| Locus | Gene model | Sequence | Description |
| AT1G02010 | AT1G02010.1 | TAAGGGTATT | member of KEULE Gene Family |
| AT1G02630 | AT1G02630.1 | TAAGGGTA | equilibrative nucleoside transporter, putative (ENT8); FUNCTIONS IN: nucleoside transmembrane transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Delayed-early response protein/equilibrative nucleoside transporter (InterPro:IPR002259); BEST Arabidopsis thaliana protein match is: ENT1,AT (EQUILIBRATIVE NUCLEOTIDE TRANSPORTER 1); nucleoside transmembrane transporter/ nucleoside transmembrane transporter, against a concentration gradient (TAIR:AT1G70330.1); Has 882 Blast hits to 771 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 483; Fungi - 75; Plants - 90; Viruses - 3; Other Eukaryotes - 231 (source: NCBI BLink). |
| AT1G02630.2 | TAAGGGTA | equilibrative nucleoside transporter, putative (ENT8); FUNCTIONS IN: nucleoside transmembrane transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Delayed-early response protein/equilibrative nucleoside transporter (InterPro:IPR002259); BEST Arabidopsis thaliana protein match is: ENT1,AT (EQUILIBRATIVE NUCLEOTIDE TRANSPORTER 1); nucleoside transmembrane transporter/ nucleoside transmembrane transporter, against a concentration gradient (TAIR:AT1G70330.1); Has 882 Blast hits to 771 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 483; Fungi - 75; Plants - 90; Viruses - 3; Other Eukaryotes - 231 (source: NCBI BLink). |
| AT1G02750 | AT1G02750.1 | TAAGGGTAT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G03130 | AT1G03130.1 | TAAGGGTA | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2) |
| AT1G04010 | AT1G04010.1 | TAAGGGTAT | phosphatidate-sterol O-acyltransferase/ phosphatidylcholine-sterol O-acyltransferase/ phosphatidylethanolamine-sterol O-acyltransferase; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity, phosphatidylethanolamine-sterol O-acyltransferase activity, phosphatidate-sterol O-acyltransferase activity; INVOLVED IN: sterol esterification, lipid metabolic process; LOCATED IN: microsome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: ATPDAT; phosphatidylcholine-sterol O-acyltransferase (TAIR:AT5G13640.1); Has 448 Blast hits to 445 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 76; Plants - 80; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT1G04020 | AT1G04020.1 | ATACCCTTA | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G04020.2 | ATACCCTTA | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G04140 | AT1G04140.1 | TAAGGGTAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G43930.3); Has 18156 Blast hits to 8656 proteins in 356 species: Archae - 50; Bacteria - 4318; Metazoa - 6686; Fungi - 3683; Plants - 1054; Viruses - 0; Other Eukaryotes - 2365 (source: NCBI BLink). |
| AT1G04140.2 | TAAGGGTAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G43930.3); Has 18156 Blast hits to 8656 proteins in 356 species: Archae - 50; Bacteria - 4318; Metazoa - 6686; Fungi - 3683; Plants - 1054; Viruses - 0; Other Eukaryotes - 2365 (source: NCBI BLink). |
| AT1G04640 | AT1G04640.1 | TAAGGGTA | Lipoyltransferase, located in mitochondria but not found in chloroplasts |
| AT1G04640.2 | TAAGGGTA | Lipoyltransferase, located in mitochondria but not found in chloroplasts |
| AT1G06010 | AT1G06010.1 | TACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G06980 | AT1G06980.1 | TAAGGGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, sepal, carpel; EXPRESSED DURING: 4 anthesis; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30230.1); Has 90 Blast hits to 90 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G07920 | AT1G07920.1 | TAAGGGTA | elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, nucleolus, plasma membrane, chloroplast, membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink). |
| AT1G07930 | AT1G07930.1 | TAAGGGTA | elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, vacuole; EXPRESSED IN: cotyledon, male gametophyte, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink). |
| AT1G07930.2 | TAAGGGTA | elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, vacuole; EXPRESSED IN: cotyledon, male gametophyte, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink). |
| AT1G10590 | AT1G10590.1 | TAAGGGTA | DNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G10590.2 | TAAGGGTA | DNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G10590.3 | TAAGGGTA | DNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G10600 | AT1G10600.1 | TACCCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink). |
| AT1G10600.2 | TACCCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink). |
| AT1G10600.3 | TACCCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink). |
| AT1G11240 | AT1G11240.1 | TACCCTTATAATGGGCCAA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 2452 Blast hits to 1845 proteins in 201 species: Archae - 0; Bacteria - 81; Metazoa - 1026; Fungi - 315; Plants - 107; Viruses - 18; Other Eukaryotes - 905 (source: NCBI BLink). |
| AT1G12990 | AT1G12990.1 | TAAGGGTA | glycosyl transferase family 17 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 17 (InterPro:IPR006813); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 17 protein (TAIR:AT1G67880.1); Has 972 Blast hits to 971 proteins in 58 species: Archae - 0; Bacteria - 24; Metazoa - 46; Fungi - 23; Plants - 68; Viruses - 4; Other Eukaryotes - 807 (source: NCBI BLink). |
| AT1G14840 | AT1G14840.1 | ATACCCTTA | Encodes a microtubule associated protein (MAP70-4). Expressed in all tissues. |
| AT1G14900 | AT1G14900.1 | TAAGGGTA | Encodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA. |
| AT1G15230 | AT1G15230.1 | AATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G15240 | AT1G15240.1 | TAAGGGTATT | phox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: PX-associated, sorting nexin 13 (InterPro:IPR013996), Sorting nexin, C-terminal (InterPro:IPR013937), Phox-like (InterPro:IPR001683), Phox-associated domain (InterPro:IPR003114); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G15900.1). |
| AT1G15240.2 | TAAGGGTATT | phox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: PX-associated, sorting nexin 13 (InterPro:IPR013996), Sorting nexin, C-terminal (InterPro:IPR013937), Phox-like (InterPro:IPR001683), Phox-associated domain (InterPro:IPR003114); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G15900.1). |
| AT1G19340 | AT1G19340.1 | TACCCTTA | methyltransferase MT-A70 family protein; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation, nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052), MT-A70 (InterPro:IPR007757); Has 423 Blast hits to 423 proteins in 157 species: Archae - 4; Bacteria - 134; Metazoa - 77; Fungi - 56; Plants - 33; Viruses - 2; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT1G19600 | AT1G19600.1 | TAAGGGTA | pfkB-type carbohydrate kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: D-ribose catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate/purine kinase (InterPro:IPR011611); BEST Arabidopsis thaliana protein match is: pfkB-type carbohydrate kinase family protein (TAIR:AT4G27600.1); Has 7782 Blast hits to 7781 proteins in 1176 species: Archae - 156; Bacteria - 3949; Metazoa - 275; Fungi - 74; Plants - 266; Viruses - 0; Other Eukaryotes - 3062 (source: NCBI BLink). |
| AT1G22410 | AT1G22410.1 | AATACCCTTA | 2-dehydro-3-deoxyphosphoheptonate aldolase, putative / 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase, putative / DAHP synthetase, putative; FUNCTIONS IN: 3-deoxy-7-phosphoheptulonate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DAHP synthetase, class II (InterPro:IPR002480); BEST Arabidopsis thaliana protein match is: DHS1 (3-DEOXY-D-ARABINO-HEPTULOSONATE 7-PHOSPHATE SYNTHASE 1); 3-deoxy-7-phosphoheptulonate synthase (TAIR:AT4G39980.1); Has 3140 Blast hits to 3125 proteins in 395 species: Archae - 0; Bacteria - 662; Metazoa - 0; Fungi - 68; Plants - 129; Viruses - 0; Other Eukaryotes - 2281 (source: NCBI BLink). |
| AT1G25682 | AT1G25682.1 | TACCCTTA | cell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25988.1); Has 517 Blast hits to 517 proteins in 152 species: Archae - 0; Bacteria - 5; Metazoa - 212; Fungi - 149; Plants - 56; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). |
| AT1G28340 | AT1G28340.1 | ATACCCTTA | Receptor Like Protein 4 (AtRLP4); FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat protein-related (TAIR:AT1G25570.1); Has 46726 Blast hits to 10140 proteins in 530 species: Archae - 12; Bacteria - 1198; Metazoa - 2417; Fungi - 194; Plants - 40627; Viruses - 0; Other Eukaryotes - 2278 (source: NCBI BLink). |
| AT1G34030 | AT1G34030.1 | TAAGGGTAT | 40S ribosomal protein S18 (RPS18B); FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: RPS18C (S18 RIBOSOMAL PROTEIN); RNA binding / nucleic acid binding / structural constituent of ribosome (TAIR:AT4G09800.1); Has 5326 Blast hits to 5326 proteins in 1715 species: Archae - 163; Bacteria - 2773; Metazoa - 291; Fungi - 107; Plants - 309; Viruses - 0; Other Eukaryotes - 1683 (source: NCBI BLink). |
| AT1G34350 | AT1G34350.1 | TAAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 140 Blast hits to 140 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT1G50520 | AT1G50520.1 | TACCCTTA | member of CYP705A |
| AT1G52400 | AT1G52400.1 | TACCCTTA | encodes a member of glycosyl hydrolase family 1, located in inducible ER bodies which were formed after wounding, required in inducible ER body formation |
| AT1G52400.2 | TACCCTTA | encodes a member of glycosyl hydrolase family 1, located in inducible ER bodies which were formed after wounding, required in inducible ER body formation |
| AT1G53542 | AT1G53542.1 | TAAGGGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G53543 | AT1G53543.1 | TAAGGGTA | unknown protein; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). |
| AT1G55680 | AT1G55680.1 | TAAGGGTA | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein (TAIR:AT3G13340.1); Has 14759 Blast hits to 7103 proteins in 369 species: Archae - 68; Bacteria - 4509; Metazoa - 4132; Fungi - 2799; Plants - 903; Viruses - 0; Other Eukaryotes - 2348 (source: NCBI BLink). |
| AT1G55930 | AT1G55930.1 | TAAGGGTATT | CBS domain-containing protein / transporter associated domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Transporter-associated region (InterPro:IPR005170), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein / transporter associated domain-containing protein (TAIR:AT3G13070.1); Has 10142 Blast hits to 10142 proteins in 1411 species: Archae - 80; Bacteria - 6182; Metazoa - 215; Fungi - 97; Plants - 96; Viruses - 0; Other Eukaryotes - 3472 (source: NCBI BLink). |
| AT1G57790 | AT1G57790.1 | TAAGGGTATTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G56470.1); Has 329 Blast hits to 324 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 329; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G66200 | AT1G66200.1 | TACCCTTA | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
| AT1G66200.2 | TACCCTTA | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
| AT1G67620 | AT1G67620.1 | TAAGGGTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Iojap-related protein (InterPro:IPR004394); Has 3104 Blast hits to 3104 proteins in 983 species: Archae - 0; Bacteria - 1779; Metazoa - 74; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink). |
| AT1G68820 | AT1G68820.1 | TACCCTTA | membrane protein, putative; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G73950.1); Has 2228 Blast hits to 2189 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1400; Fungi - 2; Plants - 302; Viruses - 198; Other Eukaryotes - 326 (source: NCBI BLink). |
| AT1G74560 | AT1G74560.1 | ATACCCTTA | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP2. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. |
| AT1G74560.2 | ATACCCTTA | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP2. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. |
| AT1G74560.3 | ATACCCTTA | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP2. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. |
| AT1G74950 | AT1G74950.1 | TAAGGGTA | TIFY10B; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to jasmonic acid stimulus, response to wounding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399), CCT domain-like (InterPro:IPR018467); BEST Arabidopsis thaliana protein match is: JAZ1 (JASMONATE-ZIM-DOMAIN PROTEIN 1); protein binding (TAIR:AT1G19180.1); Has 249 Blast hits to 244 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 249; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75280 | AT1G75280.1 | TAAGGGTATT | isoflavone reductase, putative, identical to SP:P52577 Isoflavone reductase homolog P3 (EC 1.3.1.-) {Arabidopsis thaliana}; contains Pfam profile PF02716: isoflavone reductase. Involved in response to oxidative stress. |
| AT1G75350 | AT1G75350.1 | TACCCTTA | embryo defective 2184 (emb2184); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31 (InterPro:IPR002150); Has 673 Blast hits to 673 proteins in 229 species: Archae - 0; Bacteria - 418; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink). |
| AT1G76480 | AT1G76480.1 | TAAGGGTATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20890.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G76550 | AT1G76550.1 | TAAGGGTAT | pyrophosphate--fructose-6-phosphate 1-phosphotransferase alpha subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, alpha-subunit complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: pyrophosphate--fructose-6-phosphate 1-phosphotransferase-related / pyrophosphate-dependent 6-phosphofructose-1-kinase-related (TAIR:AT1G20950.1); Has 2719 Blast hits to 2653 proteins in 853 species: Archae - 15; Bacteria - 1820; Metazoa - 8; Fungi - 4; Plants - 258; Viruses - 0; Other Eukaryotes - 614 (source: NCBI BLink). |
| AT2G01755 | AT2G01755.1 | TACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 91 Blast hits to 91 proteins in 40 species: Archae - 0; Bacteria - 64; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT2G02230 | AT2G02230.1 | TAAGGGTATT | Phloem protein 2-B1 (AtPP2-B1); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: MEE66 (maternal effect embryo arrest 66) (TAIR:AT2G02240.1); Has 319 Blast hits to 306 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 319; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G06025 | AT2G06025.1 | TACCCTTA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT4G28030.1); Has 565 Blast hits to 565 proteins in 223 species: Archae - 42; Bacteria - 278; Metazoa - 79; Fungi - 29; Plants - 83; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
| AT2G13440 | AT2G13440.1 | TACCCTTA | glucose-inhibited division family A protein; FUNCTIONS IN: FAD binding; INVOLVED IN: tRNA processing, tRNA wobble uridine modification; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glucose-inhibited division protein A-related (InterPro:IPR002218), FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Glucose-inhibited division protein A (InterPro:IPR004416); Has 9779 Blast hits to 9753 proteins in 1440 species: Archae - 2; Bacteria - 3748; Metazoa - 129; Fungi - 83; Plants - 22; Viruses - 0; Other Eukaryotes - 5795 (source: NCBI BLink). |
| AT2G16850 | AT2G16850.1 | TACCCTTA | PLASMA MEMBRANE INTRINSIC PROTEIN 2;8 (PIP2;8); FUNCTIONS IN: water channel activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: flower, root, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Aquaporin (InterPro:IPR012269), Major intrinsic protein (InterPro:IPR000425); BEST Arabidopsis thaliana protein match is: PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3); water channel (TAIR:AT4G35100.1); Has 6945 Blast hits to 6938 proteins in 1263 species: Archae - 57; Bacteria - 2670; Metazoa - 1273; Fungi - 293; Plants - 1495; Viruses - 2; Other Eukaryotes - 1155 (source: NCBI BLink). |
| AT2G20515 | AT2G20515.1 | TAAGGGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; Has 47 Blast hits to 47 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G22670 | AT2G22670.1 | AATACCCTTA | IAA8 (IAA8) gene is auxin inducible. |
| AT2G22670.2 | AATACCCTTA | IAA8 (IAA8) gene is auxin inducible. |
| AT2G22670.3 | AATACCCTTA | IAA8 (IAA8) gene is auxin inducible. |
| AT2G30360 | AT2G30360.1 | ATACCCTTA | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
| AT2G35860 | AT2G35860.1 | TACCCTTA | FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 16 PRECURSOR (FLA16); INVOLVED IN: cell adhesion; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); BEST Arabidopsis thaliana protein match is: FLA15 (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN 15 PRECURSOR) (TAIR:AT3G52370.1); Has 780 Blast hits to 747 proteins in 193 species: Archae - 12; Bacteria - 332; Metazoa - 140; Fungi - 32; Plants - 132; Viruses - 1; Other Eukaryotes - 131 (source: NCBI BLink). |
| AT2G36660 | AT2G36660.1 | TAAGGGTA | polyadenylate-binding protein, putative / PABP, putative. Member of the class III family of PABP proteins. |
| AT2G36885 | AT2G36885.1 | TAAGGGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT2G36885.2 | TAAGGGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT2G37190 | AT2G37190.1 | GAAGCCCATAAGGGTA | 60S ribosomal protein L12 (RPL12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cold, ribosome biogenesis; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L12 (RPL12B) (TAIR:AT3G53430.1); Has 1152 Blast hits to 1152 proteins in 433 species: Archae - 208; Bacteria - 278; Metazoa - 292; Fungi - 109; Plants - 81; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT2G38300 | AT2G38300.1 | TAAGGGTAT | DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.10 ten leaves visible, LP.02 two leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT2G40260.1); Has 922 Blast hits to 920 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 24; Fungi - 4; Plants - 867; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT2G38750 | AT2G38750.1 | TACCCTTA | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
| AT2G39780 | AT2G39780.1 | AAATACCCTTA | S-like ribonuclease |
| AT2G39780.2 | AAATACCCTTA | S-like ribonuclease |
| AT2G40316 | AT2G40316.1 | TAAGGGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G40316.2 | TAAGGGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G47030 | AT2G47030.1 | AAATACCCTTA | VGDH1; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: male gametophyte, flower, pollen tube; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: VGD1 (VANGUARD1); enzyme inhibitor/ pectinesterase (TAIR:AT2G47040.1); Has 1439 Blast hits to 1399 proteins in 267 species: Archae - 0; Bacteria - 422; Metazoa - 1; Fungi - 130; Plants - 885; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G47050 | AT2G47050.1 | TACCCTTA | invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT3G62180.1); Has 58 Blast hits to 57 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G47610 | AT2G47610.1 | TAAGGGTAT | 60S ribosomal protein L7A (RPL7aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, plasma membrane, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7A (InterPro:IPR001921), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7A (RPL7aB) (TAIR:AT3G62870.1); Has 1594 Blast hits to 1594 proteins in 293 species: Archae - 217; Bacteria - 0; Metazoa - 627; Fungi - 243; Plants - 175; Viruses - 0; Other Eukaryotes - 332 (source: NCBI BLink). |
| AT3G01570 | AT3G01570.1 | TAAGGGTAT | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO2 (OLEOSIN 2) (TAIR:AT5G40420.1); Has 384 Blast hits to 384 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 384; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G05570 | AT3G05570.1 | TAAGGGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G39235.1); Has 39 Blast hits to 39 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06670 | AT3G06670.1 | TAAGGGTATT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Protein of unknown function DUF625 (InterPro:IPR006887); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49390.1); Has 2798 Blast hits to 2244 proteins in 244 species: Archae - 0; Bacteria - 63; Metazoa - 1367; Fungi - 471; Plants - 155; Viruses - 18; Other Eukaryotes - 724 (source: NCBI BLink). |
| AT3G07740 | AT3G07740.1 | TAAGGGTA | encodes a transcriptional adaptor ADA2a that interacts with histone acetyltransferase GCN5 homolog and CBF1 |
| AT3G07740.2 | TAAGGGTA | encodes a transcriptional adaptor ADA2a that interacts with histone acetyltransferase GCN5 homolog and CBF1 |
| AT3G07740.3 | TAAGGGTA | encodes a transcriptional adaptor ADA2a that interacts with histone acetyltransferase GCN5 homolog and CBF1 |
| AT3G07750 | AT3G07750.1 | TACCCTTA | 3' exoribonuclease family domain 1-containing protein; FUNCTIONS IN: 3'-5'-exoribonuclease activity, RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exoribonuclease, phosphorolytic domain 1 (InterPro:IPR001247); BEST Arabidopsis thaliana protein match is: RRP45a (Ribonuclease PH45a); 3'-5'-exoribonuclease/ RNA binding (TAIR:AT3G12990.2); Has 1078 Blast hits to 1076 proteins in 235 species: Archae - 205; Bacteria - 31; Metazoa - 296; Fungi - 206; Plants - 93; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT3G07750.2 | TACCCTTA | 3' exoribonuclease family domain 1-containing protein; FUNCTIONS IN: 3'-5'-exoribonuclease activity, RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exoribonuclease, phosphorolytic domain 1 (InterPro:IPR001247); BEST Arabidopsis thaliana protein match is: RRP45a (Ribonuclease PH45a); 3'-5'-exoribonuclease/ RNA binding (TAIR:AT3G12990.2); Has 1078 Blast hits to 1076 proteins in 235 species: Archae - 205; Bacteria - 31; Metazoa - 296; Fungi - 206; Plants - 93; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT3G09720 | AT3G09720.1 | AATACCCTTA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ethylene-responsive DEAD box RNA helicase, putative (RH30) (TAIR:AT5G63120.2); Has 31352 Blast hits to 30822 proteins in 1800 species: Archae - 599; Bacteria - 13582; Metazoa - 5089; Fungi - 3376; Plants - 1453; Viruses - 31; Other Eukaryotes - 7222 (source: NCBI BLink). |
| AT3G13330 | AT3G13330.1 | TAAGGGTA | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); Has 345 Blast hits to 234 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 111; Fungi - 178; Plants - 15; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT3G13990 | AT3G13990.1 | TAAGGGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1296 (InterPro:IPR009719); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07660.1); Has 483 Blast hits to 417 proteins in 93 species: Archae - 0; Bacteria - 6; Metazoa - 202; Fungi - 61; Plants - 122; Viruses - 3; Other Eukaryotes - 89 (source: NCBI BLink). |
| AT3G13990.2 | TAAGGGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1296 (InterPro:IPR009719); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07660.1); Has 483 Blast hits to 417 proteins in 93 species: Archae - 0; Bacteria - 6; Metazoa - 202; Fungi - 61; Plants - 122; Viruses - 3; Other Eukaryotes - 89 (source: NCBI BLink). |
| AT3G14180 | AT3G14180.1 | TAAGGGTA | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT3G14230 | AT3G14230.1 | TAAGGGTAT | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
| AT3G14230.2 | TAAGGGTAT | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
| AT3G14230.3 | TAAGGGTAT | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
| AT3G15620 | AT3G15620.1 | AAATACCCTTA | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
| AT3G15620.2 | AAATACCCTTA | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
| AT3G15630 | AT3G15630.1 | AAATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52720.1); Has 35 Blast hits to 35 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15990 | AT3G15990.1 | TACCCTTA | Encodes sulfate transporter Sultr3;4. |
| AT3G16350 | AT3G16350.1 | TACCCTTA | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 7 processes; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Zinc finger, CCHC-type (InterPro:IPR001878), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT5G47390.1); Has 2137 Blast hits to 1895 proteins in 207 species: Archae - 0; Bacteria - 110; Metazoa - 783; Fungi - 82; Plants - 935; Viruses - 13; Other Eukaryotes - 214 (source: NCBI BLink). |
| AT3G17040 | AT3G17040.1 | TAAGGGTA | It is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis. |
| AT3G19790 | AT3G19790.1 | AAATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G19790.2 | AAATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G20390 | AT3G20390.1 | TAAGGGTA | endoribonuclease L-PSP family protein; FUNCTIONS IN: endoribonuclease activity; INVOLVED IN: response to cadmium ion; LOCATED IN: thylakoid, mitochondrion, chloroplast, plastid, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Endoribonuclease L-PSP (InterPro:IPR006175), Endoribonuclease L-PSP/chorismate mutase-like (InterPro:IPR013813), YjgF-like protein (InterPro:IPR006056); Has 6124 Blast hits to 6041 proteins in 1217 species: Archae - 83; Bacteria - 4022; Metazoa - 194; Fungi - 247; Plants - 42; Viruses - 0; Other Eukaryotes - 1536 (source: NCBI BLink). |
| AT3G24800 | AT3G24800.1 | TACCCTTA | Contains two ring finger domains and one ZZ domain. Week similarity to yeast Rad18p. Putative component of the N-end rule pathway (ubiquitin-dependent proteolysis). |
| AT3G27060 | AT3G27060.1 | TGTCGTTTATACCCTTA | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT3G47300 | AT3G47300.1 | TAAGGGTA | SELT-LIKE PROTEIN PRECURSOR (SELT); FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenoprotein-related (TAIR:AT5G58640.1); Has 176 Blast hits to 176 proteins in 54 species: Archae - 0; Bacteria - 2; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G51160 | AT3G51160.1 | TACCCTTA | Catalyzes the first step in the de novo synthesis of GDP-L-fucose. |
| AT3G51800 | AT3G51800.1 | TGACGTGGGCTTATATGGGCCCGGTTAAGGGTA | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
| AT3G51800.2 | TGACGTGGGCTTATATGGGCCCGGTTAAGGGTA | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
| AT3G55470 | AT3G55470.1 | TAAGGGTA | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT1G63220.1); Has 1761 Blast hits to 1679 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 1025; Fungi - 76; Plants - 508; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT3G55470.2 | TAAGGGTA | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT1G63220.1); Has 1761 Blast hits to 1679 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 1025; Fungi - 76; Plants - 508; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT3G61160 | AT3G61160.1 | TAAGGGTAT | shaggy-related protein kinase beta / ASK-beta (ASK2); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK32 (SHAGGY-LIKE PROTEIN KINASE 32); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G00720.1); Has 77717 Blast hits to 76780 proteins in 2266 species: Archae - 34; Bacteria - 5889; Metazoa - 33698; Fungi - 7803; Plants - 14511; Viruses - 397; Other Eukaryotes - 15385 (source: NCBI BLink). |
| AT3G61160.2 | TAAGGGTAT | shaggy-related protein kinase beta / ASK-beta (ASK2); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK32 (SHAGGY-LIKE PROTEIN KINASE 32); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G00720.1); Has 77717 Blast hits to 76780 proteins in 2266 species: Archae - 34; Bacteria - 5889; Metazoa - 33698; Fungi - 7803; Plants - 14511; Viruses - 397; Other Eukaryotes - 15385 (source: NCBI BLink). |
| AT3G62240 | AT3G62240.1 | TACCCTTA | zinc finger (C2H2 type) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: nucleic acid binding / protein binding / zinc ion binding (TAIR:AT2G47090.1); Has 3224 Blast hits to 1336 proteins in 208 species: Archae - 0; Bacteria - 156; Metazoa - 809; Fungi - 335; Plants - 89; Viruses - 4; Other Eukaryotes - 1831 (source: NCBI BLink). |
| AT3G62250 | AT3G62250.1 | TAAGGGTA | ubiquitin 5 (UBQ5); FUNCTIONS IN: protein binding, structural constituent of ribosome; INVOLVED IN: protein ubiquitination during ubiquitin-dependent protein catabolic process, protein modification process, translation; LOCATED IN: cytosolic small ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein S27a (InterPro:IPR002906), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: UBQ6; protein binding (TAIR:AT2G47110.1); Has 9355 Blast hits to 5604 proteins in 655 species: Archae - 78; Bacteria - 7; Metazoa - 4233; Fungi - 952; Plants - 1981; Viruses - 176; Other Eukaryotes - 1928 (source: NCBI BLink). |
| AT3G63460 | AT3G63460.1 | TACCCTTA | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). |
| AT3G63460.2 | TACCCTTA | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). |
| AT4G03180 | AT4G03180.1 | TAAGGGTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 869 Blast hits to 650 proteins in 112 species: Archae - 2; Bacteria - 20; Metazoa - 199; Fungi - 90; Plants - 42; Viruses - 0; Other Eukaryotes - 516 (source: NCBI BLink). |
| AT4G04020 | AT4G04020.1 | TAAGGGTAT | Fibrillin precursor protein. The fibrillin preprotein, but not the mature protein interacts with ABI2. Regulated by abscisic acid response regulators. Involved in abscisic acid-mediated photoprotection. |
| AT4G08960 | AT4G08960.1 | TAAGGGTAT | phosphotyrosyl phosphatase activator (PTPA) family protein; FUNCTIONS IN: phosphatase activator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphotyrosyl phosphatase activator, PTPA (InterPro:IPR004327); Has 593 Blast hits to 585 proteins in 175 species: Archae - 0; Bacteria - 4; Metazoa - 247; Fungi - 211; Plants - 54; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT4G10840 | AT4G10840.1 | TACCCTTA | kinesin light chain-related; FUNCTIONS IN: binding; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: kinesin light chain-related (TAIR:AT3G27960.1); Has 11121 Blast hits to 4321 proteins in 387 species: Archae - 236; Bacteria - 3062; Metazoa - 5775; Fungi - 596; Plants - 190; Viruses - 6; Other Eukaryotes - 1256 (source: NCBI BLink). |
| AT4G10840.2 | TACCCTTA | kinesin light chain-related; FUNCTIONS IN: binding; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: kinesin light chain-related (TAIR:AT3G27960.1); Has 11121 Blast hits to 4321 proteins in 387 species: Archae - 236; Bacteria - 3062; Metazoa - 5775; Fungi - 596; Plants - 190; Viruses - 6; Other Eukaryotes - 1256 (source: NCBI BLink). |
| AT4G12420 | AT4G12420.1 | ATACCCTTA | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
| AT4G14716 | AT4G14716.1 | TAAGGGTA | ACIREDUCTONE DIOXYGENASE 1 (ATARD1); FUNCTIONS IN: acireductone dioxygenase [iron(II)-requiring] activity, metal ion binding; INVOLVED IN: methionine salvage; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Acireductone dioxygenase, ARD (InterPro:IPR004313), Cupin, RmlC-type (InterPro:IPR011051), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acireductone dioxygenase [iron(II)-requiring]/ metal ion binding (TAIR:AT4G14710.2); Has 1016 Blast hits to 1012 proteins in 304 species: Archae - 0; Bacteria - 340; Metazoa - 125; Fungi - 85; Plants - 390; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT4G17870 | AT4G17870.1 | TACCCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46790.1); Has 177 Blast hits to 177 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 177; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18890 | AT4G18890.1 | TAAGGGTA | brassinosteroid signalling positive regulator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: brassinosteroid signalling positive regulator-related (TAIR:AT1G78700.1); Has 301 Blast hits to 214 proteins in 26 species: Archae - 0; Bacteria - 8; Metazoa - 41; Fungi - 2; Plants - 152; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT4G19003 | AT4G19003.1 | TAAGGGTA | VPS25; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT II complex; CONTAINS InterPro DOMAIN/s: ESCRT-II complex, vps25 subunit, N-terminal winged helix (InterPro:IPR014041), ESCRT-II complex, vps25 subunit, C-terminal winged helix (InterPro:IPR014040), ESCRT-II complex, vps25 subunit (InterPro:IPR008570); Has 237 Blast hits to 237 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 79; Plants - 22; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT4G19003.2 | TAAGGGTA | VPS25; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT II complex; CONTAINS InterPro DOMAIN/s: ESCRT-II complex, vps25 subunit, N-terminal winged helix (InterPro:IPR014041), ESCRT-II complex, vps25 subunit, C-terminal winged helix (InterPro:IPR014040), ESCRT-II complex, vps25 subunit (InterPro:IPR008570); Has 237 Blast hits to 237 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 79; Plants - 22; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT4G22290 | AT4G22290.1 | TAAGGGTA | ubiquitin thiolesterase; FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; BEST Arabidopsis thaliana protein match is: balbiani ring 1-related / BR1-related (TAIR:AT1G78880.1); Has 69 Blast hits to 69 proteins in 14 species: Archae - 0; Bacteria - 2; Metazoa - 5; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G23250 | AT4G23250.1 | TAAGGGTA | EMBRYO DEFECTIVE 1290 (EMB1290); FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: embryonic development ending in seed dormancy, protein amino acid autophosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Protein of unknown function DUF26 (InterPro:IPR002902), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: ATP binding / protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G23260.1); Has 87813 Blast hits to 85985 proteins in 3092 species: Archae - 45; Bacteria - 7629; Metazoa - 37890; Fungi - 6855; Plants - 20068; Viruses - 386; Other Eukaryotes - 14940 (source: NCBI BLink). |
| AT4G24740 | AT4G24740.2 | TACCCTTA | a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins. |
| AT4G28980 | AT4G28980.1 | TAAGGGTA | Encodes a CDK-activating kinase that regulates root initial cell differentiation. Phosphorylates CDKD2 and CDKD3, but not CDKD1. Controls CDK activities and basal transcription. |
| AT4G28980.2 | TAAGGGTA | Encodes a CDK-activating kinase that regulates root initial cell differentiation. Phosphorylates CDKD2 and CDKD3, but not CDKD1. Controls CDK activities and basal transcription. |
| AT4G29420 | AT4G29420.1 | TAAGGGTA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 44 Blast hits to 42 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G29430 | AT4G29430.1 | TACCCTTA | ribosomal protein S15A E (rps15ae); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, mitochondrion, cytosolic ribosome, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: rps15ab (ribosomal protein S15A B); structural constituent of ribosome (TAIR:AT2G19720.1); Has 2257 Blast hits to 2257 proteins in 736 species: Archae - 184; Bacteria - 865; Metazoa - 322; Fungi - 130; Plants - 184; Viruses - 0; Other Eukaryotes - 572 (source: NCBI BLink). |
| AT4G30840 | AT4G30840.1 | TAAGGGTA | WD-40 repeat protein family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 130 Blast hits to 129 proteins in 60 species: Archae - 0; Bacteria - 4; Metazoa - 91; Fungi - 11; Plants - 19; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G30960 | AT4G30960.1 | TAAGGGTAT | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. |
| AT4G32880 | AT4G32880.1 | TAAGGGTA | member of homeodomain-leucine zipper family, acting as a differentiation-promoting transcription factor of the vascular meristems. |
| AT4G33050 | AT4G33050.1 | TACCCTTA | embryo sac development arrest 39 (EDA39); FUNCTIONS IN: calmodulin binding; INVOLVED IN: polar nucleus fusion, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: calmodulin-binding family protein (TAIR:AT2G26190.1); Has 224 Blast hits to 148 proteins in 38 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 83; Plants - 134; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G33050.2 | TACCCTTA | embryo sac development arrest 39 (EDA39); FUNCTIONS IN: calmodulin binding; INVOLVED IN: polar nucleus fusion, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: calmodulin-binding family protein (TAIR:AT2G26190.1); Has 224 Blast hits to 148 proteins in 38 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 83; Plants - 134; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G33050.3 | TACCCTTA | embryo sac development arrest 39 (EDA39); FUNCTIONS IN: calmodulin binding; INVOLVED IN: polar nucleus fusion, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: calmodulin-binding family protein (TAIR:AT2G26190.1); Has 224 Blast hits to 148 proteins in 38 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 83; Plants - 134; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G33050.4 | TACCCTTA | embryo sac development arrest 39 (EDA39); FUNCTIONS IN: calmodulin binding; INVOLVED IN: polar nucleus fusion, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: calmodulin-binding family protein (TAIR:AT2G26190.1); Has 224 Blast hits to 148 proteins in 38 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 83; Plants - 134; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G34730 | AT4G34730.1 | ATACCCTTA | ribosome-binding factor A family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K homology-like, alpha/beta (InterPro:IPR015946), Ribosome-binding factor A (InterPro:IPR000238); Has 2908 Blast hits to 2907 proteins in 1057 species: Archae - 0; Bacteria - 2230; Metazoa - 5; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 649 (source: NCBI BLink). |
| AT4G37420 | AT4G37420.1 | TAAGGGTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27200.1); Has 141 Blast hits to 141 proteins in 46 species: Archae - 0; Bacteria - 74; Metazoa - 0; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT4G38240 | AT4G38240.1 | TAAGGGTAT | Encodes N-acetyl glucosaminyl transferase I, the first enzyme in the pathway of complex glycan biosynthesis. |
| AT4G38240.2 | TAAGGGTAT | Encodes N-acetyl glucosaminyl transferase I, the first enzyme in the pathway of complex glycan biosynthesis. |
| AT4G39950 | AT4G39950.1 | TAAGGGTATT | Belongs to cytochrome P450 and is involved in tryptophan metabolism. Converts Trp to indo-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. |
| AT5G04140 | AT5G04140.1 | TACCCTTA | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. |
| AT5G04140.2 | TACCCTTA | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. |
| AT5G04870 | AT5G04870.1 | TACCCTTA | A calcium-dependent protein kinase that can phosphorylate phenylalanine ammonia lyase (PAL), a key enzyme in pathogen defense. |
| AT5G05090 | AT5G05090.1 | TAAGGGTA | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G10760.1); Has 890 Blast hits to 890 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 877; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT5G05200 | AT5G05200.1 | TAAGGGTATTT | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink). |
| AT5G05210 | AT5G05210.1 | AAATACCCTTA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). |
| AT5G05210.2 | AAATACCCTTA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink). |
| AT5G06340 | AT5G06340.1 | TAAGGGTA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27 (ATNUDX27); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 3191 Blast hits to 3191 proteins in 724 species: Archae - 2; Bacteria - 1483; Metazoa - 9; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1660 (source: NCBI BLink). |
| AT5G08620 | AT5G08620.1 | TACCCTTAAGCCCTA | Similar in sequence to DEAD-box RNA helicases. Binds RNA. Involved in drought, salt and cold stress responses. |
| AT5G09540 | AT5G09540.1 | AAATACCCTTA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding, response to salt stress; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G64360.4); Has 752 Blast hits to 732 proteins in 227 species: Archae - 8; Bacteria - 304; Metazoa - 100; Fungi - 51; Plants - 254; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT5G11980 | AT5G11980.1 | TACCCTTA | conserved oligomeric Golgi complex component-related / COG complex component-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved oligomeric Golgi complex, COG8 (InterPro:IPR016632), Dor1-like protein (InterPro:IPR007255); Has 311 Blast hits to 311 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 82; Plants - 28; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT5G11980.1 | TACCCTTA | conserved oligomeric Golgi complex component-related / COG complex component-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved oligomeric Golgi complex, COG8 (InterPro:IPR016632), Dor1-like protein (InterPro:IPR007255); Has 311 Blast hits to 311 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 82; Plants - 28; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT5G23250 | AT5G23250.1 | TACCCTTA | succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative; FUNCTIONS IN: succinate-CoA ligase (ADP-forming) activity, succinate-CoA ligase (GDP-forming) activity, binding, ATP citrate synthase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Succinyl-CoA ligase, alpha subunit (InterPro:IPR005810), ATP-citrate lyase/succinyl-CoA ligase (InterPro:IPR005811), NAD(P)-binding (InterPro:IPR016040), CoA-binding (InterPro:IPR003781), ATP-citrate lyase/succinyl-CoA ligase, active site (InterPro:IPR017440), Succinyl-CoA synthetase-like (InterPro:IPR016102); BEST Arabidopsis thaliana protein match is: succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative (TAIR:AT5G08300.1); Has 7114 Blast hits to 7113 proteins in 1234 species: Archae - 196; Bacteria - 2692; Metazoa - 350; Fungi - 188; Plants - 87; Viruses - 0; Other Eukaryotes - 3601 (source: NCBI BLink). |
| AT5G23250.2 | TACCCTTA | succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative; FUNCTIONS IN: succinate-CoA ligase (ADP-forming) activity, succinate-CoA ligase (GDP-forming) activity, binding, ATP citrate synthase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Succinyl-CoA ligase, alpha subunit (InterPro:IPR005810), ATP-citrate lyase/succinyl-CoA ligase (InterPro:IPR005811), NAD(P)-binding (InterPro:IPR016040), CoA-binding (InterPro:IPR003781), ATP-citrate lyase/succinyl-CoA ligase, active site (InterPro:IPR017440), Succinyl-CoA synthetase-like (InterPro:IPR016102); BEST Arabidopsis thaliana protein match is: succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative (TAIR:AT5G08300.1); Has 7114 Blast hits to 7113 proteins in 1234 species: Archae - 196; Bacteria - 2692; Metazoa - 350; Fungi - 188; Plants - 87; Viruses - 0; Other Eukaryotes - 3601 (source: NCBI BLink). |
| AT5G24390 | AT5G24390.1 | TAAGGGTA | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1); Has 3521 Blast hits to 3119 proteins in 173 species: Archae - 0; Bacteria - 9; Metazoa - 2196; Fungi - 527; Plants - 339; Viruses - 0; Other Eukaryotes - 450 (source: NCBI BLink). |
| AT5G26280 | AT5G26280.1 | TACCCTTA | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT5G26300.1); Has 324 Blast hits to 260 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 16; Plants - 293; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G26280.2 | TACCCTTA | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT5G26300.1); Has 324 Blast hits to 260 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 16; Plants - 293; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G26880 | AT5G26880.1 | TACCCTTA | tRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); Has 3878 Blast hits to 3878 proteins in 1119 species: Archae - 0; Bacteria - 2309; Metazoa - 3; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 1546 (source: NCBI BLink). |
| AT5G27740 | AT5G27740.1 | AATACCCTTA | EMBRYO DEFECTIVE 2775 (EMB2775); FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding; INVOLVED IN: DNA replication; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA polymerase III clamp loader subunit, C-terminal (InterPro:IPR008921); BEST Arabidopsis thaliana protein match is: emb1968 (embryo defective 1968); ATP binding / ATPase/ DNA binding / DNA clamp loader/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT1G21690.1); Has 8053 Blast hits to 8003 proteins in 1440 species: Archae - 377; Bacteria - 2705; Metazoa - 463; Fungi - 373; Plants - 162; Viruses - 67; Other Eukaryotes - 3906 (source: NCBI BLink). |
| AT5G38420 | AT5G38420.1 | TACCCTTA | ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 8 components; EXPRESSED IN: 10 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1722 Blast hits to 1701 proteins in 391 species: Archae - 0; Bacteria - 341; Metazoa - 0; Fungi - 0; Plants - 874; Viruses - 0; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT5G38630 | AT5G38630.1 | TACCCTTA | Encodes for cytochrome b561. |
| AT5G39400 | AT5G39400.1 | ATACCCTTA | PTEN1; FUNCTIONS IN: phosphatase activity; INVOLVED IN: N-terminal protein myristoylation, pollen development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Phosphatase tensin type (InterPro:IPR014019), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Tensin phosphatase, C2 domain (InterPro:IPR014020); BEST Arabidopsis thaliana protein match is: ATPEN2 (ARABIDOPSIS THALIANA PTEN 2); phosphatase/ protein tyrosine phosphatase (TAIR:AT3G19420.1); Has 1145 Blast hits to 1141 proteins in 148 species: Archae - 6; Bacteria - 19; Metazoa - 735; Fungi - 150; Plants - 35; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink). |
| AT5G39880 | AT5G39880.1 | TACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28750.1); Has 13 Blast hits to 13 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G46440 | AT5G46440.1 | GGCCTAAGGGTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46460.1); Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G47120 | AT5G47120.1 | TAAGGGTATT | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. |
| AT5G48480 | AT5G48480.1 | TAAGGGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 236 Blast hits to 236 proteins in 116 species: Archae - 0; Bacteria - 216; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G49730 | AT5G49730.1 | TACCCTTA | Encodes a plasma membrane-located ferric chelate reductase. Its mRNA is expressed in green aerial tissues (shoot, flower and cotyledon) in a light- and cell differentiation-specific manner. |
| AT5G50370 | AT5G50370.1 | TAAGGGTA | adenylate kinase, putative; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, adenylate kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; LOCATED IN: mitochondrion, plasma membrane, plastid; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adenylate kinase, zinc-finger lid region (InterPro:IPR007862), Adenylate kinase, subfamily (InterPro:IPR006259), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: ADK1 (ADENYLATE KINASE 1); ATP binding / adenylate kinase/ nucleobase, nucleoside, nucleotide kinase/ nucleotide kinase/ phosphotransferase, phosphate group as acceptor (TAIR:AT5G63400.1); Has 8866 Blast hits to 8737 proteins in 1855 species: Archae - 61; Bacteria - 4516; Metazoa - 1039; Fungi - 291; Plants - 250; Viruses - 0; Other Eukaryotes - 2709 (source: NCBI BLink). |
| AT5G52200 | AT5G52200.1 | TACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 509 Blast hits to 471 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 232; Fungi - 109; Plants - 74; Viruses - 6; Other Eukaryotes - 88 (source: NCBI BLink). |
| AT5G55640 | AT5G55640.1 | TAAGGGTATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 59 Blast hits to 59 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G57300 | AT5G57300.1 | TAAGGGTA | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57300.2 | TAAGGGTA | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G60820 | AT5G60820.1 | TAAGGGTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G08139.1); Has 6800 Blast hits to 6591 proteins in 264 species: Archae - 0; Bacteria - 123; Metazoa - 2390; Fungi - 543; Plants - 2247; Viruses - 74; Other Eukaryotes - 1423 (source: NCBI BLink). |
| AT5G61170 | AT5G61170.1 | TAAGGGTA | 40S ribosomal protein S19 (RPS19C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 883 Blast hits to 883 proteins in 288 species: Archae - 134; Bacteria - 5; Metazoa - 345; Fungi - 97; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT5G62740 | AT5G62740.1 | TAAGGGTA | band 7 family protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: band 7 family protein (TAIR:AT1G69840.6); Has 3743 Blast hits to 3742 proteins in 1083 species: Archae - 120; Bacteria - 2217; Metazoa - 242; Fungi - 201; Plants - 160; Viruses - 2; Other Eukaryotes - 801 (source: NCBI BLink). |
| AT5G65830 | AT5G65830.1 | AATACCCTTA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP44 (Receptor Like Protein 44); protein binding (TAIR:AT3G49750.1); Has 35662 Blast hits to 8354 proteins in 444 species: Archae - 26; Bacteria - 823; Metazoa - 1315; Fungi - 106; Plants - 31516; Viruses - 0; Other Eukaryotes - 1876 (source: NCBI BLink). |
| AT5G65950 | AT5G65950.1 | ATACCCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 62; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT5G67385 | AT5G67385.1 | TAAGGGTA | protein binding / signal transducer; FUNCTIONS IN: protein binding, signal transducer activity; INVOLVED IN: response to light stimulus; CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: phototropic-responsive protein, putative (TAIR:AT3G49970.1); Has 457 Blast hits to 447 proteins in 26 species: Archae - 0; Bacteria - 2; Metazoa - 24; Fungi - 2; Plants - 429; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |