| Locus | Gene model | Sequence | Description |
| AT1G01240 | AT1G01240.1 | GTGTCGTTTT | unknown protein; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1); Has 70 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT1G01240.2 | GTGTCGTTTT | unknown protein; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1); Has 70 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT1G01240.3 | GTGTCGTTTT | unknown protein; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1); Has 70 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT1G01720 | AT1G01720.1 | GAAACGACA | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA.  |
| AT1G01730 | AT1G01730.1 | AAAACGACAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 4; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G02370 | AT1G02370.1 | AAAACGACACC | pentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G01990.1); Has 3083 Blast hits to 1840 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 43; Fungi - 27; Plants - 2899; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink).  |
| AT1G02370.1 | TAAACGACA | pentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G01990.1); Has 3083 Blast hits to 1840 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 43; Fungi - 27; Plants - 2899; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink).  |
| AT1G02890 | AT1G02890.1 | TGTCGTTTC | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), SMAD/FHA domain (InterPro:IPR008984), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT4G02480.1); Has 23205 Blast hits to 21556 proteins in 1781 species: Archae - 951; Bacteria - 7411; Metazoa - 4074; Fungi - 2356; Plants - 1493; Viruses - 28; Other Eukaryotes - 6892 (source: NCBI BLink).  |
| AT1G02890.2 | TGTCGTTTC | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), SMAD/FHA domain (InterPro:IPR008984), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT4G02480.1); Has 23205 Blast hits to 21556 proteins in 1781 species: Archae - 951; Bacteria - 7411; Metazoa - 4074; Fungi - 2356; Plants - 1493; Viruses - 28; Other Eukaryotes - 6892 (source: NCBI BLink).  |
| AT1G03130 | AT1G03130.1 | AAAACGACA | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2)  |
| AT1G03280 | AT1G03280.1 | TGTCGTTTA | transcription initiation factor IIE (TFIIE) alpha subunit family protein / general transcription factor TFIIE family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription initiation factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: endomembrane system, transcription factor TFIIE complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Transcription factor TFIIE, alpha subunit (InterPro:IPR002853), Transcription factor TFE/TFIIEalpha, HTH domain (InterPro:IPR017919); BEST Arabidopsis thaliana protein match is: RNA polymerase II transcription factor/ transcription initiation factor (TAIR:AT4G20340.1); Has 683 Blast hits to 606 proteins in 133 species: Archae - 3; Bacteria - 10; Metazoa - 347; Fungi - 130; Plants - 70; Viruses - 11; Other Eukaryotes - 112 (source: NCBI BLink).  |
| AT1G03780 | AT1G03780.1 | AAAACGACAC | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase.  |
| AT1G03780.1 | GAAACGACAC | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase.  |
| AT1G03780.2 | AAAACGACAC | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase.  |
| AT1G03780.2 | GAAACGACAC | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase.  |
| AT1G03905 | AT1G03905.1 | TGTCGTTT | ABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink).  |
| AT1G04350 | AT1G04350.1 | TGTCGTTTC | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase  |
| AT1G05840 | AT1G05840.1 | GAAACGACA | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT3G02740.1); Has 2039 Blast hits to 2022 proteins in 216 species: Archae - 0; Bacteria - 0; Metazoa - 414; Fungi - 414; Plants - 1048; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink).  |
| AT1G05870 | AT1G05870.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1685 (InterPro:IPR012881); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31560.2); Has 124 Blast hits to 124 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 124; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G05870.2 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1685 (InterPro:IPR012881); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31560.2); Has 124 Blast hits to 124 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 124; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G06700 | AT1G06700.1 | TGTCGTTTA | serine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink).  |
| AT1G06700.2 | TGTCGTTTA | serine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink).  |
| AT1G06900 | AT1G06900.1 | AAACGCGTGTCGTTTT | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding; FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 36095 Blast hits to 16198 proteins in 1364 species: Archae - 66; Bacteria - 4521; Metazoa - 14084; Fungi - 4071; Plants - 1728; Viruses - 678; Other Eukaryotes - 10947 (source: NCBI BLink).  |
| AT1G07180 | AT1G07180.1 | TGTCGTTTC | Internal NAD(P)H dehydrogenase in mitochondria. The predicted protein sequence has high homology with other designated NAD(P)H DHs from microorganisms; the capacity for matrix NAD(P)H oxidation via the rotenone-insensitive pathway is significantly reduced in the Atndi1 mutant plant line; the in vitro translation product of AtNDI1 is imported into isolated mitochondria and located on the inside of the inner membrane.  |
| AT1G08450 | AT1G08450.1 | AAACGACAC | Encodes calreticulin CRT3.  |
| AT1G08450.2 | AAACGACAC | Encodes calreticulin CRT3.  |
| AT1G09140 | AT1G09140.1 | AAAACGACA | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.  |
| AT1G09140.2 | AAAACGACA | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.  |
| AT1G09150 | AT1G09150.1 | TGTCGTTTT | pseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink).  |
| AT1G09800 | AT1G09800.1 | AAACGACACC | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT3G06950.1); Has 6844 Blast hits to 5672 proteins in 1445 species: Archae - 71; Bacteria - 3683; Metazoa - 118; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2917 (source: NCBI BLink).  |
| AT1G10580 | AT1G10580.1 | TGTCGTTTC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein (TAIR:AT5G54520.1); Has 48476 Blast hits to 23700 proteins in 723 species: Archae - 63; Bacteria - 5525; Metazoa - 21675; Fungi - 8965; Plants - 4026; Viruses - 24; Other Eukaryotes - 8198 (source: NCBI BLink).  |
| AT1G11430 | AT1G11430.1 | GGTGTCGTTTC | plastid developmental protein DAG, putative; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT3G06790.2); Has 147 Blast hits to 135 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G11870 | AT1G11870.1 | AAACGACA | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  |
| AT1G11870.1 | GAAACGACA | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  |
| AT1G11870.1 | TGTCGTTTT | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  |
| AT1G11870.2 | AAACGACA | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  |
| AT1G11870.2 | GAAACGACA | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  |
| AT1G11870.2 | TGTCGTTTT | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  |
| AT1G11870.3 | AAACGACA | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  |
| AT1G11870.3 | GAAACGACA | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  |
| AT1G11870.3 | TGTCGTTTT | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  |
| AT1G12030 | AT1G12030.1 | TGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: pollen tube, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62420.1); Has 213 Blast hits to 213 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 211; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT1G12270 | AT1G12270.1 | AAAACGACATCG | stress-inducible protein, putative; FUNCTIONS IN: binding; INVOLVED IN: response to stress; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G62740.1); Has 29103 Blast hits to 13265 proteins in 843 species: Archae - 964; Bacteria - 7395; Metazoa - 8026; Fungi - 1794; Plants - 2170; Viruses - 39; Other Eukaryotes - 8715 (source: NCBI BLink).  |
| AT1G12910 | AT1G12910.1 | GGTGTCGTTTT | Encodes a protein with similarity to the petunia WD repeat protein an11.  |
| AT1G13120 | AT1G13120.1 | TAAACGACATCG | embryo defective 1745 (emb1745); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nuclear pore; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GLE1-like (InterPro:IPR012476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G05523.1); Has 32122 Blast hits to 20275 proteins in 1392 species: Archae - 166; Bacteria - 5743; Metazoa - 12337; Fungi - 2633; Plants - 1041; Viruses - 221; Other Eukaryotes - 9981 (source: NCBI BLink).  |
| AT1G14860 | AT1G14860.1 | TGTCGTTTT | Arabidopsis thaliana Nudix hydrolase homolog 18 (atnudt18); FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt17 (Arabidopsis thaliana Nudix hydrolase homolog 17); hydrolase (TAIR:AT2G01670.1); Has 654 Blast hits to 652 proteins in 183 species: Archae - 0; Bacteria - 168; Metazoa - 195; Fungi - 79; Plants - 132; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).  |
| AT1G14900 | AT1G14900.1 | TGTCGTTTT | Encodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA.  |
| AT1G15880 | AT1G15880.1 | CGATGTCGTTTA | Golgi SNARE 11 protein (GOS11)  |
| AT1G15890 | AT1G15890.1 | TAAACGACATCG | disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation, defense response, apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G43730.1); Has 12716 Blast hits to 11782 proteins in 513 species: Archae - 12; Bacteria - 543; Metazoa - 2689; Fungi - 133; Plants - 9121; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink).  |
| AT1G16070 | AT1G16070.1 | AAAACGACA | Member of TLP family  |
| AT1G16070.2 | AAAACGACA | Member of TLP family  |
| AT1G16080 | AT1G16080.1 | TGTCGTTTT | unknown protein; LOCATED IN: apoplast, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 18 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT1G16320 | AT1G16320.1 | CGTGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G79510.2); Has 187 Blast hits to 187 proteins in 61 species: Archae - 0; Bacteria - 61; Metazoa - 72; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G16320.1 | GTGTCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G79510.2); Has 187 Blast hits to 187 proteins in 61 species: Archae - 0; Bacteria - 61; Metazoa - 72; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G16420 | AT1G16420.1 | AAAACGACA | Encodes a metacaspase (cysteine-type endopeptidase) that is involved in promoting programmed cell death in response to hydrogen peroxide (H2O2), UV light, and methyl viologen (MV). Transcript levels rise in response to UV-C, H2O2, and MV. In vitro assays demonstrate that this enzyme has a preference for cleaving after an arginine residue, and it has a pH optimum of 8.0.  |
| AT1G16810 | AT1G16810.1 | CGATGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
| AT1G16810.2 | CGATGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
| AT1G16850 | AT1G16850.1 | TGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, leaf apex, male gametophyte, flower, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; Has 9 Blast hits to 9 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G16890 | AT1G16890.1 | TGTCGTTTA | UBC36/UBC13B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair. It can bind to the MMZ/UEV1 proteins in vitro.  |
| AT1G16890.2 | TGTCGTTTA | UBC36/UBC13B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair. It can bind to the MMZ/UEV1 proteins in vitro.  |
| AT1G17070 | AT1G17070.1 | AAAACGACA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink).  |
| AT1G17455 | AT1G17455.1 | GAAACGACA | ELF4-Like 4 (ELF4-L4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1313 (InterPro:IPR009741); BEST Arabidopsis thaliana protein match is: ELF4-L2 (ELF4-Like 2) (TAIR:AT1G72630.1); Has 69 Blast hits to 68 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G17455.2 | GAAACGACA | ELF4-Like 4 (ELF4-L4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1313 (InterPro:IPR009741); BEST Arabidopsis thaliana protein match is: ELF4-L2 (ELF4-Like 2) (TAIR:AT1G72630.1); Has 69 Blast hits to 68 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G18490 | AT1G18490.1 | AAAACGACAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1637 (InterPro:IPR012864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39890.1); Has 239 Blast hits to 239 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
| AT1G18710 | AT1G18710.1 | TGTCGTTTA | Member of the R2R3 factor gene family.  |
| AT1G18950 | AT1G18950.1 | AAAACGACAGCGTTT | aminoacyl-tRNA synthetase family; FUNCTIONS IN: aminoacyl-tRNA ligase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25580.1); Has 20587 Blast hits to 12449 proteins in 605 species: Archae - 33; Bacteria - 1436; Metazoa - 9619; Fungi - 2230; Plants - 832; Viruses - 219; Other Eukaryotes - 6218 (source: NCBI BLink).  |
| AT1G19400 | AT1G19400.1 | TGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75180.3); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G19400.2 | TGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75180.3); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G19450 | AT1G19450.1 | AAAACGACA | integral membrane protein, putative / sugar transporter family protein; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: integral membrane protein, putative (TAIR:AT1G75220.1); Has 20407 Blast hits to 19945 proteins in 1330 species: Archae - 327; Bacteria - 8693; Metazoa - 4646; Fungi - 4186; Plants - 1403; Viruses - 2; Other Eukaryotes - 1150 (source: NCBI BLink).  |
| AT1G19570 | AT1G19570.1 | TGTCGTTTC | Encodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.  |
| AT1G19570.2 | TGTCGTTTC | Encodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.  |
| AT1G19580 | AT1G19580.1 | GAAACGACA | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex.  |
| AT1G21980 | AT1G21980.1 | GGTGTCGTTTT | Type I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution.  |
| AT1G22070 | AT1G22070.1 | TGTCGTTTC | Encodes a transcription factor. Like other TGAla-related factors, TGA3 has a highly conserved bZIP region and exhibits similar DNA-binding properties.  |
| AT1G22140 | AT1G22140.1 | TGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 27 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G22140.2 | TGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 27 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G22200 | AT1G22200.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).  |
| AT1G22200.2 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).  |
| AT1G22450 | AT1G22450.1 | TGTCGTTTT | subunit 6b of cytochrome c oxidase  |
| AT1G22860 | AT1G22860.1 | TAAACGACAGCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 284 Blast hits to 266 proteins in 98 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
| AT1G25440 | AT1G25440.1 | AAAACGACA | zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc finger (B-box type) family protein (TAIR:AT1G68520.1); Has 2116 Blast hits to 1317 proteins in 89 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 2049; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  |
| AT1G26220 | AT1G26220.1 | AAACGACA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: ATNSI (NUCLEAR SHUTTLE INTERACTING); N-acetyltransferase (TAIR:AT1G32070.3); Has 851 Blast hits to 851 proteins in 219 species: Archae - 14; Bacteria - 530; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 262 (source: NCBI BLink).  |
| AT1G27190 | AT1G27190.1 | TCCAACGGTGTCGTTTT | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT1G69990.1); Has 68357 Blast hits to 43210 proteins in 1433 species: Archae - 27; Bacteria - 4242; Metazoa - 15832; Fungi - 1729; Plants - 40190; Viruses - 134; Other Eukaryotes - 6203 (source: NCBI BLink).  |
| AT1G27590 | AT1G27590.1 | AAAACGACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT1G27570.1); Has 81 Blast hits to 81 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 59; Fungi - 4; Plants - 17; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT1G27630 | AT1G27630.1 | AAAACGACAC | CYCLIN T 1;3 (CYCT1;3); FUNCTIONS IN: cyclin-dependent protein kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like (InterPro:IPR011028), Transcription regulator cyclin (InterPro:IPR015429), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: cyclin family protein (TAIR:AT5G45190.1); Has 1136 Blast hits to 1136 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 700; Fungi - 230; Plants - 139; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
| AT1G27840 | AT1G27840.1 | TGTCGTTTT | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink).  |
| AT1G27840.2 | TGTCGTTTT | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink).  |
| AT1G27840.3 | TGTCGTTTT | ATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink).  |
| AT1G28300 | AT1G28300.1 | AAAACGACA | Transcription factor that contains a B3 domain, a DNA-binding motif unique to plants and characteristic of several transcription factors. Plays critical roles both early and late during embryo development. LEC2 RNA accumulates primarily during seed development. LEC2 is required for the maintenance of suspensor morphology, specification of cotyledon identity, progression through the maturation phase, and suppression of premature germination. It establishes a cellular environment sufficient to initiate embryo development - ectopic, postembryonic expression of LEC2 in transgenic plants induces the formation of somatic embryos and other organ-like structures and often confers embryonic characteristics to seedlings and to reproductive and vegetative organs of mature plants.  |
| AT1G29030 | AT1G29030.1 | AAAACGACA | apoptosis inhibitory 5 (API5) family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Apoptosis inhibitory 5 (InterPro:IPR008383), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: apoptosis inhibitory 5 (API5) family protein (TAIR:AT2G34040.1); Has 774 Blast hits to 590 proteins in 143 species: Archae - 2; Bacteria - 48; Metazoa - 221; Fungi - 85; Plants - 108; Viruses - 7; Other Eukaryotes - 303 (source: NCBI BLink).  |
| AT1G29040 | AT1G29040.1 | TGTCGTTTT | unknown protein; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP02058 (InterPro:IPR011719); Has 235 Blast hits to 235 proteins in 66 species: Archae - 0; Bacteria - 138; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
| AT1G29040.2 | TGTCGTTTT | unknown protein; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP02058 (InterPro:IPR011719); Has 235 Blast hits to 235 proteins in 66 species: Archae - 0; Bacteria - 138; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
| AT1G29040.3 | TGTCGTTTT | unknown protein; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP02058 (InterPro:IPR011719); Has 235 Blast hits to 235 proteins in 66 species: Archae - 0; Bacteria - 138; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
| AT1G29040.4 | TGTCGTTTT | unknown protein; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP02058 (InterPro:IPR011719); Has 235 Blast hits to 235 proteins in 66 species: Archae - 0; Bacteria - 138; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
| AT1G29250 | AT1G29250.1 | CGATGTCGTTT | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT2G34160.1); Has 89 Blast hits to 89 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
| AT1G29260 | AT1G29260.1 | AAACGACATCG | Encodes the peroxisomal targeting signal type 2 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS2 consensus sequence (RLX5HL or a variant) within the first 30 or so amino acids. RNAi experiments suggest that PEX7 is necessary for the maintenance of glyoxysomal but not leaf peroxisomal function.  |
| AT1G29390 | AT1G29390.1 | TAAACGACTGTCGTTTT | encodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.  |
| AT1G29390.2 | TAAACGACTGTCGTTTT | encodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.  |
| AT1G31020 | AT1G31020.1 | CGATGTCGTTTC | Arabidopsis thioredoxin o2 (ATO2); INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATO1 (Arabidopsis thioredoxin O1) (TAIR:AT2G35010.2); Has 8280 Blast hits to 8267 proteins in 1604 species: Archae - 109; Bacteria - 3630; Metazoa - 858; Fungi - 399; Plants - 738; Viruses - 3; Other Eukaryotes - 2543 (source: NCBI BLink).  |
| AT1G32130 | AT1G32130.1 | AGTCGGTTCAAACGACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TFIIS N-terminal (InterPro:IPR017923), IWS1, C-terminal (InterPro:IPR008654); BEST Arabidopsis thaliana protein match is: IWS1 C-terminus family protein (TAIR:AT4G19000.1); Has 907 Blast hits to 871 proteins in 182 species: Archae - 4; Bacteria - 14; Metazoa - 417; Fungi - 195; Plants - 42; Viruses - 8; Other Eukaryotes - 227 (source: NCBI BLink).  |
| AT1G32380 | AT1G32380.1 | AAACGACACC | ribose-phosphate pyrophosphokinase 2 / phosphoribosyl diphosphate synthetase 2 (PRS2); FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 1 / phosphoribosyl diphosphate synthetase 1 (PRSI) (TAIR:AT2G35390.2); Has 8056 Blast hits to 7889 proteins in 1556 species: Archae - 182; Bacteria - 3337; Metazoa - 501; Fungi - 457; Plants - 129; Viruses - 7; Other Eukaryotes - 3443 (source: NCBI BLink).  |
| AT1G33390 | AT1G33390.1 | AAAACGACA | helicase domain-containing protein; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: helicase domain-containing protein (TAIR:AT1G48650.2); Has 11093 Blast hits to 6432 proteins in 948 species: Archae - 0; Bacteria - 3704; Metazoa - 3089; Fungi - 1453; Plants - 542; Viruses - 298; Other Eukaryotes - 2007 (source: NCBI BLink).  |
| AT1G34220 | AT1G34220.1 | TGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35730.1); Has 1839 Blast hits to 806 proteins in 168 species: Archae - 0; Bacteria - 49; Metazoa - 372; Fungi - 160; Plants - 165; Viruses - 1; Other Eukaryotes - 1092 (source: NCBI BLink).  |
| AT1G34220.2 | TGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35730.1); Has 1839 Blast hits to 806 proteins in 168 species: Archae - 0; Bacteria - 49; Metazoa - 372; Fungi - 160; Plants - 165; Viruses - 1; Other Eukaryotes - 1092 (source: NCBI BLink).  |
| AT1G34570 | AT1G34570.1 | TAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15750.1); Has 88 Blast hits to 88 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 44; Fungi - 7; Plants - 32; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT1G44770 | AT1G44770.1 | TGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49710.3); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G44770.2 | TGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49710.3); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G48410 | AT1G48410.1 | TAAACGACA | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus.  |
| AT1G48410.2 | TAAACGACA | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus.  |
| AT1G49210 | AT1G49210.1 | GAAACGACAC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G49200.1); Has 5874 Blast hits to 5856 proteins in 209 species: Archae - 0; Bacteria - 0; Metazoa - 2008; Fungi - 350; Plants - 2603; Viruses - 38; Other Eukaryotes - 875 (source: NCBI BLink).  |
| AT1G50770 | AT1G50770.1 | GAAACGACATCGTGTCAT | unknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G50790.1); Has 864 Blast hits to 735 proteins in 105 species: Archae - 0; Bacteria - 129; Metazoa - 142; Fungi - 42; Plants - 412; Viruses - 1; Other Eukaryotes - 138 (source: NCBI BLink).  |
| AT1G51660 | AT1G51660.1 | AAAACGACACC | Encodes a mitogen-activated map kinase kinase (there are nine in Arabidopsis) involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK5. In plants with both MKK5 and MKK6 levels reduced by RNAi plants, floral organs do not abscise suggestion a role for both proteins in mediating floral organ abscission.  |
| AT1G52420 | AT1G52420.1 | TGTCGTTT | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT3G15940.1); Has 4722 Blast hits to 4718 proteins in 799 species: Archae - 145; Bacteria - 2692; Metazoa - 11; Fungi - 32; Plants - 84; Viruses - 0; Other Eukaryotes - 1758 (source: NCBI BLink).  |
| AT1G52510 | AT1G52510.1 | TAAACGACA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G12830.1); Has 3440 Blast hits to 3440 proteins in 614 species: Archae - 16; Bacteria - 2126; Metazoa - 96; Fungi - 67; Plants - 194; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink).  |
| AT1G52510.2 | TAAACGACA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G12830.1); Has 3440 Blast hits to 3440 proteins in 614 species: Archae - 16; Bacteria - 2126; Metazoa - 96; Fungi - 67; Plants - 194; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink).  |
| AT1G53520 | AT1G53520.1 | AAAACGACA | chalcone-flavanone isomerase-related; FUNCTIONS IN: chalcone isomerase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chalcone isomerase, subgroup (InterPro:IPR003466), Chalcone isomerase, 3-layer sandwich (InterPro:IPR016088), Chalcone isomerase (InterPro:IPR016087); Has 294 Blast hits to 294 proteins in 53 species: Archae - 0; Bacteria - 3; Metazoa - 0; Fungi - 2; Plants - 284; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT1G53520.1 | TAAACGACACC | chalcone-flavanone isomerase-related; FUNCTIONS IN: chalcone isomerase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chalcone isomerase, subgroup (InterPro:IPR003466), Chalcone isomerase, 3-layer sandwich (InterPro:IPR016088), Chalcone isomerase (InterPro:IPR016087); Has 294 Blast hits to 294 proteins in 53 species: Archae - 0; Bacteria - 3; Metazoa - 0; Fungi - 2; Plants - 284; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT1G53940 | AT1G53940.1 | AAACGACA | Encodes a lipase, has in vitro lipase activity with p-nitrophenyl acetate and p-nitrophenyl butyrate, gene expression induced by hormones, negatively regulates auxin signaling, involved in disease resistance  |
| AT1G55250 | AT1G55250.1 | CGATGTCGTTTA | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B.  |
| AT1G55960 | AT1G55960.1 | AAAACGACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G13062.2); Has 177 Blast hits to 177 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
| AT1G57620 | AT1G57620.1 | TAAACGACA | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G09580.1); Has 1360 Blast hits to 1358 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 707; Fungi - 343; Plants - 152; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).  |
| AT1G58190 | AT1G58190.1 | CGATGTCGTTTA | Receptor Like Protein 9 (AtRLP9); FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP14 (Receptor Like Protein 14); protein binding (TAIR:AT1G74180.1); Has 147042 Blast hits to 23181 proteins in 886 species: Archae - 108; Bacteria - 9080; Metazoa - 49718; Fungi - 1830; Plants - 74982; Viruses - 105; Other Eukaryotes - 11219 (source: NCBI BLink).  |
| AT1G60250 | AT1G60250.1 | GAAACGACA | zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: endomembrane system, intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc finger (B-box type) family protein (TAIR:AT1G68190.1); Has 522 Blast hits to 503 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 513; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT1G61000 | AT1G61000.1 | GGTGTCGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: mitosis; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Kinetochore protein Nuf2 (InterPro:IPR005549); BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT1G64330.1); Has 41010 Blast hits to 23184 proteins in 1264 species: Archae - 616; Bacteria - 3998; Metazoa - 20566; Fungi - 2893; Plants - 1316; Viruses - 149; Other Eukaryotes - 11472 (source: NCBI BLink).  |
| AT1G62305 | AT1G62305.1 | GGTGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11940.1); Has 342 Blast hits to 342 proteins in 16 species: Archae - 0; Bacteria - 9; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
| AT1G62305.2 | GGTGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11940.1); Has 342 Blast hits to 342 proteins in 16 species: Archae - 0; Bacteria - 9; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
| AT1G62420 | AT1G62420.1 | TGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G12030.1); Has 217 Blast hits to 217 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 215; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT1G63880 | AT1G63880.1 | TAAACGACA | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans.  |
| AT1G64360 | AT1G64360.1 | TAAACGACAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 9 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT1G67660 | AT1G67660.1 | AAAACGACA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative phage-type endonuclease (InterPro:IPR017482), Exonuclease, phage-type/RecB, C-terminal (InterPro:IPR011604), Restriction endonuclease, type II-like, core (InterPro:IPR011335); BEST Arabidopsis thaliana protein match is: DNA binding / nuclease (TAIR:AT1G13810.1); Has 366 Blast hits to 366 proteins in 59 species: Archae - 0; Bacteria - 65; Metazoa - 25; Fungi - 0; Plants - 35; Viruses - 27; Other Eukaryotes - 214 (source: NCBI BLink).  |
| AT1G67660.2 | AAAACGACA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative phage-type endonuclease (InterPro:IPR017482), Exonuclease, phage-type/RecB, C-terminal (InterPro:IPR011604), Restriction endonuclease, type II-like, core (InterPro:IPR011335); BEST Arabidopsis thaliana protein match is: DNA binding / nuclease (TAIR:AT1G13810.1); Has 366 Blast hits to 366 proteins in 59 species: Archae - 0; Bacteria - 65; Metazoa - 25; Fungi - 0; Plants - 35; Viruses - 27; Other Eukaryotes - 214 (source: NCBI BLink).  |
| AT1G68520 | AT1G68520.1 | AAAACGACA | zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc finger (B-box type) family protein (TAIR:AT1G25440.1); Has 2123 Blast hits to 1331 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 2036; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  |
| AT1G69330 | AT1G69330.1 | TGTCGTTTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ubiquitin-protein ligase (TAIR:AT3G29270.2); Has 225 Blast hits to 225 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 95; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT1G69330.1 | TGTCGTTTTCGTCGTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ubiquitin-protein ligase (TAIR:AT3G29270.2); Has 225 Blast hits to 225 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 95; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT1G69340 | AT1G69340.1 | AAACGACGAAAACGACA | appr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT2G40600.1); Has 2230 Blast hits to 2187 proteins in 671 species: Archae - 43; Bacteria - 984; Metazoa - 848; Fungi - 95; Plants - 99; Viruses - 7; Other Eukaryotes - 154 (source: NCBI BLink).  |
| AT1G69340.1 | TAAACGACA | appr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT2G40600.1); Has 2230 Blast hits to 2187 proteins in 671 species: Archae - 43; Bacteria - 984; Metazoa - 848; Fungi - 95; Plants - 99; Viruses - 7; Other Eukaryotes - 154 (source: NCBI BLink).  |
| AT1G69390 | AT1G69390.1 | GCCTTTAAACGACAGCGTTT | Encodes an Arabidopsis homologue of the bacterial MinE topological specificity factor ensuring correct division site placement. It is an essential integral component of the plastid division machinery.  |
| AT1G69490 | AT1G69490.1 | TAAACGACA | Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence.  |
| AT1G70480 | AT1G70480.1 | AAAACGACACGTGGCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT1G70480.2 | AAAACGACACGTGGCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT1G70520 | AT1G70520.1 | AAAACGACA | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF26 (InterPro:IPR002902), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G40380.1); Has 88792 Blast hits to 87702 proteins in 3400 species: Archae - 53; Bacteria - 7706; Metazoa - 38917; Fungi - 6981; Plants - 19431; Viruses - 436; Other Eukaryotes - 15268 (source: NCBI BLink).  |
| AT1G72140 | AT1G72140.1 | TGTCGTTT | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport, response to nematode; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT1G22540.1); Has 4291 Blast hits to 4187 proteins in 759 species: Archae - 0; Bacteria - 1913; Metazoa - 527; Fungi - 296; Plants - 1112; Viruses - 0; Other Eukaryotes - 443 (source: NCBI BLink).  |
| AT1G72280 | AT1G72280.1 | AAAACGACA | endoplasmic reticulum oxidoreductin  |
| AT1G73080 | AT1G73080.1 | AAAACGACATCG | Encodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks.  |
| AT1G74680 | AT1G74680.1 | GTGTCGTTTA | exostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT3G45400.1); Has 661 Blast hits to 657 proteins in 45 species: Archae - 0; Bacteria - 4; Metazoa - 35; Fungi - 4; Plants - 564; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).  |
| AT1G76670 | AT1G76670.1 | TAAACGACACGCGT | transporter-related; INVOLVED IN: response to nematode; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: transporter-related (TAIR:AT1G21070.1); Has 1259 Blast hits to 1249 proteins in 161 species: Archae - 0; Bacteria - 14; Metazoa - 296; Fungi - 205; Plants - 598; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
| AT1G80930 | AT1G80930.1 | GTGTCGTTTTGA | MIF4G domain-containing protein / MA3 domain-containing protein; FUNCTIONS IN: protein binding, RNA binding, binding; INVOLVED IN: translation, RNA metabolic process; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891), Armadillo-type fold (InterPro:IPR016024), MIF4G-like, type 3 (InterPro:IPR003890), MIF4-like, type 1/2/3 (InterPro:IPR016021); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52325.1); Has 47042 Blast hits to 24073 proteins in 1049 species: Archae - 54; Bacteria - 3998; Metazoa - 22628; Fungi - 5603; Plants - 2672; Viruses - 351; Other Eukaryotes - 11736 (source: NCBI BLink).  |
| AT2G01720 | AT2G01720.1 | GAAACGACA | ribophorin I family protein; FUNCTIONS IN: oligosaccharyl transferase activity, dolichyl-diphosphooligosaccharide-protein glycotransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribophorin I (InterPro:IPR007676); BEST Arabidopsis thaliana protein match is: ribophorin I family protein (TAIR:AT1G76400.1); Has 285 Blast hits to 285 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 87; Plants - 31; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  |
| AT2G01720.1 | TGTCGTTTT | ribophorin I family protein; FUNCTIONS IN: oligosaccharyl transferase activity, dolichyl-diphosphooligosaccharide-protein glycotransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribophorin I (InterPro:IPR007676); BEST Arabidopsis thaliana protein match is: ribophorin I family protein (TAIR:AT1G76400.1); Has 285 Blast hits to 285 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 87; Plants - 31; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  |
| AT2G02130 | AT2G02130.1 | AAAACGACA | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.  |
| AT2G02180 | AT2G02180.1 | TGTCGTTTT | Necessary for the efficient multiplication of tobamoviruses.  |
| AT2G02860 | AT2G02860.1 | AAACGACACC | encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding.  |
| AT2G04690 | AT2G04690.1 | TAAACGACA | cellular repressor of E1A-stimulated genes (CREG) family; FUNCTIONS IN: FMN binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular repressor of E1A-stimulated genes (CREG) (InterPro:IPR014631), FMN-binding split barrel (InterPro:IPR012349), FMN-binding split barrel, related (InterPro:IPR009002); Has 336 Blast hits to 336 proteins in 88 species: Archae - 0; Bacteria - 72; Metazoa - 145; Fungi - 2; Plants - 50; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
| AT2G04690.2 | TAAACGACA | cellular repressor of E1A-stimulated genes (CREG) family; FUNCTIONS IN: FMN binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular repressor of E1A-stimulated genes (CREG) (InterPro:IPR014631), FMN-binding split barrel (InterPro:IPR012349), FMN-binding split barrel, related (InterPro:IPR009002); Has 336 Blast hits to 336 proteins in 88 species: Archae - 0; Bacteria - 72; Metazoa - 145; Fungi - 2; Plants - 50; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
| AT2G06990 | AT2G06990.1 | TTAAAGCCCAAAACGACA | encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl.  |
| AT2G15790 | AT2G15790.1 | TGTCGTTTTGA | SQN encodes the Arabidopsis homolog of cyclophilin 40 (CyP40). It is specifically required for the vegetative but not the reproductive maturation of the shoot.  |
| AT2G17695 | AT2G17695.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 143 Blast hits to 143 proteins in 64 species: Archae - 0; Bacteria - 104; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT2G17695.2 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 143 Blast hits to 143 proteins in 64 species: Archae - 0; Bacteria - 104; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT2G17710 | AT2G17710.1 | TGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G18050 | AT2G18050.1 | TAAACGACACGTGTAC | encodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA.  |
| AT2G18050.2 | TAAACGACACGTGTAC | encodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA.  |
| AT2G18250 | AT2G18250.1 | AAAACGACAC | At2g18250 encodes pantetheine-phosphate adenylyltransferase catalyzing the formation of dephospho-CoA from pantetheine 4'-phosphate. The enzyme is involved in coenzyme A biosynthesis.  |
| AT2G18860 | AT2G18860.1 | TGTCGTTTT | syntaxin family protein; FUNCTIONS IN: protein binding; INVOLVED IN: Golgi vesicle transport, vesicle-mediated transport; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: t-SNARE (InterPro:IPR010989), Syntaxin 6, N-terminal (InterPro:IPR015260); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT4G30240.1); Has 58 Blast hits to 58 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G18860.2 | TGTCGTTTT | syntaxin family protein; FUNCTIONS IN: protein binding; INVOLVED IN: Golgi vesicle transport, vesicle-mediated transport; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: t-SNARE (InterPro:IPR010989), Syntaxin 6, N-terminal (InterPro:IPR015260); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT4G30240.1); Has 58 Blast hits to 58 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G19385 | AT2G19385.1 | TGTCGTTTT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2, LYAR-type (InterPro:IPR014898); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G19380.1); Has 443 Blast hits to 397 proteins in 133 species: Archae - 0; Bacteria - 6; Metazoa - 196; Fungi - 75; Plants - 41; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).  |
| AT2G20300 | AT2G20300.1 | TGTCGTTTC | Encodes ABNORMAL LEAF SHAPE 2 (ALE2), a receptor-like protein kinase (RLK) with a cluster of basic amino acid residues followed by a cysteine-containing sequence in the putative extracellular domain. Function together with ACR4 (Arabidopsis homolog of the Crinkly4) and ALE1 in positively regulating protoderm-specific gene expression and for the formation of leafy organs. ale2 mutants have various epidermal defects, including disorganization of epidermis-related tissues, defects in the leaf cuticle and the fusion of organs.  |
| AT2G20760 | AT2G20760.1 | TAAACGACA | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT3G51890.1); Has 1552 Blast hits to 1056 proteins in 209 species: Archae - 0; Bacteria - 461; Metazoa - 500; Fungi - 90; Plants - 101; Viruses - 0; Other Eukaryotes - 400 (source: NCBI BLink).  |
| AT2G20950 | AT2G20950.1 | TGTCGTTTC | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase-like, arabidopsis (InterPro:IPR007942); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38550.1); Has 323 Blast hits to 303 proteins in 73 species: Archae - 7; Bacteria - 10; Metazoa - 165; Fungi - 53; Plants - 73; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
| AT2G20950.2 | TGTCGTTTC | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase-like, arabidopsis (InterPro:IPR007942); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38550.1); Has 323 Blast hits to 303 proteins in 73 species: Archae - 7; Bacteria - 10; Metazoa - 165; Fungi - 53; Plants - 73; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
| AT2G20950.3 | TGTCGTTTC | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase-like, arabidopsis (InterPro:IPR007942); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38550.1); Has 323 Blast hits to 303 proteins in 73 species: Archae - 7; Bacteria - 10; Metazoa - 165; Fungi - 53; Plants - 73; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
| AT2G20950.4 | TGTCGTTTC | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase-like, arabidopsis (InterPro:IPR007942); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38550.1); Has 323 Blast hits to 303 proteins in 73 species: Archae - 7; Bacteria - 10; Metazoa - 165; Fungi - 53; Plants - 73; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
| AT2G21160 | AT2G21160.1 | CAAAACGCTGTCGTTTT | translocon-associated protein alpha (TRAP alpha) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated protein (TRAP), alpha subunit (InterPro:IPR005595); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16595.1); Has 195 Blast hits to 195 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 18; Plants - 38; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
| AT2G21160.2 | CAAAACGCTGTCGTTTT | translocon-associated protein alpha (TRAP alpha) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated protein (TRAP), alpha subunit (InterPro:IPR005595); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16595.1); Has 195 Blast hits to 195 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 18; Plants - 38; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
| AT2G21970 | AT2G21970.1 | AAAACGACACGTA | stress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein  |
| AT2G21970.1 | TAAACGACACGACGTGTAC | stress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein  |
| AT2G22090 | AT2G22090.1 | AAAACGACA | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. As with UBP1, transient overexpression of UBA1a in protoplasts increases the steady-state levels of reporter mRNAs in a promoter-dependent manner. Along with UBP1 and UBA2a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  |
| AT2G22090.2 | AAAACGACA | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. As with UBP1, transient overexpression of UBA1a in protoplasts increases the steady-state levels of reporter mRNAs in a promoter-dependent manner. Along with UBP1 and UBA2a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  |
| AT2G22490 | AT2G22490.1 | TGTCGTTTT | encodes a D-type cyclin whose transcription level is regulated by sucrose but not phytohormones or nitrate. Protein physically interacts with CDC2A. CycD2 kinase activity is regulated by sequestration of CycD2 protein in a form inaccessible to immunoprecipitation and probably not complexed to CDC2A.  |
| AT2G23080 | AT2G23080.1 | CGATGTCGTTTA | casein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink).  |
| AT2G23080.2 | CGATGTCGTTTA | casein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink).  |
| AT2G27610 | AT2G27610.1 | AAAACGACA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G13650.1); Has 19079 Blast hits to 5518 proteins in 198 species: Archae - 2; Bacteria - 20; Metazoa - 154; Fungi - 169; Plants - 18325; Viruses - 0; Other Eukaryotes - 409 (source: NCBI BLink).  |
| AT2G29310 | AT2G29310.1 | TGTCGTTTC | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29300.1); Has 77598 Blast hits to 77460 proteins in 2156 species: Archae - 462; Bacteria - 43120; Metazoa - 4057; Fungi - 3681; Plants - 1455; Viruses - 5; Other Eukaryotes - 24818 (source: NCBI BLink).  |
| AT2G29440 | AT2G29440.1 | AAAACGACA | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).  |
| AT2G30440 | AT2G30440.1 | GAAACGACA | chloroplast thylakoidal processing peptidase; FUNCTIONS IN: serine-type peptidase activity, peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927), Peptidase S26A, signal peptidase I (InterPro:IPR000223), Peptidase S26A (InterPro:IPR014037); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT1G06870.1); Has 5856 Blast hits to 5751 proteins in 1301 species: Archae - 0; Bacteria - 3613; Metazoa - 183; Fungi - 69; Plants - 112; Viruses - 0; Other Eukaryotes - 1879 (source: NCBI BLink).  |
| AT2G30520 | AT2G30520.1 | AAAACGACA | light inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis  |
| AT2G30520.2 | AAAACGACA | light inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis  |
| AT2G30520.3 | AAAACGACA | light inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis  |
| AT2G32060 | AT2G32060.1 | AAACGACAGCGTTT | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  |
| AT2G32060.2 | AAACGACAGCGTTT | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  |
| AT2G32060.3 | AAACGACAGCGTTT | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  |
| AT2G32520 | AT2G32520.1 | GTGTCGTTT | dienelactone hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase (InterPro:IPR002155), Dienelactone hydrolase (InterPro:IPR002925); BEST Arabidopsis thaliana protein match is: dienelactone hydrolase family protein (TAIR:AT1G35420.1); Has 2362 Blast hits to 2362 proteins in 596 species: Archae - 20; Bacteria - 1757; Metazoa - 54; Fungi - 12; Plants - 53; Viruses - 0; Other Eukaryotes - 466 (source: NCBI BLink).  |
| AT2G36660 | AT2G36660.1 | GAAACGACA | polyadenylate-binding protein, putative / PABP, putative. Member of the class III family of PABP proteins.  |
| AT2G37585 | AT2G37585.1 | TGTCGTTTT | glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein (TAIR:AT5G39990.1); Has 608 Blast hits to 607 proteins in 70 species: Archae - 0; Bacteria - 8; Metazoa - 401; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
| AT2G38040 | AT2G38040.1 | TAAACGACACC | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis  |
| AT2G38040.2 | TAAACGACACC | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis  |
| AT2G40810 | AT2G40810.1 | AAAACGACACG | AtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).  |
| AT2G40810.2 | AAAACGACACG | AtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).  |
| AT2G41780 | AT2G41780.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G41780.2 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT2G43560 | AT2G43560.1 | TGTCGTTTC | immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: FK506-binding protein 1 (FKBP13) (TAIR:AT5G45680.1); Has 6015 Blast hits to 5817 proteins in 1052 species: Archae - 33; Bacteria - 2800; Metazoa - 1234; Fungi - 332; Plants - 391; Viruses - 0; Other Eukaryotes - 1225 (source: NCBI BLink).  |
| AT2G44890 | AT2G44890.1 | TCAAAACGACA | member of CYP704A  |
| AT2G44970 | AT2G44970.1 | GGTGTCGTTT | lipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
| AT2G44970.2 | GGTGTCGTTT | lipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
| AT2G45690 | AT2G45690.1 | AAAACGACATCG | Encodes a protein with similarity to yeast Pep16p, a membrane localized protein involved in peroxisome assembly and protein-trafficking. SSE1 mutant seeds do not accumulate oils and dessicated seeds have a shrunken appearance. Involved in protein and oil body biogenesis. SSE is expressed during seed development, reaching the highest peak in mature siliques. Expression in leaves and roots is low compared to cotyledons and flowers. Located in peroxisomes and endoplasmic reticulum. Homologous to the peroxin PEX16 and complements the pex16 mutants of the yeast Yarrowia lipolytica.  |
| AT3G01120 | AT3G01120.1 | AAAACGACA | encodes a cystathionine gamma-synthase, which performs the first committed step in methionine biosynthesis. A conserved motif of 13 amino acids in the first exon is required for posttranscriptional autoregulation. This enzyme shares the same substrate as threonine synthase (TS) and its absence transcriptionally affects 8 genes in the genome.  |
| AT3G01540 | AT3G01540.1 | TGTCGTTTT | RNA HELICASE DRH1  |
| AT3G01540.2 | TGTCGTTTT | RNA HELICASE DRH1  |
| AT3G01540.3 | TGTCGTTTT | RNA HELICASE DRH1  |
| AT3G01540.4 | TGTCGTTTT | RNA HELICASE DRH1  |
| AT3G02080 | AT3G02080.1 | GGTGTCGTTTA | 40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae - 134; Bacteria - 4; Metazoa - 345; Fungi - 96; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
| AT3G02090 | AT3G02090.1 | TAAACGACACC | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink).  |
| AT3G02090.2 | TAAACGACACC | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink).  |
| AT3G02480 | AT3G02480.1 | AAAACGACA | ABA-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38760.1); Has 144 Blast hits to 124 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G02480.1 | CGTGTCGTTT | ABA-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38760.1); Has 144 Blast hits to 124 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G02530 | AT3G02530.1 | AAAACGACATCG | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: membrane, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, zeta subunit (InterPro:IPR012722), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT5G16070.1); Has 13554 Blast hits to 13062 proteins in 2289 species: Archae - 391; Bacteria - 5634; Metazoa - 1855; Fungi - 975; Plants - 487; Viruses - 0; Other Eukaryotes - 4212 (source: NCBI BLink).  |
| AT3G02700 | AT3G02700.1 | GGTGTCGTTTA | NC domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein (TAIR:AT5G16330.1); Has 105 Blast hits to 104 proteins in 28 species: Archae - 0; Bacteria - 23; Metazoa - 12; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT3G02710 | AT3G02710.1 | TAAACGACACC | Encodes a protein with a putative role in mRNA splicing.  |
| AT3G02800 | AT3G02800.1 | AAAACGACACGTGTCA | phosphatase/ phosphoprotein phosphatase/ protein tyrosine phosphatase; FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity, phosphoprotein phosphatase activity; INVOLVED IN: dephosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Protein-tyrosine phosphatase, SIW14-like (InterPro:IPR004861); BEST Arabidopsis thaliana protein match is: tyrosine specific protein phosphatase family protein (TAIR:AT5G16480.1); Has 485 Blast hits to 476 proteins in 107 species: Archae - 0; Bacteria - 42; Metazoa - 5; Fungi - 252; Plants - 83; Viruses - 0; Other Eukaryotes - 103 (source: NCBI BLink).  |
| AT3G03090 | AT3G03090.1 | TGTCGTTTT | Encodes a vacuolar membrane-localized glucose transporter that can also transport fructose. Mutations in these gene have effects on seed germination and time to flowering.  |
| AT3G03310 | AT3G03310.1 | TGTCGTTT | lecithin:cholesterol acyltransferase family protein / LACT family protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: lecithin:cholesterol acyltransferase family protein / LACT family protein (TAIR:AT4G19860.1); Has 367 Blast hits to 361 proteins in 102 species: Archae - 2; Bacteria - 30; Metazoa - 160; Fungi - 6; Plants - 75; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  |
| AT3G03310.1 | TGTCGTTTT | lecithin:cholesterol acyltransferase family protein / LACT family protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: lecithin:cholesterol acyltransferase family protein / LACT family protein (TAIR:AT4G19860.1); Has 367 Blast hits to 361 proteins in 102 species: Archae - 2; Bacteria - 30; Metazoa - 160; Fungi - 6; Plants - 75; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  |
| AT3G03960 | AT3G03960.1 | AAAACGACACC | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, theta subunit (InterPro:IPR012721); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 10959 Blast hits to 10902 proteins in 2114 species: Archae - 388; Bacteria - 4701; Metazoa - 1599; Fungi - 906; Plants - 376; Viruses - 0; Other Eukaryotes - 2989 (source: NCBI BLink).  |
| AT3G03960.1 | AAAACGACACC | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, theta subunit (InterPro:IPR012721); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 10959 Blast hits to 10902 proteins in 2114 species: Archae - 388; Bacteria - 4701; Metazoa - 1599; Fungi - 906; Plants - 376; Viruses - 0; Other Eukaryotes - 2989 (source: NCBI BLink).  |
| AT3G04070 | AT3G04070.1 | TAAACGACA | Arabidopsis NAC domain containing protein 47 (anac047); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAM (NO APICAL MERISTEM); transcription factor (TAIR:AT1G52880.1); Has 1636 Blast hits to 1633 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1636; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G04070.2 | TAAACGACA | Arabidopsis NAC domain containing protein 47 (anac047); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAM (NO APICAL MERISTEM); transcription factor (TAIR:AT1G52880.1); Has 1636 Blast hits to 1633 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1636; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G04780 | AT3G04780.1 | CGATGTCGTTTT | Encodes a protein with little sequence identity with any other protein of known structure or function. Part of this protein shows a 42% sequence identity with the C-terminal domain of the 32-kD human thioredoxin-like protein.  |
| AT3G04790 | AT3G04790.1 | AAAACGACATCG | ribose 5-phosphate isomerase-related; FUNCTIONS IN: ribose-5-phosphate isomerase activity; INVOLVED IN: defense response to bacterium, reductive pentose-phosphate cycle; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribose 5-phosphate isomerase (InterPro:IPR004788); BEST Arabidopsis thaliana protein match is: ribose-5-phosphate isomerase (TAIR:AT2G01290.1); Has 3164 Blast hits to 3164 proteins in 1122 species: Archae - 153; Bacteria - 1911; Metazoa - 90; Fungi - 101; Plants - 84; Viruses - 0; Other Eukaryotes - 825 (source: NCBI BLink).  |
| AT3G04810 | AT3G04810.1 | TGTCGTTTT | Encodes AtNek2, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.  |
| AT3G04810.2 | TGTCGTTTT | Encodes AtNek2, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.  |
| AT3G05030 | AT3G05030.2 | TGTCGTTTC | member of Sodium proton exchanger family  |
| AT3G05520 | AT3G05520.1 | TCAAAACGACACCGTCAGA | F-actin capping protein alpha subunit family protein; FUNCTIONS IN: actin binding; INVOLVED IN: actin cytoskeleton organization; LOCATED IN: F-actin capping protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: F-actin capping protein, alpha subunit, actin binding (InterPro:IPR018315), F-actin capping protein, alpha subunit (InterPro:IPR002189), F-actin capping protein, alpha subunit, conserved site (InterPro:IPR017865).  |
| AT3G05520.2 | TCAAAACGACACCGTCAGA | F-actin capping protein alpha subunit family protein; FUNCTIONS IN: actin binding; INVOLVED IN: actin cytoskeleton organization; LOCATED IN: F-actin capping protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: F-actin capping protein, alpha subunit, actin binding (InterPro:IPR018315), F-actin capping protein, alpha subunit (InterPro:IPR002189), F-actin capping protein, alpha subunit, conserved site (InterPro:IPR017865).  |
| AT3G06440 | AT3G06440.1 | AAAACGACATCG | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galectin, carbohydrate recognition domain (InterPro:IPR001079), Glycosyl transferase, family 31 (InterPro:IPR002659), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: GALT1 (GALACTOSYLTRANSFERASE1); UDP-galactose:N-glycan beta-1,3-galactosyltransferase/ transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G26810.1); Has 1799 Blast hits to 1791 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 1426; Fungi - 5; Plants - 334; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  |
| AT3G06440.2 | AAAACGACATCG | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galectin, carbohydrate recognition domain (InterPro:IPR001079), Glycosyl transferase, family 31 (InterPro:IPR002659), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: GALT1 (GALACTOSYLTRANSFERASE1); UDP-galactose:N-glycan beta-1,3-galactosyltransferase/ transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G26810.1); Has 1799 Blast hits to 1791 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 1426; Fungi - 5; Plants - 334; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  |
| AT3G06670 | AT3G06670.1 | TGTCGTTTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Protein of unknown function DUF625 (InterPro:IPR006887); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49390.1); Has 2798 Blast hits to 2244 proteins in 244 species: Archae - 0; Bacteria - 63; Metazoa - 1367; Fungi - 471; Plants - 155; Viruses - 18; Other Eukaryotes - 724 (source: NCBI BLink).  |
| AT3G07230 | AT3G07230.1 | GTGTCGTTTT | wound-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Wound-inducible basic (InterPro:IPR012643); Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G08780 | AT3G08780.1 | AAAACGACACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G08780.2 | AAAACGACACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G08920 | AT3G08920.1 | GGTGTCGTTTC | rhodanese-like domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT2G42220.1); Has 151 Blast hits to 151 proteins in 36 species: Archae - 0; Bacteria - 36; Metazoa - 1; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
| AT3G08950 | AT3G08950.1 | GTGTCGTTTC | electron transport SCO1/SenC family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: copper ion transport, respiratory chain complex IV assembly, cellular copper ion homeostasis, cell redox homeostasis; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Synthesis of cytochrome c oxidase, Sco1/Sco2 (InterPro:IPR017276), Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT4G39740.1); Has 3037 Blast hits to 3037 proteins in 688 species: Archae - 11; Bacteria - 1550; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 1204 (source: NCBI BLink).  |
| AT3G09690 | AT3G09690.1 | TAAACGACA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
| AT3G09690.2 | TAAACGACA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
| AT3G09850 | AT3G09850.1 | AAAACGACACG | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 3479 Blast hits to 2376 proteins in 234 species: Archae - 15; Bacteria - 783; Metazoa - 1588; Fungi - 375; Plants - 208; Viruses - 9; Other Eukaryotes - 501 (source: NCBI BLink).  |
| AT3G09860 | AT3G09860.1 | CGTGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G10420 | AT3G10420.1 | TGTCGTTTC | sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase (TAIR:AT1G73170.1); Has 837 Blast hits to 828 proteins in 331 species: Archae - 16; Bacteria - 586; Metazoa - 12; Fungi - 5; Plants - 64; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).  |
| AT3G10420.2 | TGTCGTTTC | sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase (TAIR:AT1G73170.1); Has 837 Blast hits to 828 proteins in 331 species: Archae - 16; Bacteria - 586; Metazoa - 12; Fungi - 5; Plants - 64; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).  |
| AT3G10550 | AT3G10550.1 | AAAACGACA | phosphatase/ protein tyrosine phosphatase; FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity; INVOLVED IN: dephosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Myotubularin phosphatase (InterPro:IPR017906), GRAM (InterPro:IPR004182), Myotubularin-related (InterPro:IPR010569); BEST Arabidopsis thaliana protein match is: phosphatase/ protein tyrosine phosphatase (TAIR:AT5G04540.1); Has 1385 Blast hits to 1270 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 1083; Fungi - 91; Plants - 16; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink).  |
| AT3G10670 | AT3G10670.1 | TGTCGTTTT | Plastidic SufC-like ATP-binding cassette/ATPase essential for Arabidopsis embryogenesis. Involved in the biogenesis and/or repair of oxidatively damaged FeS clusters. Expressed in embryos and meristems.  |
| AT3G10815 | AT3G10815.1 | TGTCGTTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: RHC1A; protein binding / zinc ion binding (TAIR:AT2G40830.3); Has 6466 Blast hits to 6439 proteins in 206 species: Archae - 0; Bacteria - 6; Metazoa - 2263; Fungi - 533; Plants - 2601; Viruses - 7; Other Eukaryotes - 1056 (source: NCBI BLink).  |
| AT3G11070 | AT3G11070.1 | AAAACGACATCG | outer membrane OMP85 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: outer membrane; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: Bacterial surface antigen (D15) (InterPro:IPR000184), Surface antigen variable number (InterPro:IPR010827); BEST Arabidopsis thaliana protein match is: outer membrane OMP85 family protein (TAIR:AT5G05520.1); Has 1201 Blast hits to 1199 proteins in 376 species: Archae - 0; Bacteria - 505; Metazoa - 124; Fungi - 83; Plants - 38; Viruses - 0; Other Eukaryotes - 451 (source: NCBI BLink).  |
| AT3G11290 | AT3G11290.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19220.1); Has 374 Blast hits to 234 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 22; Plants - 352; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G12720 | AT3G12720.1 | GAAACGACAC | Member of the R2R3 factor gene family.  |
| AT3G13225 | AT3G13225.2 | GGTGTCGTTT | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: WW/Rsp5/WWP (InterPro:IPR001202).  |
| AT3G13227 | AT3G13227.1 | AAAACGACA | serine-rich protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G55980.1); Has 102 Blast hits to 102 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 102; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G13230 | AT3G13230.1 | CGATGTCGTTTT | RNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087); Has 526 Blast hits to 526 proteins in 226 species: Archae - 118; Bacteria - 0; Metazoa - 138; Fungi - 131; Plants - 49; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
| AT3G13450 | AT3G13450.1 | GTGTCGTTTTGA | branched chain alpha-keto acid dehydrogenase E1 beta  |
| AT3G13940 | AT3G13940.1 | TACGTGTCGTTTT | DNA binding / DNA-directed RNA polymerase; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase I associated factor, A49-like (InterPro:IPR009668); Has 150 Blast hits to 150 proteins in 69 species: Archae - 0; Bacteria - 1; Metazoa - 57; Fungi - 66; Plants - 15; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
| AT3G14070 | AT3G14070.1 | TGTCGTTTT | Involved in cation (K, Na and Mn) homeostasis and transport  |
| AT3G14130 | AT3G14130.1 | TGTCGTTTT | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14150.2); Has 9793 Blast hits to 9779 proteins in 1166 species: Archae - 155; Bacteria - 3369; Metazoa - 366; Fungi - 469; Plants - 174; Viruses - 0; Other Eukaryotes - 5260 (source: NCBI BLink).  |
| AT3G14310 | AT3G14310.1 | AAAACGACA | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism.  |
| AT3G14430 | AT3G14430.1 | TGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G14590 | AT3G14590.1 | AAAACGACAGCGTTT | NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).  |
| AT3G14590.2 | AAAACGACAGCGTTT | NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).  |
| AT3G15070 | AT3G15070.1 | CGATGTCGTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G53190.2); Has 5164 Blast hits to 5155 proteins in 208 species: Archae - 0; Bacteria - 4; Metazoa - 1886; Fungi - 403; Plants - 1788; Viruses - 38; Other Eukaryotes - 1045 (source: NCBI BLink).  |
| AT3G15150 | AT3G15150.1 | TGTCGTTTA | zinc ion binding; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, MIZ-type (InterPro:IPR004181); Has 205 Blast hits to 205 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 36; Plants - 24; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT3G15160 | AT3G15160.1 | TAAACGACA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 67 Blast hits to 65 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT3G15660 | AT3G15660.1 | GAAACGACATCG | GLUTAREDOXIN 4 (GRX4); FUNCTIONS IN: metal ion binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336), Glutaredoxin-related protein (InterPro:IPR004480); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT4G04950.1); Has 4103 Blast hits to 3965 proteins in 839 species: Archae - 12; Bacteria - 1387; Metazoa - 395; Fungi - 212; Plants - 231; Viruses - 0; Other Eukaryotes - 1866 (source: NCBI BLink).  |
| AT3G15660.2 | GAAACGACATCG | GLUTAREDOXIN 4 (GRX4); FUNCTIONS IN: metal ion binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336), Glutaredoxin-related protein (InterPro:IPR004480); BEST Arabidopsis thaliana protein match is: thioredoxin family protein (TAIR:AT4G04950.1); Has 4103 Blast hits to 3965 proteins in 839 species: Archae - 12; Bacteria - 1387; Metazoa - 395; Fungi - 212; Plants - 231; Viruses - 0; Other Eukaryotes - 1866 (source: NCBI BLink).  |
| AT3G16060 | AT3G16060.1 | AAAACGACA | kinesin motor family protein; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: KINESIN-13A; ATP binding / microtubule motor (TAIR:AT3G16630.2); Has 7368 Blast hits to 7163 proteins in 235 species: Archae - 0; Bacteria - 4; Metazoa - 3690; Fungi - 887; Plants - 902; Viruses - 0; Other Eukaryotes - 1885 (source: NCBI BLink).  |
| AT3G17626 | AT3G17626.1 | TGTCGTTTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: ribosomal protein L18 family protein (TAIR:AT1G48350.1); Has 336 Blast hits to 336 proteins in 121 species: Archae - 0; Bacteria - 241; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  |
| AT3G17840 | AT3G17840.1 | TGTCGTTTT | Encodes a receptor-like kinase found at the cell surface of various tissues. Its function remains unknown.  |
| AT3G18760 | AT3G18760.1 | CGATGTCGTTTT | ribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 21 Blast hits to 20 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G18760.2 | CGATGTCGTTTT | ribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 21 Blast hits to 20 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G18960 | AT3G18960.1 | AAAACGACA | transcriptional factor B3 family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: transcriptional factor B3 family protein (TAIR:AT4G01580.1); Has 219 Blast hits to 200 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 219; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G19760 | AT3G19760.1 | TGTCGTTTTGA | eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: nucleolus, nucleus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative (TAIR:AT1G51380.1); Has 32402 Blast hits to 31825 proteins in 1817 species: Archae - 512; Bacteria - 14379; Metazoa - 5291; Fungi - 3422; Plants - 1433; Viruses - 38; Other Eukaryotes - 7327 (source: NCBI BLink).  |
| AT3G22260 | AT3G22260.1 | AAAACGACACG | OTU-like cysteine protease family protein; FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ovarian tumour, otubain (InterPro:IPR003323); BEST Arabidopsis thaliana protein match is: OTU-like cysteine protease family protein (TAIR:AT3G02070.1); Has 586 Blast hits to 576 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 289; Fungi - 51; Plants - 137; Viruses - 8; Other Eukaryotes - 101 (source: NCBI BLink).  |
| AT3G22260.2 | AAAACGACACG | OTU-like cysteine protease family protein; FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ovarian tumour, otubain (InterPro:IPR003323); BEST Arabidopsis thaliana protein match is: OTU-like cysteine protease family protein (TAIR:AT3G02070.1); Has 586 Blast hits to 576 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 289; Fungi - 51; Plants - 137; Viruses - 8; Other Eukaryotes - 101 (source: NCBI BLink).  |
| AT3G22410 | AT3G22410.1 | AAAACGACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05370.1); Has 1032 Blast hits to 1032 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 245; Fungi - 243; Plants - 390; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).  |
| AT3G22430 | AT3G22430.1 | TAAACGACAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 493 Blast hits to 438 proteins in 88 species: Archae - 2; Bacteria - 43; Metazoa - 185; Fungi - 27; Plants - 37; Viruses - 4; Other Eukaryotes - 195 (source: NCBI BLink).  |
| AT3G22968 | AT3G22968.1 | AAAACGACA | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF59 represents a conserved upstream opening reading frame relative to major ORF AT3G22970.1  |
| AT3G22970 | AT3G22970.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT3G22970.2 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT3G23400 | AT3G23400.1 | AAAACGACA | plastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity, transporter activity, binding; INVOLVED IN: transport; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Lipocalin (InterPro:IPR002345), PAP fibrillin (InterPro:IPR006843); Has 244 Blast hits to 244 proteins in 61 species: Archae - 0; Bacteria - 74; Metazoa - 0; Fungi - 0; Plants - 168; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT3G23410 | AT3G23410.1 | AAAACGACA | alcohol oxidase-related; FUNCTIONS IN: electron carrier activity, long-chain-alcohol oxidase activity; LOCATED IN: microsome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glucose-methanol-choline oxidoreductase, N-terminal (InterPro:IPR000172), FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Long-chain fatty alcohol dehydrogenase (InterPro:IPR012400); BEST Arabidopsis thaliana protein match is: alcohol oxidase-related (TAIR:AT4G28570.1); Has 2182 Blast hits to 2100 proteins in 448 species: Archae - 25; Bacteria - 1177; Metazoa - 54; Fungi - 156; Plants - 85; Viruses - 0; Other Eukaryotes - 685 (source: NCBI BLink).  |
| AT3G23940 | AT3G23940.1 | TAAACGACAGCGTTT | dehydratase family; FUNCTIONS IN: catalytic activity, dihydroxy-acid dehydratase activity; INVOLVED IN: branched chain family amino acid biosynthetic process, isoleucine biosynthetic process, metabolic process, valine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dihydroxy-acid dehydratase (InterPro:IPR004404), Dihydroxy-acid and 6-phosphogluconate dehydratase (InterPro:IPR000581); Has 10437 Blast hits to 10433 proteins in 1298 species: Archae - 138; Bacteria - 4265; Metazoa - 2; Fungi - 197; Plants - 21; Viruses - 0; Other Eukaryotes - 5814 (source: NCBI BLink).  |
| AT3G24150 | AT3G24150.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32295.1); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G24150.1 | GGTGTCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32295.1); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G24150.1 | TAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32295.1); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G24160 | AT3G24160.1 | TGTCGTTTA | Encodes a putative Type 1 membrane protein (PMP).  |
| AT3G24160.1 | TGTCGTTTT | Encodes a putative Type 1 membrane protein (PMP).  |
| AT3G24315 | AT3G24315.1 | TGTCGTTTC | AtSec20; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sec20 (InterPro:IPR005606); Has 205 Blast hits to 205 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 64; Plants - 27; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
| AT3G25870 | AT3G25870.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13360.1); Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G25920 | AT3G25920.1 | CGATGTCGTTTA | encodes a plastid ribosomal protein CL15, a constituent of the large subunit of the ribosomal complex  |
| AT3G26100 | AT3G26100.1 | AAAACGACA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G15430.2); Has 13018 Blast hits to 3813 proteins in 266 species: Archae - 62; Bacteria - 1274; Metazoa - 6169; Fungi - 625; Plants - 1234; Viruses - 2; Other Eukaryotes - 3652 (source: NCBI BLink).  |
| AT3G26580 | AT3G26580.1 | TAAACGACATCG | INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide region (InterPro:IPR013026); Has 2147 Blast hits to 1154 proteins in 168 species: Archae - 2; Bacteria - 99; Metazoa - 1301; Fungi - 180; Plants - 105; Viruses - 57; Other Eukaryotes - 403 (source: NCBI BLink).  |
| AT3G27060 | AT3G27060.1 | TGTCGTTTATACCCTTA | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development.  |
| AT3G45700 | AT3G45700.1 | AAACGACAC | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT3G45710.1); Has 2018 Blast hits to 1979 proteins in 299 species: Archae - 0; Bacteria - 337; Metazoa - 400; Fungi - 91; Plants - 1068; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink).  |
| AT3G46870 | AT3G46870.1 | GGTGTCGTTT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62350.1); Has 3561 Blast hits to 1614 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 53; Plants - 3447; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  |
| AT3G46960 | AT3G46960.1 | AAAACGACA | ATP binding / ATP-dependent helicase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides, helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DSH, C-terminal (InterPro:IPR012961), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), RNA helicase, ATP-dependent, SK12/DOB1 (InterPro:IPR016438), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: HEN2 (hua enhancer 2); ATP-dependent helicase/ RNA helicase (TAIR:AT2G06990.1); Has 7311 Blast hits to 5276 proteins in 657 species: Archae - 463; Bacteria - 1480; Metazoa - 1237; Fungi - 1015; Plants - 265; Viruses - 46; Other Eukaryotes - 2805 (source: NCBI BLink).  |
| AT3G48440 | AT3G48440.1 | TAAACGACA | zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT5G63260.1); Has 1145 Blast hits to 712 proteins in 117 species: Archae - 0; Bacteria - 0; Metazoa - 339; Fungi - 164; Plants - 533; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink).  |
| AT3G48460 | AT3G48460.1 | AAAACGACA | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: glycerol biosynthetic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: lipase, putative (TAIR:AT1G28650.1); Has 1735 Blast hits to 1709 proteins in 121 species: Archae - 0; Bacteria - 160; Metazoa - 1; Fungi - 6; Plants - 1561; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT3G48460.1 | AAAACGACA | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: glycerol biosynthetic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: lipase, putative (TAIR:AT1G28650.1); Has 1735 Blast hits to 1709 proteins in 121 species: Archae - 0; Bacteria - 160; Metazoa - 1; Fungi - 6; Plants - 1561; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT3G49400 | AT3G49400.1 | AAAACGACATCG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 724 Blast hits to 645 proteins in 140 species: Archae - 0; Bacteria - 177; Metazoa - 195; Fungi - 136; Plants - 78; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).  |
| AT3G49720 | AT3G49720.1 | CGTGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G49720.1 | TAAAACGCTGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G49720.2 | CGTGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G49720.2 | TAAAACGCTGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G50590 | AT3G50590.1 | TTAAAGCCCATTTAGGCCCATTAAACGACA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink).  |
| AT3G51040 | AT3G51040.1 | TGTCGTTTA | Encodes a protein of 231 amino acids with 51% identity to RTE1 over 209 amino acids.  |
| AT3G51040.2 | TGTCGTTTA | Encodes a protein of 231 amino acids with 51% identity to RTE1 over 209 amino acids.  |
| AT3G51040.3 | TGTCGTTTA | Encodes a protein of 231 amino acids with 51% identity to RTE1 over 209 amino acids.  |
| AT3G51050 | AT3G51050.1 | TAAACGACA | FG-GAP repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell-matrix adhesion; LOCATED IN: integrin complex, integral to membrane, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FG-GAP (InterPro:IPR013517); Has 68 Blast hits to 63 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
| AT3G51510 | AT3G51510.1 | TGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT3G51790 | AT3G51790.1 | TGTCGTTTT | putative transmembrane protein G1p (AtG1) mRNA, complete  |
| AT3G51840 | AT3G51840.1 | TGTCGTTTA | Encodes a short-chain acyl-CoA oxidase, which catalyzes the first step of peroxisomal fatty acid beta-oxidation during early, post-germinative growth in oilseed species. Null mutants virtually lack short-chain acyl-CoA and are resistant to 2,4-dichlorophenoxybutyric acid, which is converted to the herbicide and auxin analogue 2,4-dichlorophenoxyacetic acid by beta-oxidation. Despite the almost complete loss of short-chain activity, lipid catabolism and seedling growth and establishment was unaltered in the acx4 mutant. However, double mutants in acx3acx4 (acx3 encodes medium chain acyl CoA oxidase) were not viable and arrested during embryogenesis.  |
| AT3G52850 | AT3G52850.1 | GAAACGACA | Encodes the Vacuolar Sorting Receptor-1 (VSR-1)/Epidermal Growth Factor Receptor-like protein1(VSR-1/ATELP1). Binds vacuolar targeting signals. Involved in sorting seed storage proteins into vacuoles.  |
| AT3G53580 | AT3G53580.1 | GAAACGACA | diaminopimelate epimerase family protein; FUNCTIONS IN: diaminopimelate epimerase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Diaminopimelate epimerase, active site (InterPro:IPR018510), Diaminopimelate epimerase (InterPro:IPR001653); Has 5079 Blast hits to 5075 proteins in 1167 species: Archae - 51; Bacteria - 2343; Metazoa - 5; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 2658 (source: NCBI BLink).  |
| AT3G54440 | AT3G54440.1 | TGTCGTTTT | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).  |
| AT3G54440.2 | TGTCGTTTT | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).  |
| AT3G55070 | AT3G55070.1 | AAACGCTGTCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
| AT3G55070.2 | AAACGCTGTCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
| AT3G56110 | AT3G56110.1 | CTAACGGTGTCGTTTT | PRENYLATED RAB ACCEPTOR 1.B1 (PRA1.B1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B2 (PRENYLATED RAB ACCEPTOR 1.B2) (TAIR:AT2G40380.1); Has 388 Blast hits to 388 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 73; Plants - 185; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
| AT3G57080 | AT3G57080.1 | AAAACGACA | Non-catalytic subunit unique to Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB5.  |
| AT3G57340 | AT3G57340.1 | TGTCGTTTA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink).  |
| AT3G57340.2 | TGTCGTTTA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink).  |
| AT3G57560 | AT3G57560.1 | GAAACGACATCG | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis  |
| AT3G57570 | AT3G57570.1 | CGATGTCGTTTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 29 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT3G57780 | AT3G57780.1 | TGTCGTTTT | EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: nucleolar protein gar2-related (TAIR:AT2G42320.2); Has 3024 Blast hits to 2177 proteins in 255 species: Archae - 2; Bacteria - 181; Metazoa - 988; Fungi - 289; Plants - 172; Viruses - 72; Other Eukaryotes - 1320 (source: NCBI BLink).  |
| AT3G61460 | AT3G61460.1 | ACGACACGATGTCGTTTA | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide.  |
| AT3G62020 | AT3G62020.2 | AAAACGACA | germin-like protein (GLP10)  |
| AT3G62110 | AT3G62110.1 | TAAACGACAGCGTTT | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT4G33440.1); Has 2594 Blast hits to 2590 proteins in 344 species: Archae - 2; Bacteria - 575; Metazoa - 8; Fungi - 1060; Plants - 840; Viruses - 2; Other Eukaryotes - 107 (source: NCBI BLink).  |
| AT3G62580 | AT3G62580.1 | AAAACGACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT1G72100.1); Has 237 Blast hits to 236 proteins in 85 species: Archae - 0; Bacteria - 4; Metazoa - 103; Fungi - 69; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT3G62590 | AT3G62590.1 | AAAACGACA | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT1G02660.1); Has 135 Blast hits to 132 proteins in 41 species: Archae - 0; Bacteria - 5; Metazoa - 17; Fungi - 25; Plants - 53; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
| AT3G63520 | AT3G63520.1 | TGTCGTTT | Encodes a protein with 9-<i>cis</i>-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-<i>trans</i>-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-<i>cis</i>-double or allenic bonds.  |
| AT4G00530 | AT4G00530.1 | GGTGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G00530.1 | GTGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G00550 | AT4G00550.1 | GAAACGACACGTA | encodes a UDP-galactose-dependent digalactosyldiacylglycerol(DGDG) synthase. Located in chloroplast outer membrane.  |
| AT4G00585 | AT4G00585.1 | CGTGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 29 Blast hits to 29 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 6; Plants - 20; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT4G00590 | AT4G00590.1 | AAAACGACACG | asparaginase 2 family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase T2, asparaginase 2 (InterPro:IPR000246); BEST Arabidopsis thaliana protein match is: L-asparaginase, putative / L-asparagine amidohydrolase, putative (TAIR:AT3G16150.1); Has 2162 Blast hits to 2119 proteins in 522 species: Archae - 71; Bacteria - 869; Metazoa - 420; Fungi - 151; Plants - 90; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink).  |
| AT4G01990 | AT4G01990.1 | AAAACGACA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02370.1); Has 2034 Blast hits to 1378 proteins in 59 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 24; Plants - 1941; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
| AT4G01990.1 | TGTCGTTTT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02370.1); Has 2034 Blast hits to 1378 proteins in 59 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 24; Plants - 1941; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
| AT4G01995 | AT4G01995.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64680.1); Has 64 Blast hits to 64 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT4G01995.1 | TGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64680.1); Has 64 Blast hits to 64 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT4G02210 | AT4G02210.1 | CGATGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 475 Blast hits to 288 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 463; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G02220 | AT4G02220.1 | TAAACGACA | zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320), Zinc finger, MYND-type (InterPro:IPR002893); BEST Arabidopsis thaliana protein match is: programmed cell death 2 C-terminal domain-containing protein (TAIR:AT5G64830.1); Has 702 Blast hits to 666 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 368; Fungi - 111; Plants - 110; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink).  |
| AT4G04670 | AT4G04670.1 | TGTCGTTT | Met-10+ like family protein / kelch repeat-containing protein; INVOLVED IN: wybutosine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Protein of unknown function Met10 (InterPro:IPR003402), Kelch-type beta propeller (InterPro:IPR015915), tRNA wybutosine-synthesizing protein (InterPro:IPR003827); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G18610.1); Has 8151 Blast hits to 4692 proteins in 304 species: Archae - 337; Bacteria - 119; Metazoa - 3836; Fungi - 887; Plants - 1022; Viruses - 20; Other Eukaryotes - 1930 (source: NCBI BLink).  |
| AT4G05070 | AT4G05070.1 | ATCCAACGGAAAACGACAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G09040 | AT4G09040.1 | TGTCGTTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink).  |
| AT4G09040.2 | TGTCGTTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative (TAIR:AT2G35410.1); Has 13296 Blast hits to 10466 proteins in 519 species: Archae - 12; Bacteria - 987; Metazoa - 6994; Fungi - 1866; Plants - 1955; Viruses - 0; Other Eukaryotes - 1482 (source: NCBI BLink).  |
| AT4G11150 | AT4G11150.1 | TGTCGTTTC | Encodes a vacuolar H+-ATPase subunit E isoform 1 which is required for Golgi organization and vacuole function in embryogenesis.  |
| AT4G11670 | AT4G11670.1 | TCAAAACGACATCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Munc13 homology 1 (InterPro:IPR014770), Protein of unknown function DUF810 (InterPro:IPR008528), Munc13 homology 2 (InterPro:IPR014772); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06970.1); Has 147 Blast hits to 87 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 138; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT4G12870 | AT4G12870.1 | TGTCGTTTT | gamma interferon responsive lysosomal thiol reductase family protein / GILT family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Gamma interferon inducible lysosomal thiol reductase GILT (InterPro:IPR004911); BEST Arabidopsis thaliana protein match is: gamma interferon responsive lysosomal thiol reductase family protein / GILT family protein (TAIR:AT4G12900.1); Has 343 Blast hits to 340 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 264; Fungi - 2; Plants - 50; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).  |
| AT4G14315 | AT4G14315.1 | GAAACGACAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G14540 | AT4G14540.1 | TAAACGACA | NUCLEAR FACTOR Y, SUBUNIT B3 (NF-YB3); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB2 (NUCLEAR FACTOR Y, SUBUNIT B2); transcription factor (TAIR:AT5G47640.1); Has 1011 Blast hits to 1011 proteins in 186 species: Archae - 0; Bacteria - 1; Metazoa - 394; Fungi - 233; Plants - 298; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).  |
| AT4G14780 | AT4G14780.1 | TGTCGTTTA | protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G22750.1); Has 94189 Blast hits to 93089 proteins in 3475 species: Archae - 71; Bacteria - 8027; Metazoa - 41718; Fungi - 7876; Plants - 19036; Viruses - 588; Other Eukaryotes - 16873 (source: NCBI BLink).  |
| AT4G15830 | AT4G15830.1 | TGTCGTTTC | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT3G01450.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 5; Plants - 61; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
| AT4G15840 | AT4G15840.1 | GAAACGACA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); Has 305 Blast hits to 303 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 12; Plants - 22; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT4G16710 | AT4G16710.1 | TAAACGACAGCGTTT | glycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  |
| AT4G16710.2 | TAAACGACAGCGTTT | glycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  |
| AT4G17070 | AT4G17070.1 | AAAACGACAGCGTTT | peptidyl-prolyl cis-trans isomerase; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: response to oxidative stress; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); Has 114 Blast hits to 110 proteins in 26 species: Archae - 0; Bacteria - 24; Metazoa - 9; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
| AT4G17170 | AT4G17170.1 | GAAACGACA | member of RAB gene family  |
| AT4G17170.1 | TGTCGTTTT | member of RAB gene family  |
| AT4G17180 | AT4G17180.1 | AAAACGACA | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT4G31140.1); Has 1749 Blast hits to 1698 proteins in 136 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 52; Plants - 1687; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT4G17180.1 | TGTCGTTTC | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT4G31140.1); Has 1749 Blast hits to 1698 proteins in 136 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 52; Plants - 1687; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
| AT4G17410 | AT4G17410.1 | GAAACGACA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: DWNN domain (InterPro:IPR014891), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G47430.1); Has 8731 Blast hits to 6294 proteins in 276 species: Archae - 2; Bacteria - 71; Metazoa - 5540; Fungi - 1215; Plants - 632; Viruses - 56; Other Eukaryotes - 1215 (source: NCBI BLink).  |
| AT4G17520 | AT4G17520.1 | AAACGACA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT5G47210.1); Has 13357 Blast hits to 8375 proteins in 750 species: Archae - 13; Bacteria - 2605; Metazoa - 5274; Fungi - 1340; Plants - 1789; Viruses - 136; Other Eukaryotes - 2200 (source: NCBI BLink).  |
| AT4G17600 | AT4G17600.1 | GAAACGACA | Encodes Lil3:1 (light-harvesting-like) protein. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. A generic LHC motif is present in Lil3:1.  |
| AT4G17800 | AT4G17800.1 | AAAACGACA | DNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT2G35270.1); Has 586 Blast hits to 584 proteins in 85 species: Archae - 0; Bacteria - 79; Metazoa - 54; Fungi - 7; Plants - 430; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
| AT4G17890 | AT4G17890.1 | TACGTGTCGTTTC | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  |
| AT4G17890.2 | TACGTGTCGTTTC | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  |
| AT4G18593 | AT4G18593.1 | TAAACGACA | dual specificity protein phosphatase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 272 Blast hits to 272 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 76; Plants - 42; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  |
| AT4G18810 | AT4G18810.1 | TGTCGTTT | binding / catalytic/ transcription repressor; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NADH:ubiquinone oxidoreductase complex I intermediate-associated protein 30 (InterPro:IPR013857), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: HCF173 (high chlorophyll fluorescence phenotype 173); binding / catalytic/ transcription repressor (TAIR:AT1G16720.1); Has 1715 Blast hits to 1540 proteins in 261 species: Archae - 12; Bacteria - 728; Metazoa - 8; Fungi - 25; Plants - 255; Viruses - 0; Other Eukaryotes - 687 (source: NCBI BLink).  |
| AT4G20020 | AT4G20020.1 | AAAACGACA | unknown protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44780.1); Has 26028 Blast hits to 13667 proteins in 803 species: Archae - 4; Bacteria - 3179; Metazoa - 14711; Fungi - 2562; Plants - 2584; Viruses - 195; Other Eukaryotes - 2793 (source: NCBI BLink).  |
| AT4G20020.2 | AAAACGACA | unknown protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44780.1); Has 26028 Blast hits to 13667 proteins in 803 species: Archae - 4; Bacteria - 3179; Metazoa - 14711; Fungi - 2562; Plants - 2584; Viruses - 195; Other Eukaryotes - 2793 (source: NCBI BLink).  |
| AT4G20360 | AT4G20360.1 | TGTCGTTTA | ARABIDOPSIS RAB GTPASE HOMOLOG E1B (ATRABE1B); FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; INVOLVED IN: peptidyl-cysteine S-nitrosylation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, bacterial and organelle (InterPro:IPR004541), Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor Tu, putative / EF-Tu, putative (TAIR:AT4G02930.1); Has 60789 Blast hits to 60738 proteins in 12836 species: Archae - 775; Bacteria - 22875; Metazoa - 13447; Fungi - 6921; Plants - 1294; Viruses - 5; Other Eukaryotes - 15472 (source: NCBI BLink).  |
| AT4G21980 | AT4G21980.1 | TAAAGGCCCAATTAGCCCAAAACGACAC | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. Highest expression in flowers. mRNA abundance increased during dark-induced carbon starvation. Predominantly cytoplasmic with or without N starvation. Upon concanamycin A the protein accumulates in the central vacuole as punctuate structures that resemble autophagic bodies. This localization is more abundant upon N starvation.  |
| AT4G21980.2 | TAAAGGCCCAATTAGCCCAAAACGACAC | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. Highest expression in flowers. mRNA abundance increased during dark-induced carbon starvation. Predominantly cytoplasmic with or without N starvation. Upon concanamycin A the protein accumulates in the central vacuole as punctuate structures that resemble autophagic bodies. This localization is more abundant upon N starvation.  |
| AT4G22140 | AT4G22140.1 | TCAAAACGACA | DNA binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Bromo adjacent region (InterPro:IPR001025), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: bromo-adjacent homology (BAH) domain-containing protein (TAIR:AT4G04260.1); Has 1467 Blast hits to 1417 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 921; Fungi - 186; Plants - 236; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink).  |
| AT4G22140.2 | TCAAAACGACA | DNA binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Bromo adjacent region (InterPro:IPR001025), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: bromo-adjacent homology (BAH) domain-containing protein (TAIR:AT4G04260.1); Has 1467 Blast hits to 1417 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 921; Fungi - 186; Plants - 236; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink).  |
| AT4G22300 | AT4G22300.1 | AAAACGACA | encodes a carboxylesterase that inhibits AvrBsT-triggered phenotypes in Arabidopsis  |
| AT4G22300.1 | CGATGTCGTTTC | encodes a carboxylesterase that inhibits AvrBsT-triggered phenotypes in Arabidopsis  |
| AT4G22310 | AT4G22310.1 | GAAACGACATCG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14695.1); Has 630 Blast hits to 630 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 302; Fungi - 164; Plants - 96; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
| AT4G22310.1 | TGTCGTTTT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0041 (InterPro:IPR005336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14695.1); Has 630 Blast hits to 630 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 302; Fungi - 164; Plants - 96; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
| AT4G22910 | AT4G22910.1 | TGTCGTTTT | FIZZY-RELATED 2 (FZR2); FUNCTIONS IN: signal transducer activity; INVOLVED IN: trichome branching, signal transduction, DNA endoreduplication, cell growth; LOCATED IN: chloroplast, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: CCS52A2; signal transducer (TAIR:AT4G11920.1); Has 32185 Blast hits to 17091 proteins in 521 species: Archae - 40; Bacteria - 4571; Metazoa - 14163; Fungi - 6386; Plants - 2781; Viruses - 0; Other Eukaryotes - 4244 (source: NCBI BLink).  |
| AT4G23230 | AT4G23230.1 | TGTCGTTT | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Protein of unknown function DUF26 (InterPro:IPR002902), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G23160.1); Has 87973 Blast hits to 86925 proteins in 3135 species: Archae - 51; Bacteria - 7860; Metazoa - 38278; Fungi - 7025; Plants - 19314; Viruses - 415; Other Eukaryotes - 15030 (source: NCBI BLink).  |
| AT4G24090 | AT4G24090.1 | CGTGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 95 Blast hits to 93 proteins in 48 species: Archae - 3; Bacteria - 45; Metazoa - 6; Fungi - 11; Plants - 20; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT4G24090.1 | TGTCGTTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 95 Blast hits to 93 proteins in 48 species: Archae - 3; Bacteria - 45; Metazoa - 6; Fungi - 11; Plants - 20; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT4G24370 | AT4G24370.1 | GAAACGACATCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
| AT4G24740 | AT4G24740.1 | CGTGTCGTTTT | a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins.  |
| AT4G24760 | AT4G24760.1 | TGTCGTTTT | unknown protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14390.1); Has 2872 Blast hits to 2868 proteins in 500 species: Archae - 2; Bacteria - 744; Metazoa - 536; Fungi - 127; Plants - 153; Viruses - 6; Other Eukaryotes - 1304 (source: NCBI BLink).  |
| AT4G24790 | AT4G24790.1 | TGTCGTTTC | ATP binding / DNA binding / DNA-directed DNA polymerase; FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity, ATP binding; INVOLVED IN: DNA replication; LOCATED IN: DNA polymerase III complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), DNA polymerase III clamp loader subunit, C-terminal (InterPro:IPR008921), DNA polymerase III, subunits gamma and tau (InterPro:IPR012763); BEST Arabidopsis thaliana protein match is: DNA polymerase-related (TAIR:AT1G14460.1); Has 9086 Blast hits to 9067 proteins in 1538 species: Archae - 255; Bacteria - 4109; Metazoa - 318; Fungi - 326; Plants - 151; Viruses - 35; Other Eukaryotes - 3892 (source: NCBI BLink).  |
| AT4G24790.2 | TGTCGTTTC | ATP binding / DNA binding / DNA-directed DNA polymerase; FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity, ATP binding; INVOLVED IN: DNA replication; LOCATED IN: DNA polymerase III complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), DNA polymerase III clamp loader subunit, C-terminal (InterPro:IPR008921), DNA polymerase III, subunits gamma and tau (InterPro:IPR012763); BEST Arabidopsis thaliana protein match is: DNA polymerase-related (TAIR:AT1G14460.1); Has 9086 Blast hits to 9067 proteins in 1538 species: Archae - 255; Bacteria - 4109; Metazoa - 318; Fungi - 326; Plants - 151; Viruses - 35; Other Eukaryotes - 3892 (source: NCBI BLink).  |
| AT4G24990 | AT4G24990.1 | AAAACGACAGCGTTT | geranylgeranylated protein ATGP4  |
| AT4G25000 | AT4G25000.1 | CGTGTCGTTTA | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830).  |
| AT4G25280 | AT4G25280.1 | AAAACGACAC | adenylate kinase family protein; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, phosphotransferase activity, phosphate group as acceptor, ATP binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UMP-CMP kinase (InterPro:IPR006266), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: PYR6; cytidylate kinase/ uridylate kinase (TAIR:AT5G26667.3); Has 8572 Blast hits to 8424 proteins in 1844 species: Archae - 61; Bacteria - 4360; Metazoa - 1053; Fungi - 294; Plants - 243; Viruses - 0; Other Eukaryotes - 2561 (source: NCBI BLink).  |
| AT4G25580 | AT4G25580.1 | TGTCGTTTT | stress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink).  |
| AT4G26640 | AT4G26640.1 | TGTCGTTTC | member of WRKY Transcription Factor; Group I  |
| AT4G26840 | AT4G26840.1 | GAAACGACA | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets.  |
| AT4G27652 | AT4G27652.1 | TGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27657.1); Has 11 Blast hits to 11 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G27730 | AT4G27730.1 | TGTCGTTTT | oligopeptide transporter  |
| AT4G27750 | AT4G27750.1 | TGTCGTTT | A genetic locus involved in sugar sensing and coordinating carbohydrate synthesis and utilization by the whole plant. Lines carrying mutations in this gene shows restricted carbohydrate allocation to plant growth and seed set, elevated chlorophyll levels, and reduced sugar induction of starch biosynthesis.  |
| AT4G27940 | AT4G27940.1 | GTGTCGTTTT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G46320.1); Has 13258 Blast hits to 8472 proteins in 324 species: Archae - 0; Bacteria - 0; Metazoa - 6659; Fungi - 3535; Plants - 2092; Viruses - 0; Other Eukaryotes - 972 (source: NCBI BLink).  |
| AT4G29480 | AT4G29480.1 | CAAAACGCTGTCGTTTT | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT2G19680.2); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT4G29480.1 | GAAACGACATCG | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT2G19680.2); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
| AT4G29490 | AT4G29490.1 | AAAACGACAGCGTTTTG | aminopeptidase/ manganese ion binding; FUNCTIONS IN: manganese ion binding, aminopeptidase activity; INVOLVED IN: cellular process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (InterPro:IPR007865), Peptidase M24, structural domain (InterPro:IPR000994); BEST Arabidopsis thaliana protein match is: metallopeptidase M24 family protein (TAIR:AT1G09300.2); Has 7096 Blast hits to 7089 proteins in 1383 species: Archae - 160; Bacteria - 3987; Metazoa - 333; Fungi - 234; Plants - 49; Viruses - 0; Other Eukaryotes - 2333 (source: NCBI BLink).  |
| AT4G29490.1 | CGATGTCGTTTC | aminopeptidase/ manganese ion binding; FUNCTIONS IN: manganese ion binding, aminopeptidase activity; INVOLVED IN: cellular process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (InterPro:IPR007865), Peptidase M24, structural domain (InterPro:IPR000994); BEST Arabidopsis thaliana protein match is: metallopeptidase M24 family protein (TAIR:AT1G09300.2); Has 7096 Blast hits to 7089 proteins in 1383 species: Archae - 160; Bacteria - 3987; Metazoa - 333; Fungi - 234; Plants - 49; Viruses - 0; Other Eukaryotes - 2333 (source: NCBI BLink).  |
| AT4G29860 | AT4G29860.1 | TAAACGACACGTA | Encodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development.  |
| AT4G29870 | AT4G29870.1 | TACGTGTCGTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: membrane protein, putative (TAIR:AT2G19340.2); Has 163 Blast hits to 163 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT4G30220 | AT4G30220.1 | TGTCGTTTT | SMALL NUCLEAR RIBONUCLEOPROTEIN F (RUXF); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small nuclear ribonucleoprotein SmF (InterPro:IPR016487), Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14285.1); Has 865 Blast hits to 865 proteins in 209 species: Archae - 256; Bacteria - 0; Metazoa - 220; Fungi - 185; Plants - 64; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).  |
| AT4G30340 | AT4G30340.1 | TGTCGTTTT | encodes a diacylglycerol kinase. Applying a specific diacylglycerol kinase inhibitor to the growth media resulted in reduced root elongation and plant growth. Gene is expressed throughout the plant but is strongest in flowers and young seedlings.  |
| AT4G30580 | AT4G30580.1 | AAAACGACAC | Encodes a plastidic lysophosphatidic acid acyltransferase (LPAAT). Is critical for chloroplasts phosphatidic acid biosynthesis. The null allele is embryo lethal.  |
| AT4G31770 | AT4G31770.1 | GAAACGACATCG | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, protein serine/threonine phosphatase activity; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lariat debranching enzyme, C-terminal (InterPro:IPR007708), Metallophosphoesterase (InterPro:IPR004843); Has 452 Blast hits to 397 proteins in 153 species: Archae - 0; Bacteria - 12; Metazoa - 181; Fungi - 155; Plants - 28; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  |
| AT4G32320 | AT4G32320.1 | TGTCGTTTT | Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms.  |
| AT4G32530 | AT4G32530.1 | TGTCGTTTT | vacuolar ATP synthase, putative / V-ATPase, putative; FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: H+-transporting two-sector ATPase, C subunit family protein (TAIR:AT2G25610.1); Has 1484 Blast hits to 1216 proteins in 252 species: Archae - 35; Bacteria - 40; Metazoa - 641; Fungi - 317; Plants - 220; Viruses - 0; Other Eukaryotes - 231 (source: NCBI BLink).  |
| AT4G32530.2 | TGTCGTTTT | vacuolar ATP synthase, putative / V-ATPase, putative; FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: H+-transporting two-sector ATPase, C subunit family protein (TAIR:AT2G25610.1); Has 1484 Blast hits to 1216 proteins in 252 species: Archae - 35; Bacteria - 40; Metazoa - 641; Fungi - 317; Plants - 220; Viruses - 0; Other Eukaryotes - 231 (source: NCBI BLink).  |
| AT4G32915 | AT4G32915.1 | AAAACGACAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of translational fidelity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glu-tRNAGln amidotransferase, C subunit (InterPro:IPR003837); Has 1227 Blast hits to 1227 proteins in 425 species: Archae - 17; Bacteria - 884; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink).  |
| AT4G32915.1 | GTGTCGTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of translational fidelity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glu-tRNAGln amidotransferase, C subunit (InterPro:IPR003837); Has 1227 Blast hits to 1227 proteins in 425 species: Archae - 17; Bacteria - 884; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink).  |
| AT4G33250 | AT4G33250.1 | TGTCGTTTT | Encodes initiation factor 3k (EIF3k).  |
| AT4G33250.1 | TTAGCCCAAACGACA | Encodes initiation factor 3k (EIF3k).  |
| AT4G33400 | AT4G33400.1 | TCAAAACGACA | dem protein-related / defective embryo and meristems protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Vacuolar import and degradation, Vid27-related (InterPro:IPR013863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19240.1); Has 171 Blast hits to 171 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 88; Plants - 38; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
| AT4G33410 | AT4G33410.1 | TGTCGTTTTGA | signal peptide peptidase family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: protease-associated (PA) domain-containing protein (TAIR:AT2G43070.1); Has 697 Blast hits to 691 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 390; Fungi - 77; Plants - 139; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink).  |
| AT4G33430 | AT4G33430.1 | TGTCGTTTT | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome.  |
| AT4G33490 | AT4G33490.1 | GGCCTTTGTCGTTTT | aspartic-type endopeptidase; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: nucellin protein, putative (TAIR:AT1G44130.1); Has 1138 Blast hits to 1134 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 66; Fungi - 37; Plants - 965; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
| AT4G33670 | AT4G33670.1 | TGTCGTTTC | Encodes a L-galactose dehydrogenase, involved in ascorbate biosynthesis  |
| AT4G33880 | AT4G33880.1 | TAAACGACAAACGACA | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix protein / bHLH protein (TAIR:AT2G14760.1); Has 1879 Blast hits to 1802 proteins in 134 species: Archae - 0; Bacteria - 9; Metazoa - 175; Fungi - 34; Plants - 1499; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink).  |
| AT4G33945 | AT4G33945.1 | GAAACGACATCG | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); Has 252 Blast hits to 236 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 5; Plants - 68; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  |
| AT4G35630 | AT4G35630.1 | AAACGCTGTCGTTTT | Encodes a phosphoserine aminotransferase which is involved in serine biosynthesis in the chloroplast which operates via the phosphorylated pathway.  |
| AT4G35980 | AT4G35980.1 | TGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G36890 | AT4G36890.1 | AAAACGACACGTGTAC | The IRX14 gene encodes a putative family 43 glycosyl transferase that contributes to xylan biosynthesis. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation.  |
| AT4G37240 | AT4G37240.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23690.1); Has 130 Blast hits to 130 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT4G38600 | AT4G38600.1 | GAAACGACATCG | encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content.  |
| AT4G38600.2 | GAAACGACATCG | encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content.  |
| AT4G39480 | AT4G39480.1 | GAAACGACA | member of CYP96A  |
| AT5G01590 | AT5G01590.1 | TCAAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 32 proteins in 18 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT5G01850 | AT5G01850.1 | TGACACGTGTCGTTTA | protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Tyrosine-protein kinase, ATN1-like (InterPro:IPR015784); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT5G50180.1); Has 95530 Blast hits to 94330 proteins in 3583 species: Archae - 82; Bacteria - 8364; Metazoa - 42500; Fungi - 8087; Plants - 19045; Viruses - 483; Other Eukaryotes - 16969 (source: NCBI BLink).  |
| AT5G02270 | AT5G02270.1 | GGTGTCGTTTC | member of NAP subfamily  |
| AT5G02280 | AT5G02280.1 | GAAACGACACC | synbindin, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: cis-Golgi network; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sybindin-like protein (InterPro:IPR007233), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: synbindin, putative (TAIR:AT1G51160.2); Has 419 Blast hits to 413 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 194; Fungi - 100; Plants - 56; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  |
| AT5G02370 | AT5G02370.1 | AAACGACA | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, sequence-specific DNA binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT5G23910.1); Has 7488 Blast hits to 7156 proteins in 245 species: Archae - 0; Bacteria - 21; Metazoa - 3823; Fungi - 875; Plants - 885; Viruses - 0; Other Eukaryotes - 1884 (source: NCBI BLink).  |
| AT5G02470 | AT5G02470.1 | AAAACGACACC | core cell cycle genes  |
| AT5G02470.2 | AAAACGACACC | core cell cycle genes  |
| AT5G02470.3 | AAAACGACACC | core cell cycle genes  |
| AT5G02740 | AT5G02740.1 | AAACGCTGTCGTTTA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G02740.2 | AAACGCTGTCGTTTA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G02770 | AT5G02770.1 | CGATGTCGTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 367 Blast hits to 255 proteins in 95 species: Archae - 0; Bacteria - 48; Metazoa - 197; Fungi - 19; Plants - 22; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink).  |
| AT5G03230 | AT5G03230.1 | TGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G60680.1); Has 199 Blast hits to 199 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 195; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT5G03990 | AT5G03990.1 | GAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G51940.1); Has 212 Blast hits to 160 proteins in 36 species: Archae - 0; Bacteria - 16; Metazoa - 16; Fungi - 22; Plants - 31; Viruses - 2; Other Eukaryotes - 125 (source: NCBI BLink).  |
| AT5G04900 | AT5G04900.1 | GTGTCGTTTT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G13250.1); Has 61706 Blast hits to 61658 proteins in 2103 species: Archae - 428; Bacteria - 36076; Metazoa - 4372; Fungi - 3044; Plants - 1504; Viruses - 2; Other Eukaryotes - 16280 (source: NCBI BLink).  |
| AT5G04920 | AT5G04920.1 | AAAACGACACGTC | vacuolar protein sorting 36 family protein / VPS36 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT II complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EAP30 (InterPro:IPR007286); Has 235 Blast hits to 233 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 113; Fungi - 67; Plants - 24; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  |
| AT5G04920.1 | TGTCGTTTT | vacuolar protein sorting 36 family protein / VPS36 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT II complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EAP30 (InterPro:IPR007286); Has 235 Blast hits to 233 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 113; Fungi - 67; Plants - 24; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  |
| AT5G05740 | AT5G05740.1 | ACGTGTCGTTT | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria.  |
| AT5G05740.2 | ACGTGTCGTTT | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria.  |
| AT5G05750 | AT5G05750.1 | TAAACGACAC | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Tetratricopeptide region (InterPro:IPR013026), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT3G57340.2); Has 16636 Blast hits to 16631 proteins in 1960 species: Archae - 118; Bacteria - 5128; Metazoa - 3676; Fungi - 1518; Plants - 1246; Viruses - 21; Other Eukaryotes - 4929 (source: NCBI BLink).  |
| AT5G08450 | AT5G08450.1 | AAAACGACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone deacetylation protein Rxt3 (InterPro:IPR013951); Has 32702 Blast hits to 18312 proteins in 878 species: Archae - 45; Bacteria - 1760; Metazoa - 16233; Fungi - 3347; Plants - 1326; Viruses - 208; Other Eukaryotes - 9783 (source: NCBI BLink).  |
| AT5G08450.2 | AAAACGACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone deacetylation protein Rxt3 (InterPro:IPR013951); Has 32702 Blast hits to 18312 proteins in 878 species: Archae - 45; Bacteria - 1760; Metazoa - 16233; Fungi - 3347; Plants - 1326; Viruses - 208; Other Eukaryotes - 9783 (source: NCBI BLink).  |
| AT5G08450.3 | AAAACGACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone deacetylation protein Rxt3 (InterPro:IPR013951); Has 32702 Blast hits to 18312 proteins in 878 species: Archae - 45; Bacteria - 1760; Metazoa - 16233; Fungi - 3347; Plants - 1326; Viruses - 208; Other Eukaryotes - 9783 (source: NCBI BLink).  |
| AT5G09450 | AT5G09450.1 | AAACGACACC | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 2335 Blast hits to 1588 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 6; Plants - 2224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |
| AT5G10650 | AT5G10650.1 | GGTGTCGTTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G24870.2); Has 8469 Blast hits to 6498 proteins in 243 species: Archae - 0; Bacteria - 110; Metazoa - 2635; Fungi - 536; Plants - 2504; Viruses - 44; Other Eukaryotes - 2640 (source: NCBI BLink).  |
| AT5G10650.2 | GGTGTCGTTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G24870.2); Has 8469 Blast hits to 6498 proteins in 243 species: Archae - 0; Bacteria - 110; Metazoa - 2635; Fungi - 536; Plants - 2504; Viruses - 44; Other Eukaryotes - 2640 (source: NCBI BLink).  |
| AT5G10980 | AT5G10980.1 | AAACGACA | histone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3.2 (TAIR:AT4G40040.2); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink).  |
| AT5G11010 | AT5G11010.1 | TGTCGTTTC | pre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
| AT5G11010.2 | TGTCGTTTC | pre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
| AT5G11010.3 | TGTCGTTTC | pre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
| AT5G11270 | AT5G11270.1 | TAAACGACACG | Encodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance.  |
| AT5G12130 | AT5G12130.1 | GAAACGACA | PIGMENT DEFECTIVE 149 (PDE149); INVOLVED IN: thylakoid membrane organization; LOCATED IN: chloroplast thylakoid membrane, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Integral membrane protein TerC (InterPro:IPR005496); Has 2303 Blast hits to 2303 proteins in 668 species: Archae - 4; Bacteria - 1555; Metazoa - 2; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 721 (source: NCBI BLink).  |
| AT5G13020 | AT5G13020.1 | GAAACGACA | emsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), ENT (InterPro:IPR005491); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT2G44440.1); Has 252 Blast hits to 239 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 73; Fungi - 6; Plants - 172; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT5G13100 | AT5G13100.1 | AAAACGACA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G13280 | AT5G13280.1 | AAACGACA | Asp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH).  |
| AT5G13280.1 | TAAACGACAGCGTTTTA | Asp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH).  |
| AT5G13390 | AT5G13390.1 | AAATGACGAAACGACA | Required for normal pollen development and lipid accumulation within the tapetum  |
| AT5G13610 | AT5G13610.1 | TGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF155 (InterPro:IPR003734); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69380.1); Has 361 Blast hits to 361 proteins in 152 species: Archae - 0; Bacteria - 121; Metazoa - 21; Fungi - 154; Plants - 33; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
| AT5G14220 | AT5G14220.1 | TGTCGTTTT | Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development.  |
| AT5G14260 | AT5G14260.1 | CGTGTCGTTT | SET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
| AT5G14260.2 | CGTGTCGTTT | SET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
| AT5G14260.3 | CGTGTCGTTT | SET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
| AT5G14460 | AT5G14460.1 | CGTGTCGTTTT | pseudouridine synthase/ transporter; FUNCTIONS IN: pseudouridine synthase activity, transporter activity; INVOLVED IN: tRNA processing, pseudouridine synthesis, RNA modification, tRNA pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase B, N-terminal, bacterial-type (InterPro:IPR014780), tRNA pseudouridine synthase B, N-terminal (InterPro:IPR002501); BEST Arabidopsis thaliana protein match is: NAP57 (Arabidopsis thaliana homologue of NAP57); pseudouridine synthase (TAIR:AT3G57150.1); Has 5291 Blast hits to 5291 proteins in 1638 species: Archae - 188; Bacteria - 2754; Metazoa - 244; Fungi - 190; Plants - 55; Viruses - 0; Other Eukaryotes - 1860 (source: NCBI BLink).  |
| AT5G14530 | AT5G14530.1 | AAAACGACA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G66240.2); Has 16756 Blast hits to 10158 proteins in 404 species: Archae - 58; Bacteria - 3626; Metazoa - 6879; Fungi - 2862; Plants - 1119; Viruses - 0; Other Eukaryotes - 2212 (source: NCBI BLink).  |
| AT5G14920 | AT5G14920.1 | TAAACGACA | gibberellin-regulated family protein; INVOLVED IN: response to gibberellin stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gibberellin regulated protein (InterPro:IPR003854); BEST Arabidopsis thaliana protein match is: GASA1 (GAST1 PROTEIN HOMOLOG 1) (TAIR:AT1G75750.1); Has 151936 Blast hits to 53318 proteins in 1948 species: Archae - 727; Bacteria - 29184; Metazoa - 60097; Fungi - 18534; Plants - 16149; Viruses - 5950; Other Eukaryotes - 21295 (source: NCBI BLink).  |
| AT5G14920.2 | TAAACGACA | gibberellin-regulated family protein; INVOLVED IN: response to gibberellin stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gibberellin regulated protein (InterPro:IPR003854); BEST Arabidopsis thaliana protein match is: GASA1 (GAST1 PROTEIN HOMOLOG 1) (TAIR:AT1G75750.1); Has 151936 Blast hits to 53318 proteins in 1948 species: Archae - 727; Bacteria - 29184; Metazoa - 60097; Fungi - 18534; Plants - 16149; Viruses - 5950; Other Eukaryotes - 21295 (source: NCBI BLink).  |
| AT5G15960 | AT5G15960.1 | AAAACGACACGTGA | cold and ABA inducible protein kin1, possibly functions as an anti-freeze protein. Transcript level of this gene is induced by cold, ABA, dehydration and osmoticum (mannitol). However, protein activity of GUS fused to the promoter of this gene is inhibited by cold treatment, suggesting an inhibition of the protein by increased transcript level.  |
| AT5G15970 | AT5G15970.1 | AAAACGACACGTGA | Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance.  |
| AT5G16600 | AT5G16600.1 | AAAACGACA | Encodes a putative transcription factor (MYB43).  |
| AT5G17260 | AT5G17260.1 | AAAACGACA | Arabidopsis NAC domain containing protein 86 (anac086); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac045 (Arabidopsis NAC domain containing protein 45); transcription factor (TAIR:AT3G03200.1); Has 1637 Blast hits to 1634 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1628; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
| AT5G18760 | AT5G18760.1 | TAAACGACA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G06330.1); Has 907 Blast hits to 907 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 439; Fungi - 68; Plants - 331; Viruses - 4; Other Eukaryotes - 65 (source: NCBI BLink).  |
| AT5G19120 | AT5G19120.1 | GAAACGACAC | aspartic-type endopeptidase; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: extracellular dermal glycoprotein, putative / EDGP, putative (TAIR:AT1G03220.1); Has 701 Blast hits to 699 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 699; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G19430 | AT5G19430.1 | TGTCGTTTTGA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G12310.1); Has 381 Blast hits to 381 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 19; Plants - 127; Viruses - 42; Other Eukaryotes - 69 (source: NCBI BLink).  |
| AT5G19550 | AT5G19550.1 | AAAACGACA | Nitrogen metabolism. Major cytosolic isoenzyme controlling aspartate biosynthesis in the light.  |
| AT5G20120 | AT5G20120.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 36 Blast hits to 36 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
| AT5G20580 | AT5G20580.1 | TGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G06005.1); Has 124 Blast hits to 124 proteins in 54 species: Archae - 0; Bacteria - 16; Metazoa - 46; Fungi - 23; Plants - 24; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
| AT5G20580.2 | TGTCGTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G06005.1); Has 124 Blast hits to 124 proteins in 54 species: Archae - 0; Bacteria - 16; Metazoa - 46; Fungi - 23; Plants - 24; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
| AT5G21430 | AT5G21430.1 | AAAACGACATCG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); Has 46 Blast hits to 46 proteins in 21 species: Archae - 0; Bacteria - 14; Metazoa - 2; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT5G21430.2 | AAAACGACATCG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); Has 46 Blast hits to 46 proteins in 21 species: Archae - 0; Bacteria - 14; Metazoa - 2; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
| AT5G23120 | AT5G23120.1 | AAAACGACACGTGTAC | encodes a stability and/or assembly factor of photosystem II  |
| AT5G23900 | AT5G23900.1 | CGATGTCGTTTA | 60S ribosomal protein L13 (RPL13D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13e, conserved site (InterPro:IPR018256), Ribosomal protein L13e (InterPro:IPR001380); BEST Arabidopsis thaliana protein match is: ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1); structural constituent of ribosome (TAIR:AT3G49010.3); Has 546 Blast hits to 546 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 113; Plants - 98; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
| AT5G24130 | AT5G24130.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: leaf whorl, petal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 31 Blast hits to 31 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G25630 | AT5G25630.1 | TGTCGTTTA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G21222.1); Has 19068 Blast hits to 5732 proteins in 184 species: Archae - 3; Bacteria - 21; Metazoa - 595; Fungi - 399; Plants - 17210; Viruses - 0; Other Eukaryotes - 840 (source: NCBI BLink).  |
| AT5G27620 | AT5G27620.1 | TAAACGACATCG | core cell cycle genes  |
| AT5G28770 | AT5G28770.1 | TGTCGTTTT | bZIP protein BZO2H3 mRNA, partial cds  |
| AT5G28770.2 | TGTCGTTTT | bZIP protein BZO2H3 mRNA, partial cds  |
| AT5G28770.3 | TGTCGTTTT | bZIP protein BZO2H3 mRNA, partial cds  |
| AT5G37070 | AT5G37070.1 | CGTGTCGTTTTGA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G08890.2); Has 322 Blast hits to 320 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 321; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT5G37780 | AT5G37780.1 | TGTCGTTTT | encodes a calmodulin that is involved in thigmomorphogenesis. Gene expression is rapidly induced upon a variety of abiotic stimuli, including water spray, subirrigation, wind, touch, wounding, or darkness.  |
| AT5G37780.2 | TGTCGTTTT | encodes a calmodulin that is involved in thigmomorphogenesis. Gene expression is rapidly induced upon a variety of abiotic stimuli, including water spray, subirrigation, wind, touch, wounding, or darkness.  |
| AT5G37780.3 | TGTCGTTTT | encodes a calmodulin that is involved in thigmomorphogenesis. Gene expression is rapidly induced upon a variety of abiotic stimuli, including water spray, subirrigation, wind, touch, wounding, or darkness.  |
| AT5G39790 | AT5G39790.1 | GGTGTCGTTT | Encodes a chloroplast localized protein with starch binding activity that may be involved in carbohydrate metabolism.  |
| AT5G39950 | AT5G39950.1 | TAAACGACACG | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells.  |
| AT5G40020 | AT5G40020.1 | AAAACGACA | pathogenesis-related thaumatin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: endomembrane system; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: ATLP-1 (TAIR:AT1G18250.1); Has 1031 Blast hits to 1018 proteins in 139 species: Archae - 0; Bacteria - 16; Metazoa - 48; Fungi - 55; Plants - 907; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
| AT5G40480 | AT5G40480.1 | AAAACGACA | embryo defective 3012 (EMB3012); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Invasin/intimin cell-adhesion (InterPro:IPR008964), Bacterial Ig-like, group 2 (InterPro:IPR003343); Has 199 Blast hits to 175 proteins in 66 species: Archae - 0; Bacteria - 19; Metazoa - 135; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).  |
| AT5G42990 | AT5G42990.1 | TAAACGACACGTGTGA | ubiquitin-conjugating enzyme 18 (UBC18); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ATUBC2-1; ubiquitin-protein ligase (TAIR:AT1G45050.1); Has 6584 Blast hits to 6583 proteins in 298 species: Archae - 0; Bacteria - 0; Metazoa - 3149; Fungi - 1325; Plants - 1019; Viruses - 16; Other Eukaryotes - 1075 (source: NCBI BLink).  |
| AT5G43070 | AT5G43070.1 | TAAACGACACC | WPP family members contains an NE targeting domain. This domain, called the WPP domain after a highly conserved Trp-Pro-Pro motif, is necessary and sufficient for NE targeting of WPP1. RNAi suppression of WPP1 resulted in reduced mitotic activity.  |
| AT5G46250 | AT5G46250.1 | GGTGTCGTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
| AT5G46250.2 | GGTGTCGTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
| AT5G46250.3 | GGTGTCGTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: ribonucleoprotein complex, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630), Lupus La protein (InterPro:IPR002344), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT3G19090.1); Has 1225 Blast hits to 1223 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 762; Fungi - 166; Plants - 180; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
| AT5G46690 | AT5G46690.1 | TGTCGTTTT | beta HLH protein 71 (bHLH071); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (bHLH096) (TAIR:AT1G72210.1); Has 759 Blast hits to 756 proteins in 82 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 19; Plants - 737; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT5G47110 | AT5G47110.1 | AAAACGACA | lil3 protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis, light harvesting; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LIL3:1; transcription factor (TAIR:AT4G17600.1); Has 51 Blast hits to 51 proteins in 19 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
| AT5G48240 | AT5G48240.1 | TCAAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  |
| AT5G48240.2 | TCAAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  |
| AT5G48240.3 | TCAAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1665 (InterPro:IPR012459).  |
| AT5G48360 | AT5G48360.1 | AAAACGACA | formin homology 2 domain-containing protein / FH2 domain-containing protein; FUNCTIONS IN: actin binding; INVOLVED IN: cellular component organization, actin cytoskeleton organization; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Actin-binding FH2 and DRF autoregulatory (InterPro:IPR003104), Actin-binding FH2 (InterPro:IPR015425); BEST Arabidopsis thaliana protein match is: AFH1 (FORMIN HOMOLOGY 1); actin binding / actin filament binding / protein binding (TAIR:AT3G25500.1); Has 2141 Blast hits to 1946 proteins in 183 species: Archae - 2; Bacteria - 30; Metazoa - 1112; Fungi - 104; Plants - 453; Viruses - 75; Other Eukaryotes - 365 (source: NCBI BLink).  |
| AT5G48460 | AT5G48460.1 | AAACGACA | fimbrin-like protein, putative; FUNCTIONS IN: actin binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Actinin-type, actin-binding, conserved site (InterPro:IPR001589), Calponin-homology (InterPro:IPR016146), Calponin-like actin-binding (InterPro:IPR001715); BEST Arabidopsis thaliana protein match is: FIM2 (FIMBRIN-LIKE PROTEIN 2); actin binding (TAIR:AT5G35700.1); Has 2573 Blast hits to 1976 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 2069; Fungi - 216; Plants - 75; Viruses - 0; Other Eukaryotes - 213 (source: NCBI BLink).  |
| AT5G50320 | AT5G50320.1 | CGATGTCGTTTA | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Two lines with RNAi constructs directed against HAG3 grow normally and can produce root calli, but have defects in agrobacterium-mediated transformation.  |
| AT5G51810 | AT5G51810.1 | TGTCGTTTA | Encodes gibberellin 20-oxidase. Involved in gibberellin biosynthesis. Up-regulated by far red light in elongating petioles. Not regulated by a circadian clock.  |
| AT5G53160 | AT5G53160.1 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01360.1); Has 181 Blast hits to 181 proteins in 19 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G53160.2 | AAAACGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01360.1); Has 181 Blast hits to 181 proteins in 19 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G53300 | AT5G53300.1 | CGATGTCGTTTC | Encodes a ubiquitin conjugating enzyme.  |
| AT5G53300.2 | CGATGTCGTTTC | Encodes a ubiquitin conjugating enzyme.  |
| AT5G53300.3 | CGATGTCGTTTC | Encodes a ubiquitin conjugating enzyme.  |
| AT5G53310 | AT5G53310.1 | GAAACGACATCG | myosin heavy chain-related; FUNCTIONS IN: motor activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Myosin tail 2 (InterPro:IPR010926); Has 312 Blast hits to 312 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 37; Plants - 16; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
| AT5G53850 | AT5G53850.1 | AAAACGACA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, acireductone synthase activity, catalytic activity, phosphoglycolate phosphatase activity, metal ion binding; INVOLVED IN: methionine salvage, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), 2,3-diketo-5-methylthio-1-phosphopentane phosphatase (InterPro:IPR010041), Class II aldolase/adducin, N-terminal (InterPro:IPR001303), HAD-superfamily hydrolase, subfamily IA, variant 1 (InterPro:IPR006439), Methylthioribulose-1-phosphate dehydratase (InterPro:IPR017714); Has 1701 Blast hits to 1701 proteins in 496 species: Archae - 17; Bacteria - 1130; Metazoa - 229; Fungi - 146; Plants - 37; Viruses - 0; Other Eukaryotes - 142 (source: NCBI BLink).  |
| AT5G53850.1 | TACGTGTCGTTTC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, acireductone synthase activity, catalytic activity, phosphoglycolate phosphatase activity, metal ion binding; INVOLVED IN: methionine salvage, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), 2,3-diketo-5-methylthio-1-phosphopentane phosphatase (InterPro:IPR010041), Class II aldolase/adducin, N-terminal (InterPro:IPR001303), HAD-superfamily hydrolase, subfamily IA, variant 1 (InterPro:IPR006439), Methylthioribulose-1-phosphate dehydratase (InterPro:IPR017714); Has 1701 Blast hits to 1701 proteins in 496 species: Archae - 17; Bacteria - 1130; Metazoa - 229; Fungi - 146; Plants - 37; Viruses - 0; Other Eukaryotes - 142 (source: NCBI BLink).  |
| AT5G53850.2 | AAAACGACA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, acireductone synthase activity, catalytic activity, phosphoglycolate phosphatase activity, metal ion binding; INVOLVED IN: methionine salvage, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), 2,3-diketo-5-methylthio-1-phosphopentane phosphatase (InterPro:IPR010041), Class II aldolase/adducin, N-terminal (InterPro:IPR001303), HAD-superfamily hydrolase, subfamily IA, variant 1 (InterPro:IPR006439), Methylthioribulose-1-phosphate dehydratase (InterPro:IPR017714); Has 1701 Blast hits to 1701 proteins in 496 species: Archae - 17; Bacteria - 1130; Metazoa - 229; Fungi - 146; Plants - 37; Viruses - 0; Other Eukaryotes - 142 (source: NCBI BLink).  |
| AT5G53850.2 | TACGTGTCGTTTC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, acireductone synthase activity, catalytic activity, phosphoglycolate phosphatase activity, metal ion binding; INVOLVED IN: methionine salvage, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), 2,3-diketo-5-methylthio-1-phosphopentane phosphatase (InterPro:IPR010041), Class II aldolase/adducin, N-terminal (InterPro:IPR001303), HAD-superfamily hydrolase, subfamily IA, variant 1 (InterPro:IPR006439), Methylthioribulose-1-phosphate dehydratase (InterPro:IPR017714); Has 1701 Blast hits to 1701 proteins in 496 species: Archae - 17; Bacteria - 1130; Metazoa - 229; Fungi - 146; Plants - 37; Viruses - 0; Other Eukaryotes - 142 (source: NCBI BLink).  |
| AT5G53850.3 | AAAACGACA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, acireductone synthase activity, catalytic activity, phosphoglycolate phosphatase activity, metal ion binding; INVOLVED IN: methionine salvage, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), 2,3-diketo-5-methylthio-1-phosphopentane phosphatase (InterPro:IPR010041), Class II aldolase/adducin, N-terminal (InterPro:IPR001303), HAD-superfamily hydrolase, subfamily IA, variant 1 (InterPro:IPR006439), Methylthioribulose-1-phosphate dehydratase (InterPro:IPR017714); Has 1701 Blast hits to 1701 proteins in 496 species: Archae - 17; Bacteria - 1130; Metazoa - 229; Fungi - 146; Plants - 37; Viruses - 0; Other Eukaryotes - 142 (source: NCBI BLink).  |
| AT5G53850.3 | TACGTGTCGTTTC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, acireductone synthase activity, catalytic activity, phosphoglycolate phosphatase activity, metal ion binding; INVOLVED IN: methionine salvage, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), 2,3-diketo-5-methylthio-1-phosphopentane phosphatase (InterPro:IPR010041), Class II aldolase/adducin, N-terminal (InterPro:IPR001303), HAD-superfamily hydrolase, subfamily IA, variant 1 (InterPro:IPR006439), Methylthioribulose-1-phosphate dehydratase (InterPro:IPR017714); Has 1701 Blast hits to 1701 proteins in 496 species: Archae - 17; Bacteria - 1130; Metazoa - 229; Fungi - 146; Plants - 37; Viruses - 0; Other Eukaryotes - 142 (source: NCBI BLink).  |
| AT5G54600 | AT5G54600.1 | GTGTCGTTTA | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink).  |
| AT5G54600.2 | GTGTCGTTTA | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink).  |
| AT5G55140 | AT5G55140.1 | CAAAACGCTGTCGTTTA | ribosomal protein L30 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L30, bacterial-type (InterPro:IPR005996), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); Has 388 Blast hits to 388 proteins in 155 species: Archae - 0; Bacteria - 328; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
| AT5G55160 | AT5G55160.1 | AAAACGACA | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays.  |
| AT5G55160.2 | AAAACGACA | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays.  |
| AT5G55810 | AT5G55810.1 | CGATGTCGTTTC | encodes a bi-functional enzyme that expresses both nicotinamide-nucleotide adenylyltransferase (2.7.7.1) and nicotinate-nucleotide adenylyltransferase (2.7.7.18)activity.  |
| AT5G56360 | AT5G56360.1 | GTGTCGTTTT | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Low density lipoprotein-receptor, class A, cysteine-rich (InterPro:IPR002172), Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); BEST Arabidopsis thaliana protein match is: protein kinase C substrate, heavy chain-related (TAIR:AT2G42390.1); Has 52492 Blast hits to 29968 proteins in 1344 species: Archae - 253; Bacteria - 7152; Metazoa - 21077; Fungi - 6018; Plants - 1646; Viruses - 404; Other Eukaryotes - 15942 (source: NCBI BLink).  |
| AT5G57030 | AT5G57030.1 | TGTCGTTTA | Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase  |
| AT5G57460 | AT5G57460.1 | TAAACGACATCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to 121 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
| AT5G57580 | AT5G57580.1 | AAAACGACA | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Calmodulin binding protein-like (InterPro:IPR012416); BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT4G25800.2); Has 187 Blast hits to 178 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 187; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G57770 | AT5G57770.1 | AAAACGACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Pleckstrin-like, plant (InterPro:IPR013666), Protein of unknown function DUF828, plant (InterPro:IPR008546); Has 104 Blast hits to 104 proteins in 9 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 102; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
| AT5G57900 | AT5G57900.1 | AAACGACA | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner  |
| AT5G58490 | AT5G58490.1 | TCAAAACGACACG | cinnamoyl-CoA reductase family; FUNCTIONS IN: 3-beta-hydroxy-delta5-steroid dehydrogenase activity, binding, cinnamoyl-CoA reductase activity, catalytic activity; INVOLVED IN: lignin biosynthetic process, steroid biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-beta hydroxysteroid dehydrogenase/isomerase (InterPro:IPR002225), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: cinnamoyl-CoA reductase family (TAIR:AT2G02400.1); Has 8253 Blast hits to 8243 proteins in 1158 species: Archae - 140; Bacteria - 2986; Metazoa - 418; Fungi - 574; Plants - 1442; Viruses - 7; Other Eukaryotes - 2686 (source: NCBI BLink).  |
| AT5G58950 | AT5G58950.1 | TGTCGTTTT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G46930.1); Has 97287 Blast hits to 95864 proteins in 3755 species: Archae - 57; Bacteria - 8154; Metazoa - 43395; Fungi - 8207; Plants - 19435; Viruses - 506; Other Eukaryotes - 17533 (source: NCBI BLink).  |
| AT5G61410 | AT5G61410.1 | TAAACGACA | Arabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA  |
| AT5G61410.2 | TAAACGACA | Arabidopsis thaliana ribulose-5-phosphate-3-epimerase mRNA  |
| AT5G62190 | AT5G62190.1 | GAAACGACACG | DEAD/DEAH box RNA helicase PRH75  |
| AT5G62960 | AT5G62960.1 | GAAACGACACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10660.4); Has 89 Blast hits to 88 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
| AT5G63470 | AT5G63470.1 | CGATGTCGTTTT | NUCLEAR FACTOR Y, SUBUNIT C4 (NF-YC4); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YC1 (NUCLEAR FACTOR Y, SUBUNIT C1); DNA binding / transcription activator/ transcription factor (TAIR:AT3G48590.1); Has 950 Blast hits to 950 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 232; Plants - 264; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
| AT5G63470.2 | CGATGTCGTTTT | NUCLEAR FACTOR Y, SUBUNIT C4 (NF-YC4); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YC1 (NUCLEAR FACTOR Y, SUBUNIT C1); DNA binding / transcription activator/ transcription factor (TAIR:AT3G48590.1); Has 950 Blast hits to 950 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 232; Plants - 264; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
| AT5G63630 | AT5G63630.1 | AAAACGACATGCCGTTTT | DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase (RH26) (TAIR:AT5G08610.1); Has 27043 Blast hits to 26460 proteins in 1692 species: Archae - 431; Bacteria - 10802; Metazoa - 5031; Fungi - 3249; Plants - 1370; Viruses - 10; Other Eukaryotes - 6150 (source: NCBI BLink).  |
| AT5G63630.1 | TGTCGTTTAACGG | DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase (RH26) (TAIR:AT5G08610.1); Has 27043 Blast hits to 26460 proteins in 1692 species: Archae - 431; Bacteria - 10802; Metazoa - 5031; Fungi - 3249; Plants - 1370; Viruses - 10; Other Eukaryotes - 6150 (source: NCBI BLink).  |
| AT5G64120 | AT5G64120.1 | GGTGTCGTTTT | encodes a cell wall bound peroxidase that is induced by hypo-osmolarity  |
| AT5G64670 | AT5G64670.1 | TCAAAACGACA | ribosomal protein L15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15, bacterial-type (InterPro:IPR005749), Ribosomal protein L15 (InterPro:IPR001196); Has 5287 Blast hits to 5287 proteins in 1515 species: Archae - 0; Bacteria - 2940; Metazoa - 111; Fungi - 84; Plants - 51; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink).  |
| AT5G64680 | AT5G64680.1 | TGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.  |
| AT5G64680.2 | TGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.  |
| AT5G64680.3 | TGTCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.  |
| AT5G66880 | AT5G66880.1 | TGTCGTTTT | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth.  |
| AT5G67300 | AT5G67300.1 | AAAACGACA | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli.  |