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonuclease III (InterPro:IPR000999); Has 1405 Blast hits to 1405 proteins in 451 species: Archae - 3; Bacteria - 885; Metazoa - 2; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 508 (source: NCBI BLink). 
AT1G25280AT1G25280.2GGTTCGGTTTMember of TLP family 
AT1G25280.2TTCGGTTTMember of TLP family 
AT1G25280.3GGTTCGGTTTMember of TLP family 
AT1G25280.3TTCGGTTTMember of TLP family 
AT1G25350AT1G25350.1TTCGGTTTAAovule abortion 9 (OVA9); FUNCTIONS IN: glutamine-tRNA ligase activity; INVOLVED IN: glutamyl-tRNA aminoacylation, translation, ovule development; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Glutamyl/glutaminyl-tRNA synthetase, class Ic (InterPro:IPR000924), Glutaminyl-tRNA synthetase, class Ic, non-specific RNA-binding region part 1 (InterPro:IPR007639), Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035), Glutaminyl-tRNA synthetase, class Ic, non-specific RNA-binding region part 2 (InterPro:IPR007638), Glutaminyl-tRNA synthetase, class Ic (InterPro:IPR004514); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (E and Q) family protein (TAIR:AT5G19720.1); Has 8783 Blast hits to 8778 proteins in 1656 species: Archae - 170; Bacteria - 4659; Metazoa - 349; Fungi - 257; Plants - 97; Viruses - 0; Other Eukaryotes - 3251 (source: NCBI BLink). 
AT1G25550AT1G25550.1TTCGGTTTmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G68670.1); Has 883 Blast hits to 881 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 869; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G26300AT1G26300.1ACGTGACATTCGGTTTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT1G26300.2ACGTGACATTCGGTTTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT1G26530AT1G26530.1TGGTTCGGTTCGGTTCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46230.1); Has 345 Blast hits to 345 proteins in 143 species: Archae - 0; Bacteria - 0; Metazoa - 142; Fungi - 99; Plants - 37; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT1G26670AT1G26670.1TTCGGTTTGGmember of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles. 
AT1G26770AT1G26770.1TTCGGTTTEncodes an expansin. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. 
AT1G26770.2TTCGGTTTEncodes an expansin. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. 
AT1G27750AT1G27750.1TTCGGTTTGGnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504); BEST Arabidopsis thaliana protein match is: FPA; RNA binding (TAIR:AT2G43410.4); Has 43321 Blast hits to 25070 proteins in 1124 species: Archae - 78; Bacteria - 4579; Metazoa - 20319; Fungi - 5516; Plants - 6313; Viruses - 1307; Other Eukaryotes - 5209 (source: NCBI BLink). 
AT1G27930AT1G27930.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF579, plant (InterPro:IPR006514); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67330.1); Has 160 Blast hits to 160 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G29350AT1G29350.1TGGTTCGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1296 (InterPro:IPR009719); BEST Arabidopsis thaliana protein match is: kinase-related (TAIR:AT1G29370.1); Has 13611 Blast hits to 7582 proteins in 387 species: Archae - 0; Bacteria - 354; Metazoa - 5683; Fungi - 1538; Plants - 892; Viruses - 68; Other Eukaryotes - 5076 (source: NCBI BLink). 
AT1G29630AT1G29630.1TTAAACCGAAAACCGGDNA binding / catalytic/ nuclease; FUNCTIONS IN: DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: exonuclease, putative (TAIR:AT1G18090.2); Has 1812 Blast hits to 1629 proteins in 272 species: Archae - 190; Bacteria - 0; Metazoa - 554; Fungi - 461; Plants - 125; Viruses - 28; Other Eukaryotes - 454 (source: NCBI BLink). 
AT1G29630.2TTAAACCGAAAACCGGDNA binding / catalytic/ nuclease; FUNCTIONS IN: DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: exonuclease, putative (TAIR:AT1G18090.2); Has 1812 Blast hits to 1629 proteins in 272 species: Archae - 190; Bacteria - 0; Metazoa - 554; Fungi - 461; Plants - 125; Viruses - 28; Other Eukaryotes - 454 (source: NCBI BLink). 
AT1G29680AT1G29680.1GTTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1264 (InterPro:IPR010686); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45690.1); Has 188 Blast hits to 188 proteins in 83 species: Archae - 0; Bacteria - 84; Metazoa - 0; Fungi - 43; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G30510AT1G30510.1TGGTTCGGTTTGGEncodes a root-type ferredoxin:NADP(H) oxidoreductase. 
AT1G30510.2TGGTTCGGTTTGGEncodes a root-type ferredoxin:NADP(H) oxidoreductase. 
AT1G30510.3TGGTTCGGTTTGGEncodes a root-type ferredoxin:NADP(H) oxidoreductase. 
AT1G30580AT1G30580.1TTCGGTTTAAGTP binding; FUNCTIONS IN: GTP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF933 (InterPro:IPR013029), TGS-like (InterPro:IPR012676), GTP1/OBG (InterPro:IPR006073), Conserved hypothetical protein CHP00092 (InterPro:IPR004396), GTP-binding protein, HSR1-related (InterPro:IPR002917), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G56050.1); Has 12592 Blast hits to 12588 proteins in 1581 species: Archae - 216; Bacteria - 5420; Metazoa - 582; Fungi - 410; Plants - 148; Viruses - 0; Other Eukaryotes - 5816 (source: NCBI BLink). 
AT1G30750AT1G30750.1GTTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root, pollen tube; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1720 (InterPro:IPR013182); Has 1056 Blast hits to 518 proteins in 153 species: Archae - 0; Bacteria - 268; Metazoa - 168; Fungi - 142; Plants - 17; Viruses - 16; Other Eukaryotes - 445 (source: NCBI BLink). 
AT1G31180AT1G31180.1GTTCGGTTTThe AtIMD3 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. 
AT1G31730AT1G31730.1AAACCGAAepsilon-adaptin, putative; FUNCTIONS IN: protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Adaptor protein complex AP-4, epsilon subunit (InterPro:IPR017109), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 4111 Blast hits to 2632 proteins in 228 species: Archae - 0; Bacteria - 67; Metazoa - 1478; Fungi - 596; Plants - 220; Viruses - 3; Other Eukaryotes - 1747 (source: NCBI BLink). 
AT1G31730.1CCAAACCGAAepsilon-adaptin, putative; FUNCTIONS IN: protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Adaptor protein complex AP-4, epsilon subunit (InterPro:IPR017109), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 4111 Blast hits to 2632 proteins in 228 species: Archae - 0; Bacteria - 67; Metazoa - 1478; Fungi - 596; Plants - 220; Viruses - 3; Other Eukaryotes - 1747 (source: NCBI BLink). 
AT1G31750AT1G31750.1TTCGGTTTAAproline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 28504 Blast hits to 13839 proteins in 758 species: Archae - 8; Bacteria - 3021; Metazoa - 12889; Fungi - 3156; Plants - 5337; Viruses - 840; Other Eukaryotes - 3253 (source: NCBI BLink). 
AT1G32310AT1G32310.1TTCGGTTTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G32340AT1G32340.1TTCGGTTTEncodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression is not detected under normal conditions and in response to cucumber mosaic virus or spermine. 
AT1G32530AT1G32530.1AAACCGAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink). 
AT1G32530.1CCAAACCGAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink). 
AT1G32700AT1G32700.1GGTTCGGTTTzinc-binding family protein; FUNCTIONS IN: binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF597 (InterPro:IPR006734); BEST Arabidopsis thaliana protein match is: zinc-binding family protein (TAIR:AT4G17900.1); Has 193 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 193; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G32700.2GGTTCGGTTTzinc-binding family protein; FUNCTIONS IN: binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF597 (InterPro:IPR006734); BEST Arabidopsis thaliana protein match is: zinc-binding family protein (TAIR:AT4G17900.1); Has 193 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 193; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G33265AT1G33265.1AAACCGAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); Has 119 Blast hits to 119 proteins in 43 species: Archae - 0; Bacteria - 27; Metazoa - 33; Fungi - 2; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G33265.1AAACCGAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); Has 119 Blast hits to 119 proteins in 43 species: Archae - 0; Bacteria - 27; Metazoa - 33; Fungi - 2; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G33265.1CCAAACCGAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); Has 119 Blast hits to 119 proteins in 43 species: Archae - 0; Bacteria - 27; Metazoa - 33; Fungi - 2; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G33270AT1G33270.1AAACCGAApatatin-related; INVOLVED IN: lipid metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Patatin (InterPro:IPR002641); Has 381 Blast hits to 381 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 287; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). 
AT1G33270.2AAACCGAApatatin-related; INVOLVED IN: lipid metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Patatin (InterPro:IPR002641); Has 381 Blast hits to 381 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 287; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). 
AT1G34000AT1G34000.1CCAAACCGAAEncodes a novel member of the Lhc family from Arabidopsis with one predicted transmembrane alpha-helix closely related to helix I of Lhc protein from PSI (Lhca4). Gene expression is triggered by light stress and both transcript and protein accumulate in a light intensity-dependent manner. Ohp2 is associated with PSI under low- or high-light conditions. 
AT1G34770AT1G34770.1AAACCGAACMAGE-8 antigen-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MAGE protein (InterPro:IPR002190); Has 1021 Blast hits to 1019 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 886; Fungi - 33; Plants - 28; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G34770.1CCAAACCGAAMAGE-8 antigen-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MAGE protein (InterPro:IPR002190); Has 1021 Blast hits to 1019 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 886; Fungi - 33; Plants - 28; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G34770.1CTAAACCGAAMAGE-8 antigen-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MAGE protein (InterPro:IPR002190); Has 1021 Blast hits to 1019 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 886; Fungi - 33; Plants - 28; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G34770.2AAACCGAACMAGE-8 antigen-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MAGE protein (InterPro:IPR002190); Has 1021 Blast hits to 1019 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 886; Fungi - 33; Plants - 28; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G34770.2CCAAACCGAAMAGE-8 antigen-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MAGE protein (InterPro:IPR002190); Has 1021 Blast hits to 1019 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 886; Fungi - 33; Plants - 28; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G34770.2CTAAACCGAAMAGE-8 antigen-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MAGE protein (InterPro:IPR002190); Has 1021 Blast hits to 1019 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 886; Fungi - 33; Plants - 28; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). 
AT1G35220AT1G35220.1GGTTCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 247 Blast hits to 143 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). 
AT1G35420AT1G35420.1TTCGGTTTdienelactone hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dienelactone hydrolase (InterPro:IPR002925); BEST Arabidopsis thaliana protein match is: dienelactone hydrolase family protein (TAIR:AT3G23600.1); Has 1696 Blast hits to 1695 proteins in 498 species: Archae - 16; Bacteria - 1093; Metazoa - 57; Fungi - 202; Plants - 150; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). 
AT1G35680AT1G35680.1ATAAACCGGTAAACCGAA50S ribosomal protein L21, chloroplast / CL21 (RPL21); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: response to cold, translation; LOCATED IN: ribosome, chloroplast stroma, nucleus, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L21, conserved site (InterPro:IPR018258), Ribosomal protein L21 (InterPro:IPR001787); BEST Arabidopsis thaliana protein match is: NFD1 (NUCLEAR FUSION DEFECTIVE 1); RNA binding / structural constituent of ribosome (TAIR:AT4G30930.1); Has 4670 Blast hits to 4670 proteins in 1425 species: Archae - 0; Bacteria - 2792; Metazoa - 89; Fungi - 4; Plants - 92; Viruses - 0; Other Eukaryotes - 1693 (source: NCBI BLink). 
AT1G36160AT1G36160.1AAACCGAAEncodes acetyl-CoA carboxylase. Mutant displays uncoordinated cell divisions which are enhanced by cytokinins. Mutant also has aberrant organization of the apical region in the embryo and abnormal root and shoot development. Essential for very long chain fatty acid elongation. 
AT1G43160AT1G43160.1AAACCGAAencodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily. 
AT1G43700AT1G43700.1GTAAACCGAAEncodes a VirE2-interacting protein. VIP1 mediates nuclear translocation of VirE2 via its amino half, and interacts with histone H2A via it carboxyl half. 
AT1G45474AT1G45474.1AAACCGAAACCGAAEncodes a component of the light harvesting complex of photosystem I. 
AT1G45474.1CCAAACCGAAEncodes a component of the light harvesting complex of photosystem I. 
AT1G45474.2AAACCGAAACCGAAEncodes a component of the light harvesting complex of photosystem I. 
AT1G45474.2CCAAACCGAAEncodes a component of the light harvesting complex of photosystem I. 
AT1G47230AT1G47230.1AAACCGAACYCLIN A3;4 (CYCA3;4); FUNCTIONS IN: cyclin-dependent protein kinase regulator activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin, C-terminal (InterPro:IPR004367), Cyclin (InterPro:IPR006670), G2/mitotic-specific cyclin A (InterPro:IPR015453), Cyclin-like (InterPro:IPR011028), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin, A/B/D/E (InterPro:IPR014400); BEST Arabidopsis thaliana protein match is: cyclin family protein (TAIR:AT1G47210.2); Has 3253 Blast hits to 3252 proteins in 293 species: Archae - 0; Bacteria - 0; Metazoa - 1697; Fungi - 357; Plants - 705; Viruses - 32; Other Eukaryotes - 462 (source: NCBI BLink). 
AT1G47230.2AAACCGAACYCLIN A3;4 (CYCA3;4); FUNCTIONS IN: cyclin-dependent protein kinase regulator activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin, C-terminal (InterPro:IPR004367), Cyclin (InterPro:IPR006670), G2/mitotic-specific cyclin A (InterPro:IPR015453), Cyclin-like (InterPro:IPR011028), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin, A/B/D/E (InterPro:IPR014400); BEST Arabidopsis thaliana protein match is: cyclin family protein (TAIR:AT1G47210.2); Has 3253 Blast hits to 3252 proteins in 293 species: Archae - 0; Bacteria - 0; Metazoa - 1697; Fungi - 357; Plants - 705; Viruses - 32; Other Eukaryotes - 462 (source: NCBI BLink). 
AT1G47260AT1G47260.1TTCGGTTTGGEncodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. 
AT1G47420AT1G47420.1TTCGGTTTGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: GAMMA CA2 (GAMMA CARBONIC ANHYDRASE 2); carbonate dehydratase (TAIR:AT1G47260.1); Has 85 Blast hits to 85 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G49340AT1G49340.1ATAAACCGAAEncodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots. 
AT1G49340.2ATAAACCGAAEncodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots. 
AT1G49520AT1G49520.1TTCGGTTTSWIB complex BAF60b domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121), DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: SWIB complex BAF60b domain-containing protein (TAIR:AT3G19080.1); Has 2705 Blast hits to 1659 proteins in 214 species: Archae - 0; Bacteria - 274; Metazoa - 896; Fungi - 325; Plants - 386; Viruses - 17; Other Eukaryotes - 807 (source: NCBI BLink). 
AT1G49820AT1G49820.1TTAAACCGAAencodes 5-methylthioribose kinase, involved in methionine cycle 
AT1G50250AT1G50250.1CCAAACCGAACencodes an FTSH protease that is localized to the chloroplast. Involved in the D1 repair cycle of Photosystem II. FtsH1 and FtsH5 are interchangeable in thylakoid membranes. 
AT1G50250.1TTAAACCGAACencodes an FTSH protease that is localized to the chloroplast. Involved in the D1 repair cycle of Photosystem II. FtsH1 and FtsH5 are interchangeable in thylakoid membranes. 
AT1G50730AT1G50730.1GTTCGGTTTunknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 182 Blast hits to 175 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 2; Plants - 11; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT1G51090AT1G51090.1AAACCGAAheavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: metal ion binding (TAIR:AT4G16380.1); Has 2088 Blast hits to 1362 proteins in 268 species: Archae - 0; Bacteria - 571; Metazoa - 270; Fungi - 137; Plants - 643; Viruses - 138; Other Eukaryotes - 329 (source: NCBI BLink). 
AT1G51310AT1G51310.1ATAAACCGAAtRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase; FUNCTIONS IN: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase activity; INVOLVED IN: tRNA processing, RNA processing; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (InterPro:IPR004506), tRNA methyl transferase-like (InterPro:IPR018318); Has 5934 Blast hits to 5930 proteins in 1456 species: Archae - 0; Bacteria - 3103; Metazoa - 118; Fungi - 45; Plants - 26; Viruses - 0; Other Eukaryotes - 2642 (source: NCBI BLink). 
AT1G52825AT1G52825.1TGGTTCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14615.1); Has 30 Blast hits to 28 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G54570AT1G54570.1AAACCGAAesterase/lipase/thioesterase family protein; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, catalytic activity; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Diacylglycerol acyltransferase (InterPro:IPR007130); BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT3G26840.1); Has 434 Blast hits to 425 proteins in 124 species: Archae - 0; Bacteria - 193; Metazoa - 116; Fungi - 8; Plants - 74; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). 
AT1G54690AT1G54690.1AAACCGAACCGAEncodes HTA3, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10–20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin. 
AT1G54690.1CTAAACCGAAEncodes HTA3, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10–20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin. 
AT1G55080AT1G55080.1TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29580.1); Has 64498 Blast hits to 23302 proteins in 980 species: Archae - 12; Bacteria - 3118; Metazoa - 24455; Fungi - 7046; Plants - 5363; Viruses - 296; Other Eukaryotes - 24208 (source: NCBI BLink). 
AT1G56330AT1G56330.1ATAAACCGAAEncodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol. 
AT1G57610AT1G57610.1AAACCGAACCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT1G57610.1AAACCGAACCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT1G57610.2AAACCGAACCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT1G57610.2AAACCGAACCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT1G57610.3AAACCGAACCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT1G57610.3AAACCGAACCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF607 (InterPro:IPR006769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09575.1); Has 280 Blast hits to 278 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 41; Plants - 69; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT1G57660AT1G57660.1CCAAACCGAA60S ribosomal protein L21 (RPL21E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (TAIR:AT1G57860.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). 
AT1G57660.1CTAAACCGAACCA60S ribosomal protein L21 (RPL21E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (TAIR:AT1G57860.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). 
AT1G57720AT1G57720.1CTAAACCGAAelongation factor 1B-gamma, putative / eEF-1B gamma, putative; FUNCTIONS IN: copper ion binding, translation elongation factor activity; INVOLVED IN: response to cadmium ion; LOCATED IN: cell wall, plasma membrane, vacuole, membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, gamma chain, conserved (InterPro:IPR001662), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: elongation factor 1B-gamma, putative / eEF-1B gamma, putative (TAIR:AT1G09640.1); Has 7768 Blast hits to 7335 proteins in 985 species: Archae - 0; Bacteria - 3423; Metazoa - 1547; Fungi - 368; Plants - 575; Viruses - 5; Other Eukaryotes - 1850 (source: NCBI BLink). 
AT1G57720.2CTAAACCGAAelongation factor 1B-gamma, putative / eEF-1B gamma, putative; FUNCTIONS IN: copper ion binding, translation elongation factor activity; INVOLVED IN: response to cadmium ion; LOCATED IN: cell wall, plasma membrane, vacuole, membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, gamma chain, conserved (InterPro:IPR001662), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: elongation factor 1B-gamma, putative / eEF-1B gamma, putative (TAIR:AT1G09640.1); Has 7768 Blast hits to 7335 proteins in 985 species: Archae - 0; Bacteria - 3423; Metazoa - 1547; Fungi - 368; Plants - 575; Viruses - 5; Other Eukaryotes - 1850 (source: NCBI BLink). 
AT1G59835AT1G59835.1AACCGGAATAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50610.1); Has 25 Blast hits to 11 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G60690AT1G60690.1TTCGGTTTAAaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: ATB2; oxidoreductase (TAIR:AT1G60710.1); Has 18262 Blast hits to 18242 proteins in 1448 species: Archae - 333; Bacteria - 10168; Metazoa - 1431; Fungi - 1444; Plants - 723; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). 
AT1G60690.1TTCGGTTTAAaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: ATB2; oxidoreductase (TAIR:AT1G60710.1); Has 18262 Blast hits to 18242 proteins in 1448 species: Archae - 333; Bacteria - 10168; Metazoa - 1431; Fungi - 1444; Plants - 723; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). 
AT1G62120AT1G62120.1CTAAACCGAAmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G62085.1); Has 415 Blast hits to 372 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 404; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G63170AT1G63170.1TTCGGTTTAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT1G12760.1); Has 6437 Blast hits to 6421 proteins in 214 species: Archae - 0; Bacteria - 6; Metazoa - 2231; Fungi - 482; Plants - 2717; Viruses - 23; Other Eukaryotes - 978 (source: NCBI BLink). 
AT1G67350AT1G67350.1TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G67350.2TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G67700AT1G67700.1TGGTTCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G67700.2TGGTTCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G67890AT1G67890.1AAACCGAAprotein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: signal transduction, protein amino acid phosphorylation, regulation of transcription, DNA-dependent; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAS fold (InterPro:IPR013767), Serine/threonine protein kinase (InterPro:IPR002290), PAS (InterPro:IPR000014), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G49470.2); Has 93435 Blast hits to 92007 proteins in 3422 species: Archae - 193; Bacteria - 9066; Metazoa - 40989; Fungi - 7531; Plants - 18909; Viruses - 484; Other Eukaryotes - 16263 (source: NCBI BLink). 
AT1G67890.2AAACCGAAprotein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: signal transduction, protein amino acid phosphorylation, regulation of transcription, DNA-dependent; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAS fold (InterPro:IPR013767), Serine/threonine protein kinase (InterPro:IPR002290), PAS (InterPro:IPR000014), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G49470.2); Has 93435 Blast hits to 92007 proteins in 3422 species: Archae - 193; Bacteria - 9066; Metazoa - 40989; Fungi - 7531; Plants - 18909; Viruses - 484; Other Eukaryotes - 16263 (source: NCBI BLink). 
AT1G67960AT1G67960.1CTAAACCGAACCGAACCGACTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). 
AT1G68110AT1G68110.1TCGGTTCGGTTTepsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: clathrin coat; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT1G25240.1); Has 192 Blast hits to 186 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 4; Plants - 177; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G68410AT1G68410.1GTTCGGTTTprotein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C-related / PP2C-related (TAIR:AT1G09160.2); Has 3546 Blast hits to 3545 proteins in 302 species: Archae - 0; Bacteria - 199; Metazoa - 1018; Fungi - 331; Plants - 1165; Viruses - 4; Other Eukaryotes - 829 (source: NCBI BLink). 
AT1G68410.2GTTCGGTTTprotein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C-related / PP2C-related (TAIR:AT1G09160.2); Has 3546 Blast hits to 3545 proteins in 302 species: Archae - 0; Bacteria - 199; Metazoa - 1018; Fungi - 331; Plants - 1165; Viruses - 4; Other Eukaryotes - 829 (source: NCBI BLink). 
AT1G68610AT1G68610.1TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14870.1); Has 481 Blast hits to 480 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 68; Fungi - 60; Plants - 330; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT1G72370AT1G72370.1TTCGGTTTAAacidic protein associated to 40S ribosomal subunit of ribosomes. Involved in polysome formation during active protein synthesis. Expressed in actively growing tissue. 
AT1G72370.2TTCGGTTTAAacidic protein associated to 40S ribosomal subunit of ribosomes. Involved in polysome formation during active protein synthesis. Expressed in actively growing tissue. 
AT1G72390AT1G72390.1TTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 7899 Blast hits to 6384 proteins in 374 species: Archae - 6; Bacteria - 210; Metazoa - 3913; Fungi - 1320; Plants - 701; Viruses - 22; Other Eukaryotes - 1727 (source: NCBI BLink). 
AT1G72510AT1G72510.1CCAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G72510.2CCAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G73090AT1G73090.1TTCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G73540AT1G73540.1AAACCGAAArabidopsis thaliana Nudix hydrolase homolog 21 (atnudt21); FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt4 (Arabidopsis thaliana Nudix hydrolase homolog 4); hydrolase (TAIR:AT1G18300.1); Has 819 Blast hits to 817 proteins in 227 species: Archae - 3; Bacteria - 284; Metazoa - 212; Fungi - 79; Plants - 132; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). 
AT1G73980AT1G73980.1TTCGGTTTphosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: adenylate cyclase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, cAMP biosynthetic process, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764), Adenylate cyclase (InterPro:IPR008172); BEST Arabidopsis thaliana protein match is: phosphoribulokinase/uridine kinase family protein (TAIR:AT1G26190.1); Has 2533 Blast hits to 2522 proteins in 907 species: Archae - 19; Bacteria - 1635; Metazoa - 298; Fungi - 83; Plants - 169; Viruses - 2; Other Eukaryotes - 327 (source: NCBI BLink). 
AT1G73990AT1G73990.1AAACCGAAEncodes a putative protease SppA (SppA). 
AT1G74230AT1G74230.1ATCCGGTTTCGGTTTencodes a glycine-rich RNA binding protein. 
AT1G74458AT1G74458.1TTCGGTTTunknown protein; LOCATED IN: endomembrane system; Has 5 Blast hits to 5 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G76010AT1G76010.1TGGTTCGGTTTAAnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G20220.1); Has 75246 Blast hits to 26916 proteins in 1384 species: Archae - 54; Bacteria - 14987; Metazoa - 38865; Fungi - 4655; Plants - 6135; Viruses - 798; Other Eukaryotes - 9752 (source: NCBI BLink). 
AT1G76550AT1G76550.1CCAAACCGAApyrophosphate--fructose-6-phosphate 1-phosphotransferase alpha subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, alpha-subunit complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: pyrophosphate--fructose-6-phosphate 1-phosphotransferase-related / pyrophosphate-dependent 6-phosphofructose-1-kinase-related (TAIR:AT1G20950.1); Has 2719 Blast hits to 2653 proteins in 853 species: Archae - 15; Bacteria - 1820; Metazoa - 8; Fungi - 4; Plants - 258; Viruses - 0; Other Eukaryotes - 614 (source: NCBI BLink). 
AT1G76550.1CCAAACCGAApyrophosphate--fructose-6-phosphate 1-phosphotransferase alpha subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, alpha-subunit complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: pyrophosphate--fructose-6-phosphate 1-phosphotransferase-related / pyrophosphate-dependent 6-phosphofructose-1-kinase-related (TAIR:AT1G20950.1); Has 2719 Blast hits to 2653 proteins in 853 species: Archae - 15; Bacteria - 1820; Metazoa - 8; Fungi - 4; Plants - 258; Viruses - 0; Other Eukaryotes - 614 (source: NCBI BLink). 
AT1G77800AT1G77800.1AAACCGAACCAPHD finger family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: ATX1 (ARABIDOPSIS HOMOLOGUE OF TRITHORAX); histone-lysine N-methyltransferase/ phosphatidylinositol-5-phosphate binding (TAIR:AT2G31650.1); Has 2544 Blast hits to 1383 proteins in 151 species: Archae - 0; Bacteria - 2; Metazoa - 1640; Fungi - 401; Plants - 246; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT1G79730AT1G79730.1GTAAACCGAAEncodes a PAF1 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast PAF1 is a component of a five-member complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. 
AT2G01150AT2G01150.1ATAAACCGAAEncodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils. 
AT2G01450AT2G01450.1AAACCGAAmember of MAP Kinase 
AT2G01450.1AAACCGAAmember of MAP Kinase 
AT2G01450.2AAACCGAAmember of MAP Kinase 
AT2G01450.2AAACCGAAmember of MAP Kinase 
AT2G01450.3AAACCGAAmember of MAP Kinase 
AT2G01450.3AAACCGAAmember of MAP Kinase 
AT2G01450.4AAACCGAAmember of MAP Kinase 
AT2G01450.4AAACCGAAmember of MAP Kinase 
AT2G02160AT2G02160.1ATAAACCGAACzinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Has 10894 Blast hits to 6834 proteins in 394 species: Archae - 15; Bacteria - 298; Metazoa - 5860; Fungi - 845; Plants - 435; Viruses - 183; Other Eukaryotes - 3258 (source: NCBI BLink). 
AT2G02160.1GTTCGGTTTAAzinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Has 10894 Blast hits to 6834 proteins in 394 species: Archae - 15; Bacteria - 298; Metazoa - 5860; Fungi - 845; Plants - 435; Viruses - 183; Other Eukaryotes - 3258 (source: NCBI BLink). 
AT2G02390AT2G02390.1ATAAACCGAAEncodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. 
AT2G02390.2ATAAACCGAAEncodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. 
AT2G02390.3ATAAACCGAAEncodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. 
AT2G02590AT2G02590.1TTCGGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative small multi-drug export (InterPro:IPR009577); Has 213 Blast hits to 213 proteins in 89 species: Archae - 35; Bacteria - 146; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). 
AT2G02850AT2G02850.1AAACCGAAEncodes plantacyanin one of blue copper proteins. Involved in anther development and pollination. Expressed in the transmitting tract of the pistil. 
AT2G03430AT2G03430.1AAACCGAAankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G19150.1); Has 104929 Blast hits to 30234 proteins in 997 species: Archae - 84; Bacteria - 8435; Metazoa - 52441; Fungi - 8607; Plants - 4055; Viruses - 2006; Other Eukaryotes - 29301 (source: NCBI BLink). 
AT2G03470AT2G03470.1TTCGGTTTATAAACCGGTTAAmyb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink). 
AT2G03470.2TTCGGTTTATAAACCGGTTAAmyb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink). 
AT2G03690AT2G03690.1TTCGGTTTUbiquinone biosynthesis protein COQ4 homolog. 
AT2G04430AT2G04430.1AAACCGAACCAArabidopsis thaliana Nudix hydrolase homolog 5 (atnudt5); FUNCTIONS IN: hydrolase activity; LOCATED IN: cytosol; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Anti-sense to fibroblast growth factor protein GFG (InterPro:IPR003293); BEST Arabidopsis thaliana protein match is: ATNUDT6 (Arabidopsis thaliana Nudix hydrolase homolog 6); ADP-ribose diphosphatase/ NAD or NADH binding / hydrolase (TAIR:AT2G04450.1); Has 1869 Blast hits to 1867 proteins in 436 species: Archae - 16; Bacteria - 904; Metazoa - 164; Fungi - 13; Plants - 89; Viruses - 9; Other Eukaryotes - 674 (source: NCBI BLink). 
AT2G04520AT2G04520.1AAACCGAACeukaryotic translation initiation factor 1A, putative / eIF-1A, putative / eIF-4C, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, IF1 type (InterPro:IPR006196), Translation initiation factor 1A (eIF-1A), conserved site (InterPro:IPR018104), Translation initiation factor 1A (eIF-1A) (InterPro:IPR001253); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 1A, putative / eIF-1A, putative / eIF-4C, putative (TAIR:AT5G35680.2); Has 760 Blast hits to 760 proteins in 211 species: Archae - 192; Bacteria - 0; Metazoa - 195; Fungi - 64; Plants - 47; Viruses - 0; Other Eukaryotes - 262 (source: NCBI BLink). 
AT2G04700AT2G04700.1CTAAACCGAATTGAACCGferredoxin thioredoxin reductase catalytic beta chain family protein; FUNCTIONS IN: ferredoxin:thioredoxin reductase activity, ferredoxin reductase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin thioredoxin reductase, beta subunit (InterPro:IPR004209); Has 204 Blast hits to 204 proteins in 84 species: Archae - 14; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). 
AT2G04890AT2G04890.1TTCGGTTTAAEncodes a scarecrow-like protein (SCL21). Member of GRAS gene family. 
AT2G05310AT2G05310.1TTCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G13500.1); Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G05620AT2G05620.1ATAAACCGAAInvolved in electron flow in Photosystem I. Essential for photoprotection. 
AT2G05620.1CCAAACCGAACCGAInvolved in electron flow in Photosystem I. Essential for photoprotection. 
AT2G05910AT2G05910.1AACCGAACCCAAACCGAACCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20640.1); Has 150 Blast hits to 150 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G05910.1TTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20640.1); Has 150 Blast hits to 150 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G06010AT2G06010.1AAACCGAAencodes a novel protein whose expression level is induced in lines overexpressing salicylic-acid (SA)-inducible Arabidopsis DNA binding with one finger (Dof) transcription factor, called OBF-binding protein 3. 
AT2G06010.1TTAAACCGAAencodes a novel protein whose expression level is induced in lines overexpressing salicylic-acid (SA)-inducible Arabidopsis DNA binding with one finger (Dof) transcription factor, called OBF-binding protein 3. 
AT2G14460AT2G14460.1AAACCGAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G14460.1GTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G14460.1GTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G16640AT2G16640.1CCAAACCGAAMULTIMERIC TRANSLOCON COMPLEX IN THE OUTER ENVELOPE MEMBRANE 132 (TOC132); FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: protein targeting to chloroplast; LOCATED IN: chloroplast outer membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloroplast protein import component Toc86/159 (InterPro:IPR005690), AIG1 (InterPro:IPR006703); BEST Arabidopsis thaliana protein match is: ATTOC120; GTP binding (TAIR:AT3G16620.1); Has 6352 Blast hits to 4186 proteins in 415 species: Archae - 14; Bacteria - 449; Metazoa - 2396; Fungi - 635; Plants - 342; Viruses - 83; Other Eukaryotes - 2433 (source: NCBI BLink). 
AT2G16640.1TTAAACCGAAMULTIMERIC TRANSLOCON COMPLEX IN THE OUTER ENVELOPE MEMBRANE 132 (TOC132); FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: protein targeting to chloroplast; LOCATED IN: chloroplast outer membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloroplast protein import component Toc86/159 (InterPro:IPR005690), AIG1 (InterPro:IPR006703); BEST Arabidopsis thaliana protein match is: ATTOC120; GTP binding (TAIR:AT3G16620.1); Has 6352 Blast hits to 4186 proteins in 415 species: Archae - 14; Bacteria - 449; Metazoa - 2396; Fungi - 635; Plants - 342; Viruses - 83; Other Eukaryotes - 2433 (source: NCBI BLink). 
AT2G16930AT2G16930.1AAACCGAACCGAACCribosomal protein L27 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT5G15220.1); Has 5103 Blast hits to 5103 proteins in 1534 species: Archae - 0; Bacteria - 2966; Metazoa - 94; Fungi - 93; Plants - 70; Viruses - 0; Other Eukaryotes - 1880 (source: NCBI BLink). 
AT2G16930.2AAACCGAACCGAACCribosomal protein L27 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT5G15220.1); Has 5103 Blast hits to 5103 proteins in 1534 species: Archae - 0; Bacteria - 2966; Metazoa - 94; Fungi - 93; Plants - 70; Viruses - 0; Other Eukaryotes - 1880 (source: NCBI BLink). 
AT2G16930.3AAACCGAACCGAACCribosomal protein L27 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT5G15220.1); Has 5103 Blast hits to 5103 proteins in 1534 species: Archae - 0; Bacteria - 2966; Metazoa - 94; Fungi - 93; Plants - 70; Viruses - 0; Other Eukaryotes - 1880 (source: NCBI BLink). 
AT2G17265AT2G17265.1GTTCGGTTTEncodes a homoserine kinase (HSK) which produces O-phospho-L-homoserine (HserP), a compound at the branching point of methionine and threonine biosynthesis. HSK is found in the stromal fraction of chloroplasts. 
AT2G17510AT2G17510.1TTCGGTTTAAEMBRYO DEFECTIVE 2763 (EMB2763); FUNCTIONS IN: ribonuclease activity, RNA binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide binding protein, PINc (InterPro:IPR006596), Ribonuclease II and R (InterPro:IPR001900); BEST Arabidopsis thaliana protein match is: ribonuclease II family protein (TAIR:AT1G77680.1); Has 5395 Blast hits to 5320 proteins in 1284 species: Archae - 25; Bacteria - 2941; Metazoa - 370; Fungi - 272; Plants - 61; Viruses - 2; Other Eukaryotes - 1724 (source: NCBI BLink). 
AT2G17790AT2G17790.1TTCGGTTTVPS35 HOMOLOG A (VPS35A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport, retrograde transport, endosome to Golgi; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated protein 35 (InterPro:IPR005378); BEST Arabidopsis thaliana protein match is: VPS35B (VPS35 HOMOLOG B) (TAIR:AT1G75850.1); Has 463 Blast hits to 387 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 144; Plants - 38; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT2G18390AT2G18390.1GTTCGGTTTATEncodes a member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Mutant has abnormal mitosis and cell cycle control during seed development. 
AT2G18465AT2G18465.1AAACCGAACDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G42080.1); Has 685 Blast hits to 685 proteins in 152 species: Archae - 6; Bacteria - 112; Metazoa - 268; Fungi - 15; Plants - 75; Viruses - 0; Other Eukaryotes - 209 (source: NCBI BLink). 
AT2G18800AT2G18800.1TTCGGTTTAGXYLOGLUCAN ENDOTRANSGLUCOSYLASE/HYDROLASE 21 (XTH21); FUNCTIONS IN: hydrolase activity, acting on glycosyl bonds, xyloglucan endotransglucosylase activity; INVOLVED IN: primary root development, cell wall modification; LOCATED IN: endomembrane system, apoplast, cell wall; EXPRESSED IN: stem, flower, root, leaf; CONTAINS InterPro DOMAIN/s: Xyloglucan endotransglucosylase/hydrolase (InterPro:IPR016455), Xyloglucan endo-transglycosylase, C-terminal (InterPro:IPR010713), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Glycoside hydrolase, family 16 (InterPro:IPR000757), Glycoside hydrolase, family 16, active site (InterPro:IPR008263); BEST Arabidopsis thaliana protein match is: TCH4 (Touch 4); hydrolase, acting on glycosyl bonds / xyloglucan:xyloglucosyl transferase (TAIR:AT5G57560.1); Has 1424 Blast hits to 1415 proteins in 222 species: Archae - 0; Bacteria - 205; Metazoa - 0; Fungi - 298; Plants - 809; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink). 
AT2G18940AT2G18940.1TCGGTTCGGTTCGGTTTAGpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G02860.1); Has 28771 Blast hits to 6230 proteins in 192 species: Archae - 4; Bacteria - 37; Metazoa - 1100; Fungi - 676; Plants - 25361; Viruses - 0; Other Eukaryotes - 1593 (source: NCBI BLink). 
AT2G19385AT2G19385.1TGGTTCGGTTTATzinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2, LYAR-type (InterPro:IPR014898); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G19380.1); Has 443 Blast hits to 397 proteins in 133 species: Archae - 0; Bacteria - 6; Metazoa - 196; Fungi - 75; Plants - 41; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). 
AT2G19570AT2G19570.1AAACCGAAEncodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds. 
AT2G19570.1AAACCGAACCAEncodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds. 
AT2G19570.1GTAAACCGAAEncodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds. 
AT2G20130AT2G20130.1TTCGGTTTAALIKE COV 1 (LCV1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, flower, root, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1965 Blast hits to 1965 proteins in 370 species: Archae - 6; Bacteria - 694; Metazoa - 0; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 1180 (source: NCBI BLink). 
AT2G20140AT2G20140.1TTAAACCGAA26S protease regulatory complex subunit 4, putative; FUNCTIONS IN: hydrolase activity, nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), 26S proteasome subunit P45 (InterPro:IPR005937); BEST Arabidopsis thaliana protein match is: RPT2a (regulatory particle AAA-ATPase 2a); ATPase (TAIR:AT4G29040.1); Has 21701 Blast hits to 20141 proteins in 1744 species: Archae - 831; Bacteria - 5748; Metazoa - 4078; Fungi - 2440; Plants - 1746; Viruses - 26; Other Eukaryotes - 6832 (source: NCBI BLink). 
AT2G21440AT2G21440.1CTAAACCGAARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: SCL28; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT5G18810.1); Has 29840 Blast hits to 16953 proteins in 878 species: Archae - 28; Bacteria - 2817; Metazoa - 13587; Fungi - 3327; Plants - 3239; Viruses - 21; Other Eukaryotes - 6821 (source: NCBI BLink). 
AT2G21500AT2G21500.1TTAAACCGAAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT2G21500.2TTAAACCGAAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT2G23310AT2G23310.1GTTCGGTTTEncodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. 
AT2G23310.2GTTCGGTTTEncodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. 
AT2G23670AT2G23670.1AAACCGAAArabidopsis homolog of Synechocystis YCF37 (YCF37); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G24090AT2G24090.1TAACCGGAATAAACCGAAGTAAACCGGATribosomal protein L35 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35, conserved site (InterPro:IPR018265), Ribosomal protein L35 (InterPro:IPR001706); Has 3401 Blast hits to 3401 proteins in 1037 species: Archae - 0; Bacteria - 2119; Metazoa - 6; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1232 (source: NCBI BLink). 
AT2G24360AT2G24360.1AAACCGAAserine/threonine/tyrosine kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G31170.3); Has 96787 Blast hits to 95023 proteins in 3525 species: Archae - 68; Bacteria - 8423; Metazoa - 42926; Fungi - 8081; Plants - 19355; Viruses - 602; Other Eukaryotes - 17332 (source: NCBI BLink). 
AT2G25280AT2G25280.1AAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator of ErbB2-driven cell motility (Memo), related (InterPro:IPR002737); Has 742 Blast hits to 742 proteins in 323 species: Archae - 138; Bacteria - 240; Metazoa - 132; Fungi - 82; Plants - 26; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink). 
AT2G25280.1AAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator of ErbB2-driven cell motility (Memo), related (InterPro:IPR002737); Has 742 Blast hits to 742 proteins in 323 species: Archae - 138; Bacteria - 240; Metazoa - 132; Fungi - 82; Plants - 26; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink). 
AT2G25280.1AAACCGAAGCCCAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator of ErbB2-driven cell motility (Memo), related (InterPro:IPR002737); Has 742 Blast hits to 742 proteins in 323 species: Archae - 138; Bacteria - 240; Metazoa - 132; Fungi - 82; Plants - 26; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink). 
AT2G25355AT2G25355.1CTAAACCGAAexonuclease-related; FUNCTIONS IN: RNA binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT4G32175.1); Has 294 Blast hits to 294 proteins in 141 species: Archae - 16; Bacteria - 0; Metazoa - 101; Fungi - 85; Plants - 32; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). 
AT2G25355.2CTAAACCGAAexonuclease-related; FUNCTIONS IN: RNA binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT4G32175.1); Has 294 Blast hits to 294 proteins in 141 species: Archae - 16; Bacteria - 0; Metazoa - 101; Fungi - 85; Plants - 32; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). 
AT2G25870AT2G25870.1TTCGGTTTAGhaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cof protein (InterPro:IPR000150), HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), HAD superfamily hydrolase-like, type 3 (InterPro:IPR013200), Uncharacterised protein family UPF0054 (InterPro:IPR002036); Has 11617 Blast hits to 11603 proteins in 1525 species: Archae - 144; Bacteria - 9370; Metazoa - 28; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 2020 (source: NCBI BLink). 
AT2G26910AT2G26910.1TTCGGTTTPLEIOTROPIC DRUG RESISTANCE 4 (PDR4); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 (InterPro:IPR000412), Plant PDR ABC transporter associated (InterPro:IPR013581), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: PDR12 (PLEIOTROPIC DRUG RESISTANCE 12); ATPase, coupled to transmembrane movement of substances (TAIR:AT1G15520.1); Has 227772 Blast hits to 156896 proteins in 2502 species: Archae - 4872; Bacteria - 164954; Metazoa - 8485; Fungi - 4883; Plants - 3129; Viruses - 4; Other Eukaryotes - 41445 (source: NCBI BLink). 
AT2G27260AT2G27260.1GGTTCGGTTTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); Has 584 Blast hits to 584 proteins in 25 species: Archae - 2; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 578; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT2G28450AT2G28450.1CTAAACCGAAzinc finger (CCCH-type) family protein; FUNCTIONS IN: methyltransferase activity, zinc ion binding, RNA methyltransferase activity, nucleic acid binding; INVOLVED IN: acetate biosynthetic process from carbon monoxide, methanol oxidation, RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Methyltransferase small (InterPro:IPR007848), (Uracil-5)-methyltransferase (InterPro:IPR010280); BEST Arabidopsis thaliana protein match is: RNA methyltransferase family protein (TAIR:AT3G21300.1); Has 4397 Blast hits to 3845 proteins in 1016 species: Archae - 74; Bacteria - 3383; Metazoa - 309; Fungi - 76; Plants - 54; Viruses - 3; Other Eukaryotes - 498 (source: NCBI BLink). 
AT2G28670AT2G28670.2TTCGGTTTdisease resistance-responsive family protein / fibroin-related; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Plant disease resistance response protein (InterPro:IPR004265); BEST Arabidopsis thaliana protein match is: disease resistance-responsive family protein (TAIR:AT1G07730.2); Has 127252 Blast hits to 41131 proteins in 1818 species: Archae - 210; Bacteria - 40368; Metazoa - 38138; Fungi - 8383; Plants - 10809; Viruses - 1932; Other Eukaryotes - 27412 (source: NCBI BLink). 
AT2G31170AT2G31170.1TTAAACCGAACCGGAAASYCO ARATH; FUNCTIONS IN: cysteine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: cysteinyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cysteinyl-tRNA synthetase, class Ia (InterPro:IPR002308), Cysteinyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015803), Cysteinyl-tRNA synthetase, class Ia, C-terminal (InterPro:IPR015804), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (C) family protein (TAIR:AT5G38830.1); Has 8663 Blast hits to 8413 proteins in 1630 species: Archae - 200; Bacteria - 3464; Metazoa - 434; Fungi - 181; Plants - 82; Viruses - 3; Other Eukaryotes - 4299 (source: NCBI BLink). 
AT2G31740AT2G31740.1TTTCCGGTTCGGTTTGGmethyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: spermidine synthase-related / putrescine aminopropyltransferase-related (TAIR:AT5G04610.1); Has 1448 Blast hits to 1421 proteins in 339 species: Archae - 18; Bacteria - 478; Metazoa - 298; Fungi - 34; Plants - 123; Viruses - 0; Other Eukaryotes - 497 (source: NCBI BLink). 
AT2G31970AT2G31970.1TTCGGTTTAARAD50; FUNCTIONS IN: zinc ion binding, ATP binding, nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: chromosome, Mre11 complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc hook, Rad50 (InterPro:IPR013134), Rad50 zinc hook (InterPro:IPR007517), RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395), Recombination/repair protein Rad50 (InterPro:IPR004584); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27595.1); Has 83241 Blast hits to 43267 proteins in 1813 species: Archae - 1109; Bacteria - 10221; Metazoa - 39962; Fungi - 5795; Plants - 2652; Viruses - 436; Other Eukaryotes - 23066 (source: NCBI BLink). 
AT2G32680AT2G32680.1GTTCGGTTTAGReceptor Like Protein 23 (AtRLP23); FUNCTIONS IN: protein binding, kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP24 (Receptor Like Protein 24); kinase/ protein binding (TAIR:AT2G33020.1); Has 79005 Blast hits to 22425 proteins in 849 species: Archae - 56; Bacteria - 5890; Metazoa - 27312; Fungi - 979; Plants - 38797; Viruses - 48; Other Eukaryotes - 5923 (source: NCBI BLink). 
AT2G32840AT2G32840.1AAACCGAACCAproline-rich family protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT1G04930.1); Has 733 Blast hits to 646 proteins in 145 species: Archae - 4; Bacteria - 102; Metazoa - 178; Fungi - 111; Plants - 168; Viruses - 37; Other Eukaryotes - 133 (source: NCBI BLink). 
AT2G32840.2AAACCGAACCAproline-rich family protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT1G04930.1); Has 733 Blast hits to 646 proteins in 145 species: Archae - 4; Bacteria - 102; Metazoa - 178; Fungi - 111; Plants - 168; Viruses - 37; Other Eukaryotes - 133 (source: NCBI BLink). 
AT2G34190AT2G34190.1TTCGGTTTxanthine/uracil permease family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Xanthine/uracil permease (InterPro:IPR006042), Xanthine/uracil/vitamin C permease (InterPro:IPR006043); BEST Arabidopsis thaliana protein match is: xanthine/uracil permease family protein (TAIR:AT2G05760.1); Has 4705 Blast hits to 4685 proteins in 930 species: Archae - 37; Bacteria - 3266; Metazoa - 310; Fungi - 84; Plants - 292; Viruses - 1; Other Eukaryotes - 715 (source: NCBI BLink). 
AT2G34690AT2G34690.1AAACCGAAGene product transports the glycolipid precursor sphingosine between membranes in vitro. Mutant constitutively expresses defense-related genes that accompany the hypersensitive response normally triggered by avirulent pathogens. 
AT2G34710AT2G34710.1ATAAACCGAADominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. 
AT2G34740AT2G34740.1ACGGTTTAGATAAACCGAAcatalytic/ protein serine/threonine phosphatase; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 5333 Blast hits to 5320 proteins in 675 species: Archae - 7; Bacteria - 1029; Metazoa - 1363; Fungi - 524; Plants - 1327; Viruses - 11; Other Eukaryotes - 1072 (source: NCBI BLink). 
AT2G35410AT2G35410.1AAACCGAA33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT4G09040.2); Has 19540 Blast hits to 13531 proteins in 594 species: Archae - 12; Bacteria - 1397; Metazoa - 10397; Fungi - 2454; Plants - 3010; Viruses - 0; Other Eukaryotes - 2270 (source: NCBI BLink). 
AT2G35780AT2G35780.1TTCGGTTTCTTATTGGserine carboxypeptidase-like 26 (scpl26); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: SCPL27 (serine carboxypeptidase-like 27); serine-type carboxypeptidase (TAIR:AT3G07990.1); Has 2609 Blast hits to 2552 proteins in 299 species: Archae - 0; Bacteria - 182; Metazoa - 580; Fungi - 562; Plants - 967; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink). 
AT2G36070AT2G36070.1AAACCGAACCTTAATGGGCOne of two genes in Arabidopsis that encode a putative subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is thought to provide the energy for translocation via hydrolysis of ATP. 
AT2G37190AT2G37190.1GTAAACCGAAC60S ribosomal protein L12 (RPL12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cold, ribosome biogenesis; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L12 (RPL12B) (TAIR:AT3G53430.1); Has 1152 Blast hits to 1152 proteins in 433 species: Archae - 208; Bacteria - 278; Metazoa - 292; Fungi - 109; Plants - 81; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). 
AT2G37680AT2G37680.1AAACCGAACCGGGTCONTAINS InterPro DOMAIN/s: Vacuolar import and degradation protein Vid24 (InterPro:IPR018618); Has 214 Blast hits to 214 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 124; Plants - 31; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT2G38550AT2G38550.1TTCGGTTTGGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57280.1); Has 94 Blast hits to 92 proteins in 26 species: Archae - 0; Bacteria - 4; Metazoa - 3; Fungi - 4; Plants - 69; Viruses - 7; Other Eukaryotes - 7 (source: NCBI BLink). 
AT2G38646AT2G38646.1TTAAACCGAAunknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). 
AT2G38670AT2G38670.1AAACCGGTTTTGGTTCGGTTTAGEncodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis. 
AT2G38670.1TGGTTCGGTTTAGEncodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis. 
AT2G38740AT2G38740.1CTAAACCGAAhaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), Haloacid dehydrogenase/epoxide hydrolase (InterPro:IPR005833), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT1G56500.1); Has 10291 Blast hits to 10291 proteins in 1397 species: Archae - 137; Bacteria - 7267; Metazoa - 142; Fungi - 274; Plants - 203; Viruses - 3; Other Eukaryotes - 2265 (source: NCBI BLink). 
AT2G38780AT2G38780.1CTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 1; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT2G38780.1GTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 1; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT2G40085AT2G40085.1TGGTTCGGTTTGGTTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). 
AT2G40316AT2G40316.1TGGTTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G40316.2TGGTTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G40490AT2G40490.1AAACCGAACCAHEME2; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME1; uroporphyrinogen decarboxylase (TAIR:AT3G14930.2); Has 5539 Blast hits to 5539 proteins in 1187 species: Archae - 101; Bacteria - 2315; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2763 (source: NCBI BLink). 
AT2G41600AT2G41600.1ATAAACCGAATTAAACCGAACCGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.1TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.2ATAAACCGAATTAAACCGAACCGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.2TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.3ATAAACCGAATTAAACCGAACCGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.3TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.4ATAAACCGAATTAAACCGAACCGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.4TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.5ATAAACCGAATTAAACCGAACCGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G41600.5TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT2G42750AT2G42750.1TTCGGTTTDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G23240.1); Has 11990 Blast hits to 11989 proteins in 1806 species: Archae - 113; Bacteria - 4757; Metazoa - 2272; Fungi - 965; Plants - 810; Viruses - 15; Other Eukaryotes - 3058 (source: NCBI BLink). 
AT2G42780AT2G42780.1TGGTTCGGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of transcription; LOCATED IN: integral to membrane, nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase II transcription factor SIII, subunit A (InterPro:IPR010684); Has 143 Blast hits to 142 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 19; Plants - 18; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT2G43180AT2G43180.1TTCGGTTTcatalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink). 
AT2G43180.2TTCGGTTTcatalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink). 
AT2G43180.3TTCGGTTTcatalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink). 
AT2G43180.4TTCGGTTTcatalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink). 
AT2G43210AT2G43210.1TTAAACCGAACUBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); Has 1155 Blast hits to 742 proteins in 155 species: Archae - 0; Bacteria - 70; Metazoa - 347; Fungi - 206; Plants - 87; Viruses - 16; Other Eukaryotes - 429 (source: NCBI BLink). 
AT2G43210.2TTAAACCGAACUBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); Has 1155 Blast hits to 742 proteins in 155 species: Archae - 0; Bacteria - 70; Metazoa - 347; Fungi - 206; Plants - 87; Viruses - 16; Other Eukaryotes - 429 (source: NCBI BLink). 
AT2G43250AT2G43250.1CCAAACCGAAunknown protein; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G44530AT2G44530.1ATAAACCGAAribose-phosphate pyrophosphokinase, putative / phosphoribosyl diphosphate synthetase, putative; FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 2 / phosphoribosyl diphosphate synthetase 2 (PRS2) (TAIR:AT1G32380.1); Has 7996 Blast hits to 7829 proteins in 1556 species: Archae - 171; Bacteria - 3334; Metazoa - 500; Fungi - 457; Plants - 129; Viruses - 7; Other Eukaryotes - 3398 (source: NCBI BLink). 
AT2G44530.2ATAAACCGAAribose-phosphate pyrophosphokinase, putative / phosphoribosyl diphosphate synthetase, putative; FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 2 / phosphoribosyl diphosphate synthetase 2 (PRS2) (TAIR:AT1G32380.1); Has 7996 Blast hits to 7829 proteins in 1556 species: Archae - 171; Bacteria - 3334; Metazoa - 500; Fungi - 457; Plants - 129; Viruses - 7; Other Eukaryotes - 3398 (source: NCBI BLink). 
AT2G46735AT2G46735.1AAACCGAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 5 Blast hits to 5 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G01480AT3G01480.1AAACCGAAEncodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. 
AT3G01480.2AAACCGAAEncodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. 
AT3G03120AT3G03120.1GTAAACCGAAA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. 
AT3G03370AT3G03370.1TTCGGTTTACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT5G06050.1); Has 26 Blast hits to 26 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03890AT3G03890.1GTAAACCGAAFMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). 
AT3G03890.2GTAAACCGAAFMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). 
AT3G04080AT3G04080.1TTCGGTTTAGEncodes an enzyme with ATPase and ADPase activity (an apyrase) that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination. 
AT3G04830AT3G04830.1TTAAACCGAACCGGTTCAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT3G04830.2TTAAACCGAACCGGTTCAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT3G05200AT3G05200.1AAACCGAAEncodes a putative RING-H2 zinc finger protein ATL6 (ATL6). 
AT3G05230AT3G05230.1TTAAACCGAAsignal peptidase subunit family protein; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endoplasmic reticulum, cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Signal peptidase 22 kDa subunit (InterPro:IPR007653); BEST Arabidopsis thaliana protein match is: signal peptidase subunit family protein (TAIR:AT5G27430.1); Has 300 Blast hits to 300 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). 
AT3G05230.2TTAAACCGAAsignal peptidase subunit family protein; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endoplasmic reticulum, cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Signal peptidase 22 kDa subunit (InterPro:IPR007653); BEST Arabidopsis thaliana protein match is: signal peptidase subunit family protein (TAIR:AT5G27430.1); Has 300 Blast hits to 300 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 90; Plants - 44; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). 
AT3G05570AT3G05570.1TTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G39235.1); Has 39 Blast hits to 39 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G05570.1TTCGGTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G39235.1); Has 39 Blast hits to 39 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G06140AT3G06140.1TTAAACCGAACzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G19080.1); Has 6615 Blast hits to 4433 proteins in 311 species: Archae - 2; Bacteria - 83; Metazoa - 2278; Fungi - 466; Plants - 2616; Viruses - 263; Other Eukaryotes - 907 (source: NCBI BLink). 
AT3G06960AT3G06960.1AAACCGAAPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G06960.2AAACCGAAPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G07140AT3G07140.1AAACCGAAGPI transamidase component Gpi16 subunit family protein; FUNCTIONS IN: GPI-anchor transamidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gpi16 subunit, GPI transamidase component (InterPro:IPR007245); Has 252 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 88; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT3G07140.2AAACCGAAGPI transamidase component Gpi16 subunit family protein; FUNCTIONS IN: GPI-anchor transamidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gpi16 subunit, GPI transamidase component (InterPro:IPR007245); Has 252 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 88; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT3G07670AT3G07670.1AAACCGAACCAAACCGSET domain-containing protein; FUNCTIONS IN: [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco methyltransferase (InterPro:IPR011192), SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT5G14260.3); Has 844 Blast hits to 844 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 238; Plants - 226; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). 
AT3G08720AT3G08720.1GTTCGGTTTCCCAATAGEncodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. 
AT3G08720.2GTTCGGTTTCCCAATAGEncodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. 
AT3G08740AT3G08740.1CGGTTCGGTTTelongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P (InterPro:IPR011768), Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT4G26310.1); Has 6860 Blast hits to 6860 proteins in 1429 species: Archae - 3; Bacteria - 4309; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 2510 (source: NCBI BLink). 
AT3G09360AT3G09360.1TTCGGTTTAGRNA polymerase II transcription factor/ protein binding / transcription activator/ transcription regulator/ translation initiation factor/ zinc ion binding; FUNCTIONS IN: in 6 functions; INVOLVED IN: translational initiation, positive regulation of transcription, regulation of transcription, DNA-dependent, transcription initiation; LOCATED IN: transcription factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor TFIIB related (InterPro:IPR000812), Cyclin-like (InterPro:IPR011028), Transcription factor TFIIB, cyclin-related (InterPro:IPR013150), Cyclin-related (InterPro:IPR013763), Brf1-like TBP-binding (InterPro:IPR011665), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: MEE65 (maternal effect embryo arrest 65); RNA polymerase II transcription factor/ cation:chloride symporter (TAIR:AT2G01280.1); Has 20399 Blast hits to 12051 proteins in 760 species: Archae - 341; Bacteria - 837; Metazoa - 8420; Fungi - 1909; Plants - 698; Viruses - 262; Other Eukaryotes - 7932 (source: NCBI BLink). 
AT3G09370AT3G09370.1GTTCGGTTTGGputative c-myb-like transcription factor (MYB3R3) mRNA, 
AT3G09370.2GTTCGGTTTGGputative c-myb-like transcription factor (MYB3R3) mRNA, 
AT3G09470AT3G09470.1ATAAACCGAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). 
AT3G09470.2ATAAACCGAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). 
AT3G09700AT3G09700.1AAACCGAADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G35795.1); Has 701 Blast hits to 701 proteins in 218 species: Archae - 0; Bacteria - 144; Metazoa - 169; Fungi - 136; Plants - 46; Viruses - 2; Other Eukaryotes - 204 (source: NCBI BLink). 
AT3G10030AT3G10030.1AAACCGAAaspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). 
AT3G10030.1TGGTTCGGTTTGGaspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). 
AT3G10030.1TTCGGTTTGGaspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). 
AT3G10030.2AAACCGAAaspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). 
AT3G10030.2TGGTTCGGTTTGGaspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). 
AT3G10030.2TTCGGTTTGGaspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Aspartate/glutamate/uridylate kinase (InterPro:IPR001048), MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: aspartate/glutamate/uridylate kinase family protein (TAIR:AT3G18680.1); Has 5113 Blast hits to 5109 proteins in 1474 species: Archae - 117; Bacteria - 3243; Metazoa - 36; Fungi - 2; Plants - 203; Viruses - 0; Other Eukaryotes - 1512 (source: NCBI BLink). 
AT3G10070AT3G10070.1TTCGGTTTAAEncodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. 
AT3G10860AT3G10860.1TTCGGTTTACubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT5G05370.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G11320AT3G11320.1CCAAACCGAACCGAorganic anion transmembrane transporter; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT5G05820.1); Has 2042 Blast hits to 2037 proteins in 214 species: Archae - 8; Bacteria - 61; Metazoa - 646; Fungi - 307; Plants - 755; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink). 
AT3G11590AT3G11590.1TTCGGTTTAAGTCGGTTTACunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22310.1); Has 18950 Blast hits to 12386 proteins in 794 species: Archae - 267; Bacteria - 1381; Metazoa - 9845; Fungi - 1311; Plants - 683; Viruses - 61; Other Eukaryotes - 5402 (source: NCBI BLink). 
AT3G11710AT3G11710.1ATAAACCGAAARABIDOPSIS THALIANA LYSYL-TRNA SYNTHETASE 1 (ATKRS-1); FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, lysine-tRNA ligase activity, ATP binding, nucleic acid binding; INVOLVED IN: lysyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Lysyl-tRNA synthetase, class II, C-terminal (InterPro:IPR018149), Lysyl-tRNA synthetase, class II (InterPro:IPR002313), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 15525 Blast hits to 13421 proteins in 1696 species: Archae - 251; Bacteria - 8760; Metazoa - 567; Fungi - 510; Plants - 102; Viruses - 0; Other Eukaryotes - 5335 (source: NCBI BLink). 
AT3G11710.1GTAAACCGAATAAGCCCTAARABIDOPSIS THALIANA LYSYL-TRNA SYNTHETASE 1 (ATKRS-1); FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, lysine-tRNA ligase activity, ATP binding, nucleic acid binding; INVOLVED IN: lysyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Lysyl-tRNA synthetase, class II, C-terminal (InterPro:IPR018149), Lysyl-tRNA synthetase, class II (InterPro:IPR002313), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 15525 Blast hits to 13421 proteins in 1696 species: Archae - 251; Bacteria - 8760; Metazoa - 567; Fungi - 510; Plants - 102; Viruses - 0; Other Eukaryotes - 5335 (source: NCBI BLink). 
AT3G12070AT3G12070.1TTCGGTTTAGgeranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Prenyltransferase/squalene oxidase (InterPro:IPR001330); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative (TAIR:AT5G12210.1); Has 1147 Blast hits to 1009 proteins in 184 species: Archae - 0; Bacteria - 22; Metazoa - 467; Fungi - 295; Plants - 126; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink). 
AT3G12070.2TTCGGTTTAGgeranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Prenyltransferase/squalene oxidase (InterPro:IPR001330); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase type II beta subunit, putative / RAB geranylgeranyltransferase beta subunit, putative (TAIR:AT5G12210.1); Has 1147 Blast hits to 1009 proteins in 184 species: Archae - 0; Bacteria - 22; Metazoa - 467; Fungi - 295; Plants - 126; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink). 
AT3G12080AT3G12080.1CTAAACCGAAembryo defective 2738 (emb2738); FUNCTIONS IN: GTP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), Small GTP-binding protein (InterPro:IPR005225), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT5G39960.1); Has 29827 Blast hits to 16895 proteins in 1667 species: Archae - 139; Bacteria - 20018; Metazoa - 342; Fungi - 286; Plants - 215; Viruses - 0; Other Eukaryotes - 8827 (source: NCBI BLink). 
AT3G12080.2CTAAACCGAAembryo defective 2738 (emb2738); FUNCTIONS IN: GTP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), Small GTP-binding protein (InterPro:IPR005225), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT5G39960.1); Has 29827 Blast hits to 16895 proteins in 1667 species: Archae - 139; Bacteria - 20018; Metazoa - 342; Fungi - 286; Plants - 215; Viruses - 0; Other Eukaryotes - 8827 (source: NCBI BLink). 
AT3G12130AT3G12130.1TTCGGTTTACKH domain-containing protein / zinc finger (CCCH type) family protein; FUNCTIONS IN: transcription factor activity, nucleic acid binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein / zinc finger (CCCH type) family protein (TAIR:AT5G06770.1); Has 951 Blast hits to 736 proteins in 106 species: Archae - 0; Bacteria - 4; Metazoa - 647; Fungi - 21; Plants - 174; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). 
AT3G12170AT3G12170.1GTTCGGTTTAADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: ATJ6 (Arabidopsis J-domain protein 6); heat shock protein binding / unfolded protein binding (TAIR:AT5G06910.1); Has 16438 Blast hits to 16435 proteins in 1943 species: Archae - 109; Bacteria - 5179; Metazoa - 3539; Fungi - 1500; Plants - 1231; Viruses - 45; Other Eukaryotes - 4835 (source: NCBI BLink). 
AT3G12260AT3G12260.1GTAAACCGAAcomplex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT3G12550AT3G12550.1CTAAACCGAACCGAXH/XS domain-containing protein / XS zinc finger domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function XS (InterPro:IPR005380), Region of unknown function XH (InterPro:IPR005379), Region of unknown function, putative Zinc finger, XS and XH (InterPro:IPR005381); BEST Arabidopsis thaliana protein match is: XH/XS domain-containing protein / XS zinc finger domain-containing protein (TAIR:AT3G48670.2); Has 23408 Blast hits to 15451 proteins in 943 species: Archae - 218; Bacteria - 2032; Metazoa - 11697; Fungi - 1231; Plants - 587; Viruses - 80; Other Eukaryotes - 7563 (source: NCBI BLink). 
AT3G12600AT3G12600.1TGGGCCCATTAAACCGAAArabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT3G12600.2TGGGCCCATTAAACCGAAArabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT3G12680AT3G12680.1GGGCTTTGTTCGGTTTMember of the floral homeotic AGAMOUS pathway. 
AT3G12690AT3G12690.1TTCGGTTTEncodes a putative serine/threonine kinase It is expressed specifically in pollen and appears to function redundantly with AGC1.7 to regulate polarized growth of pollen tubes. 
AT3G12690.2TTCGGTTTEncodes a putative serine/threonine kinase It is expressed specifically in pollen and appears to function redundantly with AGC1.7 to regulate polarized growth of pollen tubes. 
AT3G12690.3TTCGGTTTEncodes a putative serine/threonine kinase It is expressed specifically in pollen and appears to function redundantly with AGC1.7 to regulate polarized growth of pollen tubes. 
AT3G13230AT3G13230.1TTCGGTTTACRNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087); Has 526 Blast hits to 526 proteins in 226 species: Archae - 118; Bacteria - 0; Metazoa - 138; Fungi - 131; Plants - 49; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). 
AT3G13445AT3G13445.1AAACCGAATBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex 
AT3G13445.2AAACCGAATBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex 
AT3G13930AT3G13930.1AAACCGAAdihydrolipoamide S-acetyltransferase, putative; FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: pyruvate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide acetyltransferase, long form (InterPro:IPR006257), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: dihydrolipoamide S-acetyltransferase, putative (TAIR:AT1G54220.2); Has 15128 Blast hits to 14242 proteins in 1320 species: Archae - 43; Bacteria - 6315; Metazoa - 646; Fungi - 315; Plants - 198; Viruses - 0; Other Eukaryotes - 7611 (source: NCBI BLink). 
AT3G14220AT3G14220.1TTCGGTTTGDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: ESM1 (epithiospecifier modifier 1); carboxylesterase/ hydrolase, acting on ester bonds (TAIR:AT3G14210.1); Has 1563 Blast hits to 1553 proteins in 83 species: Archae - 0; Bacteria - 93; Metazoa - 1; Fungi - 3; Plants - 1460; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT3G14910AT3G14910.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT3G15090AT3G15090.1TCGGTTCGGTTTGGoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 20659 Blast hits to 20565 proteins in 1484 species: Archae - 253; Bacteria - 11042; Metazoa - 1064; Fungi - 2188; Plants - 463; Viruses - 0; Other Eukaryotes - 5649 (source: NCBI BLink). 
AT3G15470AT3G15470.1AAACCGAAWD-40 repeat family protein; FUNCTIONS IN: signal transducer activity; INVOLVED IN: signal transduction; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein (TAIR:AT5G54200.1); Has 26859 Blast hits to 16455 proteins in 561 species: Archae - 48; Bacteria - 3965; Metazoa - 11807; Fungi - 5031; Plants - 2311; Viruses - 6; Other Eukaryotes - 3691 (source: NCBI BLink). 
AT3G15770AT3G15770.1AAACCGAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25360.1); Has 74 Blast hits to 74 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G15770.2AAACCGAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25360.1); Has 74 Blast hits to 74 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G17880AT3G17880.1GTTCGGTTTEncodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. 
AT3G17880.2GTTCGGTTTEncodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. 
AT3G18160AT3G18160.1CGGTTCGGTTTperoxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1). 
AT3G18160.2CGGTTCGGTTTperoxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1). 
AT3G18160.3CGGTTCGGTTTperoxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1). 
AT3G18510AT3G18510.1CTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G18530AT3G18530.1TTCGGTTTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT3G01450.1); Has 132 Blast hits to 132 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT3G18570AT3G18570.1CTAAACCGAAglycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: glycine-rich protein / oleosin (TAIR:AT1G48990.1); Has 235 Blast hits to 235 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 235; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G18890AT3G18890.1CCAAACCGAAbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: flavin reductase-related (TAIR:AT2G34460.1); Has 22640 Blast hits to 13883 proteins in 1103 species: Archae - 75; Bacteria - 3686; Metazoa - 9197; Fungi - 3839; Plants - 1321; Viruses - 607; Other Eukaryotes - 3915 (source: NCBI BLink). 
AT3G20680AT3G20680.1CCAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G20680.1TTCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G21865AT3G21865.1TTCGGTTTATInteracts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes. 
AT3G22220AT3G22220.1AAACCGAAhAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: DNA binding / protein dimerization (TAIR:AT4G15020.2); Has 496 Blast hits to 443 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 490; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT3G22220.2AAACCGAAhAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: DNA binding / protein dimerization (TAIR:AT4G15020.2); Has 496 Blast hits to 443 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 490; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT3G22961AT3G22961.1TTCGGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Paired amphipathic helix (InterPro:IPR003822); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G24093.1); Has 11 Blast hits to 11 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G24100AT3G24100.1AAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Four F5 protein (InterPro:IPR007513); BEST Arabidopsis thaliana protein match is: four F5 protein-related / 4F5 protein-related (TAIR:AT4G13615.1); Has 195 Blast hits to 195 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 136; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT3G24100.1GTAAACCGAACCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Four F5 protein (InterPro:IPR007513); BEST Arabidopsis thaliana protein match is: four F5 protein-related / 4F5 protein-related (TAIR:AT4G13615.1); Has 195 Blast hits to 195 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 136; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT3G24440AT3G24440.1TTCGGTTTEncodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM. 
AT3G24500AT3G24500.1AAACCGAAOne of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses. 
AT3G24800AT3G24800.1AAACCGAAContains two ring finger domains and one ZZ domain. Week similarity to yeast Rad18p. Putative component of the N-end rule pathway (ubiquitin-dependent proteolysis). 
AT3G25290AT3G25290.1AAACCGAAauxin-responsive family protein; INVOLVED IN: multicellular organismal development; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT4G12980.1); Has 386 Blast hits to 386 proteins in 66 species: Archae - 0; Bacteria - 4; Metazoa - 51; Fungi - 67; Plants - 253; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT3G25290.2AAACCGAAauxin-responsive family protein; INVOLVED IN: multicellular organismal development; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT4G12980.1); Has 386 Blast hits to 386 proteins in 66 species: Archae - 0; Bacteria - 4; Metazoa - 51; Fungi - 67; Plants - 253; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT3G25760AT3G25760.1AAACCGAAencodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. 
AT3G25860AT3G25860.1CTAAACCGAANuclear encoded dihydrolipoamide S-acetyltransferase (LTA2) that encodes teh Pyruvate Decarboxylase E2 subunit. Mutant has embryo defect. 
AT3G26630AT3G26630.1ATAAACCGAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 11770 Blast hits to 4443 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 21; Plants - 11596; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). 
AT3G26630.1TTCGGTTTAGpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 11770 Blast hits to 4443 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 21; Plants - 11596; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). 
AT3G26730AT3G26730.1TTAAACCGAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 5616 Blast hits to 1874 proteins in 214 species: Archae - 3; Bacteria - 108; Metazoa - 2179; Fungi - 373; Plants - 239; Viruses - 6; Other Eukaryotes - 2708 (source: NCBI BLink). 
AT3G26922AT3G26922.1AAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G52680.2). 
AT3G27860AT3G27860.1AAACCGAAPWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT5G40340.1); Has 164 Blast hits to 155 proteins in 31 species: Archae - 0; Bacteria - 1; Metazoa - 56; Fungi - 9; Plants - 69; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT3G28710AT3G28710.1TTCGGTTTAAH+-transporting two-sector ATPase, putative; FUNCTIONS IN: hydrogen ion transmembrane transporter activity, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: vacuolar membrane, plasma membrane, vacuole, plant-type vacuole; EXPRESSED IN: cultured cell, callus; CONTAINS InterPro DOMAIN/s: ATPase, V0/A0 complex, subunit C/D (InterPro:IPR002843), ATPase, V0 complex, subunit D (InterPro:IPR016727); BEST Arabidopsis thaliana protein match is: H+-transporting two-sector ATPase, putative (TAIR:AT3G28715.1); Has 443 Blast hits to 442 proteins in 188 species: Archae - 14; Bacteria - 1; Metazoa - 206; Fungi - 98; Plants - 47; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT3G29185AT3G29185.1ATCCGGTTCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 38 Blast hits to 38 proteins in 17 species: Archae - 0; Bacteria - 23; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G29185.2ATCCGGTTCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 38 Blast hits to 38 proteins in 17 species: Archae - 0; Bacteria - 23; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G42950AT3G42950.1TCGGTTCGGTTTglycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT1G19170.1); Has 2496 Blast hits to 2489 proteins in 316 species: Archae - 2; Bacteria - 615; Metazoa - 8; Fungi - 925; Plants - 839; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT3G43520AT3G43520.1AAACCGAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26240.1); Has 432 Blast hits to 415 proteins in 105 species: Archae - 4; Bacteria - 70; Metazoa - 210; Fungi - 11; Plants - 99; Viruses - 7; Other Eukaryotes - 31 (source: NCBI BLink). 
AT3G44340AT3G44340.1AACCGAACTTAAACCGAAChomologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. 
AT3G44340.2AACCGAACTTAAACCGAAChomologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. 
AT3G45770AT3G45770.1TTCGGTTToxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: zinc ion binding, ATP binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion, chloroplast, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NQR; binding / catalytic/ oxidoreductase/ zinc ion binding (TAIR:AT1G49670.1); Has 15702 Blast hits to 15648 proteins in 1321 species: Archae - 139; Bacteria - 8514; Metazoa - 1237; Fungi - 1345; Plants - 386; Viruses - 0; Other Eukaryotes - 4081 (source: NCBI BLink). 
AT3G45770.2TTCGGTTToxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: zinc ion binding, ATP binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion, chloroplast, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NQR; binding / catalytic/ oxidoreductase/ zinc ion binding (TAIR:AT1G49670.1); Has 15702 Blast hits to 15648 proteins in 1321 species: Archae - 139; Bacteria - 8514; Metazoa - 1237; Fungi - 1345; Plants - 386; Viruses - 0; Other Eukaryotes - 4081 (source: NCBI BLink). 
AT3G46130AT3G46130.2AAACCGAAEncodes a putative transcription factor (MYB48) that functions to regulate flavonol biosynthesis primarily in cotyledons. 
AT3G46150AT3G46150.1TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G47120AT3G47120.1AAACCGAACCGARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G19960.1); Has 20793 Blast hits to 16950 proteins in 655 species: Archae - 10; Bacteria - 1203; Metazoa - 11844; Fungi - 2178; Plants - 3009; Viruses - 0; Other Eukaryotes - 2549 (source: NCBI BLink). 
AT3G47836AT3G47836.1ATAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G47836.2ATAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G48990AT3G48990.1AAACCGAAAMP-dependent synthetase and ligase family protein; FUNCTIONS IN: catalytic activity, AMP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: apoplast, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate--CoA ligase, putative / 4-coumaroyl-CoA synthase, putative (TAIR:AT4G05160.1); Has 56117 Blast hits to 51778 proteins in 2278 species: Archae - 561; Bacteria - 29860; Metazoa - 2967; Fungi - 3087; Plants - 1292; Viruses - 1; Other Eukaryotes - 18349 (source: NCBI BLink). 
AT3G49080AT3G49080.1AAACCGAACCGGTribosomal protein S9 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: RPS9 (RIBOSOMAL PROTEIN S9); structural constituent of ribosome (TAIR:AT1G74970.1); Has 5624 Blast hits to 5609 proteins in 1600 species: Archae - 138; Bacteria - 2917; Metazoa - 148; Fungi - 89; Plants - 121; Viruses - 18; Other Eukaryotes - 2193 (source: NCBI BLink). 
AT3G49400AT3G49400.1TTCGGTTTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 724 Blast hits to 645 proteins in 140 species: Archae - 0; Bacteria - 177; Metazoa - 195; Fungi - 136; Plants - 78; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). 
AT3G49770AT3G49770.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G51100AT3G51100.1TGGTTCGGGTTCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G51100.2TGGTTCGGGTTCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G51100.3TGGTTCGGGTTCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G52860AT3G52860.1TTCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 68 Blast hits to 68 proteins in 28 species: Archae - 0; Bacteria - 2; Metazoa - 36; Fungi - 13; Plants - 13; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT3G53110AT3G53110.1ATAAACCGAAEncodes a putative DEAD-Box RNA Helicase and has RNA-dependent ATPase activity. Mutant is Sensitive to chilling stress and heat stress. Germination of the mutant is inhibited by ABA. LOS4 may be involved in temperature sensing. Is enriched in the nuclear envelope and also located in the cytoplasm. LOS4 is involved in export of poly A RNA. 
AT3G53890AT3G53890.1TTCGGTTT40S ribosomal protein S21 (RPS21B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e (InterPro:IPR001931), Ribosomal protein S21e, conserved site (InterPro:IPR018279); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT5G27700.1); Has 478 Blast hits to 478 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 224; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). 
AT3G53890.2TTCGGTTT40S ribosomal protein S21 (RPS21B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e (InterPro:IPR001931), Ribosomal protein S21e, conserved site (InterPro:IPR018279); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT5G27700.1); Has 478 Blast hits to 478 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 224; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). 
AT3G54050AT3G54050.1TTCGGTTTAGfructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative; FUNCTIONS IN: fructose 1,6-bisphosphate 1-phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: response to cold, fructose metabolic process; LOCATED IN: apoplast, stromule, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase/Fructose-1,6-bisphosphatase (InterPro:IPR017955), Fructose-1,6-bisphosphatase (InterPro:IPR000146); BEST Arabidopsis thaliana protein match is: fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative (TAIR:AT1G43670.1); Has 2353 Blast hits to 2350 proteins in 800 species: Archae - 24; Bacteria - 1225; Metazoa - 332; Fungi - 108; Plants - 224; Viruses - 0; Other Eukaryotes - 440 (source: NCBI BLink). 
AT3G54900AT3G54900.1CCAAACCGAACCGGAAA.thaliana PICOT protein.It activates CAX1 gene Calcium transport activity.In other organisms, PICOT proteins appear to play a negative regulatory role in cellular stress responses. 
AT3G54900.1TTAAACCGAAA.thaliana PICOT protein.It activates CAX1 gene Calcium transport activity.In other organisms, PICOT proteins appear to play a negative regulatory role in cellular stress responses. 
AT3G55360AT3G55360.1ATAAACCGAAEnoyl-CoA reductase is involved in all very long chain fatty acids (VLCFA) elongation reactions that are required for cuticular wax, storage lipid and sphingolipid metabolism. The protein is located in the ER, but in contrast to its yeast homolog TSC13 is not particularly enriched in the nuclear envelope-vacuole junction. Mutants in this gene show abnormal organ morphology and stem glossiness. Cells in all tissues are only about 1/3 of the size of wild type cells. The morphological changes are most likely to result from the reduction in the VLCFA content of sphingolipids. Mutants also show abnormalities in the endocytic membrane organization and transport. 
AT3G56150AT3G56150.1TTCGGTTTmember of eIF3c - eukaryotic initiation factor 3c 
AT3G56460AT3G56460.1GACCGGTTCGGTTToxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G21580.1); Has 27533 Blast hits to 27426 proteins in 1649 species: Archae - 279; Bacteria - 14496; Metazoa - 1760; Fungi - 2501; Plants - 878; Viruses - 3; Other Eukaryotes - 7616 (source: NCBI BLink). 
AT3G56750AT3G56750.1TCGGTTCGGTTTAATTAAACCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41150.2); Has 71 Blast hits to 71 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT3G57050AT3G57050.1ATAAACCGAAEncodes second enzyme in the methionine biosynthetic pathway 
AT3G57050.1TTCGGTTTEncodes second enzyme in the methionine biosynthetic pathway 
AT3G57050.2ATAAACCGAAEncodes second enzyme in the methionine biosynthetic pathway 
AT3G57050.2TTCGGTTTEncodes second enzyme in the methionine biosynthetic pathway 
AT3G57050.3ATAAACCGAAEncodes second enzyme in the methionine biosynthetic pathway 
AT3G57050.3TTCGGTTTEncodes second enzyme in the methionine biosynthetic pathway 
AT3G57280AT3G57280.1CTAAACCGAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G20510.1); Has 95 Blast hits to 95 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 21; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G57280.1CTAAACCGAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G20510.1); Has 95 Blast hits to 95 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 21; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G58900AT3G58900.1TTCGGTTTF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58860.1); Has 1272 Blast hits to 1243 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 1261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G58900.2TTCGGTTTF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58860.1); Has 1272 Blast hits to 1243 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 1261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G58900.3TTCGGTTTF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58860.1); Has 1272 Blast hits to 1243 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 1261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G60320AT3G60320.1AAACCGAADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF630 (InterPro:IPR006868), Protein of unknown function DUF632 (InterPro:IPR006867); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G02110.1); Has 6404 Blast hits to 2781 proteins in 248 species: Archae - 2; Bacteria - 111; Metazoa - 1760; Fungi - 418; Plants - 766; Viruses - 106; Other Eukaryotes - 3241 (source: NCBI BLink). 
AT3G61190AT3G61190.1AAACCGAAEncodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. 
AT3G61600AT3G61600.1AAACCGAACCAPOZ/BTB containing-protein AtPOB1 
AT3G61600.2AAACCGAACCAPOZ/BTB containing-protein AtPOB1 
AT3G61930AT3G61930.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G61930.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G62880AT3G62880.1AAACCGAATTGAACCGGTHomologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. 
AT3G62880.2AAACCGAATTGAACCGGTHomologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. 
AT4G00740AT4G00740.1AAACCGAACCGAACCGAACdehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive family protein (TAIR:AT4G10440.1); Has 538 Blast hits to 531 proteins in 57 species: Archae - 2; Bacteria - 72; Metazoa - 0; Fungi - 0; Plants - 461; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G02140AT4G02140.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02700.1); Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G02730AT4G02730.1AAACCGAAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 78608 Blast hits to 31153 proteins in 723 species: Archae - 58; Bacteria - 7156; Metazoa - 36882; Fungi - 14702; Plants - 7512; Viruses - 12; Other Eukaryotes - 12286 (source: NCBI BLink). 
AT4G03410AT4G03410.1TTCGGTTTperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT4G03410.2TTCGGTTTperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT4G03420AT4G03420.1TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF789 (InterPro:IPR008507); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03610.1); Has 151 Blast hits to 150 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT4G04630AT4G04630.1GTTCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 212 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G04630.1TCGGTTCGGTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 212 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G04630.1TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 212 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G04830AT4G04830.1GTAAACCGAACCGGmethionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04810.1); Has 5914 Blast hits to 5905 proteins in 1230 species: Archae - 53; Bacteria - 2684; Metazoa - 224; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2759 (source: NCBI BLink). 
AT4G04870AT4G04870.1AAACCGAAEncodes a protein with cardiolipin synthase activity that is localized to the mitochondiria. 
AT4G05400AT4G05400.1AAACCGAACCAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21140.1); Has 31 Blast hits to 31 proteins in 12 species: Archae - 5; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G05400.2AAACCGAACCAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21140.1); Has 31 Blast hits to 31 proteins in 12 species: Archae - 5; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G05410AT4G05410.1TTCGGTTTACtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: mitochondrial fission; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, anaphase-promoting complex, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: EMB2271 (EMBRYO DEFECTIVE 2271); nucleotide binding (TAIR:AT4G21130.1); Has 36165 Blast hits to 19140 proteins in 585 species: Archae - 40; Bacteria - 4252; Metazoa - 16125; Fungi - 6813; Plants - 3147; Viruses - 96; Other Eukaryotes - 5692 (source: NCBI BLink). 
AT4G05420AT4G05420.1GTAAACCGAAStructurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis. 
AT4G05420.1GTTCGGTTTAGStructurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis. 
AT4G05420.2GTAAACCGAAStructurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis. 
AT4G05420.2GTTCGGTTTAGStructurally similar to damaged DNA binding proteins.DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis. 
AT4G05450AT4G05450.1ATCCGGTTCGGTTTAAadrenodoxin-like ferredoxin 2; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: pollen tube development; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Adrenodoxin (InterPro:IPR001055), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), Adrenodoxin, iron-sulphur binding site (InterPro:IPR018298); BEST Arabidopsis thaliana protein match is: adrenodoxin-like ferredoxin 1 (TAIR:AT4G21090.3); Has 3455 Blast hits to 3455 proteins in 760 species: Archae - 0; Bacteria - 1368; Metazoa - 220; Fungi - 90; Plants - 51; Viruses - 0; Other Eukaryotes - 1726 (source: NCBI BLink). 
AT4G05460AT4G05460.1TCGGTTCGGTTTATF-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT4G05460.1TTCGGTTTF-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT4G05460.1TTCGGTTTGGF-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT4G08540AT4G08540.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G77890.1); Has 42 Blast hits to 42 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 6; Plants - 28; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT4G09340AT4G09340.1AAACCGAASPla/RYanodine receptor (SPRY) domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B302 (SPRY)-like (InterPro:IPR001870), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144), SPla/RYanodine receptor SPRY (InterPro:IPR003877); BEST Arabidopsis thaliana protein match is: SPla/RYanodine receptor (SPRY) domain-containing protein (TAIR:AT1G35470.2); Has 922 Blast hits to 864 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 443; Fungi - 205; Plants - 109; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink). 
AT4G09340.1AAACCGAASPla/RYanodine receptor (SPRY) domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B302 (SPRY)-like (InterPro:IPR001870), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144), SPla/RYanodine receptor SPRY (InterPro:IPR003877); BEST Arabidopsis thaliana protein match is: SPla/RYanodine receptor (SPRY) domain-containing protein (TAIR:AT1G35470.2); Has 922 Blast hits to 864 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 443; Fungi - 205; Plants - 109; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink). 
AT4G09340.1AAACCGAACCGASPla/RYanodine receptor (SPRY) domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: B302 (SPRY)-like (InterPro:IPR001870), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144), SPla/RYanodine receptor SPRY (InterPro:IPR003877); BEST Arabidopsis thaliana protein match is: SPla/RYanodine receptor (SPRY) domain-containing protein (TAIR:AT1G35470.2); Has 922 Blast hits to 864 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 443; Fungi - 205; Plants - 109; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink). 
AT4G09720AT4G09720.1AAACCGAACCGAATRABG3A; FUNCTIONS IN: protein binding, GTP binding, GTPase activity; INVOLVED IN: intracellular protein transport, signal transduction, nucleocytoplasmic transport, protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ran GTPase (InterPro:IPR002041), Ras (InterPro:IPR013753), Ras small GTPase, Ras type (InterPro:IPR003577), Ras small GTPase, Rho type (InterPro:IPR003578), Small GTP-binding protein (InterPro:IPR005225), Ras GTPase (InterPro:IPR001806), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: RABG3B; GTP binding (TAIR:AT1G22740.1). 
AT4G09720.2AAACCGAACCGAATRABG3A; FUNCTIONS IN: protein binding, GTP binding, GTPase activity; INVOLVED IN: intracellular protein transport, signal transduction, nucleocytoplasmic transport, protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ran GTPase (InterPro:IPR002041), Ras (InterPro:IPR013753), Ras small GTPase, Ras type (InterPro:IPR003577), Ras small GTPase, Rho type (InterPro:IPR003578), Small GTP-binding protein (InterPro:IPR005225), Ras GTPase (InterPro:IPR001806), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: RABG3B; GTP binding (TAIR:AT1G22740.1). 
AT4G09720.3AAACCGAACCGAATRABG3A; FUNCTIONS IN: protein binding, GTP binding, GTPase activity; INVOLVED IN: intracellular protein transport, signal transduction, nucleocytoplasmic transport, protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ran GTPase (InterPro:IPR002041), Ras (InterPro:IPR013753), Ras small GTPase, Ras type (InterPro:IPR003577), Ras small GTPase, Rho type (InterPro:IPR003578), Small GTP-binding protein (InterPro:IPR005225), Ras GTPase (InterPro:IPR001806), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: RABG3B; GTP binding (TAIR:AT1G22740.1). 
AT4G10790AT4G10790.1CTAAACCGAAUBX domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UAS (InterPro:IPR006577), UBX (InterPro:IPR001012); BEST Arabidopsis thaliana protein match is: SAY1 (TAIR:AT4G11740.1); Has 16384 Blast hits to 7928 proteins in 781 species: Archae - 7; Bacteria - 2234; Metazoa - 5947; Fungi - 1696; Plants - 733; Viruses - 184; Other Eukaryotes - 5583 (source: NCBI BLink). 
AT4G10800AT4G10800.1TTCGGTTTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT3G05675.2); Has 114 Blast hits to 114 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G11910AT4G11910.1AAACCGAACINVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: NYE1 (NON-YELLOWING 1) (TAIR:AT4G22920.1); Has 130 Blast hits to 128 proteins in 45 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT4G11910.1GTAAACCGAAINVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: NYE1 (NON-YELLOWING 1) (TAIR:AT4G22920.1); Has 130 Blast hits to 128 proteins in 45 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT4G12334AT4G12334.1TTCGGTTTelectron carrier/ heme binding / iron ion binding / monooxygenase; FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, heme binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128); BEST Arabidopsis thaliana protein match is: CYP706A2; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding (TAIR:AT4G22710.1). 
AT4G13050AT4G13050.1AAACCGAAacyl-(acyl carrier protein) thioesterase, putative / acyl-ACP thioesterase, putative / oleoyl-(acyl-carrier protein) hydrolase, putative / S-acyl fatty acid synthase thioesterase, putative; FUNCTIONS IN: acyl carrier activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acyl-ACP thioesterase (InterPro:IPR002864); BEST Arabidopsis thaliana protein match is: AtFaTA (Arabidopsis FatA acyl-ACP thioesterase); acyl carrier/ acyl-[acyl-carrier-protein] hydrolase (TAIR:AT3G25110.1); Has 601 Blast hits to 601 proteins in 228 species: Archae - 0; Bacteria - 383; Metazoa - 2; Fungi - 0; Plants - 209; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT4G13220AT4G13220.1AAACCGAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G13340AT4G13340.1AAACCGAAleucine-rich repeat family protein / extensin family protein; FUNCTIONS IN: structural constituent of cell wall, protein binding; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein / extensin family protein (TAIR:AT3G24480.1); Has 527469 Blast hits to 98695 proteins in 2588 species: Archae - 1432; Bacteria - 100230; Metazoa - 200562; Fungi - 58262; Plants - 84057; Viruses - 13216; Other Eukaryotes - 69710 (source: NCBI BLink). 
AT4G13340.1AAACCGAACCAleucine-rich repeat family protein / extensin family protein; FUNCTIONS IN: structural constituent of cell wall, protein binding; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein / extensin family protein (TAIR:AT3G24480.1); Has 527469 Blast hits to 98695 proteins in 2588 species: Archae - 1432; Bacteria - 100230; Metazoa - 200562; Fungi - 58262; Plants - 84057; Viruses - 13216; Other Eukaryotes - 69710 (source: NCBI BLink). 
AT4G13770AT4G13770.1CGGTTAAGTTCGGTTTEncodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis. 
AT4G13860AT4G13860.1TTCGGTTTAAglycine-rich RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: GR-RBP2 (GLYCINE-RICH RNA-BINDING PROTEIN 2); ATP binding / RNA binding / double-stranded DNA binding / single-stranded DNA binding (TAIR:AT4G13850.4); Has 20625 Blast hits to 15554 proteins in 614 species: Archae - 10; Bacteria - 1109; Metazoa - 12326; Fungi - 2038; Plants - 3107; Viruses - 0; Other Eukaryotes - 2035 (source: NCBI BLink). 
AT4G14190AT4G14190.1AAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G42630.1); Has 7409 Blast hits to 2639 proteins in 94 species: Archae - 1; Bacteria - 0; Metazoa - 60; Fungi - 16; Plants - 7130; Viruses - 0; Other Eukaryotes - 202 (source: NCBI BLink). 
AT4G14190.1TTAAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G42630.1); Has 7409 Blast hits to 2639 proteins in 94 species: Archae - 1; Bacteria - 0; Metazoa - 60; Fungi - 16; Plants - 7130; Viruses - 0; Other Eukaryotes - 202 (source: NCBI BLink). 
AT4G14190.1TTAAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G42630.1); Has 7409 Blast hits to 2639 proteins in 94 species: Archae - 1; Bacteria - 0; Metazoa - 60; Fungi - 16; Plants - 7130; Viruses - 0; Other Eukaryotes - 202 (source: NCBI BLink). 
AT4G14315AT4G14315.1ATAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G14540AT4G14540.1AAACCGAANUCLEAR FACTOR Y, SUBUNIT B3 (NF-YB3); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB2 (NUCLEAR FACTOR Y, SUBUNIT B2); transcription factor (TAIR:AT5G47640.1); Has 1011 Blast hits to 1011 proteins in 186 species: Archae - 0; Bacteria - 1; Metazoa - 394; Fungi - 233; Plants - 298; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT4G14880AT4G14880.1AAACCGAAEncodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. 
AT4G14880.2AAACCGAAEncodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. 
AT4G14890AT4G14890.1TTCGGTTTferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD3 (ferredoxin 3); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT2G27510.1); Has 3979 Blast hits to 3977 proteins in 721 species: Archae - 45; Bacteria - 2406; Metazoa - 8; Fungi - 2; Plants - 434; Viruses - 2; Other Eukaryotes - 1082 (source: NCBI BLink). 
AT4G14890.1TTCGGTTTAAferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD3 (ferredoxin 3); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT2G27510.1); Has 3979 Blast hits to 3977 proteins in 721 species: Archae - 45; Bacteria - 2406; Metazoa - 8; Fungi - 2; Plants - 434; Viruses - 2; Other Eukaryotes - 1082 (source: NCBI BLink). 
AT4G14890.1TTCGGTTTAAGTCGGTTTTCGGTTTferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD3 (ferredoxin 3); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT2G27510.1); Has 3979 Blast hits to 3977 proteins in 721 species: Archae - 45; Bacteria - 2406; Metazoa - 8; Fungi - 2; Plants - 434; Viruses - 2; Other Eukaryotes - 1082 (source: NCBI BLink). 
AT4G14900AT4G14900.1TTCGGTTTAChydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT3G22440.1); Has 1960 Blast hits to 1334 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 248; Fungi - 80; Plants - 1600; Viruses - 2; Other Eukaryotes - 22 (source: NCBI BLink). 
AT4G15545AT4G15545.1TTCGGTTTAAunknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16520.1); Has 557 Blast hits to 539 proteins in 129 species: Archae - 0; Bacteria - 87; Metazoa - 242; Fungi - 51; Plants - 82; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink). 
AT4G15830AT4G15830.1GTAAACCGAACCGAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT3G01450.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 5; Plants - 61; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT4G15840AT4G15840.1TCGGTTCGGTTTACprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); Has 305 Blast hits to 303 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 12; Plants - 22; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT4G16630AT4G16630.1TCGGTTCGGTTTDEAD/DEAH box helicase, putative (RH28); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G16280.1); Has 75014 Blast hits to 49574 proteins in 2104 species: Archae - 542; Bacteria - 21437; Metazoa - 22382; Fungi - 7369; Plants - 2826; Viruses - 629; Other Eukaryotes - 19829 (source: NCBI BLink). 
AT4G17040AT4G17040.1TTCGGTTTATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plastid stroma, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: ATP-dependent Clp protease proteolytic subunit, putative (TAIR:AT1G09130.2); Has 8307 Blast hits to 8303 proteins in 1647 species: Archae - 0; Bacteria - 4113; Metazoa - 115; Fungi - 50; Plants - 683; Viruses - 6; Other Eukaryotes - 3340 (source: NCBI BLink). 
AT4G17050AT4G17050.1AAACCGAAUREIDOGLYCINE AMINOHYDROLASE (UGLYAH); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cupin 2, conserved barrel (InterPro:IPR013096), Cupin, RmlC-type (InterPro:IPR011051), RmlC-like jelly roll fold (InterPro:IPR014710); Has 513 Blast hits to 513 proteins in 229 species: Archae - 4; Bacteria - 414; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). 
AT4G17060AT4G17060.1AAACCGAAEncodes one of the FRI interacting proteins: FRIGIDA INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI (At4G00650) is a major determinant of natural variation in Arabidopsis flowering time. 
AT4G18395AT4G18395.1TTCGGTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G18460AT4G18460.1TGGTTCGGTTTD-Tyr-tRNA(Tyr) deacylase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds; INVOLVED IN: D-amino acid catabolic process; LOCATED IN: cytoplasm; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-tyrosyl-tRNA(Tyr) deacylase (InterPro:IPR003732); Has 3035 Blast hits to 3034 proteins in 1108 species: Archae - 3; Bacteria - 2050; Metazoa - 120; Fungi - 93; Plants - 20; Viruses - 0; Other Eukaryotes - 749 (source: NCBI BLink). 
AT4G18465AT4G18465.1AAACCGAACCARNA helicase, putative; FUNCTIONS IN: RNA helicase activity, helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 7224 Blast hits to 6791 proteins in 1024 species: Archae - 6; Bacteria - 1974; Metazoa - 1905; Fungi - 796; Plants - 374; Viruses - 693; Other Eukaryotes - 1476 (source: NCBI BLink). 
AT4G18580AT4G18580.1TTAAACCGAACCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G18580.2TTAAACCGAACCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G18590AT4G18590.1CAAACCGGTTCGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Replication factor A protein 3 (InterPro:IPR013970), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52630.2); Has 58 Blast hits to 58 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT4G18650AT4G18650.1TTCGGTTTAAtranscription factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14880.2); Has 341 Blast hits to 340 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 339; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G19185AT4G19185.1TTCGGTTTintegral membrane family protein; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin-related / integral membrane family protein (TAIR:AT5G45370.2); Has 2223 Blast hits to 2208 proteins in 424 species: Archae - 18; Bacteria - 1141; Metazoa - 6; Fungi - 0; Plants - 631; Viruses - 0; Other Eukaryotes - 427 (source: NCBI BLink). 
AT4G19190AT4G19190.1CCAAACCGAAzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); Has 29640 Blast hits to 15322 proteins in 578 species: Archae - 9; Bacteria - 1666; Metazoa - 14701; Fungi - 2090; Plants - 1417; Viruses - 133; Other Eukaryotes - 9624 (source: NCBI BLink). 
AT4G19400AT4G19400.1GTTCGGTTTATactin binding; FUNCTIONS IN: actin binding; INVOLVED IN: cytoskeleton organization; LOCATED IN: actin cytoskeleton; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Profilin/allergen (InterPro:IPR002097); Has 17 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G21160AT4G21160.1AAACCGAAADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT4G21160.2AAACCGAAADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT4G21160.3AAACCGAAADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT4G21160.4AAACCGAAADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT4G21300AT4G21300.1AAACCGAApentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G03580.1); Has 19749 Blast hits to 5268 proteins in 182 species: Archae - 1; Bacteria - 4; Metazoa - 89; Fungi - 126; Plants - 19072; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink). 
AT4G21650AT4G21650.1TTAAACCGAACCAsubtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: subtilase family protein (TAIR:AT4G21630.1); Has 4532 Blast hits to 3933 proteins in 710 species: Archae - 129; Bacteria - 2684; Metazoa - 30; Fungi - 172; Plants - 917; Viruses - 0; Other Eukaryotes - 600 (source: NCBI BLink). 
AT4G22380AT4G22380.1ATAAACCGAACTAAACCGAAribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT5G20160.1); Has 1361 Blast hits to 1361 proteins in 295 species: Archae - 226; Bacteria - 7; Metazoa - 464; Fungi - 191; Plants - 162; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink). 
AT4G22530AT4G22530.1TTAAACCGAAembryo-abundant protein-related; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: embryo-abundant protein-related (TAIR:AT5G10830.1); Has 712 Blast hits to 708 proteins in 256 species: Archae - 2; Bacteria - 390; Metazoa - 65; Fungi - 87; Plants - 109; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). 
AT4G23730AT4G23730.1TTCGGTTTaldose 1-epimerase family protein; FUNCTIONS IN: isomerase activity, carbohydrate binding, aldose 1-epimerase activity, catalytic activity; INVOLVED IN: galactose metabolic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Aldose 1-epimerase (InterPro:IPR008183), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718); BEST Arabidopsis thaliana protein match is: aldose 1-epimerase family protein (TAIR:AT3G61610.1); Has 1392 Blast hits to 1391 proteins in 571 species: Archae - 0; Bacteria - 958; Metazoa - 38; Fungi - 84; Plants - 134; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). 
AT4G25150AT4G25150.1ATAAACCGAAacid phosphatase, putative; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase (Class B) (InterPro:IPR005519), Vegetative storage protein/acid phosphatase (InterPro:IPR014403), Acid phosphatase, plant (InterPro:IPR010028); BEST Arabidopsis thaliana protein match is: acid phosphatase, putative (TAIR:AT5G51260.1); Has 559 Blast hits to 559 proteins in 162 species: Archae - 0; Bacteria - 269; Metazoa - 2; Fungi - 0; Plants - 241; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT4G25390AT4G25390.1TTCGGTTTAAprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G51770.1); Has 62019 Blast hits to 52421 proteins in 1538 species: Archae - 19; Bacteria - 4146; Metazoa - 22140; Fungi - 3414; Plants - 25096; Viruses - 163; Other Eukaryotes - 7041 (source: NCBI BLink). 
AT4G25390.2TTCGGTTTAAprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G51770.1); Has 62019 Blast hits to 52421 proteins in 1538 species: Archae - 19; Bacteria - 4146; Metazoa - 22140; Fungi - 3414; Plants - 25096; Viruses - 163; Other Eukaryotes - 7041 (source: NCBI BLink). 
AT4G26100AT4G26100.1CCAAACCGAACEncodes a member of the casein kinase 1 protein family that is expressed in punctate particles at the cell periphery suggesting possible plasmodesmatal localization. 
AT4G26240AT4G26240.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 17 Blast hits to 17 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G26420AT4G26420.1TTCGGTTTA member of the Arabidopsis SABATH methyltransferase gene family. Encodes GAMT1, a methyltransferase that uses S-adenosine-L-methionine (SAM) as a methyl donor to methylate the carboxyl group of GAs, resulting in the methyl esters of GAs (MeGAs). Expressed most highly in the siliques during seed development. 
AT4G26420.2TTCGGTTTA member of the Arabidopsis SABATH methyltransferase gene family. Encodes GAMT1, a methyltransferase that uses S-adenosine-L-methionine (SAM) as a methyl donor to methylate the carboxyl group of GAs, resulting in the methyl esters of GAs (MeGAs). Expressed most highly in the siliques during seed development. 
AT4G27020AT4G27020.1GTTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: vacuole; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G54870.1); Has 70 Blast hits to 70 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). 
AT4G27030AT4G27030.1AAACCGAACsmall conjugating protein ligase; FUNCTIONS IN: small conjugating protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: small conjugating protein ligase (TAIR:AT1G62190.1); Has 180 Blast hits to 180 proteins in 75 species: Archae - 0; Bacteria - 19; Metazoa - 108; Fungi - 0; Plants - 24; Viruses - 3; Other Eukaryotes - 26 (source: NCBI BLink). 
AT4G27130AT4G27130.1CTAAACCGAACCAeukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT5G54760.2); Has 620 Blast hits to 617 proteins in 201 species: Archae - 6; Bacteria - 1; Metazoa - 295; Fungi - 109; Plants - 120; Viruses - 3; Other Eukaryotes - 86 (source: NCBI BLink). 
AT4G27680AT4G27680.1TTCGGTTTMSP1 protein, putative / intramitochondrial sorting protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: MSP1 protein, putative / intramitochondrial sorting protein, putative (TAIR:AT5G53540.1); Has 20791 Blast hits to 19084 proteins in 1738 species: Archae - 856; Bacteria - 5934; Metazoa - 4055; Fungi - 2306; Plants - 1353; Viruses - 23; Other Eukaryotes - 6264 (source: NCBI BLink). 
AT4G27940AT4G27940.1CCAAACCGAAmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G46320.1); Has 13258 Blast hits to 8472 proteins in 324 species: Archae - 0; Bacteria - 0; Metazoa - 6659; Fungi - 3535; Plants - 2092; Viruses - 0; Other Eukaryotes - 972 (source: NCBI BLink). 
AT4G27970AT4G27970.1CGTTTTGATTCGGTTTEncodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. 
AT4G28590AT4G28590.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31840.1); Has 81 Blast hits to 81 proteins in 33 species: Archae - 2; Bacteria - 0; Metazoa - 16; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT4G29130AT4G29130.1AAACCGAAEncodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. 
AT4G29510AT4G29510.1AAACCGAACCGGTHas arginine N-methyltransferase activity. Modifies AtMBD7. 
AT4G29850AT4G29850.1TGGTTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0414 (InterPro:IPR008590); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19350.1); Has 188 Blast hits to 188 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G29900AT4G29900.1AAACCGAAone of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. 
AT4G29910AT4G29910.1AAACCGAAOrigin Recognition Complex subunit 5. Involved in the initiation of DNA replication. Interacts strongly with all ORC subunits. 
AT4G29910.1AAACCGAAOrigin Recognition Complex subunit 5. Involved in the initiation of DNA replication. Interacts strongly with all ORC subunits. 
AT4G30010AT4G30010.1ATAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G30130AT4G30130.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF630 (InterPro:IPR006868), Protein of unknown function DUF632 (InterPro:IPR006867); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19090.1); Has 301 Blast hits to 242 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 2; Plants - 287; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G30290AT4G30290.1TTCGGTTTputative xyloglucan endotransglycosylase/hydrolase, expressed throughout both the main and the lateral root, with intensive expression at the dividing and elongating regions. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. 
AT4G30860AT4G30860.1AAACCGAACEncodes a member of the trxG protein family. Contains a SET domain which is known to be involved in modification of histone tails by methylation. Interacts physically with AMS, but the implications of this interaction are unknown.Overexpression results in plieotrophic developmental defects. 
AT4G30890AT4G30890.1AAACCGAACEncodes a ubiquitin-specific protease. 
AT4G30890.2AAACCGAACEncodes a ubiquitin-specific protease. 
AT4G30900AT4G30900.1TCGGTTCGGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); Has 408 Blast hits to 408 proteins in 132 species: Archae - 4; Bacteria - 213; Metazoa - 1; Fungi - 69; Plants - 10; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). 
AT4G30900.2TCGGTTCGGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); Has 408 Blast hits to 408 proteins in 132 species: Archae - 4; Bacteria - 213; Metazoa - 1; Fungi - 69; Plants - 10; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). 
AT4G31450AT4G31450.1AAACCGAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G24870.2); Has 5333 Blast hits to 5244 proteins in 197 species: Archae - 0; Bacteria - 4; Metazoa - 1900; Fungi - 309; Plants - 2274; Viruses - 6; Other Eukaryotes - 840 (source: NCBI BLink). 
AT4G31460AT4G31460.1AAACCGAACCGribosomal protein L28 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28 (InterPro:IPR001383); Has 797 Blast hits to 797 proteins in 221 species: Archae - 0; Bacteria - 262; Metazoa - 81; Fungi - 82; Plants - 19; Viruses - 0; Other Eukaryotes - 353 (source: NCBI BLink). 
AT4G31530AT4G31530.1GTTCGGTTTAGbinding / catalytic; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Male sterility, NAD-binding (InterPro:IPR013120); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 2281 Blast hits to 2232 proteins in 521 species: Archae - 12; Bacteria - 1390; Metazoa - 76; Fungi - 31; Plants - 258; Viruses - 0; Other Eukaryotes - 514 (source: NCBI BLink). 
AT4G31610AT4G31610.1TTCGGTTTExpressed specifically in reproductive meristems, member of a moderately sized gene family distantly related to known plant DNA binding proteins 
AT4G31780AT4G31780.1TTCGGTTTAGEncodes an A-type monogalactosyldiacylglycerol (MGDG) synthase. It represents the isoform responsible for the bulk of MGDG synthesis in Arabidopsis. 
AT4G31780.2TTCGGTTTAGEncodes an A-type monogalactosyldiacylglycerol (MGDG) synthase. It represents the isoform responsible for the bulk of MGDG synthesis in Arabidopsis. 
AT4G32130AT4G32130.1AAACCGAACcarbohydrate binding; FUNCTIONS IN: carbohydrate binding; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: male gametophyte, callus, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784); BEST Arabidopsis thaliana protein match is: carbohydrate binding (TAIR:AT2G25310.1); Has 213 Blast hits to 213 proteins in 94 species: Archae - 0; Bacteria - 2; Metazoa - 121; Fungi - 44; Plants - 26; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT4G32160AT4G32160.1CCAAACCGAAphox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G25350.1); Has 27288 Blast hits to 16752 proteins in 957 species: Archae - 276; Bacteria - 2134; Metazoa - 15048; Fungi - 1956; Plants - 870; Viruses - 159; Other Eukaryotes - 6845 (source: NCBI BLink). 
AT4G32175AT4G32175.1ACGGTTTAAGTAAACCGAARNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: exonuclease-related (TAIR:AT2G25355.1); Has 380 Blast hits to 380 proteins in 172 species: Archae - 65; Bacteria - 0; Metazoa - 101; Fungi - 101; Plants - 32; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink). 
AT4G32610AT4G32610.1GTTCGGTTTunknown protein; LOCATED IN: mitochondrial matrix; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25670.2); Has 47502 Blast hits to 27315 proteins in 1430 species: Archae - 78; Bacteria - 5619; Metazoa - 19417; Fungi - 5653; Plants - 1695; Viruses - 355; Other Eukaryotes - 14685 (source: NCBI BLink). 
AT4G32940AT4G32940.1TTCGGTTTEncodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. 
AT4G33460AT4G33460.1AAACCGAAmember of NAP subfamily 
AT4G33460.1AAACCGAACCGGATmember of NAP subfamily 
AT4G33470AT4G33470.1GTAAACCGAAEncodes HDA14, a member of the histone deacetylase family proteins. 
AT4G33680AT4G33680.1AAACCGAACCGGAACAAACCGGATInvolved in disease resistance against Pseudomonas syringae. mutants have elevated SA levels, a low level of spontaneous cell death, callose deposition, and enlarged cells in leaves. genetically maps on chr 4 between L23H3 and nga1139. 
AT4G33680.1CCAAACCGAAInvolved in disease resistance against Pseudomonas syringae. mutants have elevated SA levels, a low level of spontaneous cell death, callose deposition, and enlarged cells in leaves. genetically maps on chr 4 between L23H3 and nga1139. 
AT4G33690AT4G33690.1ATCCGGTTTGTTCCGGTTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: pollen tube; Has 499 Blast hits to 464 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 283; Fungi - 48; Plants - 38; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). 
AT4G33690.1TTCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: pollen tube; Has 499 Blast hits to 464 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 283; Fungi - 48; Plants - 38; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). 
AT4G33760AT4G33760.1ATAAACCGAAtRNA synthetase class II (D, K and N) family protein; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: aspartyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast, membrane, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aspartyl-tRNA synthetase, class IIb, bacterial/mitochondrial type (InterPro:IPR004524), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Aspartyl-tRNA synthetase, class IIb, bacterial/mitochondrial type, C-terminal (InterPro:IPR018153), GAD (InterPro:IPR004115); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 20510 Blast hits to 15912 proteins in 1700 species: Archae - 534; Bacteria - 11175; Metazoa - 763; Fungi - 675; Plants - 169; Viruses - 0; Other Eukaryotes - 7194 (source: NCBI BLink). 
AT4G33925AT4G33925.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; Has 70 Blast hits to 70 proteins in 36 species: Archae - 8; Bacteria - 0; Metazoa - 38; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT4G33925.1CTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; Has 70 Blast hits to 70 proteins in 36 species: Archae - 8; Bacteria - 0; Metazoa - 38; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT4G33925.2AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; Has 70 Blast hits to 70 proteins in 36 species: Archae - 8; Bacteria - 0; Metazoa - 38; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT4G33925.2CTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; Has 70 Blast hits to 70 proteins in 36 species: Archae - 8; Bacteria - 0; Metazoa - 38; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT4G34190AT4G34190.1GGTTCGGTTTEncodes a stress enhanced protein that localizes to the thylakoid membrane and whose mRNA is upregulated in response to high light intensity. It may be involved in chlorophyll binding. 
AT4G34265AT4G34265.1ATAAACCGAACCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G15000.3); Has 58 Blast hits to 58 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G34265.2ATAAACCGAACCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G15000.3); Has 58 Blast hits to 58 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G34430AT4G34430.1AAACCGAAMember of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). 
AT4G34430.2AAACCGAAMember of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). 
AT4G34430.3AAACCGAAMember of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). 
AT4G34430.4AAACCGAAMember of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). 
AT4G34720AT4G34720.1TTCGGTTTvacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p1) 
AT4G34730AT4G34730.1TTCGGTTTAAribosome-binding factor A family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K homology-like, alpha/beta (InterPro:IPR015946), Ribosome-binding factor A (InterPro:IPR000238); Has 2908 Blast hits to 2907 proteins in 1057 species: Archae - 0; Bacteria - 2230; Metazoa - 5; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 649 (source: NCBI BLink). 
AT4G35530AT4G35530.1AAACCGAAphosphatidylinositolglycan-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 63 Blast hits to 63 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT4G35720AT4G35720.1AAACCGAAunknown protein; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF241, plant (InterPro:IPR004320); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35690.1); Has 230 Blast hits to 226 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 226; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT4G35785AT4G35785.1CCGAACCAAACCGAAnucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). 
AT4G35785.1TTAAACCGAACCAnucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). 
AT4G35785.2CCGAACCAAACCGAAnucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). 
AT4G35785.2TTAAACCGAACCAnucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). 
AT4G35785.3CCGAACCAAACCGAAnucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). 
AT4G35785.3TTAAACCGAACCAnucleic acid binding / nucleotide binding; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: ribonucleoprotein complex, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: transformer serine/arginine-rich ribonucleoprotein, putative (TAIR:AT1G07350.1); Has 15256 Blast hits to 9223 proteins in 448 species: Archae - 0; Bacteria - 390; Metazoa - 11188; Fungi - 900; Plants - 1084; Viruses - 218; Other Eukaryotes - 1476 (source: NCBI BLink). 
AT4G37130AT4G37130.1AAACCGAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 28754 Blast hits to 10910 proteins in 570 species: Archae - 13; Bacteria - 821; Metazoa - 8015; Fungi - 3269; Plants - 2417; Viruses - 369; Other Eukaryotes - 13850 (source: NCBI BLink). 
AT4G38580AT4G38580.1AAACCGAAputative farnesylated protein (At4g38580) mRNA, complete 
AT4G39090AT4G39090.1AAACCGAASimilar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R–mediated resistance response. 
AT4G39140AT4G39140.1TTCGGTTTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G21500.2); Has 1494 Blast hits to 203 proteins in 51 species: Archae - 0; Bacteria - 6; Metazoa - 85; Fungi - 41; Plants - 92; Viruses - 0; Other Eukaryotes - 1270 (source: NCBI BLink). 
AT4G39140.2TTCGGTTTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G21500.2); Has 1494 Blast hits to 203 proteins in 51 species: Archae - 0; Bacteria - 6; Metazoa - 85; Fungi - 41; Plants - 92; Viruses - 0; Other Eukaryotes - 1270 (source: NCBI BLink). 
AT4G39140.3TTCGGTTTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G21500.2); Has 1494 Blast hits to 203 proteins in 51 species: Archae - 0; Bacteria - 6; Metazoa - 85; Fungi - 41; Plants - 92; Viruses - 0; Other Eukaryotes - 1270 (source: NCBI BLink). 
AT4G39140.4TTCGGTTTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G21500.2); Has 1494 Blast hits to 203 proteins in 51 species: Archae - 0; Bacteria - 6; Metazoa - 85; Fungi - 41; Plants - 92; Viruses - 0; Other Eukaryotes - 1270 (source: NCBI BLink). 
AT4G39140.5TTCGGTTTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G21500.2); Has 1494 Blast hits to 203 proteins in 51 species: Archae - 0; Bacteria - 6; Metazoa - 85; Fungi - 41; Plants - 92; Viruses - 0; Other Eukaryotes - 1270 (source: NCBI BLink). 
AT4G39350AT4G39350.1TTCGGTTTATEncodes a cellulose synthase isomer, related to CESA6. 
AT4G39520AT4G39520.1AAACCGAAGTP-binding protein, putative; FUNCTIONS IN: GTP binding; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), TGS (InterPro:IPR004095), GTP1/OBG (InterPro:IPR006073), GTP1/OBG, conserved site (InterPro:IPR006074), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: developmentally regulated GTP-binding protein, putative (TAIR:AT1G72660.3); Has 12043 Blast hits to 12023 proteins in 1588 species: Archae - 468; Bacteria - 6069; Metazoa - 728; Fungi - 429; Plants - 176; Viruses - 0; Other Eukaryotes - 4173 (source: NCBI BLink). 
AT4G39610AT4G39610.1TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G21990.1); Has 140 Blast hits to 140 proteins in 8 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G01420AT5G01420.1TGGTTCGGTTTATglutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT5G03870.1); Has 300 Blast hits to 300 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 0; Plants - 195; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). 
AT5G01510AT5G01510.1ATAAACCGAATTTAACCGGGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: RUS1 (ROOT UVB SENSITIVE 1) (TAIR:AT3G45890.1); Has 266 Blast hits to 266 proteins in 86 species: Archae - 0; Bacteria - 2; Metazoa - 95; Fungi - 39; Plants - 94; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). 
AT5G02870AT5G02870.1AAACCGAACCG60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). 
AT5G02870.1CTAAACCGAA60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). 
AT5G02870.2AAACCGAACCG60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). 
AT5G02870.2CTAAACCGAA60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). 
AT5G03220AT5G03220.1TTAAACCGAAtranscriptional co-activator-related; FUNCTIONS IN: transcription coactivator activity; INVOLVED IN: positive regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: MED7 (InterPro:IPR009244); BEST Arabidopsis thaliana protein match is: transcription coactivator (TAIR:AT5G03500.2); Has 302 Blast hits to 300 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 111; Plants - 29; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT5G03290AT5G03290.1AAACCGAATCCGGTTTGisocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink). 
AT5G03830AT5G03830.1TTCGGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: p21Cip1-binding protein-related (TAIR:AT2G44510.1); Has 225 Blast hits to 225 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 68; Plants - 27; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). 
AT5G04080AT5G04080.1ATAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; Has 77 Blast hits to 77 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 73; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G04170AT5G04170.1TTAAACCGAACcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT3G10300.3); Has 32062 Blast hits to 17618 proteins in 833 species: Archae - 4; Bacteria - 3047; Metazoa - 14595; Fungi - 4725; Plants - 3524; Viruses - 254; Other Eukaryotes - 5913 (source: NCBI BLink). 
AT5G04910AT5G04910.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT5G05000AT5G05000.1TTCGGTTTAGTCCGGTTOuter membrane protein that may function in import of nuclear encoded proteins into the chloroplast. 
AT5G05000.2TTCGGTTTAGTCCGGTTOuter membrane protein that may function in import of nuclear encoded proteins into the chloroplast. 
AT5G05000.3TTCGGTTTAGTCCGGTTOuter membrane protein that may function in import of nuclear encoded proteins into the chloroplast. 
AT5G05010AT5G05010.1AACCGGACTAAACCGAAclathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). 
AT5G05010.2AACCGGACTAAACCGAAclathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). 
AT5G05200AT5G05200.1CGGTTCGGTTTAATGGGABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink). 
AT5G05210AT5G05210.1CCCATTAAACCGAACCGnucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). 
AT5G05210.2CCCATTAAACCGAACCGnucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). 
AT5G05590AT5G05590.1AAACCGAAEncodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. 
AT5G05590.1TTCGGTTTEncodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. 
AT5G05590.1TTCGGTTTGGTTCGGTTTAAEncodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. 
AT5G05590.2AAACCGAAEncodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. 
AT5G05590.2TTCGGTTTEncodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. 
AT5G05590.2TTCGGTTTGGTTCGGTTTAAEncodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. 
AT5G06050AT5G06050.1AAACCGAAdehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive family protein (TAIR:AT2G39750.1); Has 497 Blast hits to 489 proteins in 40 species: Archae - 0; Bacteria - 24; Metazoa - 2; Fungi - 0; Plants - 468; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT5G06180AT5G06180.1TTCGGTTTGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1022 (InterPro:IPR009367); BEST Arabidopsis thaliana protein match is: ELM1 (ELONGATED MITOCHONDRIA 1) (TAIR:AT5G22350.1); Has 1314 Blast hits to 1313 proteins in 81 species: Archae - 0; Bacteria - 151; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 1132 (source: NCBI BLink). 
AT5G06180.2TTCGGTTTGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1022 (InterPro:IPR009367); BEST Arabidopsis thaliana protein match is: ELM1 (ELONGATED MITOCHONDRIA 1) (TAIR:AT5G22350.1); Has 1314 Blast hits to 1313 proteins in 81 species: Archae - 0; Bacteria - 151; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 1132 (source: NCBI BLink). 
AT5G06260AT5G06260.1TTAAACCGAAnucleolar protein-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571), EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: calcium ion binding (TAIR:AT4G34070.1); Has 925 Blast hits to 924 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 578; Fungi - 44; Plants - 76; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink). 
AT5G06265AT5G06265.1TCGGTTCGGTTThyaluronan mediated motility receptor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44280.1); Has 44 Blast hits to 44 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G06265.1TCGGTTCGGTTThyaluronan mediated motility receptor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44280.1); Has 44 Blast hits to 44 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G06265.2TCGGTTCGGTTThyaluronan mediated motility receptor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44280.1); Has 44 Blast hits to 44 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G06265.2TCGGTTCGGTTThyaluronan mediated motility receptor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44280.1); Has 44 Blast hits to 44 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G06430AT5G06430.1ATAAACCGAAthioredoxin-related; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: HCF164; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT4G37200.1); Has 165 Blast hits to 164 proteins in 55 species: Archae - 0; Bacteria - 86; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT5G06430.1TTCGGTTTGGthioredoxin-related; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: HCF164; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT4G37200.1); Has 165 Blast hits to 164 proteins in 55 species: Archae - 0; Bacteria - 86; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT5G07020AT5G07020.1AAACCGAAproline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 32 Blast hits to 32 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 1; Plants - 28; Viruses - 1; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G07560AT5G07560.1CCAAACCGAALipid-binding oleosins, glycine-rich protein. 
AT5G08080AT5G08080.1CCAAACCGAACCGmember of SYP13 Gene Family 
AT5G08080.1TTCGGTTTACmember of SYP13 Gene Family 
AT5G08080.2CCAAACCGAACCGmember of SYP13 Gene Family 
AT5G08080.2TTCGGTTTACmember of SYP13 Gene Family 
AT5G08650AT5G08650.1TTCGGTTTAAGTP-binding protein LepA, putative; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding protein LepA (InterPro:IPR006297), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), GTP-binding protein LepA, C-terminal (InterPro:IPR013842), Elongation factor G, III and V (InterPro:IPR009022), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: GTP binding / GTPase/ translation elongation factor (TAIR:AT5G39900.1); Has 58694 Blast hits to 51359 proteins in 6862 species: Archae - 845; Bacteria - 29013; Metazoa - 5946; Fungi - 3236; Plants - 868; Viruses - 0; Other Eukaryotes - 18786 (source: NCBI BLink). 
AT5G09250AT5G09250.1TTCGGTTTputative transcriptional co-activator (KIWI) mRNA, complete 
AT5G09250.2TTCGGTTTputative transcriptional co-activator (KIWI) mRNA, complete 
AT5G09680AT5G09680.1AAACCGAAcytochrome b5 domain-containing protein; FUNCTIONS IN: heme binding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome b5, heme-binding site (InterPro:IPR018506), Cytochrome b5 (InterPro:IPR001199); BEST Arabidopsis thaliana protein match is: CB5-A (CYTOCHROME B5 ISOFORM A); heme binding (TAIR:AT1G26340.1); Has 2233 Blast hits to 2217 proteins in 344 species: Archae - 1; Bacteria - 7; Metazoa - 608; Fungi - 741; Plants - 527; Viruses - 0; Other Eukaryotes - 349 (source: NCBI BLink). 
AT5G09680.2AAACCGAAcytochrome b5 domain-containing protein; FUNCTIONS IN: heme binding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome b5, heme-binding site (InterPro:IPR018506), Cytochrome b5 (InterPro:IPR001199); BEST Arabidopsis thaliana protein match is: CB5-A (CYTOCHROME B5 ISOFORM A); heme binding (TAIR:AT1G26340.1); Has 2233 Blast hits to 2217 proteins in 344 species: Archae - 1; Bacteria - 7; Metazoa - 608; Fungi - 741; Plants - 527; Viruses - 0; Other Eukaryotes - 349 (source: NCBI BLink). 
AT5G09920AT5G09920.1TTCGGTTTATNon-catalytic subunit specific to DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB4) 
AT5G10270AT5G10270.1TTAAACCGAAEncodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. 
AT5G11010AT5G11010.1TTCCGGTTCGGTTTpre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT5G11010.2TTCCGGTTCGGTTTpre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT5G11010.3TTCCGGTTCGGTTTpre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT5G11450AT5G11450.1TTCGGTTTAATAAACCGAoxygen-evolving complex-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 81 Blast hits to 81 proteins in 22 species: Archae - 0; Bacteria - 22; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G11680AT5G11680.1CTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 136 Blast hits to 136 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 26; Plants - 24; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT5G11680.1CTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 136 Blast hits to 136 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 26; Plants - 24; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT5G11890AT5G11890.1AAACCGAAFUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G17620.1); Has 455 Blast hits to 454 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 453; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G12120AT5G12120.1TTCGGTTTubiquitin-associated (UBA)/TS-N domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940); BEST Arabidopsis thaliana protein match is: ubiquitin-associated (UBA)/TS-N domain-containing protein (TAIR:AT2G26920.1); Has 346 Blast hits to 332 proteins in 63 species: Archae - 0; Bacteria - 2; Metazoa - 124; Fungi - 55; Plants - 32; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink). 
AT5G12130AT5G12130.1AAACCGAAPIGMENT DEFECTIVE 149 (PDE149); INVOLVED IN: thylakoid membrane organization; LOCATED IN: chloroplast thylakoid membrane, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Integral membrane protein TerC (InterPro:IPR005496); Has 2303 Blast hits to 2303 proteins in 668 species: Archae - 4; Bacteria - 1555; Metazoa - 2; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 721 (source: NCBI BLink). 
AT5G15220AT5G15220.1AAACCGAACribosomal protein L27 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27 (InterPro:IPR001684), Ribosomal protein L27, conserved site (InterPro:IPR018261); BEST Arabidopsis thaliana protein match is: ribosomal protein L27 family protein (TAIR:AT2G16930.3); Has 5114 Blast hits to 5114 proteins in 1538 species: Archae - 0; Bacteria - 2974; Metazoa - 94; Fungi - 94; Plants - 70; Viruses - 0; Other Eukaryotes - 1882 (source: NCBI BLink). 
AT5G15390AT5G15390.1CTAAACCGAAtRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); BEST Arabidopsis thaliana protein match is: tRNA/rRNA methyltransferase (SpoU) family protein (TAIR:AT2G19870.1); Has 6929 Blast hits to 6927 proteins in 1354 species: Archae - 6; Bacteria - 4609; Metazoa - 116; Fungi - 48; Plants - 75; Viruses - 0; Other Eukaryotes - 2075 (source: NCBI BLink). 
AT5G15390.1TTAAACCGAAtRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); BEST Arabidopsis thaliana protein match is: tRNA/rRNA methyltransferase (SpoU) family protein (TAIR:AT2G19870.1); Has 6929 Blast hits to 6927 proteins in 1354 species: Archae - 6; Bacteria - 4609; Metazoa - 116; Fungi - 48; Plants - 75; Viruses - 0; Other Eukaryotes - 2075 (source: NCBI BLink). 
AT5G15410AT5G15410.1ATAAACCGAA'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens. 
AT5G15410.1CCGGTTCGGTTT'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens. 
AT5G15410.2ATAAACCGAA'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens. 
AT5G15410.2CCGGTTCGGTTT'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens. 
AT5G16510AT5G16510.1GTTCGGTTTreversibly glycosylated polypeptide, putative; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: response to salt stress; LOCATED IN: Golgi apparatus, cell junction, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1,4-glucan-protein synthase, UDP-forming (InterPro:IPR004901); BEST Arabidopsis thaliana protein match is: RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1); cellulose synthase (UDP-forming) (TAIR:AT3G02230.1); Has 134 Blast hits to 133 proteins in 31 species: Archae - 12; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G16510.1TTCGGTTTGGreversibly glycosylated polypeptide, putative; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: response to salt stress; LOCATED IN: Golgi apparatus, cell junction, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1,4-glucan-protein synthase, UDP-forming (InterPro:IPR004901); BEST Arabidopsis thaliana protein match is: RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1); cellulose synthase (UDP-forming) (TAIR:AT3G02230.1); Has 134 Blast hits to 133 proteins in 31 species: Archae - 12; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G16510.2GTTCGGTTTreversibly glycosylated polypeptide, putative; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: response to salt stress; LOCATED IN: Golgi apparatus, cell junction, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1,4-glucan-protein synthase, UDP-forming (InterPro:IPR004901); BEST Arabidopsis thaliana protein match is: RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1); cellulose synthase (UDP-forming) (TAIR:AT3G02230.1); Has 134 Blast hits to 133 proteins in 31 species: Archae - 12; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G16510.2TTCGGTTTGGreversibly glycosylated polypeptide, putative; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: response to salt stress; LOCATED IN: Golgi apparatus, cell junction, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1,4-glucan-protein synthase, UDP-forming (InterPro:IPR004901); BEST Arabidopsis thaliana protein match is: RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1); cellulose synthase (UDP-forming) (TAIR:AT3G02230.1); Has 134 Blast hits to 133 proteins in 31 species: Archae - 12; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G16820AT5G16820.1AAACCGAACEncodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. 
AT5G16820.1TTAAACCGAAEncodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. 
AT5G16820.2AAACCGAACEncodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. 
AT5G16820.2TTAAACCGAAEncodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. 
AT5G17310AT5G17310.2CTAAACCGAACUTP--glucose-1-phosphate uridylyltransferase, putative / UDP-glucose pyrophosphorylase, putative / UGPase, putative; FUNCTIONS IN: UTP:glucose-1-phosphate uridylyltransferase activity, nucleotidyltransferase activity; INVOLVED IN: response to cadmium ion, response to salt stress, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: UTP--glucose-1-phosphate uridylyltransferase, subgroup (InterPro:IPR016267), UTP--glucose-1-phosphate uridylyltransferase (InterPro:IPR002618); BEST Arabidopsis thaliana protein match is: UGP (UDP-glucose pyrophosphorylase); UTP:glucose-1-phosphate uridylyltransferase/ nucleotidyltransferase (TAIR:AT3G03250.1); Has 871 Blast hits to 866 proteins in 241 species: Archae - 0; Bacteria - 171; Metazoa - 281; Fungi - 198; Plants - 121; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). 
AT5G17620AT5G17620.1TTCGGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plant nuclear matrix 1 (InterPro:IPR010604); Has 62 Blast hits to 62 proteins in 32 species: Archae - 0; Bacteria - 19; Metazoa - 8; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT5G17650AT5G17650.1CTAAACCGAACCGglycine/proline-rich protein; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; Has 8612 Blast hits to 5536 proteins in 501 species: Archae - 4; Bacteria - 1051; Metazoa - 4454; Fungi - 1160; Plants - 1109; Viruses - 38; Other Eukaryotes - 796 (source: NCBI BLink). 
AT5G17900AT5G17900.1AAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink). 
AT5G17900.1AAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink). 
AT5G17900.1CCGAACCGAACCGACCCGTAAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink). 
AT5G17900.1TCGGTTCGGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink). 
AT5G18200AT5G18200.1TTCGGTTTGGencodes an adenylyltransferase 
AT5G18760AT5G18760.1GTTCGGTTTAGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G06330.1); Has 907 Blast hits to 907 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 439; Fungi - 68; Plants - 331; Viruses - 4; Other Eukaryotes - 65 (source: NCBI BLink). 
AT5G18770AT5G18770.1CTAAACCGAACF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G18780.1); Has 1198 Blast hits to 1165 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1198; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G19240AT5G19240.1CTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19230.1); Has 42 Blast hits to 41 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G19540AT5G19540.1TGGTTCGGTTTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 48 Blast hits to 47 proteins in 16 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT5G19660AT5G19660.1ATAAACCGAAS1P appears to function as a Golgi-localized subtilase and to help protect seedlings against salt and osmotic stress. The roots of s1p-3 mutants are hypersensitive to NaCl, KCl, LiCl, and mannitol. Several salt-stress responsive genes show weaker induction in an s1P-3 mutant background. The proteolytic cleavage of the bZIP17 transcription factor depends on S1P in vitro. And there is evidence that S1P can cleave bZIP17 in vitro. 
AT5G19660.1CCAAACCGAACCAS1P appears to function as a Golgi-localized subtilase and to help protect seedlings against salt and osmotic stress. The roots of s1p-3 mutants are hypersensitive to NaCl, KCl, LiCl, and mannitol. Several salt-stress responsive genes show weaker induction in an s1P-3 mutant background. The proteolytic cleavage of the bZIP17 transcription factor depends on S1P in vitro. And there is evidence that S1P can cleave bZIP17 in vitro. 
AT5G19670AT5G19670.1TGGTTCGGTTTGGexostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT5G25820.1); Has 802 Blast hits to 800 proteins in 88 species: Archae - 0; Bacteria - 10; Metazoa - 236; Fungi - 4; Plants - 470; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). 
AT5G19670.1TTCGGTTTATexostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT5G25820.1); Has 802 Blast hits to 800 proteins in 88 species: Archae - 0; Bacteria - 10; Metazoa - 236; Fungi - 4; Plants - 470; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). 
AT5G20040AT5G20040.1GTTCGGTTTATEncodes tRNA isopentenyltransferase AtIPT9. 
AT5G20040.2GTTCGGTTTATEncodes tRNA isopentenyltransferase AtIPT9. 
AT5G20060AT5G20060.1GTAAACCGAAphospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink). 
AT5G20060.1TTAAACCGAAphospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink). 
AT5G20060.2GTAAACCGAAphospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink). 
AT5G20060.2TTAAACCGAAphospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink). 
AT5G20060.3GTAAACCGAAphospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink). 
AT5G20060.3TTAAACCGAAphospholipase/carboxylesterase family protein; FUNCTIONS IN: hydrolase activity, carboxylesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase/carboxylesterase (InterPro:IPR003140); BEST Arabidopsis thaliana protein match is: phospholipase/carboxylesterase family protein (TAIR:AT1G52700.1); Has 1596 Blast hits to 1590 proteins in 465 species: Archae - 2; Bacteria - 608; Metazoa - 304; Fungi - 165; Plants - 109; Viruses - 0; Other Eukaryotes - 408 (source: NCBI BLink). 
AT5G20140AT5G20140.1CCAAACCGAACCGASOUL heme-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790), SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT3G10130.1); Has 1348 Blast hits to 1346 proteins in 137 species: Archae - 10; Bacteria - 204; Metazoa - 88; Fungi - 0; Plants - 111; Viruses - 0; Other Eukaryotes - 935 (source: NCBI BLink). 
AT5G20570AT5G20570.1TTAAACCGAAEncodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein. 
AT5G20570.2TTAAACCGAAEncodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein. 
AT5G20570.3TTAAACCGAAEncodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein. 
AT5G20910AT5G20910.1CCAAACCGAACzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G19950.1); Has 6524 Blast hits to 6509 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2244; Fungi - 556; Plants - 2592; Viruses - 49; Other Eukaryotes - 1083 (source: NCBI BLink). 
AT5G20910.1TTGAACCGAACCAAACCGAACzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G19950.1); Has 6524 Blast hits to 6509 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2244; Fungi - 556; Plants - 2592; Viruses - 49; Other Eukaryotes - 1083 (source: NCBI BLink). 
AT5G20980AT5G20980.1TTCGGTTTGGencodes a plastidic methionine synthase, involved in methionine de novo synthesis in the chloroplast 
AT5G20980.1TTCGGTTTGGencodes a plastidic methionine synthase, involved in methionine de novo synthesis in the chloroplast 
AT5G20980.2TTCGGTTTGGencodes a plastidic methionine synthase, involved in methionine de novo synthesis in the chloroplast 
AT5G20980.2TTCGGTTTGGencodes a plastidic methionine synthase, involved in methionine de novo synthesis in the chloroplast 
AT5G22360AT5G22360.1CCAAACCGAAMember of Synaptobrevin-like AtVAMP7C, v-SNARE protein family. 
AT5G23390AT5G23390.1CGGTTTAATTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF639 (InterPro:IPR006927); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48840.1); Has 83 Blast hits to 81 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G23390.1TGGTTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF639 (InterPro:IPR006927); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48840.1); Has 83 Blast hits to 81 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G23660AT5G23660.1GGCCTAAACCGAAhomolog of the Medicago nodulin MTN3 
AT5G24313AT5G24313.1TCCGGTTCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G24314AT5G24314.1TTAAACCGAACCGGPTAC7; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastid chromosome, nucleoid; Has 35 Blast hits to 35 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G25090AT5G25090.1TTCGGTTTplastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT2G25060.1); Has 775 Blast hits to 766 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 775; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G25265AT5G25265.1AACCGAACTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: cultured cell, leaf; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25260.1); Has 112 Blast hits to 97 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 99; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT5G25600AT5G25600.1TGGTTCGGTTTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: nucleic acid binding / zinc ion binding (TAIR:AT5G36228.1); Has 119 Blast hits to 119 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G25600.1TTCGGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: nucleic acid binding / zinc ion binding (TAIR:AT5G36228.1); Has 119 Blast hits to 119 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G26060AT5G26060.1CTAAACCGAAS1 self-incompatibility protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11820.1); Has 20 Blast hits to 19 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G26110AT5G26110.1CCAAACCGAACATP binding / catalytic/ protein kinase; FUNCTIONS IN: protein kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), RIO-like kinase (InterPro:IPR018934), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08120.1); Has 1182 Blast hits to 1178 proteins in 337 species: Archae - 148; Bacteria - 370; Metazoa - 229; Fungi - 137; Plants - 43; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT5G26110.1TTCGGTTTATP binding / catalytic/ protein kinase; FUNCTIONS IN: protein kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), RIO-like kinase (InterPro:IPR018934), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08120.1); Has 1182 Blast hits to 1178 proteins in 337 species: Archae - 148; Bacteria - 370; Metazoa - 229; Fungi - 137; Plants - 43; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT5G26110.2CCAAACCGAACATP binding / catalytic/ protein kinase; FUNCTIONS IN: protein kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), RIO-like kinase (InterPro:IPR018934), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08120.1); Has 1182 Blast hits to 1178 proteins in 337 species: Archae - 148; Bacteria - 370; Metazoa - 229; Fungi - 137; Plants - 43; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT5G26110.2TTCGGTTTATP binding / catalytic/ protein kinase; FUNCTIONS IN: protein kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), RIO-like kinase (InterPro:IPR018934), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08120.1); Has 1182 Blast hits to 1178 proteins in 337 species: Archae - 148; Bacteria - 370; Metazoa - 229; Fungi - 137; Plants - 43; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink). 
AT5G26180AT5G26180.1AAACCGAANOL1/NOP2/sun family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 5353 Blast hits to 5300 proteins in 1252 species: Archae - 211; Bacteria - 3160; Metazoa - 580; Fungi - 261; Plants - 117; Viruses - 1; Other Eukaryotes - 1023 (source: NCBI BLink). 
AT5G26180.2AAACCGAANOL1/NOP2/sun family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 5353 Blast hits to 5300 proteins in 1252 species: Archae - 211; Bacteria - 3160; Metazoa - 580; Fungi - 261; Plants - 117; Viruses - 1; Other Eukaryotes - 1023 (source: NCBI BLink). 
AT5G26610AT5G26610.1TGGTTCGGTTTAGD111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink). 
AT5G26610.2TGGTTCGGTTTAGD111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink). 
AT5G26820AT5G26820.1AAACCGAACIRON-REGULATED PROTEIN 3 (ATIREG3); LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: ATIREG2 (IRON-REGULATED PROTEIN 2); nickel ion transmembrane transporter (TAIR:AT5G03570.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 2; Metazoa - 84; Fungi - 42; Plants - 43; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT5G27440AT5G27440.1TTCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: shoot, shoot apex, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; Has 3 Blast hits to 3 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G27450AT5G27450.1CCAAACCGAAEncodes a protein with mevalonate kinase activity involved in the mevalonate pathway. 
AT5G27450.2CCAAACCGAAEncodes a protein with mevalonate kinase activity involved in the mevalonate pathway. 
AT5G27950AT5G27950.1ACCCGGTTATTCGGTTTkinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT1G55550.1); Has 7669 Blast hits to 7281 proteins in 238 species: Archae - 0; Bacteria - 8; Metazoa - 3877; Fungi - 919; Plants - 883; Viruses - 0; Other Eukaryotes - 1982 (source: NCBI BLink). 
AT5G27980AT5G27980.1AAACCGAACCGAseed maturation family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: multicellular organismal development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Seed maturation protein (InterPro:IPR007011); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G22490.1); Has 103 Blast hits to 86 proteins in 19 species: Archae - 0; Bacteria - 11; Metazoa - 2; Fungi - 0; Plants - 88; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G28220AT5G28220.1ATAAACCGAACCGGCbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT3G04830.1); Has 387 Blast hits to 385 proteins in 147 species: Archae - 20; Bacteria - 17; Metazoa - 192; Fungi - 72; Plants - 23; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). 
AT5G28750AT5G28750.1TTCGGTTTthylakoid assembly protein, putative; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion, protein transport; LOCATED IN: chloroplast thylakoid membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Twin-arginine translocation protein TatB (InterPro:IPR003998), Bacterial sec-independent translocation protein mttA/Hcf106 (InterPro:IPR003369), Twin-arginine translocation protein TatA/E (InterPro:IPR006312); BEST Arabidopsis thaliana protein match is: HCF106; proton motive force dependent protein transmembrane transporter (TAIR:AT5G52440.1); Has 1888 Blast hits to 1888 proteins in 601 species: Archae - 44; Bacteria - 1428; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 356 (source: NCBI BLink). 
AT5G35320AT5G35320.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G36890AT5G36890.1GCCGGTTCGGTTTBETA GLUCOSIDASE 42 (BGLU42); FUNCTIONS IN: cation binding, beta-glucosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: cellulose catabolic process, carbohydrate metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1, beta-glucosidase (InterPro:IPR017736), Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU40 (BETA GLUCOSIDASE 40); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G26560.1); Has 5821 Blast hits to 5565 proteins in 799 species: Archae - 98; Bacteria - 3179; Metazoa - 610; Fungi - 134; Plants - 849; Viruses - 0; Other Eukaryotes - 951 (source: NCBI BLink). 
AT5G36890.2GCCGGTTCGGTTTBETA GLUCOSIDASE 42 (BGLU42); FUNCTIONS IN: cation binding, beta-glucosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: cellulose catabolic process, carbohydrate metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1, beta-glucosidase (InterPro:IPR017736), Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU40 (BETA GLUCOSIDASE 40); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G26560.1); Has 5821 Blast hits to 5565 proteins in 799 species: Archae - 98; Bacteria - 3179; Metazoa - 610; Fungi - 134; Plants - 849; Viruses - 0; Other Eukaryotes - 951 (source: NCBI BLink). 
AT5G37740AT5G37740.1TTCGGTTTC2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT1G66360.1); Has 2572 Blast hits to 2201 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 1663; Fungi - 280; Plants - 414; Viruses - 0; Other Eukaryotes - 215 (source: NCBI BLink). 
AT5G37830AT5G37830.1AAACCGAAEncodes a 5-oxoprolinase that acts in the glutathione degradation pathway and in 5-oxoproline metabolism. 
AT5G37850AT5G37850.2CCAAACCGAAEncodes a pyridoxal kinase required for root hair development. Mutants are hypersensitive to Na+, K+ and Li+. 
AT5G39400AT5G39400.1TTCGGTTTPTEN1; FUNCTIONS IN: phosphatase activity; INVOLVED IN: N-terminal protein myristoylation, pollen development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Phosphatase tensin type (InterPro:IPR014019), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Tensin phosphatase, C2 domain (InterPro:IPR014020); BEST Arabidopsis thaliana protein match is: ATPEN2 (ARABIDOPSIS THALIANA PTEN 2); phosphatase/ protein tyrosine phosphatase (TAIR:AT3G19420.1); Has 1145 Blast hits to 1141 proteins in 148 species: Archae - 6; Bacteria - 19; Metazoa - 735; Fungi - 150; Plants - 35; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink). 
AT5G39600AT5G39600.1AAACCGAACCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G40200AT5G40200.1TTCGGTTTEncodes a putative DegP protease. 
AT5G40240AT5G40240.1TTCGGTTTnodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin-related (TAIR:AT5G40230.1); Has 1618 Blast hits to 1607 proteins in 311 species: Archae - 15; Bacteria - 735; Metazoa - 4; Fungi - 9; Plants - 626; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). 
AT5G40240.1TTCGGTTTAGnodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin-related (TAIR:AT5G40230.1); Has 1618 Blast hits to 1607 proteins in 311 species: Archae - 15; Bacteria - 735; Metazoa - 4; Fungi - 9; Plants - 626; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). 
AT5G40450AT5G40450.1AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28770.1); Has 222145 Blast hits to 74171 proteins in 2066 species: Archae - 1478; Bacteria - 23379; Metazoa - 97811; Fungi - 22006; Plants - 7575; Viruses - 1468; Other Eukaryotes - 68428 (source: NCBI BLink). 
AT5G40450.2AAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28770.1); Has 222145 Blast hits to 74171 proteins in 2066 species: Archae - 1478; Bacteria - 23379; Metazoa - 97811; Fungi - 22006; Plants - 7575; Viruses - 1468; Other Eukaryotes - 68428 (source: NCBI BLink). 
AT5G41140AT5G41140.1TTCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G63300.1); Has 134231 Blast hits to 67045 proteins in 2157 species: Archae - 1495; Bacteria - 17732; Metazoa - 63246; Fungi - 9993; Plants - 4740; Viruses - 695; Other Eukaryotes - 36330 (source: NCBI BLink). 
AT5G42130AT5G42130.1ATAAACCGAAmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SAMC1 (S-ADENOSYLMETHIONINE CARRIER 1); S-adenosylmethionine transmembrane transporter/ binding (TAIR:AT4G39460.1); Has 17455 Blast hits to 9853 proteins in 357 species: Archae - 0; Bacteria - 0; Metazoa - 8573; Fungi - 4742; Plants - 2529; Viruses - 0; Other Eukaryotes - 1611 (source: NCBI BLink). 
AT5G42655AT5G42655.1AAACCGAACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: disease resistance-responsive family protein (TAIR:AT5G42500.1); Has 121 Blast hits to 121 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 121; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G43260AT5G43260.1ATAAACCGAACCGchaperone protein dnaJ-related; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 66 Blast hits to 65 proteins in 21 species: Archae - 0; Bacteria - 15; Metazoa - 2; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT5G43280AT5G43280.1CTAAACCGAAEncodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. 
AT5G43280.2CTAAACCGAAEncodes the peroxisomal delta 3,5-delta2,4-dienoyl-CoA isomerase, a enzyme involved in degradation of unsaturated fatty acids. Gene expression is induced upon seed germination. 
AT5G43430AT5G43430.1CTAAACCGGATTAAACCGAAEncodes the electron transfer flavoprotein ETF beta, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation. 
AT5G43430.2CTAAACCGGATTAAACCGAAEncodes the electron transfer flavoprotein ETF beta, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation. 
AT5G43430.3CTAAACCGGATTAAACCGAAEncodes the electron transfer flavoprotein ETF beta, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF alpha is At1g50940) in Arabidopsis. Mutations of the ETF beta gene result in accelerated senescence and early death compared to wild-type during extended darkness. Also involved in the catabolism of leucine and chlorophyll degradation pathway activated during darkness-induced carbohydrate deprivation. 
AT5G44070AT5G44070.1CCAAACCGAAPhytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. 
AT5G45620AT5G45620.1TTCGGTTT26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). 
AT5G45620.2TTCGGTTT26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). 
AT5G45900AT5G45900.1ATAAACCGAAComponent of autophagy conjugation pathway. Required for proper senescence. 
AT5G45930AT5G45930.1CCAAACCGAAencodes a second Chl I gene (CHLI2), a subunit of magnesium chelatase which is required for chlorophyll biosynthesis. Has ATPase activity, regulated by TRX-f. Involved in the assembly of the Mg chelatase complex. 
AT5G46180AT5G46180.1AAACCGAAornithine delta-aminotransferase 
AT5G47060AT5G47060.1AAACCGAAsenescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT4G17670.1); Has 303 Blast hits to 303 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 289; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G48150AT5G48150.1TTCGGTTTMember of GRAS gene family. Semi-dominant mutant has a reduced response to far-red light and appears to act early in the phytochrome A signaling pathway. 
AT5G48150.2TTCGGTTTMember of GRAS gene family. Semi-dominant mutant has a reduced response to far-red light and appears to act early in the phytochrome A signaling pathway. 
AT5G48240AT5G48240.1AACCCGACCTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). 
AT5G48240.2AACCCGACCTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). 
AT5G48240.3AACCCGACCTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459). 
AT5G48335AT5G48335.1TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07580.1); Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G48550AT5G48550.1AAACCGAACCGAF-box family protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: leaf whorl; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G47730.1); Has 160 Blast hits to 160 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G48580AT5G48580.1TTAAACCGAAimmunophilin (FKBP15-2) 
AT5G49230AT5G49230.1TTCGGTTTGGIdentified in a screen for mutations hypersensitive to red and blue light. Mutants have shorter hypocotyls. Encodes a nuclear localized protein with similarity to drought induced proteins. Contains a ZZ zinc finger domain which is thought to mediate protein-protein interactions.May be involved in red and blue light signal transduction. 
AT5G50380AT5G50380.1CTAAACCGAAA member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. 
AT5G50440AT5G50440.1AAACCGAAmember of Membrin Gene Family 
AT5G50800AT5G50800.1TTCGGTTTnodulin MtN3 family protein; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: MtN3 and saliva related transmembrane protein, conserved region (InterPro:IPR018169), RAG1-activating protein 1 homologue (InterPro:IPR018179), MtN3 and saliva related transmembrane protein (InterPro:IPR004316); BEST Arabidopsis thaliana protein match is: nodulin MtN3 family protein (TAIR:AT4G25010.1); Has 585 Blast hits to 542 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 231; Fungi - 0; Plants - 290; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT5G50850AT5G50850.1TTCGGTTTMACCI-BOU (MAB1); FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity, catalytic activity; INVOLVED IN: defense response to bacterium; LOCATED IN: mitochondrion, nucleolus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Transketolase, C-terminal (InterPro:IPR005476), Transketolase C-terminal-like (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: PDH-E1 BETA (PYRUVATE DEHYDROGENASE E1 BETA); pyruvate dehydrogenase (acetyl-transferring) (TAIR:AT1G30120.1); Has 11982 Blast hits to 11974 proteins in 1601 species: Archae - 106; Bacteria - 6028; Metazoa - 516; Fungi - 148; Plants - 236; Viruses - 0; Other Eukaryotes - 4948 (source: NCBI BLink). 
AT5G51350AT5G51350.1TGGTTCGGTTTGGleucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G61480.1); Has 68844 Blast hits to 28909 proteins in 838 species: Archae - 29; Bacteria - 3219; Metazoa - 20839; Fungi - 694; Plants - 39080; Viruses - 14; Other Eukaryotes - 4969 (source: NCBI BLink). 
AT5G51390AT5G51390.1TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G51510AT5G51510.1TGGTTCGGTTTAGTTCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G51740AT5G51740.1AAACCGAApeptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 4555 Blast hits to 4524 proteins in 759 species: Archae - 2; Bacteria - 2617; Metazoa - 54; Fungi - 111; Plants - 18; Viruses - 0; Other Eukaryotes - 1753 (source: NCBI BLink). 
AT5G51740.1ATAAACCGAApeptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 4555 Blast hits to 4524 proteins in 759 species: Archae - 2; Bacteria - 2617; Metazoa - 54; Fungi - 111; Plants - 18; Viruses - 0; Other Eukaryotes - 1753 (source: NCBI BLink). 
AT5G51760AT5G51760.1AAACCGAAEncodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination. 
AT5G52180AT5G52180.1AAACCGAACCGAACCGGAAunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 50 Blast hits to 50 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 37; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G52190AT5G52190.1AAACCGAACCGAACCGGAAsugar isomerase (SIS) domain-containing protein; FUNCTIONS IN: sugar binding; INVOLVED IN: carbohydrate metabolic process; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Sugar isomerase (SIS) (InterPro:IPR001347); Has 410 Blast hits to 410 proteins in 146 species: Archae - 96; Bacteria - 262; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). 
AT5G52370AT5G52370.1CTAAACCGAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G58990.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 18; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G52540AT5G52540.1TTCGGTTTGGunknown protein; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF819 (InterPro:IPR008537); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24000.1); Has 519 Blast hits to 519 proteins in 137 species: Archae - 2; Bacteria - 275; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 208 (source: NCBI BLink). 
AT5G52882AT5G52882.1AAACCGAAATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT4G28000.1); Has 27413 Blast hits to 25805 proteins in 1860 species: Archae - 929; Bacteria - 10210; Metazoa - 4036; Fungi - 2467; Plants - 1717; Viruses - 25; Other Eukaryotes - 8029 (source: NCBI BLink). 
AT5G53050AT5G53050.1AAACCGAACCGAACCAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). 
AT5G53050.2AAACCGAACCGAACCAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). 
AT5G53050.3AAACCGAACCGAACCAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink). 
AT5G53450AT5G53450.1TTCGGTTTATOBP3-responsive gene 1 (ORG1); FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); Has 437 Blast hits to 437 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 146; Fungi - 39; Plants - 194; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). 
AT5G53450.2TTCGGTTTATOBP3-responsive gene 1 (ORG1); FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); Has 437 Blast hits to 437 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 146; Fungi - 39; Plants - 194; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). 
AT5G53620AT5G53620.1AAACCGAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.1CCAAACCGAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.1CCAAACCGAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.1TTCGGTTTGGunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.2AAACCGAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.2CCAAACCGAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.2CCAAACCGAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.2TTCGGTTTGGunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.3AAACCGAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.3CCAAACCGAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.3CCAAACCGAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.3TTCGGTTTGGunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G54310AT5G54310.1TTAAACCGAAA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT5G54310.1TTAAACCGAACCAA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT5G54540AT5G54540.1ATAAACCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP012943 (InterPro:IPR016606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25170.1); Has 60 Blast hits to 60 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G54690AT5G54690.1AAACCGAAEncodes a protein with putative galacturonosyltransferase activity. Mutants defective in this gene displayed a notable reduction in xylose (>50%) in the cell walls from stems and roots and a reduction in cellulose (~25%). 
AT5G55290AT5G55290.1GTTCGGTTTATP synthase subunit H family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: ATP hydrolysis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, V0 complex, subunit E (InterPro:IPR008389); BEST Arabidopsis thaliana protein match is: ATP synthase subunit H family protein (TAIR:AT4G26710.2); Has 207 Blast hits to 207 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 12; Plants - 37; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). 
AT5G55290.2GTTCGGTTTATP synthase subunit H family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: ATP hydrolysis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, V0 complex, subunit E (InterPro:IPR008389); BEST Arabidopsis thaliana protein match is: ATP synthase subunit H family protein (TAIR:AT4G26710.2); Has 207 Blast hits to 207 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 12; Plants - 37; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). 
AT5G55500AT5G55500.1TCGGTTCGGTTTAAEncodes a beta-1,2-xylosyltransferase that is glycosylated at two positions. 
AT5G56100AT5G56100.1GTTCGGTTTglycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G56140AT5G56140.1ATAAACCGAAKH domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 4346 Blast hits to 2291 proteins in 261 species: Archae - 6; Bacteria - 444; Metazoa - 2561; Fungi - 214; Plants - 674; Viruses - 13; Other Eukaryotes - 434 (source: NCBI BLink). 
AT5G56460AT5G56460.1TTCGGTTTAAprotein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G01020.1); Has 80161 Blast hits to 79301 proteins in 2452 species: Archae - 44; Bacteria - 7377; Metazoa - 35060; Fungi - 5996; Plants - 18115; Viruses - 334; Other Eukaryotes - 13235 (source: NCBI BLink). 
AT5G57930AT5G57930.1TTCGGTTTACCUMULATION OF PHOTOSYSTEM ONE 2 
AT5G57930.2TTCGGTTTACCUMULATION OF PHOTOSYSTEM ONE 2 
AT5G58040AT5G58040.1TTCGGTTTTCCGGTEncodes a subunit of the polyadenylation apparatus that interacts with and stimulates the activity of poly(A) polymerase. Additionally , it interacts with several polyadenylation factor subunits and is an RNA-binding protein. It is suggested that this protein coordinates a number of polyadenylation factor subunits with PAP and with RNA. 
AT5G58060AT5G58060.1CTAAACCGAACCGAmember of YKT6 Gene Family 
AT5G58060.2CTAAACCGAACCGAmember of YKT6 Gene Family 
AT5G58670AT5G58670.1TTCGGTTTATphosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one). 
AT5G58990AT5G58990.1TTCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52370.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 18; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G59030AT5G59030.1AAACCGAAencodes a putative copper transport protein that contains copper-binding motif and functionally complements in copper-transport defective yeast strains 
AT5G59590AT5G59590.1TTCGGTTTUDP-GLUCOSYL TRANSFERASE 76E2 (UGT76E2); FUNCTIONS IN: quercetin 3-O-glucosyltransferase activity, quercetin 7-O-glucosyltransferase activity, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT76E1 (UDP-GLUCOSYL TRANSFERASE 76E1); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ quercetin 7-O-glucosyltransferase (TAIR:AT5G59580.1); Has 4913 Blast hits to 4888 proteins in 333 species: Archae - 0; Bacteria - 148; Metazoa - 1910; Fungi - 21; Plants - 2692; Viruses - 112; Other Eukaryotes - 30 (source: NCBI BLink). 
AT5G60170AT5G60170.1AAACCGAACCGGACRNA binding / nucleic acid binding / nucleotide binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), RNA recognition motif, RNP-1 (InterPro:IPR000504), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), RNA recognition, region 1 (InterPro:IPR003954); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G45630.1); Has 1060 Blast hits to 628 proteins in 173 species: Archae - 0; Bacteria - 202; Metazoa - 240; Fungi - 159; Plants - 78; Viruses - 0; Other Eukaryotes - 381 (source: NCBI BLink). 
AT5G60640AT5G60640.1GTTCGGTTTATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. 
AT5G60640.1TCGGTTCGGTTTAGEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. 
AT5G60640.2GTTCGGTTTATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. 
AT5G60640.2TCGGTTCGGTTTAGEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. 
AT5G61240AT5G61240.1TTCGGTTTACprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT1G13910.1); Has 54870 Blast hits to 18308 proteins in 781 species: Archae - 35; Bacteria - 3366; Metazoa - 15390; Fungi - 767; Plants - 32078; Viruses - 0; Other Eukaryotes - 3234 (source: NCBI BLink). 
AT5G62050AT5G62050.1CCAAACCGAACessential factor for protein sorting and assembly into membranes 
AT5G62060AT5G62060.1GTTCGGTTTGGF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 3 (InterPro:IPR013187), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G32420.1); Has 662 Blast hits to 644 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 662; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G62810AT5G62810.1GTTCGGTTTmutant has a defect in the intracellular transport of thiolase from the cytosol to glyoxysomes (formerly known as ped2) 
AT5G62920AT5G62920.1TTCGGTTTEncodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. 
AT5G64290AT5G64290.1TTCGGTTTDICARBOXYLATE TRANSPORT 2.1 (DIT2.1); FUNCTIONS IN: oxoglutarate:malate antiporter activity; INVOLVED IN: malate transport, response to nematode; LOCATED IN: chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sodium/sulphate symporter (InterPro:IPR001898); BEST Arabidopsis thaliana protein match is: DiT2.2 (dicarboxylate transporter 2.2); oxoglutarate:malate antiporter (TAIR:AT5G64280.1); Has 2721 Blast hits to 2720 proteins in 602 species: Archae - 47; Bacteria - 2055; Metazoa - 43; Fungi - 9; Plants - 101; Viruses - 2; Other Eukaryotes - 464 (source: NCBI BLink). 
AT5G64341AT5G64341.1AAACCGAAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF40 represents a conserved upstream opening reading frame relative to major ORF AT5G64340.1 
AT5G64342AT5G64342.1AAACCGAAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF39 represents a conserved upstream opening reading frame relative to major ORF AT5G64340.1 
AT5G64343AT5G64343.1AAACCGAAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF38 represents a conserved upstream opening reading frame relative to major ORF AT5G64340.1 
AT5G65430AT5G65430.1AAACCGAAmember of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 
AT5G65430.2AAACCGAAmember of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 
AT5G65490AT5G65490.1TTCGGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SGT1 (InterPro:IPR010770); Has 4480 Blast hits to 3390 proteins in 346 species: Archae - 8; Bacteria - 210; Metazoa - 1070; Fungi - 582; Plants - 124; Viruses - 61; Other Eukaryotes - 2425 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.